Method for producing effector cells with desired specificity
The RMCE method enables efficient and controlled production of T cells and CAR-T cells with desired specificity by using a cassette deck structure, addressing inefficiencies and risks in existing gene introduction methods.
Patent Information
- Application Number
- JP2022552076
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-09-24
- Filing Date
- 2021-09-24
- Publication Date
- 2026-01-28
- Estimated Expiration
- 2041-09-24
AI Technical Summary
Current methods for producing T cells with desired specificity, such as TCR or CAR, are inefficient, time-consuming, and costly, and random gene introduction poses risks of genome damage and expression control challenges, especially when producing multiple TCRs for tumor-infiltrating lymphocytes.
A method using recombinase-mediated cassette exchange (RMCE) or genome editing to introduce and exchange genes in pluripotent stem cells, allowing for the simultaneous production of effector cells with different specificities by creating a cassette deck structure that enables controlled gene expression and replacement.
This method efficiently produces large numbers of mature T cells or CAR-T cells with stable and controlled expression of desired TCR or CAR, overcoming the limitations of existing techniques and facilitating scalable cellular immunotherapy.
Smart Images

Figure 0007807756000010 
Figure 0007807756000011 
Figure 0007807756000012
Abstract
Description
[Technical Field]
[0001] The present application relates to a method for producing effector cells expressing a desired specificity site. In particular, the present invention relates to a method for efficiently producing mature T cells or mature CAR-T cells expressing a T cell receptor (TCR) or chimeric antigen receptor (CAR) with a desired specificity, or their precursor cells, by using a recombinase-mediated cassette exchange (RMCE) method or a genome editing method. [Background technology]
[0002] The presence of tumor-infiltrating T lymphocytes (TILs), highly specific T lymphocytes that recognize tumor tissue as foreign bodies and infiltrate tumors, has been reported in 50-80% of cases of many cancers and is considered evidence of an immune response against cancer. These TILs contain multiple types of T lymphocytes with different specificities, and if large numbers of TILs could be amplified and administered to patients, therapeutic effects could be expected. However, extracting and amplifying TILs from each patient is difficult, and even if it were possible, it would be time-consuming and costly, and to date only limited effectiveness has been demonstrated.
[0003] Methods for introducing antigen receptor genes, such as TCRs and CARs, into mature T cells are currently being used clinically, and CARs in particular have already been approved. These methods involve randomly introducing antigen receptor genes into mature T cells using retroviruses or lentiviruses. However, knocking TCR and CAR genes into their native TCR loci is expected to produce more physiological expression patterns. Random gene introduction, however, poses challenges, including the inability to control the insertion site, the risk of genome damage, and difficulty in controlling expression levels. Furthermore, the application of this approach to the simultaneous administration of mature T cells expressing various TCRs, such as tumor-infiltrating T lymphocytes, requires the simultaneous introduction of each TCR or CAR into each mature T cell, which is not practical.
[0004] Some of the present inventors have proposed introducing a TCR at the level of pluripotent stem cells, inducing their differentiation into mature T cells, and using them in cellular immunotherapy (Patent Documents 1 to 4). Another group has also proposed introducing a CAR gene at the level of pluripotent stem cells (Patent Document 5). All of these methods are disclosed as feasible, in which a TCR or CAR gene is introduced at the iPS cell stage, followed by inducing differentiation into functional effector cells.
[0005] The present inventors have also proposed a method for introducing a desired TCR into ES cells or iPS cells by inserting a cassette into the TCR locus so that the gene is under the control of a promoter and endogenous enhancer (Patent Document 6). This method utilizes a recombinase-mediated cassette exchange (RMCE) method, in which a structure capable of recombining specific portions of the cell's genes with foreign sequences (cassette tapes) is first introduced into the target cells, similar to a cassette deck, and then the cassette is exchanged using recombinase enzymes such as Cre or Flippase (FLP). Specifically, pluripotent stem cells are constructed that contain a cassette deck structure equipped with an empty cassette tape containing a drug resistance gene so that the gene is expressed under the control of the pluripotent stem cell's expression regulatory mechanism. By replacing the empty cassette tape gene with a cassette tape encoding the desired TCR gene, pluripotent stem cells expressing the foreign TCR gene under the control of the endogenous TCR locus can be produced. The resulting pluripotent stem cells can be proliferated as needed and induced to differentiate into mature T cells for use in cellular immunotherapy.
[0006] This method has made it possible to efficiently produce cells for cell therapy that stably express the desired TCR gene or CAR gene. However, while the technique of introducing TCRs into mature T cells or T cell precursors is widely used, the differentiation of pluripotent stem cells into mature T cells is not a common procedure and is not widely used in clinical settings. For antigens commonly expressed in many cancers, such as the WT1 antigen, mass production of mature T cells carrying a single TCR gene is useful for cellular immunotherapy. However, to regenerate TILs, it is necessary to isolate the TCR from TILs, introduce it into iPS cells to generate multiple TCR-iPS cells, and then induce their differentiation into T cells, which is a time-consuming and labor-intensive process. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] International Publication WO2016 / 010153 [Patent Document 2] International Publication WO2016 / 010154 [Patent Document 3] International Publication WO2016 / 010155 [Patent Document 4] International Publication WO2017 / 179720 [Patent Document 5] International Publication WO2014 / 165707 [Patent Document 6] International Publication WO2020 / 022512 [Non-patent literature]
[0008] [Non-Patent Document 1] Themeli et al., Nat Biotechnol.(2013)928-33 [Non-patent document 2] Gong Ying et al., Journal of Cell Biology (2015) 1481-1489 Summary of the Invention [Problem to be solved by the invention]
[0009] An object of the present invention is to provide a method for easily producing effector cells having a desired specificity-determining site. Another object of the present invention is to provide an effector cell having a so-called cassette deck structure that allows easy exchange of specificity-determining sites. Another object of the present invention is to provide a method for simultaneously producing effector cells of the same species having different types of specificity-determining sites. [Means for solving the problem]
[0010] The present application provides a method for producing a cell-derived material having the ability to differentiate into an effector cell, the method comprising the steps of: (1) providing a cell-derived material having a cassette deck structure in which the cell-derived material has a cassette deck gene containing a gene encoding a marker protein in the genome of the cell-derived material such that the marker protein can be expressed in cells obtained by inducing differentiation of the cell-derived material into an effector cell or a precursor cell of the effector cell; (2) growing the material cells; (3) inducing the differentiation of the material cells into effector cells or their precursor cells; and (4) A method for producing effector cells that express a desired protein is provided, which comprises the step of replacing the marker protein gene of the effector cells or their precursor cells with a gene that encodes the desired protein.
[0011] Step (4) can be performed using the RMCE method or genome editing method. When the RMCE method is used as one embodiment of step (4), a pair of recombinase target sequences is provided upstream and downstream of the gene encoding the marker protein in step (1). The effector cells or their precursor cells obtained in (3) contain a gene encoding the marker protein sandwiched between a pair of recombinase target sequences. An example of a step of exchanging the marker protein gene with the gene encoding the desired protein is to culture the effector cells or their precursor cells in the presence of a recombinase together with a cassette tape exchange vector containing a pair of recombinase target sequences identical to the pair of recombinase target sequences and a gene encoding the desired protein between the pair of recombinase target sequences.
[0012] Another example of step (4) is a step of disrupting a marker protein gene contained in the effector cells or their precursor cells by genome editing, or replacing it with a gene encoding a desired protein, and introducing it so that it is expressed in the source cells.
[0013] In another aspect of the present application, there is provided a method for producing an effector cell or a precursor cell thereof, the effector cell or precursor cell having a cassette deck structure in its genome that includes a cassette tape gene including a gene encoding a marker protein so that the marker protein can be expressed, and which does not include an exogenous drug resistance gene; (ii) A method for producing effector cells that express a desired protein is provided, which comprises the step of replacing a marker protein gene of the effector cells or their precursor cells with a gene that encodes the desired protein.
[0014] In yet another embodiment of the present application, there is provided a method for producing a cassette deck introducing vector, the method comprising the steps of: (a) preparing a cassette deck introducing vector comprising, in order from upstream, a first promoter sequence, a target sequence for a first recombinase, a gene encoding a marker protein linked so as to be expressed under the first promoter sequence, a target sequence for the first recombinase, a target sequence for a second recombinase, a second promoter sequence expressible in a material cell, a drug resistance gene linked so as to be expressed under the second promoter, and a target sequence for the second recombinase; (b) knocking in the cassette deck introduction vector prepared in (a) into the expression control mechanism of the material cell genome; (c) a step of selecting cells in which the cassette deck introduction vector containing a gene encoding a marker protein has been successfully knocked in, the step comprising culturing the cells obtained in (b) in the presence of a drug to which the drug resistance gene is resistant; and (d) providing a method for producing a material cell containing a cassette deck structure containing a cassette tape gene, the method comprising the step of culturing the obtained cells in the presence of a second recombinase to remove the drug resistance gene. The material cell containing the cassette deck structure containing a cassette tape gene of this embodiment is suitable for use in cassette tape replacement by the RMCE method.
[0015] In the method of the present application, the term "material cells" refers to cells used to introduce a gene encoding a marker protein, and refers to cells that have a cassette deck structure containing a cassette tape gene encoding the marker protein, and also refers to cells before being induced to differentiate into effector cells. Pluripotent stem cells are preferably used as material cells, and ES cells and iPS cells are particularly preferably used.
