RNAi agents for inhibiting expression of HIF-2 alpha (EPAS1), compositions thereof and methods of use

RNAi agents conjugated with targeting ligands and PK enhancers address the delivery challenges of oligonucleotides, achieving selective and efficient HIF-2α inhibition in cells to treat conditions like ccRCC.

JP7808963B2Active Publication Date: 2026-01-30ARROWHEAD PHARMACEUTICALS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2021540037
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-26
Filing Date
2020-01-08
Publication Date
2026-01-30
Estimated Expiration
2040-01-08

AI Technical Summary

Technical Problem

Existing RNAi agents face challenges in selectively and efficiently delivering oligonucleotide-based therapeutics to target cells, particularly extrahepatic cells, due to degradation and filtration issues, and there is a need for potent inhibitors of HIF-2α expression to treat conditions like clear cell renal cell carcinoma (ccRCC).

Method used

Development of RNA interference (RNAi) agents linked to targeting ligands and pharmacokinetic (PK) enhancers, specifically designed to inhibit HIF-2α gene expression, which can be administered via intravenous or subcutaneous routes, ensuring selective delivery and efficient reduction of HIF-2α gene expression in target cells.

Benefits of technology

The RNAi agents effectively inhibit HIF-2α gene expression, providing therapeutic benefits for conditions such as ccRCC by selectively targeting and reducing HIF-2α levels in cells, thereby inhibiting tumor growth and metastasis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007808963000428
    Figure 0007808963000428
  • Figure 0007808963000429
    Figure 0007808963000429
  • Figure 0007808963000430
    Figure 0007808963000430
Patent Text Reader

Abstract

The present disclosure relates to RNAi agents, e.g., double-stranded RNAi agents, capable of inhibiting HIF-2α (EPAS1) gene expression. Pharmaceutical compositions comprising the HIF-2α RNAi agents and methods for using the same are also disclosed. The HIF-2α RNAi agents disclosed herein can be bound or complexed to a targeting ligand (e.g., a compound with affinity for an integrin, e.g., α-v-β-3 and α-v-β-5 integrin) and a pharmacokinetic (PK) enhancer to facilitate delivery to clear cell renal cell carcinoma cells and tumors. Delivery of a composition comprising the HIF-2α RNAi agent in vivo provides inhibition of HIF-2α gene expression. The HIF-2α RNAi agents can be used in methods for treating various diseases and disorders, including ccRCC.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing which has been filed in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy is named 30663 SEQ It is LISTING.txt and is 227kb in size.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 790,360, filed January 9, 2019; U.S. Provisional Application No. 62 / 827,564, filed April 1, 2019; and U.S. Provisional Application No. 62 / 839,381, filed April 26, 2019.

[0003] FIELD OF THE INVENTION The present disclosure relates to RNA interference agents for the inhibition of HIF-2α (EPAS1) gene expression, compositions comprising HIF-2α RNAi agents, and methods of use thereof. [Background technology]

[0004] Hypoxia-inducible factor-2α (HIF-2α, HIF2-α, Hif2α, or Hif2α), also known as endothelial PAS domain-containing protein 1 (EPAS1), is a hypoxia-inducible transcription factor that responds to a decrease in available oxygen (hypoxia). HIF-2α is encoded by the EPAS1 gene (alternatively referred to herein as the "HIF-2α gene"), and its expression is known to be upregulated under hypoxic conditions.

[0005] In certain human populations living at high altitudes (e.g., Tibetans), a high proportion of the population has evolved to carry specific allelic variants of the HIF-2α gene, which helps improve oxygen transport in the body in hypoxic environments. However, in more typical high-altitude environments, overexpression of wild-type EPAS1 is associated with increased hypertension and stroke, as well as symptoms similar to mountain sickness due to excessive red blood cell production. Mutations in this gene are also associated with familial polycythemia type 4 and pulmonary hypertension.

[0006] Notably, HIF-2α is widely expressed in various human tissues, and HIF-2α protein has been identified as necessary for or enhancing the expression of various genes involved in various diseases, including tumor progression. For example, HIF-2α is thought to play a role in the progression of uveal melanoma by promoting the autocrine loop VEGF-pVEGFR2 / KDR and enhancing LDHA expression, thereby conferring a growth advantage.

[0007] EPAS1 has also been shown to associate with or upregulate the expression of other factors, including cMyc (which promotes cell proliferation, transformation, neoplasia, and tumorigenesis and is highly expressed in most cancers), interleukin-8 (a pro-inflammatory mediator, e.g., in gingivitis and psoriasis), SP-1 (a transcription factor involved in IL-8 regulation and a coactivator of cMyc), LDH5 (associated with tumor necrosis and increased tumor size), and LANA (a latency-associated nuclear antigen associated with Kaposi's sarcoma-associated herpesvirus). Furthermore, HIF (hypoxia-inducible factor) activity may generally play a role in angiogenesis, which is necessary for cancer tumor growth. For example, HIF-2α is thought to be involved in several other diseases, including renal carcinoma, clear cell renal cell carcinoma (and metastasis of other cancers), melanoma, inflammation, chronic inflammation, neovascular disease, rheumatoid arthritis, uveal melanoma, chondrosarcoma, and multiple myeloma. Mutations in the EPAS1 gene have also been correlated with the early onset of neuroendocrine tumors, such as paragangliomas, somatostatinomas, and / or pheochromocytomas. These mutations are generally somatic missense mutations located in the primary hydroxylation site of HIF-2α. These mutations are thought to disrupt the protein hydroxylation / degradation mechanism, resulting in protein stabilization and pseudohypoxic signaling. Furthermore, neuroendocrine tumors release erythropoietin (EPO) into the circulation, causing polycythemia.

[0008] More specifically, HIF-2α is associated with tumor progression and metastasis in clear cell renal cell carcinoma (ccRCC). A high percentage of ccRCC tumors express a mutant form of the Von Hippel-Landau protein that is unable to degrade HIF-2α, which is thought to lead to the accumulation of HIF-2α and activation of HIF-2α-regulated genes that promote tumor growth and metastasis.

[0009] There remains a need for viable therapeutic treatments for treating various diseases, including cancers such as ccRCC. Similarly, there continues to be a need for therapeutic agents that can inhibit the expression and / or reduce the production of HIF-2α. By way of example only, a substantial reduction in HIF-2α expression in ccRCC cells can inhibit the unwanted proliferation or otherwise slow the progression of these cancer cells.

[0010] One known method of inhibiting gene expression is through RNA interference (RNAi) by administering oligonucleotide-based drug preparations (such as RNAi agents) that can inhibit or silence gene expression.However, there remains a great challenge in both identifying the potent and stable oligonucleotide sequences that can silence gene expression in vivo, and determining the therapeutically viable method for safely and selectively delivering treatment to desired cells or tissues.Oligonucleotide-based drugs, in particular, due to their relatively small size and inherent organic properties, tend to be easily and quickly degraded or filtered when administered in vivo, which often prevents them from reaching their intended target cells and / or tissues. To overcome this limitation, various approaches have been developed, such as encapsulation in liposomes, iontophoresis, hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugates™ (DPCs) (see, e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185). Alternatively, conjugation of oligonucleotides to targeting ligands, such as cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, or antibody mimetics with affinity for cell surface molecules, has seen some recent success in delivering oligonucleotide-based therapeutics to hepatocytes in the liver. However, to date, attempts to target oligonucleotide-based formulations to extrahepatic cells have largely failed due to either a lack of efficacy, toxicity, or a combination of both.

[0011] Despite some progress in this field, there remains a need for improved delivery mechanisms to facilitate the delivery of therapeutics, including oligonucleotides and oligonucleotide-based drug formulations, in vivo. Additionally, there is a need for potent and selective inhibitors of HIF-2α. Summary of the Invention

[0012] Disclosed herein are RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents, that can selectively and efficiently inhibit the expression of the HIF-2α (EPAS1) gene. Further disclosed herein are compositions comprising an RNAi agent for inhibiting the expression of HIF-2α, wherein the HIF-2α RNAi agent is linked to at least one targeting ligand having affinity for a cellular receptor present on a target cell, and optionally, at least one pharmacokinetic (PK) enhancer. The HIF-2α RNAi agents disclosed herein can selectively and efficiently reduce or inhibit the expression of the HIF-2α (EPAS1) gene in a subject, e.g., a human or animal subject.

[0013] In general, the disclosure features HIF-2α gene-specific RNAi agents, compositions including HIF-2α RNAi agents, and methods of inhibiting expression of the HIF-2α RNAi (EPAS1) gene in vivo and / or in vitro using HIF-2α RNAi agents and compositions, including the HIF-2α RNAi agents described herein.

[0014] The described HIF-2α RNAi agents can be used in methods for treating (including preventative and prophylactic treatment) conditions and diseases that may be at least partially mediated by reduced HIF-2α expression, including carcinomas such as clear cell renal cell carcinoma (ccRCC). The HIF-2α RNAi agents disclosed herein can selectively reduce HIF-2α gene expression in cells of a subject. The methods disclosed herein include administering one or more HIF-2α RNAi agents to a subject, e.g., a human or animal subject, using any suitable method known in the art, such as intravenous infusion, intravenous injection, or subcutaneous injection.

[0015] In one embodiment, the disclosure features an RNAi agent for inhibiting expression of the human HIF-2α (EPAS1) gene, wherein the RNAi agent comprises a sense strand and an antisense strand. The HIF-2α RNAi agent can be further linked or conjugated to one or more target ligands and / or one or more PK enhancers.

[0016] Also described herein are pharmaceutical compositions comprising an RNAi agent capable of inhibiting expression of the HIF-2α (EPAS1) gene, wherein the composition further comprises at least one pharmaceutically acceptable excipient. The pharmaceutical compositions described herein, comprising one or more of the disclosed HIF-2α RNAi agents, can selectively and efficiently reduce or inhibit expression of the HIF-2α gene in vivo. Compositions comprising one or more HIF-2α RNAi agents can be administered to a subject, such as a human or animal subject, for treatment (including prophylactic treatment or suppression) of conditions and diseases that may be at least partially mediated by reduced HIF-2α expression, including carcinomas such as ccRCC.

[0017] One embodiment described herein is an RNAi agent for inhibiting expression of the HIF-2α (EPAS1) gene, comprising: (i) an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 3; (ii) a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; (iii) one or more targeting ligands.