[0016] Effector cells include, in particular, mature T cells or their precursor cells. In this case, examples of the marker protein and desired protein include a T cell receptor (TCR) or a chimeric antigen receptor (CAR). Alternatively, a fluorescent protein may be used as the marker protein.
[0017] In the method of the present application, a material cell is preferably produced that has, in the genome of a single material cell, only one cassette deck structure that contains a cassette tape gene containing a gene encoding a marker protein under an expression control mechanism. By simultaneously exchanging the cassette tape genes contained in each cell of effector cells or clones of their precursor cells, which contain one cassette deck structure per cell, with multiple types of cassette tape genes, it is possible to simultaneously produce multiple types of effector cells that express different proteins.
[0018] The present application also provides a cell preparation for immune cell therapy, which contains multiple types of effector cells expressing distinct proteins, produced by the method of the present invention. [Brief explanation of the drawings]
[0019] [Figure 1A] This figure shows an outline of the TIL cocktail method when using the RMCE method provided by the method of the present application. Note that when using genome editing, the recombinase target sequences lox2272 and loxP adjacent to the known TCR in the figure are not required, and a genome editing vector is used instead of the recombinase Cre. [Figure 1B] 1 shows an outline of the TIL cocktail method provided using the method of the present application. [Figure 2] FIG. 1 is a diagram showing an outline of the procedure of Example 1. [Figure 3] FIG. 1 shows the results of knocking in a cassette deck introduction vector into Jurkat cells in Example 1, and then removing drug resistance factors by treating them with FLP and ganciclovir. [Figure 4] The cells in Figure 3 were further subjected to FACS Aria to obtain TCR-expressing cells. [Figure 5A] Schematic diagram of the procedure for reacting the NY-ESO1-specific TCR gene cassette tape exchange plasmid vector and Cre recombinase expression vector with the TCR-expressing cells in Figure 4, i.e., the cassette deck KI-Jurkat cells containing the WT1-specific TCR cassette tape. [Figure 5B] Schematic representation of the procedure as in FIG. 5A, but using linear DNA for tape replacement of the NY-ESO1-specific TCR expression cassette. [Figure 6] FACS analysis of the TCR-expressing cells in Figure 4, i.e., WT1-specific TCR cassette tape KI-Jurkat cells, obtained by reacting with an NY-ESO1-specific TCR expression cassette tape exchange plasmid vector, or a linear DNA for cassette tape exchange of NY-ESO1-specific TCR and a Cre recombinase expression vector. [Figure 7A] A diagram showing an outline of the procedure of Example 2. A step of knocking in a vector for cassette deck introduction. [Figure 7B] A diagram showing an outline of the procedure in Example 2. This is a step of removing a drug resistance factor contained in a cassette deck transfer vector. [Figure 8] FIG. 10 shows the results of Example 2. [Figure 9] FIG. 1 shows the results of Example 3 [Figure 10] FIG. 1 shows the design concept of the guide RNA for cleaving the WT1-specific TCR (WT1-TCR) gene, which is a marker protein gene, in the genome editing of Example 4, and the 5' and 3' arms for the knock-in vector that introduces a desired sequence into the cleavage site. [Figure 11] Schematic diagram of the NYESO1-specific TCR (NYESO1-TCR) gene knock-in vector used in Example 4. [Figure 12] Schematic diagram of the CRISPR-Cas9 vector used in Example 4. This is a plasmid vector containing a guide RNA for TCR cleavage (gRNA#1) and a guide RNA for KI vector cleavage (gRNA#5), each operably linked to a U6 promoter, and a gene encoding Cas9 operably linked to a CBh promoter. [Figure 13] Schematic diagram showing the knock-in process of Example 4. [Figure 14A]A diagram showing the results of Example 4 (using gRNA#1). Top row: Analysis of the expression of TCRβ with mouse Cβ and the expression of NYESO1 (NYESO1 tetramer: NYESO1). The numbers at the top indicate the percentage of all cells (mTCRβ+NYESO1+) in the upper right compartment. Middle row: Analysis of the expression of TCRβ with mouse Cβ and the expression of human TCR. Bottom row: Analysis of the expression of mouse TCRβ and human TCRαβ in the mouse TCRβ and NYESO1 tetramer-positive cells confirmed in the upper row. The numbers of mouse TCRβ-positive, NYESO1 tetramer-positive, and human TCRαβ-negative cells in the upper left compartment are listed in the bottom row. [Figure 14B] A diagram showing the results of Example 4 (using gRNA#4). Top row: Analysis of the expression of TCRβ with mouse Cβ and the expression of NYESO1 (NYESO1 tetramer: NYESO1). The numbers at the top indicate the percentage of all cells (mTCRβ+NYESO1+) in the upper right compartment. Middle row: Analysis of the expression of TCRβ with mouse Cβ and the expression of human TCR. Bottom row: Analysis of the expression of mouse TCRβ and human TCRαβ in the mouse TCRβ and NYESO1 tetramer-positive cells confirmed in the upper row. The numbers of mouse TCRβ-positive, NYESO1 tetramer-positive, and human TCRαβ-negative cells in the upper left compartment are listed in the bottom row. DETAILED DESCRIPTION OF THE INVENTION
[0020] In the present specification and claims, the term "effector cells" refers to cells that perform a specific function in the body after administration. Examples of effector cells include various mature T cells such as helper T cells, regulatory T cells, and cytotoxic T cells, immune cells such as natural killer (NK) cells, NKT cells, macrophages, and dendritic cells, as well as cells administered in a suspended state such as platelets, hormone-producing cells, immunosuppressive cells represented by mesenchymal stem cells, and neurons, as well as various tissues with two-dimensional structures such as the retina, retinal pigment epithelium, skin, and intestinal epithelium, and various organs with three-dimensional structures such as the heart, liver, and kidney.
[0021] The method of the present application is particularly suitable for use with immune cells, such as mature T cells, natural killer (NK) cells, NKT cells, macrophages, and dendritic cells, as effector cells, and is particularly suitable for producing mature T cells or their precursor cells having a specificity-determining site such as a desired T cell receptor (TCR) or chimeric antigen receptor (CAR), as well as CAR-T cells or their precursor cells.
[0022] In the present application, the TCR gene used as the gene encoding the desired protein to be introduced into effector cells is not particularly limited, and may be a known rearranged TCR gene, or a TCR gene obtained by amplifying a TCR gene from a T cell specific to an antigen targeted by cell therapy using a known method. For example, a TCR specific to a cancer antigen may be used. Furthermore, in TIL therapy, TILs may be collected from a patient's cancer tissue and subjected to single-cell analysis to obtain TCRs of frequently occurring killer T cell clones.
[0023] The term "chimeric antigen receptor" or "CAR" refers to a chimeric antigen receptor comprising an antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain comprising a cytoplasmic sequence of a CD3ζ sequence sufficient to stimulate a T cell upon binding to an antigen, and optionally, cytoplasmic sequences of one or more (e.g., 2, 3, or 4) costimulatory proteins (e.g., one or more cytoplasmic sequences of a ligand that specifically binds to CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, B7-H3, and CD83) that provide costimulation of the T cell upon binding of the antigen binding domain to the antigen.
[0024] "Precursor cells" refer to cells that are in the process of differentiation but have the ability to differentiate into the cells in question. "Material cells capable of differentiating into effector cells" refer to cells that can be differentiated in vitro into effector cells or their precursor cells. Material cells are preferably cells that have the ability to differentiate into effector cells and can proliferate in vitro.
[0025] Examples of material cells capable of differentiating into effector cells include pluripotent stem cells and tissue stem cells.
[0026] Examples of tissue stem cells or somatic stem cells include neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.
[0027] Pluripotent stem cells are stem cells that have the pluripotency to differentiate into many cells present in the body and also have the ability to self-renew. Examples of pluripotent stem cells include embryonic stem (ES) cells, cloned embryonic stem (ntES) cells obtained by nuclear transfer, spermatogonial stem cells (GS cells), embryonic germ cells (EG cells), induced pluripotent stem (iPS) cells, and pluripotent cells derived from cultured fibroblasts or bone marrow stem cells (Muse cells). Pluripotent stem cells are preferably mammalian pluripotent stem cells, more preferably human pluripotent stem cells. ES cells or iPS cells are preferably used as the source cells.
[0028] ES cells and iPS cells may be produced by known methods, or commercially available cells may be used. When using iPS cells, they may be produced from somatic cells obtained from the patient to be treated. In addition, a method has been proposed in which ES cells or iPS cells are manipulated with HLA using genome editing technology to make pluripotent stem cells versatile (reference), and such versatile pluripotent stem cells may be used as the source cells of the present application.
[0029] As described above, the method of the present application is particularly suitable for obtaining mature T cells having a desired TCR or CAR as effector cells. Hereinafter, a method for obtaining mature T cells expressing a desired TCR by the RMCE method as effector cells expressing a desired protein will be described as an example.
[0030] First, we provide material cells that contain a cassette deck structure in which the genome of the material cell, a pluripotent stem cell, contains a set of recombinase target sequences and a cassette tape gene containing a gene encoding a marker protein between the target sequences, so that the marker protein can be expressed when the material cell is induced to differentiate into a T cell or a T cell precursor.