[0018] In another embodiment, RNAi agents capable of inhibiting expression of the HIF-2α (EPAS1) gene are described, including: (i) an antisense strand of 18 to 49 nucleotides in length that is at least partially complementary to the HIF-2α (EPAS1) gene (SEQ ID NO: 1); (ii) a sense strand that is at least partially complementary to the antisense strand; (iii) a targeting ligand linked to the sense strand; and (iv) PK enhancer bound to the sense strand.

[0019] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising a nucleotide sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUUCAUGAAAUCGUUACGUUG (SEQ ID NO: 827). In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UUUCAUGAAAUCGUUACGUUG (SEQ ID NO: 827), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUUCAUGAAAUCGUUACGUUG (SEQ ID NO: 827), wherein SEQ ID NO: 827 is located at positions 1-21 (5'→3') of the antisense strand.

[0020] In some embodiments, the HIF-2α RNAi agents disclosed herein comprise an antisense strand (SEQ ID NO: 30) consisting essentially of or comprising a modified nucleotide sequence (5'→3') that differs by no more than one nucleotide, where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As those skilled in the art will clearly understand, the inclusion of phosphorothioate linkages, as shown in the modified nucleotide sequences disclosed herein, replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 7A-7G, which show all internucleoside linkages). In certain embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of or comprising the nucleotide sequence (5'→3')usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0021] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises a HIF-2α RNAi agent that consists of, or essentially comprises, a modified nucleotide sequence that differs by no more than one nucleotide (5'→3') from the nucleotide sequence (5'→3') asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO: 90), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In certain embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of or comprising the nucleotide sequence (5'→3')asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO: 90), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0022] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In certain embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of or comprising the nucleotide sequence (5'→3')usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0023] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising zero or one nucleobase sequence that differs from the nucleotide sequence (5'→3')ACAUAGUACAUAGAGAAUGUG (SEQ ID NO: 883). In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')ACAUAGUACAUAGAGAAUGUG (SEQ ID NO: 883), wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence (5'→3') that differs from the nucleotide sequence (5'→3')ACAUAGUACAUAGAGAAUGUG (SEQ ID NO: 883), wherein SEQ ID NO: 883 is located at positions 1-21 (5'→3') of the antisense strand.

[0024] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising zero or one nucleobase sequence that differs from the nucleotide sequence (5'→3')UGUUAGUAUGGACAGUUGUGU (SEQ ID NO: 902). In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UGUUAGUAUGGACAGUUGUGU (SEQ ID NO: 902), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, consisting of, or comprising a nucleobase sequence (5'→3') that differs from the nucleotide sequence (5'→3')UGUUAGUAUGGACAGUUGUGU (SEQ ID NO: 902), wherein SEQ ID NO: 902 is located at positions 1-21 (5'→3') of the antisense strand.

[0025] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand that comprises, or essentially comprises, the modified nucleotide sequence (5'→3')usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30) and a sense strand that consists essentially of, or comprises, the modified nucleotide sequence (5'→3')Y-(NH-C6)scsaacguaaCfGfAfuuuZcaZugZaaZsa(invAb)(6-S)-X (SEQ ID NO: 761). wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); and u Z , a Z , g Z , and c Zrepresent uridine, adenosine, guanosine, and cytidine, respectively, having a pharmacological moiety (e.g., a targeting ligand, targeting group, and / or PK enhancer) attached to the 2' position of the nucleotide (the HIF-2α RNAi agents disclosed in the Examples herein were accomplished by coupling to a 2'-O-propargyl group), and (NH2-C6) are as defined in Table 7 and represent phosphorothioate linkages. In some embodiments, a HIF-2α RNAi agent disclosed herein consists essentially of, consists of, or comprises the modified nucleotide sequence (5'→3')usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30), or comprises, or comprises, an antisense strand of the modified nucleotide sequence (5'→3')Y-(NH-C6)scsaacguaaCfGfAfuuuZcaZugZaaZsa(invAb)(6-S)-X (SEQ ID NO: 761), wherein the sense strand further comprises reverse attenuating residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0026] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence consisting of the modified nucleotide sequence (5'→3')asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO: 90), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence consisting of the modified nucleotide sequence (5'→3')(Z)3-(TriAlkl4)s(invAb)scacauucuCfUfAfuguZacZuaZugZus(invAb)(C6-S)-X (SEQ ID NO: 806). where a, c, g, and u represent 2'-O-methyladenosine, guanosine, cytidine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, guanosine, and uridine, respectively; each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer), and u Z , a Z , g Z , and c Zrepresent uridine, adenosine, guanosine, and cytidine, respectively; the pharmacological moiety (e.g., targeting ligand, targeting group, and / or PK enhancer) is linked to the 2' position of the nucleotide (accomplished for the HIF-2α RNAi agents disclosed in the Examples herein by coupling to a 2'-O-propargyl group); (TriAlk14), (C6-S), and (invAb) are as defined in Table 7; and s represents a phosphorothioate linkage. In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO: 90), and a sense strand consisting of, or comprising the modified nucleotide sequence (5'→3')(Z)3-(TriAlkl4)s(invAb)scacauucuCfUfAfuguZacZuaZugZus(invAb)(C6-S)-X (SEQ ID NO: 806), wherein the sense strand further comprises inverted weak base residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0027] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113), and an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Zand a sense strand consisting essentially of, or comprising, as(invAb)(C6-S)-X (SEQ ID NO: 810), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer), and u Z , a Z , g Z , and c Z represent uridine, adenosine, guanosine, and cytidine, respectively; the pharmacological moiety (e.g., targeting ligand, targeting group, and / or PK enhancer) is linked to the 2' position of the nucleotide (accomplished for the HIF-2α RNAi agents disclosed in the Examples herein by coupling to a 2'-O-propargyl group); (TriAlk14), (C6-S), and (invAb) are as defined in Table 7; and s represents a phosphorothioate linkage. In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113), and an antisense strand consisting of the modified nucleotide sequence (5'→3')(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Z and a sense strand consisting essentially of, or comprising, as(invAb)(C6-S)-X (SEQ ID NO: 810), wherein the sense strand further comprises reverse attenuating residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0028] In some embodiments, the HIF-2α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30), and a Z cgua Z aCfGfAfuuuca Z ugaa Z sa(invAb)(6-S)-X (SEQ ID NO: 740), Y-(NH-C6)scsaac Z guaa Z CfGfAfuuu Z caug Z aasa(invAb)(6-S)-X (SEQ ID NO: 756), Y-(NH-C6)scsaacg Z uaa Z CfGfAfu Z uuc Z augaasa(invAb)(6-S)-X (SEQ ID NO: 757), and Y-(NH-C6)scsaacguaaCfGfAfuuucau Z g Z a Z a Z a(invAb)(6-S)-X (SEQ ID NO: 762), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer), and u Z , a Z , g Z , and c Zrepresent uridine, adenosine, guanosine, and cytidine, respectively; the pharmacological moiety (e.g., targeting ligand, targeting group, and / or PK enhancer) is linked to the 2' position of the nucleotide (accomplished for the HIF-2α RNAi agents disclosed in the Examples herein by coupling to a 2'-O-propargyl group); (TriAlkl4), (NH2-C6), (invAb), and (6-S) are as defined in Table 7; and s represents a phosphorothioate linkage. In some embodiments, the HIF-2α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30); and Y-(NH-C6)scsaa Z cgua Z aCfGfAfuuuca Z ugaa Z sa(invAb)(6-S)-X (SEQ ID NO: 740), Y-(NH-C6)scsaac Z guaa Z CfGfAfuuu Z caug Z aasa(invAb)(6-S)-X (SEQ ID NO: 756), Y-(NH-C6)scsaacg Z uaa Z CfGfAfu Z uuc Z augaasa(invAb)(6-S)-X (SEQ ID NO: 757), and Y-(NH-C6)scsaacguaaCfGfAfuuucau Z g Z a Z a Z The present invention relates to a method for detecting an integrin receptor comprising administering to a mammalian subject the invention further ...

[0029] In some embodiments, the HIF-2α RNAi agents disclosed herein have the following nucleotide sequence (5'→3'):

[0030] [ka]

[0031] and an antisense strand that consists essentially of, or comprises a nucleotide sequence that differs by zero or one nucleotide from one of: wherein the HIF-2α RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides on both the antisense and sense strands are modified nucleotides.

[0032] In some embodiments, the HIF-2α RNAi agents disclosed herein have the following nucleotide sequence (5'→3'):

[0033] [ka]

[0034] and an antisense strand that consists essentially of, or comprises a nucleotide sequence that differs by zero or one nucleotide from one of: wherein the HIF-2α RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides; and wherein the sense strand further comprises reverse attenuating residues at the 3'-terminus and at the 5'-terminus of the nucleotide sequence, and wherein the sense strand also comprises a targeting ligand covalently attached to the 5'-terminus, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0035] In some embodiments, the HIF-2α RNAi agents disclosed herein have the following nucleotide sequence (5'→3'):

[0036] [ka]

[0037] and an antisense strand that consists essentially of, or comprises a nucleotide sequence that differs by zero or one nucleotide from one of: wherein the HIF-2α RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides, the sense strand further comprises an inverted weak base residue at the 3'-terminus and at the 5'-terminus of the nucleotide sequence, and the sense strand comprises a targeting ligand covalently attached to the 5'-terminus, wherein the targeting ligand comprises a compound having affinity for an integrin receptor; and wherein each antisense strand sequence is located at positions 1-21 of the antisense strand.

[0038] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair:

[0039] [ka]

[0040] A nucleic acid sequence comprising, consisting essentially of, or comprising a nucleotide sequence that differs by zero or one nucleotide from one of:

[0041] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair:

[0042] [ka]

[0043] wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; and the sense strand further comprises an inverted weaker residue at the 3'-terminus and at the 5'-terminus of the nucleotide sequence, wherein the sense strand also comprises a targeting ligand covalently attached to the 5'-terminus, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0044] In some embodiments, the HIF-2α RNAi agents disclosed herein have the following nucleotide sequence (5'→3'):

[0045] [ka]

[0046] wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; which represent phosphorothioate linkages; and wherein the HIF-2α RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides in the sense strand are modified nucleotides.