[0031] Examples of marker proteins include known ligands or receptors expressed on the surface of effector cells or their precursor cells. To produce mature T cells expressing a desired TCR, known TCRs or CARs for which tetramers are available are preferably used as marker proteins. Alternatively, examples of marker proteins include known fluorescent proteins. Many fluorescent proteins are known for use in genetic engineering, and many are commercially available. An appropriate fluorescent protein may be selected from these known fluorescent proteins.
[0032] In this specification and claims, the term "recombinase" refers to an enzyme that induces site-specific recombination, and a recombinase target sequence refers to a sequence that is recognized by the recombinase and can induce deletion, integration, or inversion between two target sequences. Examples of combinations of a recombinase and its target sequence include Cre recombinase and loxP and its derivatives, Flipperse (FLP) and frt, and clonase and attB / attP / attL / attR. The combination of a recombinase target sequence and a recombinase contained in the cassette tape gene of the present application is preferably a recombinase system that can replace a cassette tape gene containing a desired protein gene flanked by a set of recombinase target sequences with a cassette tape gene containing a marker protein flanked by the same target sequences in the same orientation.
[0033] For example, when Cre recombinase is used as the recombinase enzyme, examples of target sequences include loxP, lox2272, lox511, and loxFas. In the presence of Cre recombinase, recombination between identical target sequences is promoted. Through such recombination, for example, a sequence flanked by lox2272 and loxP in the genome of a source cell can be exchanged for a sequence flanked by lox2272 and loxP on a vector.
[0034] The source cells used in the methods of the present application have a cassette tape gene containing a gene encoding a marker protein in the genome of the source cells, such that the marker protein can be expressed in cells obtained by inducing the differentiation of the source cells into effector cells or effector cell precursor cells. When obtaining mature T cells having a desired TCR or CAR as effector cells, the cassette tape gene can be introduced into the source cells so that the gene encoding the TCR is expressed under the control of the TCR expression control mechanism of the source cells, or can be introduced into the source cells together with an expression control function including a promoter and / or enhancer involved in TCR expression control. Preferably, the cassette tape gene can be introduced so that it is expressed under the control of the TCR expression control mechanism of the source cells.
[0035] Hereinafter, we will refer to the structure containing, from upstream, a promoter, a gene encoding a marker protein, and an enhancer as a "cassette deck structure," and the structure containing a gene encoding a marker protein as a "cassette tape gene." First, we will explain step (1) of providing a material cell having a cassette deck structure containing a cassette tape gene.
[0036] When the source cells are cells after TCR gene rearrangement, such as iPS cells induced from T cells, a cassette tape gene containing a marker protein can be inserted under the physiological expression control of the rearranged TCR locus by constructing a cassette deck structure containing the cassette tape gene between the promoter and enhancer of the rearranged TCR locus.
[0037] When the source cells do not have a rearranged TCR locus, as disclosed in Patent Document 6 (International Publication No. WO2020 / 022512), there are three methods for constructing a cassette deck structure: (A) A cassette tape gene is introduced between the enhancer of the C region of the TCR gene of the material cell and the promoter of the V region so as to shorten the distance between them.
[0038] (B) The promoter of the V region of the TCR locus and the cassette tape gene are introduced upstream of the enhancer of the C region of the TCR locus in the material cells, in that order from upstream to downstream, so that the promoter of the V region and the enhancer of the C region are close enough to exert their expression control function on the gene sandwiched between them.
[0039] (C) A cassette tape gene and a gene containing an enhancer for the C region of the TCR locus are introduced downstream of the promoter for the V region of the TCR locus in the material cells, in that order from upstream to downstream, so that the promoter for the V region and the enhancer for the C region are close enough to exert their expression control function on the gene sandwiched between them.
[0040] In the present application, the phrase "the V region promoter and the C region enhancer are close enough to exert their expression control function for the gene sandwiched between them" means that the distance between them is not particularly limited, as long as the V region promoter is under the control of the C region enhancer. For example, the distance between the V region promoter and the C region enhancer after introduction of the cassette tape gene may be about 8 to 50 kbp, about 10 to 40 kbp, about 12 to 32 kbp, or about 14 to 22 kbp.
[0041] The "enhancer of the C region of the TCR locus" and the "promoter of the V region of the TCR locus" may be sequences derived from the source cells, sequences obtained from cells derived from other individuals of the same species as the source cells, or sequences obtained from cells derived from animals of other species.
[0042] The cassette deck structure can be introduced into the source cells in a single operation or in multiple steps, and can also be carried out by conventionally known recombination techniques, such as homologous recombination, genome editing, and techniques that combine recombinases such as Cre and Flippase.
[0043] When a rearranged TCR is used as the marker protein contained in the cassette tape gene, it is preferably a heterodimer of TCRα and TCRβ. When expressing a rearranged TCRα and TCRβ heterodimer, the gene encoding the marker protein preferably has a sequence in which the rearranged TCRα gene and TCRβ gene are connected by a self-cleaving 2A peptide. By placing a self-cleaving 2A peptide between the α chain and the β chain, both genes can be expressed under the expression control system of a single gene.
[0044] Examples of 2A peptides that can be used include p2A, T2A, E2A, and F2A, with the p2A peptide being preferred because of its high cleavage efficiency. While either the TCRα gene or the TCRβ gene may be introduced upstream, a poly(A) sequence is preferably linked to the TCR gene introduced downstream.
[0045] An intron is preferably contained upstream of the TCR gene. The intron sequence may be any sequence that contains a splice donor sequence and a splice acceptor sequence in addition to the sequence to be removed by splicing, such as the intron of the human polypeptide chain elongation factor α (EF1α) gene or the intron portion of the chicken β-actin (CAG) gene promoter.
[0046] It is preferable to introduce both the rearranged TCRα gene and the TCRβ gene into effector cells after differentiation induction from the source cells so that they are under the control of a single gene expression control mechanism. The TCR gene locus into which the cassette deck structure containing the cassette tape gene on the source cell genome is introduced may be TCRα or TCRβ. It is preferable to delete the TCRα and β gene loci not used for gene introduction. Deletion of a specific gene locus can be performed using known methods as appropriate, such as known genome editing techniques such as CRISPR / Cas9 and Talen.
[0047] The method for creating a vector for expressing the reconstituted TCR α and β heterodimer and the method for introducing it into the material cells can be the method described in Patent Document 6 (WO2020 / 022512).
[0048] This section describes the above-mentioned embodiment (B), i.e., a method for obtaining material cells for use in RMCE by introducing, in order from upstream, a promoter for the V region of the TCR locus and a cassette tape gene upstream of the enhancer for the C region of the TCR locus of a material cell, such that the promoter for the V region and the enhancer for the C region are sufficiently close to each other to exert their expression-regulating function for the gene sandwiched between them. Note that the material cells may be cells in which the TCR locus has been rearranged, or cells in which the TCR locus has not been rearranged.
[0049] When the RMCE method is used, recombinase target sequences are inserted into the cassette tape gene adjacent to the upstream and downstream of a gene encoding a marker protein. In this embodiment, (a) a step of preparing a cassette tape introduction vector containing, in order from upstream, a first promoter sequence expressible in effector cells after differentiation of the material cells into effector cells, a target sequence of the first recombinase, a cassette tape gene containing a gene encoding a marker protein linked to be expressed under the first promoter sequence and the target sequence of the first recombinase, a target sequence of the second recombinase, a second promoter sequence expressible in the material cells, a drug resistance gene linked to be expressed under the second promoter expressible in the material cells, and the target sequence of the second recombinase; (b) A step of knocking in the cassette deck introduction vector prepared in (a) into the material cells; (c) culturing the cells obtained in (b) in the presence of a drug to which the drug resistance gene is resistant, and selecting cells in which the cassette deck transfer vector containing a gene encoding a marker protein has been successfully knocked in; and (d) A method for producing material cells having a cassette deck structure is provided, which includes a step of treating the obtained cells with a second recombinase to remove the drug resistance gene.
[0050] In this embodiment, the first recombinase is specific to the target sequence of the recombinase contained in the effector cell having the cassette deck structure described above. The combination of the second recombinase and its target sequence is not particularly limited, as long as it does not cross-react with the first recombinase. For example, when the Cre / loxp system is used as the first recombinase, an example of the second recombinase is the FLP / frt system. The combination of the second recombinase and target sequence is such that the site flanked by the target sequences is cross-reacted by the action of the second recombinase.
[0051] The first promoter is a promoter capable of inducing expression of a marker protein in cells induced to differentiate into effector cells. When a known TCR is used as the marker protein, the promoter is preferably a promoter of the TCR locus of the source cells, such as a promoter of the V region of the TCR locus of the source cells.
[0052] The V region of the TCR locus has one promoter for each V gene. The V region promoter of the TCR locus is not particularly limited and may be selected appropriately. For example, when the TCRβ locus is used, the Vβ20-1 promoter can be used. The promoter sequence can be obtained by designing primers and amplifying them by PCR to obtain a DNA fragment of the promoter sequence immediately upstream from the translation initiation point in the first exon of the V gene.