[0047] In some embodiments, the HIF-2α RNAi agents disclosed herein have the following nucleotide sequence (5'→3'):

[0048] [ka]

[0049] and an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by zero or one nucleotide from one of: The HIF-2α RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides, wherein all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides, the sense strand further comprises an inverted weak base residue at the 3' end and at the 5' end of the nucleotide sequence, and the sense strand comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0050] In some embodiments, the HIF-2α RNAi agents disclosed herein comprise an antisense strand and the following nucleotide sequence pair (5'→3'):

[0051] [ka]

[0052] wherein a, c, g, and u represent 2'-methyladenosine, cytidine, Gf, and uridine, respectively; each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and / or PK enhancer); and u Z , a Z , g Z , and c Zrepresent uridine, adenosine, guanosine, and cytidine, respectively, bearing a pharmacological moiety (e.g., targeting ligand, targeting group), and / or nucleotides disclosed in the Examples herein (HIF-2α RNAi agents are completed by coupling to 2'-O-propargyl groups, (TriAlk14), (NH2-C6), (C6-S), and (invAb), as defined in Table 7, and which represent phosphorothioate linkages.

[0053] In some embodiments, the HIF-2α RNAi agents disclosed herein comprise an antisense strand and the following nucleotide sequence pair (5'→3'):

[0054] [ka]

[0055] wherein a, c, g, and u represent 2'-methyladenosine, cytidine, Gf, and uridine, respectively; each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); and u Z , a Z , g Z , and c Z represent uridine, adenosine, guanosine, and cytidine, respectively, bearing a pharmacological moiety (e.g., a targeting ligand, a targeting group). The (in this case, TriAlk14), (NH2-C6), (C6-S), (6-S), and (invAb) linked to the 2'-position of the nucleotide (HIF-2α RNAi enhancer) disclosed in the Examples herein represent phosphorothioate linkages, as defined in Table 7; the sense strand also includes a targeting ligand covalently linked to the 5'-end, where the targeting ligand includes a compound having affinity for an integrin receptor.

[0056] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises (5'→3'):

[0057] [ka]

[0058] and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of:

[0059] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises (5'→3'):

[0060] [ka]

[0061] and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all nucleotides are modified nucleotides.

[0062] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises (5'→3'):

[0063] [ka]

[0064] and an antisense strand comprising a nucleobase sequence that differs by zero or one nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO:5, SEQ ID NO:10, and SEQ ID NO:13 are located at nucleotide positions 1 to 19 (5' to 3') of the antisense strand, respectively.

[0065] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand and a sense strand, each of which has the sequence (5'→3'):

[0066] [ka]

[0067] The nucleotide sequence comprises a nucleobase sequence that differs by 0 or 1 nucleobase from a pair of nucleotide sequences selected from the group consisting of:

[0068] In some embodiments, a HIF-2α RNAi agent disclosed herein comprises an antisense strand and a sense strand, each of which has the sequence (5'→3'):

[0069] [ka]

[0070] and a nucleobase sequence that differs by zero or one nucleobase from a pair of nucleotide sequences selected from the group consisting of: wherein all or substantially all nucleotides are modified nucleotides.

[0071] In some embodiments, compositions described herein comprising one or more HIF-2α RNAi agents are packaged in kits, containers, packs, dispensers, pre-filled syringes, or vials. In certain embodiments, compositions described herein are administered parenterally, for example, by intravenous injection, intravenous infusion, or subcutaneous injection.

[0072] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are merely illustrative and not intended to be limiting.

[0073] Other objects, features, embodiments, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]

[0074] [Figure 1] Schematic diagram of a HIF-2α RNAi agent (shown as a double helix) linked to a tridentate targeting group containing three structural 2-avb3 targeting ligands, a C18-diacid PK enhancer, and four internal structural 2-abv3 targeting ligands linked to internal nucleotides on the HIF-2α RNAi agent. The chemical structures of the targeting ligands, targeting groups, and PK enhancers are shown. [Figure 2] Schematic diagram of a tridentate scaffold suitable for forming a tridentate targeting group containing a HIF-2α RNAi agent (shown as a double helix) linked to a PK enhancer at one end and three targeting ligands at the other end. The HIF-2α RNAi agent diagram further shows certain possible sites for linking targeting ligands (represented as "TL" in Figure 2) to the HIF-2α RNAi agent, which shows four targeting ligands linked to internal nucleotides. [Figure 3A] Representation of the chemical structure of the HIF-2α RNAi agent AD06299 in its free acid form, showing "TL" at the 2' position of nucleotides 2, 4, 6, and 8 (3'→5') of the sense strand, starting from the first nucleotide that base-pairs with the antisense strand (starting in Figure 3D and continuing in Figure 3C). The "TL" represents the binding site for the targeting ligand on these internal nucleotides. [Figure 3B] Representation of the chemical structure of the HIF-2α RNAi agent AD06299 in its free acid form, showing "TL" at the 2' position of nucleotides 2, 4, 6, and 8 (3'→5') of the sense strand, starting from the first nucleotide that base-pairs with the antisense strand (starting in Figure 3D and continuing in Figure 3C). The "TL" represents the binding site for the targeting ligand on these internal nucleotides. [Figure 3C]Representation of the chemical structure of the HIF-2α RNAi agent AD06299 in its free acid form, showing "TL" at the 2' position of nucleotides 2, 4, 6, and 8 (3'→5') of the sense strand, starting from the first nucleotide that base-pairs with the antisense strand (starting in Figure 3D and continuing in Figure 3C). The "TL" represents the binding site for the targeting ligand on these internal nucleotides. [Figure 3D] Representation of the chemical structure of the HIF-2α RNAi agent AD06299 in its free acid form, showing "TL" at the 2' position of nucleotides 2, 4, 6, and 8 (3'→5') of the sense strand, starting from the first nucleotide that base-pairs with the antisense strand (starting in Figure 3D and continuing in Figure 3C). The "TL" represents the binding site for the targeting ligand on these internal nucleotides. [Figure 4] Figures 4A and 4B show tumor sizes from tumor-bearing mice on day 36, following the study described in Example 16 herein. Figure 4A shows tumor sizes from the vehicle control group (D5W), with the left kidney representing the contralateral kidney and the right kidney representing the tumor-bearing kidney. Figure 4B shows tumor sizes from mice administered with an HIF-2α RNAi agent, with the left kidney representing the contralateral kidney and the right kidney representing the tumor-bearing kidney. [Figure 5] Images showing immunohistochemistry (IHC) staining of HIF-2α protein from tumor-bearing mice treated according to Example 16 herein. Figure 5A shows the solvent control group (D5W), with darkened spots indicating the presence of HIF-2α protein. Figure 5B shows the treatment group mice administered with a HIF-2α RNAi agent. [Figure 6] A bar graph reflecting tumor size in animals treated according to Example 19 herein. Animals were grouped based on tumor size measurements at day 34. [Figure 7A-7C]Schematic diagram showing the nucleotides, internucleoside linkages, and sense strand modifications of AD05971, AD06153, AD059630, AD05966, AD05967, AD05967, AD05967, and AD05972 synthesized on a solid support, where a, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; aAlk, cAlk, gAlk, and uAlk represent 2'-O-propargyl adenosine, cytidine, guanosine, and uridine, respectively; o represents a phosphorothioate linkage; and invAb, 6-SS-6, C6-SS-C6, NH2-C6, and TriAlk14 are all defined in Table 7. Further modifications to the RNAi agents of Figure 7 can be made after cleavage from the solid support, such as the addition of targeting ligands and PK enhancers. [Figures 7D-7G] Schematic diagram showing the nucleotide, intermolecular nucleoside linkages, and sense strand modifications of AD05971, AD06153, AD059630, AD05966, AD05967, AD05967, AD05967, and AD05972 synthesized on a solid support, where a, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; aAlk, cAlk, gAlk, and uAlk represent 2'-O-propargyl adenosine, cytidine, guanosine, and uridine, respectively; o represents a phosphorothioate linkage; invAb, 6-SS-6, C6-SS-C6, NH2-C6, and TriAlk14 are all defined in Table 7. Further modifications to the RNAi agents in Figure 7 can be made after cleavage from the solid support, such as the addition of targeting ligands and PK enhancers. DETAILED DESCRIPTION OF THE INVENTION

[0075] RNAi agents Described herein are RNAi agents that inhibit expression of the HIF-2α (EPAS1) gene (referred to herein as HIF-2α or HIF2α RNAi agents, or HIF-2α RNAi triggers). The HIF-2α RNAi agents described herein include a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense and antisense strands can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands can each be 16 to 49 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands can be the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In certain embodiments, both the sense and antisense strands are 21 nucleotides in length. In certain embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi agents described herein inhibit expression of one or more HIF-2α (EPAS1) genes in vivo or in vitro upon delivery to cells expressing HIF-2α.

[0076] One embodiment described herein is an RNAi agent for inhibiting expression of the HIF-2α (EPAS1) gene, comprising: (i) an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 3; (ii) a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; and (iii) one or more targeting ligands.

[0077] In another described embodiment, an RNAi agent capable of inhibiting expression of the HIF-2α (EPAS1) gene comprises: (i) an antisense strand of 18 to 49 nucleotides in length that is at least partially complementary to the HIF-2α (EPAS1) gene (SEQ ID NO: 1); (ii) a sense strand that is at least partially complementary to the antisense strand; (iii) a targeting ligand linked to the sense strand; and (iv) PK enhancer bound to the sense strand.

[0078] The antisense strand of the HIF-2α RNAi agent described herein comprises a core extension sequence (also referred to herein as a "core extension" or "core sequence") of the same number of nucleotides in the HIF-2α mRNA and at least 16 contiguous nucleotides that are at least 85% complementary to a core extension of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core extension is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core extension is 19 nucleotides in length. In some embodiments, the antisense strand core extension is 17 nucleotides in length.

[0079] The sense strand of a HIF-2α RNAi agent described herein comprises at least 16 contiguous nucleotides having at least 85% identity to a core extension of the same number of nucleotides in a HIF-2α mRNA. In certain embodiments, the sense strand core extension is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core extension is 17 nucleotides in length. In some embodiments, the sense strand core extension is 19 nucleotides in length.

[0080] In some embodiments, a HIF-2α RNAi agent disclosed herein targets a portion of the HIF-2α gene having the sequence of any of the sequences disclosed in Table 1.

[0081] Examples of HIF-2α RNAi agent antisense strands that may be included in the HIF-2α RNAi agents disclosed herein are shown in Table 3. Examples of HIF-2α RNAi agent antisense strands that may be included in the HIF-2α RNAi agents disclosed herein are provided in Tables 4, 4.1, 4.2, and 4.3. Examples of HIF-2α RNAi agent duplexes are shown in Table 5. Examples of 19-nucleotide core extension sequences that consist of or are included in the sense and antisense strands of the HIF-2α RNAi agents disclosed herein are shown in Table 2.

[0082] In some embodiments, a composition described herein is a composition comprising one or more HIF-2α RNAi agents having a double-stranded structure disclosed in Table 5.

[0083] In further embodiments, the HIF-2α RNAi agents disclosed herein can be delivered to target cells or tissues by covalently linking or conjugating the RNAi agent to one or more targeting ligands (e.g., ligands comprising compounds that have affinity for one or more cellular receptors located on cells that express HIF-2α). In certain embodiments, suitable targeting ligands comprise or consist of compounds that have affinity for one or more integrins (alternatively referred to as "integrin receptors").

[0084] HIF-2α RNAi agents can be delivered to cells, including cancer cells such as (ccRCC) cells, using any oligonucleotide delivery technique known in the art, including, but not limited to, linkage or conjugation to a targeting ligand, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugate™ (DPC).

[0085] In some embodiments, the HIF-2α RNAi agent is linked to a targeting ligand, which comprises a compound having affinity for one or more integrins (hereinafter referred to as an "integrin targeting ligand"). In some embodiments, a suitable targeting ligand for use with the HIF-2α RNAi agent disclosed herein has affinity for integrin α-v-β3, integrin α-v-β-5, or both of these integrins. The targeting ligands can be present individually (only one targeting compound present), or two or more targeting ligands can be linked via a branch point or scaffold to form a targeting group, with the branch point or scaffold of the targeting group then being linked solely to the RNAi agent. The targeting group can include two targeting ligands (referred to as "bidentate"), three targeting ligands ("tridentate"), four targeting ligands ("tetradentate"), or more than four targeting ligands. In certain embodiments, the HIF-2α RNAi agent is linked to two or more targeting ligands. In some embodiments, the HIF-2α RNAi agent is linked to 2 to 10 targeting ligands. In some embodiments, the HIF-2α RNAi agent is linked to 7 targeting ligands. In some embodiments, the HIF-2α RNAi agent is linked to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 targeting ligands.

[0086] In some embodiments, when a HIF-2α RNAi agent is conjugated to a targeting ligand comprising a compound having affinity for integrin α-v-β3 and / or integrin α-v-β-5, the RNAi agent is selectively internalized by ccRCC cells either via receptor-mediated endocytosis or other means. Examples of targeting ligands and targeting groups having affinity for integrin α-v-β3 and / or integrin α-v-β-5 useful for delivering HIF-2α RNAi agents are disclosed, for example, in PCT Patent Publication No. WO 2019 / 210200, which is incorporated herein by reference in its entirety.

[0087] The targeting ligand can be linked to one or more individual nucleotides of the sense strand and / or the antisense strand of the HIF-2α RNAi agent at the 3' or 5' end of the sense strand, the 3' or 5' end of the antisense strand, and / or internally. In some embodiments, the targeting ligand or targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting ligand or targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting ligand or targeting group is linked internally to a nucleotide of the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, the targeting ligand or targeting group is linked to the 5' end of the sense strand, and one or more targeting ligands are linked to one or more internal nucleotides of the sense strand. In some embodiments, the targeting ligand or targeting group is linked to the RNAi agent via a linker.

[0088] The targeting ligand or targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, or 4, 4.1, 4.2, or 4.3. The targeting ligand or targeting group can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, or 4, 4.1, 4.2, or 4.3.

[0089] In further embodiments, the HIF-2α RNAi agents disclosed herein may be linked or conjugated to one or more pharmacokinetic / pharmacodynamic (PK) enhancers. As used herein, a PK enhancer (also referred to as a "pharmacokinetic (PK) modifier") is a compound that, when linked to an oligonucleotide-based drug product or other therapeutic agent, can increase the in vivo systemic circulation time of the therapeutic agent relative to the free form of the therapeutic agent (increased half-life or plasma residence time) without interfering with delivery of the therapeutic agent to target cells or tissues by limiting renal excretion, or provide improved pharmacodynamics over a therapeutic agent without the PK enhancer. Exemplary PK enhancers suitable for use with HIF-2α RNAi agents are disclosed herein. Given a selected therapeutic agent, one of skill in the art could readily design relevant in vivo and / or in vitro tests to identify additional suitable PK enhancers. For example, studies comparing therapeutic effects with and without PK enhancers can be readily designed to quantify the amount of formulation remaining in a subject's systemic circulation at various time intervals, or to evaluate the efficacy, potency, or duration of the therapeutic effect at relevant time points. This is within the knowledge of one skilled in the art.

[0090] In another embodiment, the disclosure features a method for inhibiting expression of the HIF-2α (EPAS1) gene, the method including administering to a subject or a cell of a subject an amount of a HIF-2α RNAi agent capable of inhibiting expression of the HIF-2α gene, wherein the HIF-2α RNAi agent comprises a sense strand and an antisense strand, and wherein the antisense strand comprises any of the antisense strand nucleotide sequences in Table 2 or Table 3. In some embodiments, disclosed herein are methods for inhibiting expression of the HIF-2α gene, the methods including administering to a subject or a cell a HIF-2α RNAi agent capable of inhibiting expression of the HIF-2α gene, wherein the HIF-2α RNAi agent comprises a sense strand and an antisense strand, and the sense strand comprises any one of the sense strand nucleotide sequences in Table 2, 4, 4.1, 4.2, or 4.3. Also described herein are compositions for use in such methods.

[0091] Also disclosed herein are methods for in vivo delivery of a HIF-2α RNAi agent to cells expressing integrins (also referred to herein as "integrin receptors") in a subject, such as a mammal. In some embodiments, delivery of the HIF-2α RNAi agent to the desired cells is facilitated by linking the HIF-2 RNAi agent to one or more targeting ligands and / or one or more PK enhancers. Compositions for use in such methods are also described.

[0092] In further embodiments, the disclosure features methods of treating (including preventative or prophylactic treatment) a disease, condition, or symptom that may be mediated at least in part by decreased HIF-2α expression, including ccRCC, wherein the method comprises administering to a subject in need thereof a HIF-2α RNAi agent having an antisense strand comprising a sequence of any of the sequences in Tables 2 or 3. In some embodiments, the methods described herein are methods of treating (including preventative or prophylactic treatment) a disease, condition, or symptom that may be mediated at least in part by decreased HIF-2α expression, including ccRCC, wherein the method comprises administering to a subject in need thereof a HIF-2α RNAi agent having a sense strand comprising a sequence of any of the sequences in Tables 2, 4, 4.1, 4.2, or 4.3. Also described herein are compositions for use in such methods.

[0093] Also described are methods for treating a human subject having or at risk of developing a pathological condition (e.g., a condition or disease) mediated at least in part by HIF-2α gene expression, comprising administering a therapeutically effective amount of a HIF-2α RNAi agent and / or a composition containing a HIF-2α RNAi agent to the subject. Methods for treating a subject with a HIF-2α RNAi agent and / or a composition containing a HIF-2α RNAi agent can optionally be combined with one or more steps of administering one or more additional (e.g., second, third, etc.) therapeutic agents or therapies. The additional therapeutic agent can be another HIF-2α RNAi agent (e.g., a HIF-2α RNAi agent targeting a different sequence within the HIF-2α gene). The additional therapeutic agent can also be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0094] In further embodiments, the pharmaceutical compositions described herein comprise one or more of the described HIF-2α RNAi agents, optionally in combination with one or more additional (second, third, etc.) therapeutic agents. In some embodiments, pharmaceutical compositions comprising one or more of the described HIF-2α RNAi agents, optionally in combination with one or more additional (e.g., second, third, etc.) therapeutic agents, can be formulated in a pharmaceutically acceptable carrier or diluent. In certain embodiments, these compositions can be administered to a subject, such as a mammal. In some embodiments, the mammal is a human. In certain embodiments, any one or more additional therapeutic agents are pharmaceutical formulations indicated for the treatment of cancer, such as one or more carcinomas. The HIF-2α RNAi agent and the additional therapeutic agents can be administered in a single composition or can be administered separately. In some embodiments, the one or more additional therapeutic agents are administered separately in a separate dosage form from the RNAi agent (e.g., the HIF-2α RNAi agent is administered by intravenous infusion or injection, while the additional therapeutic agents involved in the therapeutic administration regimen are administered orally). In some embodiments, the described HIF-2α RNAi agent is administered to a subject in need thereof via intravenous infusion or injection, and one or more optional additional therapeutic agents are also administered by intravenous infusion, injection, or orally; together, the administration provides a treatment regimen for diseases and conditions that may be mediated by HIF-2α gene expression, such as ccRCC. In some embodiments, the HIF-2α RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated into a single composition for intravenous infusion or injection). The HIF-2α RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0095] In some embodiments, the methods disclosed herein are methods for inhibiting expression of the HIF-2α gene in a cell or a subject, the methods comprising administering to the cell or subject a HIF-2α RNAi agent having a sense strand comprising any of the sequences in Table 4, 4.1, 4.2 or 4.3, and an antisense strand comprising any of the sequences in Table 3.

[0096] In some embodiments, compositions for in vivo delivery of HIF-2α RNAi agents to ccRCC cells are described, the compositions comprising a HIF-2α RNAi agent conjugated or complexed to one or more targeting ligands. In certain embodiments, the targeting ligand comprises a compound having affinity for integrin α-v-β-3 and / or integrin α-v-β-5. In some embodiments, the HIF-2α RNAi agent conjugated or complexed to one or more targeting ligands is further conjugated or complexed to one or more PK enhancers.