[0053] The promoter that can be expressed in the source cells is not particularly limited as long as it can induce the expression of a linked drug resistance gene in the cells. Examples include, but are not limited to, the cytomegalovirus (CMV) promoter, the simian virus 40 (SV40) promoter, and the phosphoglycerate kinase (PGK) promoter. An example is the promoter (pPGK) of the mouse phosphoglycerate kinase (PGK) gene.
[0054] As the drug resistance gene, a known drug resistance gene that can function as a marker in the source cells may be used, and examples thereof include resistance genes to hygromycin, puromycin, neomycin, etc.
[0055] The drug resistance gene is preferably a fusion gene having a drug sensitivity gene downstream thereof. A drug sensitivity gene means a gene that, when expressed, can induce apoptosis of cells in response to an exogenously added substance. Such a drug sensitivity gene is not particularly limited and may be appropriately selected from known gene types. Examples include the thymidine kinase gene of herpes simplex virus and varicella-zoster virus. An example of a drug that induces apoptosis in cells into which such a gene has been incorporated is ganciclovir. A polyA sequence is preferably connected downstream of the drug resistance gene.
[0056] The vector used in the present application may be appropriately selected from vectors used in genetic recombination, and examples thereof include vectors such as viruses, plasmids, and artificial chromosomes. Examples of viral vectors include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, and Sendai viral vectors. Examples of artificial chromosome vectors include human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), and bacterial artificial chromosomes (BAC, PAC). Plasmids for mammalian cells may be used as plasmids. Commercially available vectors may be appropriately selected and used depending on the purpose.
[0057] The targeting vector for cassette deck insertion is constructed by determining the position in the TCR locus of the source cell genome where the cassette deck structure will be inserted. The insertion position should be such that the C enhancer derived from the source cell can activate the V promoter when a sequence containing the V promoter and cassette tape gene is inserted in that order from upstream.
[0058] For example, when a cassette deck structure is introduced into the TCRβ locus of a source cell, it can be introduced when rearrangement of the TCRβ locus has not occurred, and a region close to the enhancer is preferred, for example, upstream of Dβ2 and downstream of Cβ1. When a cassette deck structure is introduced into the TCRα locus of a source cell, it can be introduced when rearrangement of the TCRα locus has not occurred, and a region close to the enhancer is preferred, for example, upstream of the most upstream Jα gene and downstream of the most downstream Vα gene.
[0059] Once the site of introduction in the TCR locus of the genome of the source cell has been determined, sequences homologous to the sequences upstream and downstream of the introduction site are introduced as the 5' arm and 3' arm, respectively, to enable homologous recombination. In this context, the term "homologous sequences" refers to the 5' arm and 3' arm sequences that are sufficiently homologous to each other that homologous recombination occurs.
[0060] For example, when introducing a cassette deck structure into the unrearranged TCRβ locus of the genome of a source cell, a DNA fragment extending from approximately 110 bp upstream of the Dβ2 gene to approximately 1.6 kbp further upstream can be used as the 5' arm sequence, and a DNA fragment extending from approximately 50 bp upstream of the Dβ2 gene to approximately 1.6 kbp downstream can be used as the 3' arm sequence. The DNA fragments for the 5' arm and 3' arm can be obtained by PCR amplification using primers capable of specifically amplifying the respective sequences and the genomic DNA of the source cell as a template.
[0061] Specifically, examples of targeting vectors for cassette deck introduction include a vector containing, from upstream to downstream, a sequence (5' arm) homologous to the 5' end of the insertion site within the TCR locus of the source cell genome, a promoter sequence for the TCR locus V region, a target sequence for a first recombinase, a cassette tape gene containing a gene encoding a marker protein linked to the first promoter sequence for expression, and the target sequence for the first recombinase, a target sequence for a second recombinase, a second promoter sequence expressible in the source cell, a drug resistance gene linked to the second promoter for expression, and the target sequence for the second recombinase, and a sequence (3' arm) homologous to the 3' end of the insertion site in the source cell. When amplifying each sequence by PCR, primers are designed to add a DNA sequence for introducing the resulting PCR product into the drug resistance vector. The resulting PCR product can be used to construct a vector using known methods, such as Gibson assembly, or commercially available kits.
[0062] The targeting vector for cassette deck introduction may further comprise a promoter and a marker gene that can be expressed in the source cells downstream of the 3' arm. An example of such a promoter-marker combination is the combination of the MC1 promoter and the diphtheria toxin gene (DTA).
[0063] Process (b) The targeting vector for introducing the cassette deck is knocked into the TCR locus of the source cells by homologous recombination. Knock-in can be performed by known methods, such as electroporation.
[0064] To increase the efficiency of knock-in by homologous recombination, it is preferable to introduce two single-strand breaks (nicks) at the knock-in site, for example, near the initiation site (upstream) of the 3' arm, before knocking in the targeting vector for introducing the cassette deck. Nicks can be introduced by known methods, such as the CRISPR / Cas9n system.
[0065] Process (c) In source cells where homologous recombination is successful, the drug resistance gene is expressed due to the action of the introduced promoter. Therefore, source cells where homologous recombination is successful can be selected in the presence of a drug to which the drug resistance gene is resistant. Furthermore, if a marker gene is incorporated downstream of the 3' arm of the targeting vector for cassette deck introduction, source cells into which the outer portions of the 5' arm and 3' arm sequences, i.e., the cassette tape gene and the drug resistance gene, are introduced, express the marker, e.g., a cytotoxin, and the cells do not survive. Therefore, by selecting surviving cells, cells in which the cassette deck introduction vector has been successfully knocked in can be selected. The selected source cells can be further confirmed by PCR to select only cells in which the V-region promoter and cassette tape gene have been knocked in.
[0066] Process (d) A second recombinase is applied to cells into which a cassette deck introduction vector has been knocked in. To apply the second recombinase, for example, a second recombinase expression vector is introduced into the cells. Expression of the second recombinase expression vector removes the drug resistance gene, resulting in the production of material cells containing a cassette deck structure having a promoter, a set of recombinase target sequences, and a gene encoding a marker protein between the target sequences, and an enhancer in the genome of the material cells, such that the marker protein can be expressed in cells induced to differentiate from the material cells into effector cells or precursor cells of effector cells.
[0067] If the drug resistance gene is a fusion gene having a drug sensitivity gene downstream thereof, after step (d), cells in which removal of the drug resistance gene has failed may be removed by further culturing the cells in the presence of a substance that can induce apoptosis by the drug sensitivity gene.
[0068] The above is one embodiment of step (1) of the method of the present application when using the RMCE method: a step of providing a source cell that has the ability to differentiate into an effector cell, and that has, in the genome of the source cell, a cassette tape gene that includes a set of recombinase target sequences and a gene encoding a marker protein between the target sequences, such that the marker protein can be expressed in cells that have been induced to differentiate into effector cells or precursor cells of effector cells.
[0069] For example, in the above-mentioned case of "(A) introducing a cassette tape gene between the enhancer of the C region of the TCR gene of the material cell and the promoter of the V region so as to shorten the distance between them," a cassette deck transfer vector that does not have a first promoter sequence can be prepared in step (a). Also, in the case of "(C) introducing, downstream of the promoter of the V region of the TCR gene locus of the material cell, the cassette tape gene and a gene containing an enhancer of the C region of the TCR gene locus, in that order from upstream to downstream, so that the promoter of the V region and the enhancer of the C region are close enough to exert their expression control function for the gene sandwiched between them," a cassette deck transfer vector that does not have a first promoter sequence and includes an enhancer of the C region of the TCR gene agent of the material cell downstream of the drug resistance gene and the target sequence of the second recombinase can be used.
[0070] Process (2): The provided material cells are grown. The method for growing the material cells may be appropriately selected depending on the type of material cells.
[0071] Process (3): The expanded source cells are differentiated into effector cells. When the source cells are pluripotent stem cells and the effector cells are T cells, known methods can be used to induce differentiation of pluripotent stem cells into T cells, such as those described in Non-Patent Documents 1 and 2 and Patent Documents 1 to 5. By using such methods, when the source cells are pluripotent stem cells, differentiation into mature T cells can be induced without disrupting the cassette deck structure established at the TCR locus. TCR rearrangement can be suppressed by deleting the Rag1 gene or the Rag2 gene. It is sufficient to delete either the Rag1 gene or the Rag2 gene.
[0072] T cells are cells that express CD3 and at least one of CD4 and CD8. Depending on the therapeutic purpose, they may be differentiated into either killer T cells that express CD8 or helper T cells that express CD4. They may also be used as precursor cells.
[0073] The resulting T cells have a cassette deck structure in their genome that includes, in order from upstream, a promoter, a set of recombinase target sequences, and a cassette tape gene containing a gene encoding a known TCR (marker protein) between the target sequences, and an enhancer, and express the known TCR (marker protein).
[0074] The presence of a known TCR marker protein in the obtained T cells can be confirmed using a specific antibody or tetramer, thereby selecting cells having a cassette deck structure.
[0075] The method of the present application makes it possible to produce a large number of mature T cells that have a cassette deck structure containing a cassette tape gene containing the same marker protein and express the marker protein.
[0076] Process (4): The marker protein gene of the effector cells or their precursor cells is replaced with a gene encoding a desired protein. A specific example of this step when using the RMCE method will be described below. The effector cells or their precursor cells are cultured in the presence of a recombinase together with a cassette tape exchange vector containing a pair of recombinase target sequences identical to the recombinase target sequences and a gene encoding a desired protein between the pair of recombinase target sequences, thereby exchanging the cassette tape gene containing the marker protein gene for a cassette tape gene containing a gene encoding the desired protein.