[0097] In some embodiments, compositions disclosed herein are for delivering a HIF-2α RNAi agent to ccRCC cells in vivo, the composition comprising a HIF-2α RNAi agent bound or linked to one or more targeting ligands and / or targeting groups. In certain embodiments, the targeting ligands and / or targeting groups comprise compounds having affinity for one or more integrins. In some embodiments, compositions are described for delivering a HIF-2α RNAi agent to ccRCC cells in vivo, the composition comprising a HIF-2α RNAi agent linked to α-v-β-3 and / or α-v-β-5 integrin targeting ligands.

[0098] In some embodiments, a method disclosed herein is a method for inhibiting expression of the HIF-2α (EPAS1) gene in a cell, wherein the method comprises administering to the cell a HIF-2α RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a HIF-2α mRNA having a sequence in Table 1. In some embodiments, a method disclosed herein is a method for inhibiting expression of the HIF-2α gene in a cell, wherein the method comprises administering to the cell a HIF-2α RNAi agent comprising an antisense strand that comprises a sequence in any of Table 2 or Table 3, and a sense strand that comprises a sequence in Table 2 or any of Tables 4, 4.1, 4.2, or 4.3, wherein the HIF-2α RNAi agent is at least partially complementary to the antisense strand. In some embodiments, the methods disclosed herein are methods of inhibiting expression of the HIF-2α gene in a cell, wherein the method comprises administering a HIF-2α RNAi agent comprising a sense strand comprising a sequence of any of Tables 2 or 4, 4.1, 4.2 or 4.3, and an antisense strand comprising a sequence of any of the sequences of Tables 2 or 3 that is at least partially complementary to the sense strand.

[0099] In some embodiments, the compositions disclosed herein are compositions for inhibiting expression of the HIF-2α gene in a cell, wherein the method comprises administering a composition comprising a HIF-2α RNAi agent having a double-stranded duplex structure shown in Table 5.

[0100] The HIF-2α RNAi agent disclosed herein is designed to target a specific position on the HIF-2α (EPAS1) gene (SEQ ID NO: 1). As defined herein, the antisense strand sequence is designed to target the HIF-2α gene at a specific position on the gene when the 5'-terminal nucleobase of the antisense strand, when base-paired with the gene, aligns with a position 19 nucleotides downstream (towards the 3' end) from the position on the gene. For example, as shown in Tables 1 and 2 herein, the antisense strand sequence designed to target the HIF-2α gene at position 5033 requires that the 5'-terminal nucleobase of the antisense strand aligns with position 5051 of the HIF-2α (EPAS1) gene when base-paired with the gene.

[0101] As provided herein, a HIF-2α RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to a gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, or 100% complementarity) over a core stretch sequence of at least 16 contiguous nucleotides. For example, for a HIF-2α RNAi agent disclosed herein that is designed to target position 5033 of the HIF-2α gene, the 5'-terminal nucleobase of the antisense strand of the HIF-2α RNAi agent must be aligned with position 5051 of the gene, but the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 5051 of the HIF-2α gene, provided there is at least 85% complementarity of the antisense strand and the gene (e.g., at least 85, 86, 87, 88, 89, 91, 92, 94, 95, 96, 97, 98, 99, or 100% complementarity). In particular, as demonstrated by the examples disclosed herein, the specific site of binding of the gene by the antisense strand of the HIF-2α RNAi agent (e.g., whether the HIF-2α RNAi agent is designed to target the HIF-2α (EPAS1) gene at position 5033 or another position) is important to the level of inhibition achieved by the HIF-2α RNAi agent.

[0102] The described HIF-2α RNAi agents can mediate RNA interference to inhibit the expression of one or more genes required for the production of HIF-2α protein. The HIF-2α RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including ccRCC. Additionally, compositions for delivering HIF-2α RNAi agents to ccRCC cells in vivo are described.

[0103] Pharmaceutical compositions comprising one or more HIF-2α RNAi agents can be administered in many ways, depending on whether local or systemic treatment is desired.Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subcutaneous (e.g., via an implanted device), and intraparenchymal administration.In some embodiments, the pharmaceutical compositions described herein are administered by intravenous infusion or injection.

[0104] In some embodiments, the compositions described herein comprising one or more HIF-2α RNAi agents are packaged in kits, containers, packs, dispensers, pre-filled syringes, infusion bags, or vials. In some embodiments, the compositions described herein are administered parenterally.

[0105] Each HIF-2α RNAi agent comprises a sense strand and an antisense strand. The sense strand and antisense strand can each be 16-30 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 17-27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 17-21 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length. In certain embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0106] In some embodiments, the region of complete, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not complete, substantial, or partial complementarity).

[0107] The sense strand and antisense strand each contain a core extension (also referred to herein as a "core sequence" or "core extension sequence") that is 16 to 23 nucleotides in length. The antisense strand core extension is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., sometimes referred to as a target sequence) present in the HIF-2α (EPAS1) mRNA target. The sense strand core extension sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core extension sequence in the antisense strand; therefore, the sense strand core extension sequence is typically completely identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the HIF-2α mRNA target. The sense strand core extension sequence may be the same length as the corresponding antisense core sequence, or may be a different length. In certain embodiments, the antisense strand core extension sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core extension sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0108] Examples of nucleotide sequences used to form HIF-2α RNAi agents are shown in Tables 2, 3, and 4 (and 4.1, 4.2, and 4.3). Examples of RNAi agent duplexes comprising the sense and antisense strand sequences of Tables 2, 3, and 4 are shown in Table 5.

[0109] The sense and antisense strands of a HIF-2α RNAi agent anneal to form a duplex. The sense and antisense strands of a HIF-2α RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core extension sequence is at least 85% complementary or 100% complementary to the antisense core extension sequence. In some embodiments, the sense strand core stretch sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (e.g., the sense and antisense core stretch sequences of a HIF-2 alpha RNAi agent may have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% basepaired or 100% basepaired).

[0110] In some embodiments, the antisense strand of a HIF-2α RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a HIF-2α RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Tables 4, 4.1, 4.2, or 4.3.

[0111] The sense strand and / or antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3'-end, 5'-end, or both the 3'-end and 5'-end of the core extension sequence. If present, the additional nucleotides in the antisense strand may or may not be complementary to the corresponding sequence in the HIF-2α mRNA. If present, the additional nucleotides in the sense strand may or may not be identical to the corresponding sequence in the HIF-2α mRNA. If present, the additional nucleotides in the antisense strand may or may not be complementary to the corresponding additional nucleotides in the sense strand.

[0112] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core extension sequence and / or the antisense strand core extension sequence. The extension nucleotides on the sense strand may or may not be complementary to nucleotides in either the core extension sequence nucleotides or the extension nucleotides in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to nucleotides in either the core extension nucleotides or the extension nucleotides in the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent comprise 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand are base-paired with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand are not base-paired with one or more 5' extension nucleotides of the other strand. In some embodiments, an HIF-2α RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotides are unpaired and form an overhang. As used herein, an "overhang" refers to a stretch of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand that does not form part of the hybridizing or duplexed portion of an RNAi agent disclosed herein.

[0113] In some embodiments, the HIF-2α RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the HIF-2α RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises nucleotides that are complementary to the corresponding HIF-2α mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises nucleotides that are not complementary to the corresponding HIF-2α mRNA sequence.

[0114] In some embodiments, the 5'-end and / or 3'-end of the antisense strand can include an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1'-position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203, incorporated herein by reference.) In some embodiments, the abasic residue can be positioned within the nucleotide sequence. In some embodiments, Ab or Ab can be added to the 3'-end of the antisense strand. In some embodiments, the 5'-end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (Ab)). In some embodiments, UUAb, UAb, or Ab is added to the 3'-end of the sense strand. In some embodiments, abasic (deoxyribose) residues can be replaced with ribitol (abasic ribose) residues.

[0115] In some embodiments, the sense strand or antisense strand may include an "end cap," which, as used herein, refers to a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the strands of an RNAi agent disclosed herein, and in some instances can provide the RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, an inverted weak base residue (invAb) is added as an end cap (see Table 7). (See, e.g., F. Czaudema, Nucleic Acids Res., 2003, 31(11), 2705-16). End caps are commonly known in the art and include, for example, a terminal C3H7 group, C6H 13 group, or C 12 H 25 The end cap may comprise an inverted attenuating residue, as well as a carbon chain such as a base. In some embodiments, the end cap is present at either the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the sense strand. In some embodiments, the 3'-end of the sense strand may comprise an additional abasic residue or an inverted attenuating end cap.

[0116] In some embodiments, one or more inverted attenuating residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted weak base residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inversion relief residues or inversion relief sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the activity or other desired property of the RNAi agent can be enhanced by including one or more inverted attenuating residues or inverted attenuating sites at or near the end of the sense strand of the RNAi agent.

[0117] In some embodiments, one or more inverted attenuating residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted attenuating residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, inclusion of one or more inverted attenuating residues at or near the end of the sense strand of the RNAi agent can allow for enhanced activity or other desired properties of the RNAi agent. In some embodiments, inverted weak base (deoxyribose) residues can be replaced with inverted ribitol (abasic ribose) residues.

[0118] In some embodiments, the 3' end of the antisense strand core extension sequence or the 3' end of the antisense strand sequence may comprise an inverted weak base residue (invAb (see Table 7)).

[0119] In some embodiments, the HIF-2α RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the HIF-2α mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (listed from 5' to 3', respectively).

[0120] In some embodiments, the HIF-2α RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the HIF-2α mRNA sequence. In some embodiments, the sense strand 5' extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5' to 3'). The sense strand can have a 3' extension and / or a 5' extension.

[0121] Examples of sequences used to form HIF-2α RNAi agents are shown in Tables 2, 3, and 4, 4.1, 4.2, and 4.3. In some embodiments, the HIF-2α RNAi agent antisense strand comprises a sequence from any of the sequences in Table 2 or 3. In certain embodiments, the HIF-2α RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the HIF-2α RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2 or 3. In some embodiments, the HIF-2α RNAi agent sense strand comprises a sequence from any of the sequences in Table 2 or Table 4. In some embodiments, the HIF-2α RNAi agent sense strand comprises the sequence of nucleotides (5' end to 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of the sequences in any of Tables 2 or 4. In some embodiments, the HIF-2α RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Tables 4, 4.1, 4.2, or 4.3.