[0077] The cassette tape gene containing a gene encoding a known TCR between the target sequences of a pair of recombinases is replaced with a cassette tape gene containing a desired rearranged TCR gene between the target sequences of the same recombinases.
[0078] The rearranged TCR gene to be introduced into T cells can be prepared by amplifying and isolating TCR genes from T cells specific to the antigen targeted by cell therapy using known methods. For example, a TCR specific to a cancer antigen can be used. Furthermore, for TIL therapy, TILs can be collected from a patient's cancer tissue and subjected to single-cell analysis to obtain TCRs from frequently expressed killer T cell clones.
[0079] A cassette tape exchange vector for introducing a TCR is created. The TCR is preferably a heterodimer of TCRα and TCRβ, similar to the TCR used as a marker protein. When expressing a heterodimer of rearranged TCRα and TCRβ, the gene encoding the marker protein preferably has a sequence in which the rearranged TCRα gene and TCRβ gene are connected by a self-cleaving 2A peptide. Furthermore, it is preferable for the structure to have an intron upstream and a poly(A) downstream of the TCRα and TCRβ genes, sandwiched between recombinase target sequences and containing the 2A peptide between them.
[0080] The vector for cassette tape exchange may be appropriately selected from the vectors used for genetic recombination described above, such as viruses, plasmids, artificial chromosomes, etc. Alternatively, a linear DNA vector may be used.
[0081] By introducing a cassette tape exchange vector into mature T cells with a cassette deck structure in the presence of a recombinase, the TCR gene contained in the cassette tape exchange vector can be exchanged with the TCR gene contained as a marker protein.
[0082] Specifically, the cassette tape exchange vector and the recombinant enzyme expression vector may be knocked into mature T cells by a known method, such as electroporation.
[0083] Cassette exchange can be confirmed by confirming the presence of the TCR used as a marker protein in the resulting cells. Known TCRs can be identified using tetramers or specific antibodies.
[0084] The method of the present application makes it possible to produce a large number of effector cells of the same type, each having a cassette deck structure containing one identical cassette tape gene, and by exchanging the cassette tape gene, it is possible to express a desired protein.
[0085] The method of the present application can also be carried out using a genome editing method. When using a genome editing method, the source cells having a cassette deck structure provided in step (1) are cells that have a cassette tape gene containing a gene encoding a marker protein in the genome of the source cells, such that the marker protein can be expressed in cells obtained by inducing the differentiation of the source cells into effector cells or precursor cells of effector cells. Here, the "cassette deck structure" refers to a structure that includes, from upstream, a promoter, a gene encoding the marker protein, and an enhancer, with the gene encoding the marker protein serving as the cassette tape. When using a genome editing method, it is not necessary to sandwich the marker protein between target genes of a recombinase. Steps (2) and (3) are the same as when the RMCE method is used. In the effector cells containing the cassette tape gene containing the marker protein obtained in step (3), the marker protein gene contained in the effector cells or their precursor cells is destroyed or replaced with the marker protein by genome editing, and a gene encoding the desired protein is introduced so that it is expressed in the source cells. Below, we describe a method using the CRISPR / Cas9 system, a genome editing method, to destroy a marker protein in effector cells containing a cassette tape gene containing a reconstituted TCR as a marker protein and introduce another reconstituted TCR.
[0086] i) Design of guide RNA for cleaving marker protein gene (see Figure 10) The guide RNA is designed to cleave a portion involved in the specificity of the marker protein gene. For example, if the marker protein is a TCR gene in which TCRα and TCRβ are linked by p2A as shown in FIG. 5A, the guide RNA may be designed to cleave one of CDR1 to 3, for example, CDR3, which contributes to the specificity of either TCR chain. Below, the case of cleaving CDR3 within the TCRβ chain variable region will be described. ii) Design of the arms for the reconstructed TCR gene knock-in vector (see Figure 10) A guide RNA recognition site for cleaving the marker protein is determined within the CDR3 region, with approximately 20 bp upstream of the CRISPR / Cas9 cleavage site serving as the homologous sequence for the 5' arm and approximately 20 bp downstream serving as the homologous sequence for the 3' arm. iii) Design of the reconstructed TCR gene knock-in vector (see Figure 11) A knock-in vector for introducing the TCR is created. When knocking in a heterodimer of rearranged TCRα and TCRβ, a gene encoding an amino acid sequence in which the rearranged TCRα gene and TCRβ gene are connected by a self-cleaving 2A peptide is preferred. The sequence to be knocked in is sandwiched between the homologous sequences of the 5' and 3' arms determined in step ii), and recognition sequences for the guide RNA for cleavage of the KI vector are installed at both ends. A gene encoding a self-cleaving 2A peptide is placed most upstream of the sequence to be knocked in, sandwiched between the 5' arm and 3' arm, and a stop codon is placed most downstream of the gene encoding the desired protein. Specific examples of reconstituted TCR gene KI vectors include those having, from upstream to downstream, a guide RNA recognition sequence for KI vector cleavage, a 5' arm sequence, a gene encoding the 2A peptide, a gene encoding TCRβ, a gene encoding the 2A peptide, a gene encoding TCRα, a stop codon, a 3' arm sequence, and a guide RNA recognition sequence for KI vector cleavage. iv) Construction of CRISPR / Cas9 vectors A vector was created that expresses the guide RNA sequence for cleaving the marker gene and the guide RNA sequence for cleaving the reconstituted TCR gene knock-in vector, either individually or together with the Cas9 gene. The vector can be created by inserting two guide RNA sequences into a commercially available CRISPR / Cas9 vector so that they are operably located downstream of the promoter. A schematic diagram of a vector with two guide RNAs inserted is shown in Figure 12. Commercially available Cas9 gene expression vectors include pX330, pCAS-Guide, and pGuide-it. v) Knock-in of the reconstructed TCR gene knock-in vector and CRISPR / Cas9 vector into the source cells The vector can be knocked into the source cells by a known method, for example, electroporation. Knock-in involves the integration of a rearranged TCR gene so that it interrupts the specific portion of the marker TCR gene (Figure 13). In Figure 13, the sequence from the start codon of the gene encoding the marker protein of the source cell to the stop codon of the knocked-in rearranged TCR gene is translated. The 5' fragment of the marker TCR β chain is cleaved by self-cleavage of the p2A peptide, resulting in a loss of specificity. The remaining portion of the marker TCR is located 3' from the stop codon at the end of the knocked-in rearranged TCR gene and is not translated. The translated rearranged TCR α and β chains are generated as two proteins by self-cleavage of the p2A peptide between them. Thus, the TCR protein used as the marker is replaced by the desired rearranged TCR protein.
[0087] The present method allows for the mass production of mature T cells or their progenitors that express a desired TCR by producing a large number of mature T cells or their progenitors with a cassette deck structure containing a cassette deck gene containing a known rearranged TCR as a marker protein and then replacing the cassette deck gene with a cassette deck gene containing a desired TCR gene. By introducing only one cassette deck structure into a single mature T cell or its progenitor cell, it is possible to simultaneously exchange cassette deck genes for multiple TCRs in multiple mature T cells or their progenitor cells (Figure 1A). For example, disrupting the TCR expression mechanism without a marker protein can yield effector cells that have only one cassette deck structure introduced into each cell. This method of exchanging cassette tapes for multiple TCRs into a cell clone with only one cassette deck structure is suitable for use in TIL therapy.
[0088] An example of the present method for TIL therapy is the TIL cocktail method, in which multiple TCR cassettes are exchanged for a cell clone with only one cassette deck structure. First, TILs are collected from a patient's cancer tissue, and single-cell analysis of the TILs can provide information on the TCRs of multiple frequently expressed killer T cell clones. The resulting multiple TCRs are then inserted into a cassette deck exchange vector (Figure 1B). Meanwhile, regenerative T cell clones with a cassette deck structure are generated using the present method from pluripotent stem cells that have been generalized through HLA manipulation, and a TCR is then introduced into these regenerative T cells. The present invention is used in the step of introducing a TCR into these regenerative T cells with a cassette deck structure. In principle, this strategy can be applied to all patients from whom TILs can be collected. Because T cells themselves are generalized, while TCR genes are personalized, this strategy can be considered a combination of personalized medicine and generalized medicine.
[0089] A method has been proposed in which pluripotent stem cells are made more versatile by manipulating the HLA of ES cells or iPS cells using genome editing technology, and such versatile pluripotent stem cells may be used as the material cells of the present application.
[0090] When using the RMCE method, the TIL cocktail method involves: 1) inserting a rearranged TCR gene into the TCR locus of the base ES / iPS cells in a position where expression is controlled by the endogenous enhancer (Figure 1A). 2) Placing lox2272 and loxp upstream and downstream of the inserted TCR gene creates a cassette tape-like structure. 3) The TCR gene to be introduced is a known TCR for which a tetramer for staining is available. 4) To ensure that only one TCR locus is expressed in the cells, the TCR locus without the rearranged TCR gene is destroyed. 5) T cells are regenerated from the ES / iPS cells thus created. 6) Meanwhile, placing lox2272 and loxp upstream and downstream of the TCR gene to be introduced (cassette tape exchange vector). 7) The mixture of multiple TCR genes is introduced into cells together with Cre.
[0091] When using genome editing, the TIL cocktail method involves: 1) inserting a rearranged TCR gene into the TCR locus of the base ES / iPS cells in a position where expression is controlled by the endogenous enhancer. 2) At this time, the TCR locus without the rearranged TCR gene is destroyed so that only one TCR locus is expressed in the cell. 3) The TCR gene to be introduced is a known TCR for which a tetramer for staining is available. 4) T cells are regenerated from the ES / iPS cells thus created. 5) Separately, a genome editing vector is prepared to introduce the desired sequence into the sequence site specific to the introduced TCR gene, and a knock-in vector (a vector for cassette tape replacement) is prepared to introduce the rearranged TCR gene. 6) The genome editing vector is then applied to the cells along with the knock-in vectors for introducing multiple types of rearranged TCR genes.
[0092] This method has the following advantages: 1) it allows gene transfer without the risk of mispairing even when multiple TCR vectors are mixed, and 2) the replaced cells can be sorted as tetramer-negative cells. As a result, it is possible to produce large amounts of T cells that express the same TCR as TILs. On the other hand, the present invention can be applied not only to TIL-derived TCR genes, but also to the introduction of one or more TCR genes or CAR genes against cancer common antigens into regenerated T cells. [Example]
[0093] The present invention will be described in more detail below with reference to examples. Hereinafter, a cassette tape gene containing a specific gene will be referred to as a "cassette tape of the specific gene." In this example, cells were prepared containing a cassette deck containing a cassette tape of a WT1-specific TCR gene under the control of the TCR expression mechanism in Jurkat cells, a type of mature T cell. By applying a cassette tape exchange vector for the NY-ESO1-specific TCR gene to the cassette tape in the resulting cassette deck, the cassette tape of the WT1-specific TCR gene was successfully exchanged for a cassette tape of the NY-ESO1-specific TCR gene. The entire procedure is shown in Figure 2. 1) Knock-in of a cassette deck containing a TCR gene cassette into the TCRβ locus Dβ2 region (hereinafter also referred to as the "TCRDβ2 gene region") of Jurkat cells by homologous recombination:
[0094] Reagents and antibodies used: KOD-FX (Toyobo, KFX-101), Amaxa R Cell Line Nucleofector R Kit V (Lonza, VACA-1003), Puromycin dihydrochloride (Wako,160-23151), Ganciclovir (Wako, 078-04481), PE / Cy7 anti-human TCRα / βmonoclonal antibody (BioLegend, 306719), APC Anti-Human CD3 monoclonal antibody (BioLegend, 300439), APC / Cyanine7 anti-human CD3 Antibody (BioLegend, 300426) APC mouse IgG2bκ isotype control antibody (BioLegend, 400322), HLA-A*24:02 modified WT1 Tetramer-CYTWNQMNL-PE (MBL, TS-M014-1), HLA-A*02:01 NY-ESO-1 Tetramer-SLLMWITQC-PE (MBL, TB-M011-1)
[0095] In all experiments, the cells were cultured in a culture medium with the following composition. When selecting with a drug, the cells were cultured with the following composition and each drug added. [Table 1] *The composition of the penicillin / streptomycin / L-glutamine solution is 10,000 U / mL penicillin, 10,000 μg / mL streptomycin, and 29.2 mg / mL L-glutamine, resulting in final concentrations of 100 U / mL, 100 μg / mL, and 292 μg / mL, respectively.
[0096] In this example, the vector was introduced into the cells by electroporation. R Cell Line Nucleofector R We followed the instructions in the Kit V kit manual. After suspending the cells and vector in the reagent provided with the kit, we transferred them to the cuvette provided with the kit and placed them in an Amaxa Nucleofector II (Lonza). We then transfected the cells with the vector using the built-in program X001.
[0097] The cell line used as the source was the J.RT3-T3.5 Jurkat cell line (hereafter referred to as Jurkat β mutant) (Ohashi et al., Science 316, 606-609, 1985), a subspecies of the Jurkat cell line in which the rearranged TCR β gene is no longer expressed due to a mutation.
[0098] A targeting vector for cassette deck introduction was prepared, containing the cassette tape gene containing the reconstituted TCR (corresponding to the marker protein) flanked by lox2272 and loxP, as shown in Figure 2A. Although not shown in Figure 2A, the vector also contains the DCT gene and its promoter downstream of the 3' arm homologous region.
[0099] The Vβ20-1 promoter and TCR gene cassette were inserted into the TCRβ locus of Jurkat cells (Figure 2B), approximately 50 bp upstream of the Dβ2 gene (Figure 2B). A schematic diagram of the inserted cassette is shown in Figure 2C.
[0100] To increase the efficiency of homologous recombination-mediated knock-in, two single-strand breaks (nicks) were introduced approximately 50 bp upstream of the Dβ2 gene using the CRISPR / Cas9n system. The targeting vector for cassette deck introduction was introduced into Jurkat β mutants together with the two CRISPR / Cas9n vectors shown below.
[0101] In cells that have integrated the cassette deck delivery targeting vector into their genomic DNA by homologous recombination, the EF1α promoter drives expression of a fusion gene (PurorΔTK) consisting of a puromycin resistance gene and the kinase domain of herpesvirus thymidine kinase (ΔTK) (Figure 2C). Therefore, clones that have integrated the drug resistance gene from the cassette deck delivery targeting vector into their genome were selected using 0.25 μg / mL puromycin in culture medium (positive selection). On the other hand, cells that have integrated the vector portion outside the 5' and 3' arm sequences of the cassette deck delivery targeting vector into their genomic DNA by random integration are eliminated due to the production of diphtheria toxin (DTA) within the cells (negative selection).
[0102] Next, from the selected cells (clones), we used PCR to identify clones that had integrated the TCR gene and drug resistance gene segments from the Vβ20-1 promoter to the frt gene into the TCRDβ2 gene region. From these, we selected cells that had the TCR gene cassette inserted into only one allele of the TCRDβ2 gene region and had not integrated the vector into other regions of the genomic DNA by random integration. [Table 2]
[0103] The CRISPR / Cas9n vectors used are as follows: A: 5'-CACCGAGGTTAGTCTGACTGTGTG-3' (SEQ ID NO: 1) B: 5'-AAACCACAGTCAGACTAACCTC-3' (SEQ ID NO: 2) C: 5'-CACCCTGCCGCTGCCCAGTGGTTG-3' (SEQ ID NO: 3) D: 5'-AAACCAACCACTGGGCAGCGGCAG-3' (SEQ ID NO: 4) The oligonucleotides A and B (vector 1) and C and D (vector 2) were annealed and inserted into the plasmid pX460 cleaved with the restriction enzyme BbsI.
[0104] Integration of the TCR gene into the TCRDβ2 gene region was confirmed by amplifying the 5′ arm region and 3′ arm region using the following primers and PCR method.
[0105] 5' arm region Primer1, 5'-ACGGCTGAAATCTCCCTAACCC-3' (SEQ ID NO: 5) Primer2, 5'-ATACGAAGTTATAGCTAGTCTTCCGTGATGGCCTCACACCA-3' (SEQ ID NO: 6) PCR was performed using KOD-FX (Toyobo, KFX-101) with 35 cycles of 94°C for 2 minutes, followed by 98°C for 10 seconds and 68°C for 4 minutes.
[0106] 3' arm region Primer3, 5'-GTCCAGACCCACGTCACC-3' (SEQ ID NO: 7) Primer4, 5'-GGGGACCGAGGGCTGGAAG-3' (SEQ ID NO: 8) PCR was performed using KOD-FX (Toyobo, KFX-101) with 35 cycles of 94°C for 2 minutes, followed by 98°C for 10 seconds, and 68°C for 2 minutes and 30 seconds.
[0107] The integration of the TCR gene into only one allele of the TCRDβ2 gene region was confirmed using the following primers and PCR reaction conditions. Primer5, 5'-CCTCCTGTCATAAGGTGCCAT-3'(SEQ ID NO: 9) Primer6, 5'- CCACTTTGCTGTCTTGGCCTT-3' (SEQ ID NO: 10) PCR was carried out using KOD-FX (Toyobo, KFX-101) with 35 cycles of 94°C for 2 minutes, 98°C for 10 seconds, 60°C for 30 seconds, and 68°C for 8 minutes.
[0108] Whether the vector had been incorporated into the genomic DNA by random integration was confirmed by amplifying the diphtheria toxin (DTA) gene using the following primers and PCR reaction conditions. Diphtheria toxin (DTA) gene Primer7, 5'-AGCCAAAATCTGGTACACAAGG-3' (SEQ ID NO: 11) Primer8, 5'-CTGAGCACTACACGCGAAGCA-3' (SEQ ID NO: 12) PCR was carried out using KOD-FX (Toyobo, KFX-101) for 35 cycles of 94°C for 2 minutes, followed by 98°C for 10 seconds, 58°C for 30 seconds, and 68°C for 25 seconds.
[0109] Diphtheria toxin-free cells were used below as "KI-Jurkat cells carrying a targeting vector for cassette deck introduction."