[0122] In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to an end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0123] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form unwrapped ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form fried ends. In certain embodiments, both ends of an RNAi agent form fried ends. In some embodiments, neither end of an RNAi agent is a fried end. As used herein, "unwrapped end" refers to an end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands from a pair are not complementary (form a non-complementary pair) (do not form an overhang). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides can be on the sense strand or the antisense strand, resulting in either a 3' or 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a missing end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a fly end and a 5' overhanging end, a fly end and a 3' overhanging end, a fly end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two fly ends, or two blunt ends. Typically, if an overhang is present, it is located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0124] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can increase the serum stability of these compounds while preserving the activity of the compounds in cells and can minimize the potential for activating interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.

[0125] In some embodiments, the HIF-2α RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the HIF-2α RNAi agent is prepared as a sodium salt. Such forms, as are known in the art, are within the scope of the invention disclosed herein.

[0126] definition As used herein, the terms "oligonucleotide" and "polynucleotide" each refer to a polymer of linked nucleosides, which may or may not be independently modified.

[0127] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent may act through an RNA interference mechanism (e.g., by inducing RNA interference through interaction with the RNA interference pathway apparatus (RNA-induced silencing complex or RISC) of mammalian cells), or any alternative mechanism or pathway. While an RNAi agent, as used herein, primarily acts through an RNA interference mechanism, the disclosed RNAi agents are not considered to be bound to or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, short (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the target mRNA (HIF-2α mRNA). The RNAi agent can contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0128] As used herein, the terms "silence," "reduce," "suppression," "downregulation," or "knockdown," when referring to the expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene, or the level of polypeptide, protein, or protein subunit translated from mRNA, in a cell, tissue, organ, or subject in which the gene is transcribed, is decreased when treated with an RNAi agent described herein, compared to a second cell, group of cells, tissue, organ, or subject that is not so treated or is not so treated.

[0129] As used herein, the terms "sequence" and "nucleotide sequence" mean the sequence or order of nucleic acid bases or nucleotides, written as a sequence of letters using standard nomenclature.

[0130] As used herein, a "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0131] As used herein, and unless otherwise indicated, when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a target mRNA) with respect to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide), the term "complementary" means that an oligonucleotide or polynucleotide comprising the first nucleotide sequence hybridizes (forms base-pair hydrogen bonds under physiological conditions in a mammal (or similar conditions in vitro)) and forms a duplex or double-helix structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under specific standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0132] As used herein, "fully complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0133] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 70% of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide, although not all of the bases. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0134] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85% of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide, but not all of them. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0135] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of HIF-2α (EPAS1) mRNA.

[0136] As used herein, the term "substantially identical" or "substantially identical" as applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleobase occurs to generate the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to generate the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0137] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief or alleviation from the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include preventative treatment, management, prophylactic therapy, and / or suppression or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0138] As used herein, when referring to an RNAi agent, the phrase "introducing into a cell" refers to functionally delivering the RNAi agent into a cell. The term "functional delivery" refers to delivering the RNAi agent into a cell in a manner that allows the RNAi agent to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0139] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers," stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers," or optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0140] As used herein, for each structure in which a chiral center exists, unless specifically identified in the structure as having a particular configuration, thus giving rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein includes all such possible isomers, including optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0141] When used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not recited in the claim. When used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to particular materials or steps and to those that do not materially affect the basic and novel characteristics of the claimed invention.

[0142] Those skilled in the art will readily understand that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art.

[0143] As used herein, the term "linked" or "conjugated," when referring to a bond between two compounds or molecules, means that the two molecules are linked by a covalent bond or are linked through a non-covalent bond (e.g., a hydrogen bond or an ionic bond). In some examples, when the term "linked" or "conjugated" refers to a bond between two molecules through a non-covalent bond, the bond between the two different molecules is greater than 1×10 in a physiologically acceptable buffer (e.g., buffered saline). -4 Less than M (e.g., 1 × 10 -5 Less than M, 1 x 10 -6 Less than M or 1 x 10 -7 Unless otherwise stated, the terms "linked" and "conjugated" as used herein can refer to a linkage between a first compound and a second compound, with or without an intervening atom or atomic group.

[0144] As used herein, a linking group is one or more atoms that connect one molecule or a portion of a molecule to another molecule or a second portion of a molecule.Similarly, as used in the art, the term scaffold is often used interchangeably with linking group.A linking group can contain any number of atoms or functional groups.In some embodiments, a linking group does not promote any biological or pharmaceutical response, but simply serves to connect two biologically active molecules.

[0145] Unless otherwise noted, symbols used herein:

[0146] [ka]

[0147] The use of means that any group or groups can be linked to it according to the scope of the invention described herein.

[0148] As used herein, the term "including" is used herein to mean and is used herein to mean the phrase "including but not limited to."

[0149] When used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not recited in the claim. When used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to particular materials or steps and to those that do not materially affect the basic and novel characteristics of the claimed invention.

[0150] Modified Nucleotides In some embodiments, the HIF-2α RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleobases, modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me, 2'-fluoro nucleotides, 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring), 2'-O-methyl nucleotides, 2'-fluoro nucleotides (also referred to herein as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (also referred to as 2'-O-2-methoxyethyl) nucleotides, 2'-amino nucleotides, and not all positions in a compound need be uniformly modified. Conversely, two or more modifications can be incorporated into a single HIF-2α RNAi agent, or even into a single nucleotide thereof. The sense and antisense strands of the HIF-2α RNAi agent can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0151] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, and the like. uracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0152] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand, and the antisense strand is ribonucleotides (unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. In certain embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides.

[0153] As described elsewhere herein, in some embodiments, the HIF-2α RNAi agents disclosed herein can be linked to one or more targeting ligands and / or one or more PK enhancers on internal nucleotides of the sense or antisense strand of the RNAi agent to facilitate in vivo delivery of the HIF-2α RNAi agent. In some embodiments, the targeting ligand or PK enhancer is linked or conjugated to one or more internal nucleotides of the sense strand of the HIF-2α RNAi agent. For example, the targeting ligand can be linked to an individual nucleotide at the 2' position of the ribose ring, the 3' position of the ribose ring, the 1' position of the ribose ring, or the nucleobase of the nucleotide, the 4' position of the ribose ring, the 5' position of the nucleotide, or the oxygen atom of the ribose ring. The following description is based on the carbon numbering of the ribose nucleotide:

[0154] [ka]

[0155] In some embodiments, 2'-O-propargyl modified nucleotides are incorporated into the nucleotide sequence to facilitate linkage of one or more targeting ligands to internal nucleotides (see, e.g., Table 7 and Tables 4, 4.1, 4.2, and 4.3). After synthesis of each strand, the 2'-O-propargyl modified nucleotides can be linked or conjugated to the targeting ligand, targeting group, and / or PK enhancer at the 2' position using standard coupling techniques known in the art.

[0156] In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with at least one 2'-O-propargyl modified nucleotide in the sense strand to facilitate conjugation to a targeting ligand or targeting group. In some embodiments, the sense strand of the RNAi agent is synthesized to include at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more than ten 2'-O-propargyl modified nucleotides to facilitate conjugation to at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more than ten 2'-O-propargyl modified nucleotides. In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with one 2'-O-propargyl modified nucleotide in the sense strand. In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with 2'-O-propargyl modified nucleotides in the sense strand. In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with three 2'-O-propargyl modified nucleotides in the sense strand. In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with four 2'-O-propargyl modified nucleotides in the sense strand. In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with five 2'-O-propargyl modified nucleotides in the sense strand. In some embodiments, the HIF-2α RNAi agents disclosed herein can be synthesized with more than five 2'-O-propargyl modified nucleotides in the sense strand.

[0157] Modified internucleoside linkages In some embodiments, one or more nucleotides of a HIF-2α RNAi agent are linked by a non-standard bond or backbone (eg, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with opposite polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In certain embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH moieties.

[0158] In some embodiments, the sense strand of a HIF-2α RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a HIF-2α RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a HIF-2 alpha RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a HIF-2 alpha RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently include 1, 2, 3, or 4 phosphorothioate linkages.

[0159] In some embodiments, the sense strand of a HIF-2α RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least two phosphorothioate internucleotide linkages are located between nucleotides 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleotide linkage is located at the 5' end of the sense strand and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, two phosphorothioate internucleotide linkages are located at the 5' end of the sense strand and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate internucleotide linkages between nucleotides at both the 5' and 3' ends and an optional inverted base residue end cap. In some embodiments, a targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0160] In some embodiments, the HIF-2α RNAi agent antisense strand comprises four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In certain embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In certain embodiments, the HIF-2α RNAi agent comprises at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0161] In some embodiments, a HIF-2α RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In certain embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0162] HIF-2α RNAi agents In some embodiments, a HIF-2α RNAi agent disclosed herein targets the HIF-2α gene at or near the location of a HIF-2α gene sequence shown in Table 1. In some embodiments, the antisense strand of a HIF-2α RNAi agent disclosed herein comprises a core extension sequence that is fully, substantially, or at least partially complementary to a target HIF-2α 19-mer sequence disclosed in Table 1.

[0163] [Table 1]

[0164] In some embodiments, a HIF-2α RNAi agent comprises an antisense strand in which position 19 of the antisense strand (5'→3') can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a HIF-2α RNAi agent comprises an antisense strand in which position 1 of the antisense strand (5'→3') can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0165] In some embodiments, a HIF-2α RNAi agent comprises an antisense strand in which position 2 of the antisense strand (5'→3') can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an aHIF-2α RNAi agent comprises an antisense strand in which positions 2-18 (5'→3') of the antisense strand can base pair with the respective complementary bases located at positions 18-2 of a 19-mer target sequence disclosed in Table 1.

[0166] For the RNAi agents disclosed herein, the nucleotide at position 1 (5' to 3' end) of the antisense strand can be perfectly complementary to the HIF-2α gene or can be non-complementary to the HIF-2α gene. In some embodiments, the nucleotide at position 1 (5' to 3' end) of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' to 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0167] In some embodiments, the HIF-2α RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the HIF-2α RNAi sense strand comprises the sequence of nucleotides (5' to 3') 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4, 4.1, 4.2, or 4.3.