[0110] 2) Introduction of FLP vector into KI-Jurkat cells, a targeting vector for cassette deck introduction (generation of Jurkat cells expressing exogenous TCR) material [Table 3]
[0111] The Flipperse expression vector (pCAGGS-FLPe) was electroporated into KI-Jurkat cells. FLP recognizes the frt sequence and deletes the region flanked by these sequences. Figures 2C and 2D show the TCRβ locus Dβ2 region after knock-in (Figure 2C) and the TCRβ locus with the deletion of the frt sequence (Figure 2D).
[0112] Transient FLP expression by electroporation resulted in a mixture of cells in which the region flanked by frt was deleted and cells in which the deletion did not occur. Therefore, we used ganciclovir to eliminate cells in which the deletion failed (cells in which FLP-mediated recombination failed). Ganciclovir is generally ineffective in human cells such as Jurkat cells. In contrast, in cells containing PurorΔTK, ganciclovir becomes a nucleic acid analog when phosphorylated by ΔTK, inhibiting DNA replication and resulting in cell growth arrest or cell death.
[0113] After 9 days of culture in 12 μM ganciclovir / culture medium, the expression of TCR and CD3 on the cell membrane was analyzed by FACS. The results are shown in Figure 3. Ganciclovir selection increased the number of cells expressing TCR. However, many cells still did not express TCR. Therefore, TCR-expressing cells were isolated using FACA Aria (BD) and used for the following (Figure 4).
[0114] After culturing the isolated cells, deletion of the region flanked by the frt sequences was confirmed by PCR and reanalysis by FACS. It was confirmed that the isolated cells had deleted the region flanked by the frt sequences and maintained TCR expression (Figure 4). The resulting cells were used in the following experiments as "TCR expression cassette deck KI-Jurkat cells." 3) TCR cassette deck replacement using plasmid DNA in KI-Jurkat cells [Table 4]
[0115] This step is shown in Figures 2D and 2E of Figure 2. An outline is provided again in Figure 5A. From top to bottom, the diagrams show the TCRβ locus Dβ2 region of the TCR expression cassette KI-Jurkat cells, the TCR cassette tape exchange vector (plasmid vector), and the TCRβ locus after cassette tape exchange. Downstream of the Vβ20-1 promoter in the TCRβ locus Dβ2 region is an intron-TCRβ-p2A-TCRα-polyA flanked by Lox2272 and Loxp.
[0116] The vector used for TCR cassette exchange was a plasmid vector containing intron-TCRβ-p2A-TCRα-polyA flanked by Lox2272 and Lox. TCRs against the NY-ESO1 antigen were used as TCRα and TCRβ.
[0117] To perform cassette exchange, the TCR cassette exchange vector and Cre expression vector (pCAG-nls-Cre) were introduced into TCR expression cassette deck KI-Jurkat cells by electroporation. After electroporation, the cells were cultured for 7 days. To confirm that the region flanked by lox2272 and loxP had been replaced by cassette exchange, the presence or absence of NY-ESO1 tetramer-positive cells was confirmed using FACS. The results are shown in Figure 6. NY-ESO1 tetramer-positive cells were not detected in cells that had not undergone cassette exchange, but NY-ESO1 tetramer-positive cells were detected in cells transfected with the TCR cassette exchange vector and Cre expression vector.
[0118] 4) Linear DNA TCR expression cassette deck: Replacement of TCR cassette tape in KI-Jurkat cells To improve the efficiency of the TCR cassette exchange method, we attempted to use linear DNA, which is smaller than plasmid DNA. A schematic diagram is shown in Figure 5B. The linear DNA was generated by PCR amplification of the region flanked by lox2272 and loxP in the TCR cassette exchange vector (plasmid vector) described above (see Materials below). The linear DNA for TCR cassette exchange and a Cre expression vector (pCAG-nls-Cre) were introduced into TCR expression cassette KI-Jurkat cells by electroporation. In this example, the TCR introduced was directed against the NY-ESO1 antigen. After 14 days of culture, the presence or absence of NY-ESO1 tetramer-positive cells was confirmed using FACS to confirm that the region flanked by lox2272 and loxP had been replaced by cassette exchange. The results are shown in Figure 6. As with TCR cassette exchange using plasmid DNA, NY-ESO1 tetramer-positive cells were detected.
[0119] material Linear DNA for replacing TCR cassette tapes Primer9, 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 13) Primer10, 5'-CAGGAAACAGCTATGACCATG-3' (SEQ ID NO: 14) PCR was carried out using KOD-FX (Toyobo, KFX-101) with 35 cycles of 94°C for 2 minutes, followed by 98°C for 10 seconds, 59.1°C for 30 seconds, and 68°C for 4 minutes.
[0120] [Table 5] [Example]
[0121] 1) Knock-in of a cassette deck containing a WT-1-specific TCR gene (cassette tape gene) flanked by lox sites into the Dβ2 region of the TCRβ locus in human iPS cells [Table 6] The following iPS cell lines were used: HKM1 line: derived from human monocytes (established by the Kawamoto Hiroshi Laboratory, Institute for Frontier Medical Sciences, Kyoto University) I14s04 line: Derived from human monocytes (established at the Center for iPS Cell Research and Application, Kyoto University)
[0122] 2) TCR knock-in (gene editing using CRISPR / Cas9) A targeting vector for cassette deck introduction was prepared in the same manner as in Example 1. The structure of the vector is shown in Figure 7A. The TCR gene used was a TCR (KM#3-3) obtained from a WT1-specific TCR. The plasmids of CRISPR / Cas9 and guide RNA expression vector 1 and targeting vector for cassette deck introduction 2, mixed in the ratio described above, were transfected into iPS cells by electroporation. Two days later, the cells were harvested and 5 x 10 4 / well (6-well plate), and the next day drug selection was performed using puromycin at the final concentrations shown below.
[0123] Electroporation was performed using 1 x 10 iPS cells per session. 6 A total of 10 μg of plasmid DNA was used, and NEPA21 was used under the following conditions. Day 0: Electroporation Day 2: Cell reseeding 5×10 4 cells / well Day 3: Puromycin 180ng / ml Day 4: Puromycin 150ng / ml Day 5-9: Normal culture Day 12: iPSC colony pick-up
[0124] PCR was performed on the genomic DNA of each of the established iPS cell clones to confirm and select strains with the desired knock-in.
[0125] 3) Removal of drug selection mechanism (site-specific recombination using FLP) Thymidine kinase is expressed downstream of the targeting vector for cassette deck introduction shown in Figure 7A, which converts ganciclovir (GCV) into toxic substances within the cells, resulting in cell death when co-cultured with GCV. Using this mechanism, FLP expression vector 3 was electroporated, and after transient expression of FLP, drug selection was performed using GCV at the final concentrations shown below. A schematic diagram is shown in Figure 7B.
[0126] Day 0: Electroporation Day 2: Cell reseeding 2-4×10 3 cells / well Day 3-6: GCV 5ug / ml Day 7-12: Normal culture Day 12: iPSC colony pick-up
[0127] PCR was performed on the genomic DNA of each of the established iPS cell clones to identify strains in which the target PurorΔTK site was deleted.
[0128] CD8 single positive T cells (CTLs) were obtained by inducing differentiation from iPS cells having a cassette deck structure containing a cassette tape of a TCR gene having a lox2272-TCR-loxP structure containing the obtained WT1-specific TCR.
[0129] CTLs were induced by the method described in Patent Document 4 (WO2017 / 179720). Specifically, iPS cells were induced to develop T cell precursors, which were CD4CD8 double-positive cells, and then the CD4CD8 double-positive cells were isolated. The isolated CD4CD8 double-positive cells were further induced to develop CD8 single-positive cells. The results are shown in Figure 8. WT1-specific CD8 single-positive T cells were obtained, in which the CD8 antigen was heterozygous for the CD8 α chain and CD8 β chain. In other words, the obtained cells were CD8 single-positive T cells that had a cassette deck containing a cassette tape of a WT1-specific TCR gene. [Example]
[0130] The cassette tape of CD8 single-positive T cells was exchanged with a cassette deck containing the cassette tape of the WT1-specific TCR gene obtained in Example 2. 1) TCR cassette exchange of CD8SPT cells using plasmid DNA [Table 7]
[0131] Cassette exchange was performed according to the outline shown in Figure 5A. The vector used for cassette exchange was a circular plasmid vector containing intron-TCRβ-p2A-TCRα-polyA flanked by Lox2272 and Lox. TCRs against the NY-ESO1 antigen were used as TCRα and β. A plasmid vector encoding the GFP gene flanked by Lox2272 and Lox was used as the mock vector.
[0132] To replace the cassette tape, CD8+ SPT cells containing a cassette deck containing a WT1-specific TCR gene cassette were electroporated with a TCR cassette replacement vector or mock vector and a Cre expression vector (pCAG-nls-Cre). After electroporation, the cells were cultured for 13 days. To confirm replacement by the cassette tape replacement method, the presence or absence of NY-ESO1 tetramer-positive cells was confirmed using FACS. Cells whose TCR had been replaced by cassette tape replacement were detected as NY-ESO1 tetramer-positive cells. The results are shown in Figure 9. As a negative control, 10 μg of mock vector was used instead of the TCR cassette replacement vector (NY-ESO1).
[0133] When the mock vector was introduced, no NY-ESO1 tetramer-positive cells were generated. We performed cassette exchange twice using a cassette vector containing the NY-ESO1 TCR under different electroporation conditions. Although the efficiency was low in both cases, NY-ESO1 tetramer-expressing cells were generated, confirming that cassette exchange was successful. [Example]
[0134] Using genome editing, the marker protein, TCR, was switched to another TCR. Cells (TCR expression cassette deck KI-Jurkat cells) in which the rearranged WT1-specific TCR prepared in Example 1 was knocked into the Dβ2 region of the TCRβ locus of Jurkat cells were used. The TCRβ locus of these cells has the structure shown in Figure 5A, WT1-TCR KI Human TCRβ locus. In Example 4, these cells are referred to as "Jurkat WT1-TCR cells." In this example, genome editing was used to express NYESO1-TCR in place of WT1-TCR in Jurkat WT1-TCR cells.
[0135] Two types of guide RNAs were created (gRNA#1 and gRNA#4) that target the gene portion encoding the CDR3 region of the TCR β chain of WT1-TCR. The 20 bp 5'-arm and 20 bp 3'-arm portions of the cleavage site of each guide RNA were designated the 5'-arm and 3'-arm, respectively. A conceptual diagram of the homologous sequence portions and 5'-arm and 3'-arm designs of the two guide RNAs is shown in Figure 10. In the figure, the vertical lines separating the base sequences correspond to the reading frame of protein translation. Another guide RNA (gRNA#5) was used for cleavage of the NYESO-1-TCR knock-in vector. The recognition sequence of gRNA#5 is underlined below. 5'- GCATCGTACGCGTACGTGTT TGG-3' (SEQ ID NO: 15) The DNA sequence of the gRNA portion of the gRNA#5 vector was a previously reported sequence (Nature Protocol 11, 118-133, 2016).
[0136] The NYESO1-TCR gene used to replace the WT1-TCR was a chimeric TCR β chain in which the variable region (Vβ) of the TCR β chain of a known human TCR that recognizes the NYESO1 antigen was linked to a mouse TCR constant region (mCβ), and a chimeric gene in which a chimeric TCR α chain of similar structure was linked via the p2A peptide gene (Figure 11).
[0137] A schematic diagram of the NYESO1-TCR gene knock-in vector is shown in Figure 11. The NYESO1-TCR knock-in vector is a plasmid DNA vector that contains, from upstream, the gRNA#5 recognition sequence, the 5' arm sequence, the p2A sequence, the NYESO1-TCR gene in which the TCR β chain and the TCR β chain are linked by the p2A sequence, the 3' arm sequence, and the gRNA#5 recognition sequence. It also contains a stop codon at the 3' end of the NYESO1-TCR gene.
[0138] Construction of guide RNA expression vectors for CRISPR / Cas9 We created CRISPR / Cas9 vectors by introducing gRNA#1, gRNA#4, and gRNA#5 into the plasmid vector pX330, which can express both guide RNA and Cas9. We also created vectors by introducing gRNA#1 & gRNA#5 and gRNA#4 & gRNA#5. As an example, a schematic diagram of a vector expressing gRNA#1, gRNA#5, and Cas9 is shown in Figure 12.
[0139] Transfection of NYESO1-TCR KI vector and CRISPR / Cas9 vector into Jurkat WT1-TCR cells The vector was introduced into the cells using electroporation. Electroporation was performed according to the Amaxa® Cell Line Nucleofector® Kit V kit manual. 2 × 10 cells were cultured in 100 μL of the reagent provided with the kit. 6 After suspending the cells and the vector, the cells were transferred to a cuvette provided with the kit and set in an Amaxa Nucleofector II (Lonza), and the vector was introduced into the cells using the built-in program X001.
[0140] Conditions for gene transfer by electroporation Condition 1: WT1-TCR gene cleaved by gRNA#1 [Table 8]
[0141] Condition 2: WT1-TCR gene cleaved by gRNA#4 [Table 9]
[0142] Six days after gene transfection, TCR expression was analyzed using a flow cytometer for the eight cell types (conditions 1-1 to 2-4) and non-transfected Jurkat WT1-TCR cells. The two antibodies and one tetramer shown below were used for the analysis. antibody Human TCRαβ antibody-PECy7(BioLegend, 306720) Mouse TCRβ antibody-APC(BioLegend, 109212) Tetramer NYESO1-tetramer-PE(MBL, TB-M011-1)
[0143] The human TCRαβ antibody recognizes TCRs with human C regions, but not TCRs with mouse C regions. On the other hand, the mouse TCRβ antibody recognizes TCRs with mouse C regions, but not TCRs with human C regions. Furthermore, the NYESO1-tetramer recognizes only the NYESO1-TCR. Under these experimental conditions, the human TCRαβ antibody recognizes WT1-TCR (KM#3-3), while the mouse TCRβ antibody and the NYESO1-tetrame are thought to recognize the NYESO1-TCR. The results are shown in Figure 14A and Figure 14B.
[0144] In untransfected Jurkat WT1-TCR cells, expression of a TCR (KM#3-3) recognized by human TCRαβ antibody was confirmed, but no expression of a TCR recognized by mouse TCRβ antibody or NYESO1-tetramer was observed (upper and middle rows of the Jurkat WT1-TCR cell column on the right in Figures 14A and 14B). In contrast, in cell groups co-transfected with the NYESO1-TCR vector and a gRNA / Cas9 expression vector for knocking the NYESO1-TCR vector into the CDR3 region of WT1-TCR, cells expressing NYESO1-TCR were observed, albeit in very small numbers (Figure 14A, upper and middle rows for conditions 1-1, 1-2, 1-3, and 1-4) (Figure 14B, upper and middle rows for conditions 2-1, 2-2, 2-3, and 2-4). Furthermore, most of the cells expressing NYESO1-TCR did not express WT1-TCR (Figure 14A, lower rows for conditions 1-1, 1-2, 1-3, and 1-4) (Figure 14B, lower rows for conditions 2-1, 2-2, and 2-4). These results suggest that the TCR expressed in Jurkat WT1-TCR cells was switched from WT1-TCR to NYESO1-TCR. These results demonstrate that genome editing can be used to switch the expression of an exogenously introduced T cell receptor (TCR) from the existing TCR to a different TCR.
Claims
1. Providing a group of T cells or T cell precursors each containing, in its genome, a cassette tape gene containing a gene encoding a marker protein and a recombinase target gene adjacent to the gene upstream and downstream thereof so as to be capable of expressing the marker protein, and each cell containing the same cassette deck structure that does not contain an exogenous drug resistance gene; A method for simultaneously producing multiple types of T cells or T cell precursors expressing distinct specificity-determining sites, the method comprising the step of simultaneously replacing the marker protein genes of the T cell group or T cell precursor group with genes encoding multiple types of specificity-determining site proteins.
2. The method according to claim 1, further comprising the step of selecting a population of T cells or T cell precursors that express a desired protein by selecting marker protein-negative cells.
3. The method of claim 1 or 2, wherein the marker protein is a known ligand or receptor expressed on the surface of T cells or T cell precursors.
4. The method of claim 3, wherein the marker protein is a gene encoding a known rearranged T cell receptor (TCR) or chimeric antigen receptor (CAR).
5. The method of claim 1 or 2, wherein the marker protein is a fluorescent protein.
6. The method according to any one of claims 1 to 5, wherein the step of replacing the marker protein genes of the T cell group or T cell precursor group with genes encoding multiple types of specificity-determining site proteins is carried out by Recombinase-mediated Cassette Exchange (RMCE) or genome editing.
7. A method described in any one of claims 1 to 6, wherein the specificity-determining site protein expressed in T cells or T cell precursors is a rearranged T cell receptor (TCR) or a chimeric antigen receptor (CAR).
8. The method described in claim 7, wherein the specificity-determining site protein expressed in T cells or T cell precursors is a rearranged TCR.
9. The method described in claim 7 or 8, wherein the TCR or CAR expressed in T cells or T precursor cells is derived from tumor-infiltrating lymphocytes.
10. The step of providing a population of T cells or T cell precursors each containing a cassette deck structure containing a gene encoding a marker protein and a cassette tape gene containing recombinase target genes adjacent to the gene encoding a marker protein and located upstream and downstream thereof, in a manner such that the marker protein can be expressed, and which does not contain an exogenous drug resistance gene, comprises the steps of: (1) providing a source cell having the ability to differentiate into a T cell, the source cell having a cassette deck structure in which the source cell has a cassette tape gene containing a gene encoding a marker protein in the genome of the source cell so that the marker protein can be expressed in cells induced to differentiate into T cells or T cell precursors; (2) growing the material cells; (3) The method according to any one of claims 1 to 9, further comprising the step of inducing the differentiation of the material cells into T cells or T cell precursors.
11. The method according to claim 10 , wherein the material cells are pluripotent stem cells.
12. The method according to claim 11 , wherein the material cells are ES cells or iPS cells.
Citation Information
Patent Citations
Dual-RMCE-mediated (dual-recombinase mediated cassette exchange-mediated) TCR (T cell receptor) gene replacement system and method
CN105316362A
Effective generation of tumor-targeted t-cells derived from pluripotent stem cells
WO2014165707A2
Method for inducing t cells for immunotherapy
WO2016010153A1
Production method for pluripotent stem cells having antigen-specific t cell receptor gene
WO2016010154A1
Production method for pluripotent stem cells having antigen-specific t cell receptor gene
WO2016010155A1