[0168] In some embodiments, the HIF-2α RNAi agent comprises (i) an antisense strand comprising the sequence of nucleotides 2-18 or 2-19 (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1-17 or 1-18 (5' end to 3' end) of any of the sense strand sequences in Table 2 or Table 4, 4.1, 4.2, or 4.3.

[0169] In some embodiments, the HIF-2α RNAi agent comprises a core 19-mer nucleotide sequence shown in Table 2 below.

[0170] [Table 2]

[0171] The sense and antisense strands of a HIF-2α RNAi agent comprising or consisting of a sequence in Table 2 can be modified or unmodified nucleotides. In some embodiments, a HIF-2α RNAi agent having sense and antisense strand sequences comprising or consisting of a sequence in Table 2 is all or substantially all modified nucleotides.

[0172] In some embodiments, the antisense strand of a HIF-2α RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a HIF-2α RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0173] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has the same nucleobase as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has a different nucleobase than the N nucleotide at the corresponding position on the other strand.

[0174] Certain modified HIF-2α RNAi agent antisense strands, and their underlying unmodified nucleobase sequences, are shown in Table 3. Certain modified HIF-2α RNAi agent sense strands, and their underlying unmodified nucleobase sequences, are shown in Table 4 (also reflected in 4.1, 4.2, and 4.3). In forming a HIF-2α RNAi agent, each nucleotide of the underlying base sequences listed in Tables 3 and 4, and Table 2 above, can be a modified nucleotide.

[0175] The HIF-2α RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4, 4.1, 4.2, or 4.3 can be hybridized with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity to a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0176] In some embodiments, the HIF-2α RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0177] In some embodiments, a HIF-2α RNAi agent comprises or consists of a duplex having a nucleobase sequence of a sense strand and an antisense strand of any of the sequences in Table 2, Table 3, or Table 4, 4.1, 4.2, or 4.3.

[0178] Examples of antisense strands containing modified nucleotides are shown in Table 3. Examples of sense strands containing modified nucleotides are shown in Table 4.

[0179] As used in Tables 3 and 4 and 4.1, 4.2, and 4.3, the following notations are used to denote modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3′-phosphate; U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is=2'-O-methylinosine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dA = 2'-deoxyadenosine-3'-phosphate dAs = 2'-deoxyadenosine-3'-phosphorothioate dC = 2'-deoxycytidine-3'-phosphate dCs = 2'-deoxycytidine-3'-phosphorothioate dG = 2'-deoxyguanosine-3'-phosphate dGs = 2'-deoxyguanosine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate dTs = 2'-deoxythymidine-3'-phosphorothioate dU = 2'-deoxyuridine-3'-phosphate dU = 2'-deoxyuridine-3'-phosphorothioate A UNA 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA 2',3'-Secocytidine-3'-phosphate C UNA s = 2',3'-secocytidine-3'-phosphorothioate G UNA 2',3'-seco-guanosine-3'-phosphate GUNA s=2',3'-seco-guanosine-3'-phosphorothioate U UNA 2',3'-seco-uridine-3'-phosphate U UNA s=2',3'-seco-uridine-3'-phosphorothioate aAlk = 2'-O-propargyl adenosine-3'-phosphate, see Table 7 aAlks = 2'-O-propargyl adenosine-3'-phosphorothioate, see Table 7 cAlk = 2'-O-propargylcytidine-3'-phosphate, see Table 7 cAlks = 2'-O-propargylcytidine-3'-phosphorothioate, see Table 7 gAlk = 2'-O-propargylguanosine-3'-phosphate, see Table 7 gAlks = 2'-O-propargylguanosine-3'-phosphorothioate, see Table 7 tAlk = 2'-O-propargyl-5-methyluridine-3'-phosphate, see Table 7 tAlks = 2'-O-propargyl-5-methyluridine-3'-phosphorothioate, see Table 7 uAlk = 2'-O-propargyluridine-3'-phosphate, see Table 7 uAlks = 2'-O-propargyluridine-3'-phosphorothioate, see Table 7 a 2N=See Table 7 a 2Ns=See Table 7 (invAb) = inverse basic deoxyribonucleotide, see Table 7 (invAb)s = reverse-basic deoxyribonucleotide-5'-phosphorothioates, see Table 7 s = phosphorothioate bond (C6-SS-Alk)=See Table 7 (C6-SS-C6)=See Table 7 (C3-SS-C3)=See Table 7 (6-SS-6)=See Table 7 (NH2-C6)=See Table 7 (C6-NH2)=See Table 7 (TriAlk#) = See Table 7 (TriAlk#)s=See Table 7

[0180] Those skilled in the art will readily understand that, unless otherwise indicated by the sequence (e.g., a phosphorothioate linkage "s"), nucleotide monomers, when present in an oligonucleotide, are linked to one another by a 5'-3'-phosphodiester bond. As those skilled in the art will clearly understand, the inclusion of a phosphorothioate linkage, as shown in the modified nucleotide sequences disclosed herein, replaces the phosphodiester linkage typically present in oligonucleotides. Furthermore, those skilled in the art will readily understand that the 3'-terminal nucleotide of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the 3' position of each given monomer in vitro, instead of a phosphate moiety. Furthermore, in the embodiments disclosed herein, when viewing each strand 5'→3', a reverse base pair is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the preceding monomer on each strand. Furthermore, as those skilled in the art will readily understand and appreciate, while the phosphorothioate chemical structures shown herein typically show the anion of the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., when the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless otherwise expressly indicated herein, such understanding of those skilled in the art will be used in describing the HIF-2α RNAi agents and compositions of HIF-2α RNAi agents disclosed herein.

[0181] Specific examples of linking groups for use with the HIF-2α RNAi agents disclosed herein are provided in Table 7, below. Specific examples of targeting ligands and / or targeting groups and PK enhancers that can be linked or attached to the HIF-2α RNAi agents disclosed herein are also disclosed herein. For example, in certain examples, PK-enhancing compounds are provided in Table 6, below. Additionally, in some embodiments, a PK enhancer can be positioned at the 3' end of the sense strand of the HIF-2α RNAi agent.

[0182] Linking groups include, but are not limited to: (NH2-C6), (C6-NH2), (C6-SS-C6), (6-SS-6), (TriAlk1), (TriAlk1)s, (TriAlk2), (TriAlk2)s, (TriAlk3), (TriAlk3)s, (TriAlk4), (TriAlk4)s, (TriAlk5), (TriAlk5)s, (TriAlk6), (Tri Alk6)s, (TriAlk7), (TriAlk7)s, (TriAlk8), (TriAlk8)s, (TriAlk9), (TriAlk9)s, (TriAlk10), (TriAlk10)s, (TriAlk11), (TriAlk11)s, (TriAlk12), (TriAlk12)s, (TriAlk13), (TriAlk13)s, (TriAlk14), or (TriAlk14)s. Each sense and / or antisense strand can have any targeting ligand or targeting group, linking group, and / or PK enhancer, as well as other targeting ligands / groups, other linking groups, and / or other PK enhancers conjugated to the 5' and / or 3' end of the sequence.

[0183] [Table 3-1]

[0184] [Table 3-2]

[0185] Table 3-3

[0186] Table 3-4

[0187] Table 4-1

[0188] Table 4-2

[0189] Table 4-3

[0190] Table 4-4

[0191] Table 4-5

[0192] Table 4-6

[0193] Table 4-7

[0194] Table 4-8

[0195] Table 4-9

[0196] [Table 4-10]

[0197] [Table 4-11]

[0198] [Table 4-12]

[0199] As shown in Table 4 above, many of the example HIF-2α nucleotide sequences are further shown to contain a reactive linking group at the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the nucleotide sequence of the sense strand. For example, some HIF-2α nucleotide sequences shown in Table 4 above have an (NH2-C6) linking group or a (TriAlk) linking group at the 5'-end of the nucleotide sequence. Similarly, some HIF-2α nucleotide sequences shown in Table 4 above have a (C6-SS-C6) or (6-SS-6) linking group at the 3'-end of the nucleotide sequence. Such reactive linking groups are positioned to facilitate the attachment of targeting ligands, targeting groups, and / or PK enhancers to the HIF-2α RNAi agents disclosed herein. Ligation or conjugation reactions are well known in the art and provide for the formation of a covalent bond between two molecules or reactants. Conjugation reactions suitable for use within the scope of the present invention include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, and click chemistry cycloaddition reactions.

[0200] In some embodiments, the targeting ligand can be synthesized as a tetrafluorophenyl (TFP) ester, which can be substituted with a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to a HIF-2α RNAi agent disclosed herein. In certain embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group, for example, via a click chemistry cycloaddition reaction.

[0201] Additionally, some of the nucleotide sequences are synthesized with a dT nucleotide at the 3' end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6), which in some embodiments can be used after cleavage from the resin to facilitate conjugation to additional components, such as a PK enhancer or one or more targeting ligands. Synthesis in this manner involves the dT bound to the resin, followed by coupling of the linker and the remaining nucleotides of the sense strand. As described herein, upon conjugation of the desired PK enhancer (or targeting ligand), the terminal dT is cleaved from the molecule. Table 4.1 below shows the nucleotide sequences identified in Table 4 above, but which do not include a 3'-terminal dT nucleotide.

[0202] Additionally, Table 4.2 below shows the nucleotide sequences identified in Table 4 above, but without the terminal linking groups present.

[0203] [Table 5-1]

[0204] [Table 5-2]

[0205] [Table 6-1]

[0206] Table 6-2

[0207] Table 6-3

[0208] Table 6-4

[0209] Table 6-5

[0210] Table 6-6

[0211] Table 6-7

[0212] Table 6-8

[0213] Table 6-9

[0214] Table 6-10

[0215] Table 6-11

[0216] [Table 6-12]

[0217] As discussed herein, in some embodiments, one or more targeting ligands and / or PK enhancers are linked or conjugated to the RNAi agent. In certain embodiments, the targeting ligand (or targeting group) and / or PK enhancer is linked to the 5' end of the sense strand, the 3' end of the sense strand, and / or to one or more internal nucleotides. Synthesis of the sense strand and / or antisense strand can be designed so that reactive groups are readily available to facilitate attachment to additional components, such as targeting ligands or PK enhancers. Table 4.3 below shows the sense strands of the HIF-2α RNAi agents disclosed in Table 4 after linking to one or more targeting ligands and / or PK enhancers (collectively, shown below as Z).

[0218] Table 4.3. HIF-2 alpha RNAi agent sense strand sequences showing location of targeting ligand and / or PK enhancer (Each X, Y, and Z is independently a pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); (Z)3 = three linked ligands (e.g., a triangular targeting group); uZ, aZ, gZ, and cZ represent uridine, adenosine, guanosine, and cytidine, respectively, with the pharmacological moiety (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) linked to the 2' position (in the case of HIF) of the nucleotide. Two alpha RNAi agents disclosed in the Examples herein were completed by coupling to a 2'-O-propargyl group.)

[0219] [Table 7-1]

[0220] [Table 7-2]

[0221] Table 7-3

[0222] Table 7-4

[0223] Table 7-5

[0224] Table 7-6

[0225] Table 7-7

[0226] Table 7-8

[0227] Table 7-9

[0228] Table 7-10

[0229] Table 7-11

[0230] The HIF-2α RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 (or 4.1, 4.2, or 4.3) can be hybridized with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity to a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0231] In some embodiments, the antisense strand of a HIF-2α RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of a HIF-2α RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.

[0232] In some embodiments, the HIF-2α RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In certain embodiments, the HIF-2α RNAi agent antisense strand comprises nucleotide sequence 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 (5' to 3') of any of the sequences in Table 2 or Table 3. In certain embodiments, the HIF-2α RNAi agent antisense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 3.

[0233] In some embodiments, the HIF-2α RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4 (or Tables 4.1, 4.2, or 4.3). In some embodiments, the HIF-2α RNAi agent sense strand comprises the sequence of nucleotides (5' end-3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24. In certain embodiments, the HIF-2α RNAi agent sense strand comprises or consists of the modified sequence of any one of the modified sequences of Table 4 (or Tables 4.1, 4.2, or 4.3).

[0234] For the HIF-2α RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the HIF-2α gene or can be non-complementary to the HIF-2α gene. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT (or modified versions thereof). In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0235] In some embodiments, the HIF-2α RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 2-18 or 2-19 of the antisense strand sequence of any of Table 2 or Table 3. In some embodiments, the HIF-2α RNAi sense strand comprises the sequence of nucleotides (5' to 3') 1-17 or 1-18 of the sense strand sequence of any of Table 2 or Table 4 (or Tables 4.1, 4.2, or 4.3).

[0236] In some embodiments, the HIF-2α RNAi agent comprises (i) an antisense strand comprising nucleotide sequence (5' to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising nucleotide sequence (5' to 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4 (or Tables 4.1, 4.2, or 4.3).

[0237] A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity to a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, a HIF-2α RNAi agent has a sense strand consisting of a modified version of any of the modified sequences in Table 4 (or Tables 4.1, 4.2, or 4.3), and an antisense strand consisting of a modified version of any of the modified sequences in Table 3. Some representative sequence pairs are illustrated by double ID numbers. Table 5 shows:

[0238] In some embodiments, the HIF-2α RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, the HIF-2α RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, the HIF-2α RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein, and a targeting ligand, targeting group, and / or linking group, wherein the targeting ligand, targeting group, and / or linking group is covalently bound (attached) to the sense or antisense strand. In some embodiments, the HIF-2α RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, the HIF-2α RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID numbers presented herein, and a targeting ligand, targeting group, and / or linking group, wherein the targeting ligand, targeting group, and / or linking group is covalently attached to the sense strand or the antisense strand.

[0239] In some embodiments, a HIF-2α RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of an antisense strand / sense strand duplex in either Table 2 or Table 5, and further comprises a targeting group. In some embodiments, a HIF-2α RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of an antisense strand / sense strand duplex in either Table 5, and further comprises an integrin receptor ligand targeting group.

[0240] In some embodiments, a HIF-2α RNAi agent comprises an antisense strand and any of the nucleotide strand / sense strand duplexes in Table 5, including (NH2-C6), (C6-NH2), (C6-SS-C6), (6-SS-6), (TriAlk1), (TriAlk1)s, (TriAlk2), (TriAlk2)s, (TriAlk3), (TriAlk3)s, (TriAlk4), (TriAlk4)s, (TriAlk5), (TriAlk5)s, (TriAlk6), (TriAlk6)s , (TriAlk7), (TriAlk7)s, (TriAlk8), (TriAlk8)s, (TriAlk9), (TriAlk9)s, (TriAlk10), (TriAlk10)s, (TriAlk11), (TriAlk11)s, (TriAlk12), (TriAlk12)s, (TriAlk13), (TriAlk13)s, (TriAlk14), or (TriAlk14)s.

[0241] In some embodiments, a HIF-2α RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of Table 3 or Table 4, 4.1, 4.2 or 4.3.

[0242] In some embodiments, a HIF-2α RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes in Table 5, and further comprises an integrin targeting group.

[0243] In some embodiments, the HIF-2α RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 5.

[0244] [Table 8-1]

[0245] [Table 8-2]

[0246] [Table 8-3]

[0247] [Table 8-4]

[0248] In some embodiments, the HIF-2α RNAi agents are prepared or provided as a salt, mixed salt, or free acid, either before or after being optionally bound or conjugated to one or more targeting ligands, targeting groups, and / or PK enhancers. The RNAi agents described herein inhibit or knock down expression of one or more HIF-2α genes in vivo and / or in vitro upon delivery to cells expressing the HIF-2α gene.

[0249] Targeting Ligands and Targeting Groups Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific (and in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have higher valency relative to the target to which they are directed. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In certain embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can serve as the linker. In certain embodiments, the targeting group comprises an integrin targeting ligand.

[0250] In some embodiments, the RNAi agents described herein are conjugated to a targeting group. In certain embodiments, the targeting ligand enhances the ability of the RNAi agent to bind to a specific cellular receptor on a cell of interest. In some embodiments, the targeting ligand conjugated to the RNAi agents described herein has affinity for an integrin receptor. In some embodiments, a suitable targeting ligand for use with the HIF-2α RNAi agents disclosed herein has affinity for integrin α-v-β3, integrin α-v-β-5, or both of these integrins.

[0251] In some embodiments, the HIF-2α RNAi agents disclosed herein have the formula:

[0252] [ka]

[0253] linked to one or more integrin targeting ligands, including compounds of the formula: X is -C(R 3 )2-, -NR 3 -,

[0254] [ka]

[0255] and; Y is a substituted alkylene when the alkylene chain has 1 to 8 carbon atoms; Z, O, NR 3 , or S; R 1 is an optionally substituted aryl, an optionally substituted heteroaryl, an optionally substituted heterocyclyl, an optionally substituted cycloalkyl, or R 1 comprises an RNAi agent; R 2 is H, optionally substituted alkyl, or R 2comprises an RNAi agent; R 3 each instance of R is independently selected from the group consisting of H and optionally substituted alkyl, or 3 comprises an RNAi agent; R 4 is H or optionally substituted alkyl; and Y, R 1 , R 2 , R 3 In any case of and R 4 At least one of the comprises an RNAi agent.

[0256] In some embodiments, a HIF-2α RNAi agent disclosed herein is linked to one or more integrin-targeting ligands comprising one of the following structures:

[0257] [Table 9-1]

[0258] [Table 9-2]

[0259] [Table 9-3]

[0260] [Table 9-4]

[0261] [Table 9-5]

[0262] [Table 9-6]

[0263] [Table 9-7]

[0264] [ka]

[0265] indicates the binding site for the HIF-2α RNAi agent.

[0266] In some embodiments, the targeting group is attached to the RNAi agent using "click" chemistry. In certain embodiments, the RNAi agent is functionalized with one or more alkyne-containing groups, and the targeting ligand contains an azide-containing group. Upon reaction, the azide and alkyne generate a triazole. An example reaction scheme is shown below.

[0267] [ka]

[0268] where TL comprises the targeting ligand and RNA comprises the RNAi agent.

[0269] A HIF-2α RNAi agent can comprise two or more targeting ligands. In some embodiments, a HIF-2α RNAi agent comprises 1 to 20 targeting ligands. In some embodiments, a HIF-2α RNAi agent comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 targeting ligands to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 targeting ligands.

[0270] In some embodiments, a HIF-2α RNAi agent comprises a targeting group comprising two or more targeting ligands. In certain embodiments, the targeting group may be conjugated at the 5' or 3' end of the sense strand of the HIF-2α RNAi agent. In certain embodiments, the targeting group may be attached to an internal nucleotide on the HIF-2 RNAi agent. In certain embodiments, the targeting group may consist of two targeting ligands linked together, referred to as a "bidentate" targeting group. In certain embodiments, the targeting group may consist of three targeting ligands linked together, referred to as a "tridentate" targeting group. In certain embodiments, the targeting group may consist of four targeting ligands linked together, referred to as a "tetradentate" targeting group.

[0271] In some embodiments, a HIF-2α RNAi agent can include both a targeting group conjugated to the 3'-end or 5'-end of the sense strand and a targeting ligand conjugated to an internal nucleotide. In certain embodiments, a tridentate targeting group is conjugated to the 5'-end of the sense strand of the HIF-2α RNAi agent, and at least one targeting ligand is conjugated to an internal nucleotide of the sense strand. In further embodiments, a tridentate targeting group is conjugated to the 5'-end of the sense strand of the HIF-2α RNAi agent, and four targeting ligands are conjugated to internal nucleotides of the sense strand. In some embodiments, the four targeting ligands are conjugated to the 2nd, 4th, 6th, and 8th nucleotide positions of the sense strand.

[0272] In some embodiments, the HIF-2α RNAi agent is linked to one or more targeting groups of the following formula:

[0273] [ka]

[0274] [ka]

[0275] indicates the point of attachment. In some embodiments, the point of attachment is at the 5' end of the sense strand of the HIF-2α RNAi agent.

[0276] Internally linked targeting ligands Some embodiments of the HIF-2α RNAi agents described herein include targeting ligands conjugated to internal nucleotides of the sense or antisense strand. In certain embodiments, up to 15 targeting ligands may be conjugated to internal nucleotides of the sense strand of the HIF-2α RNAi agent. In certain embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 targeting ligands may be conjugated to internal nucleotides of the sense strand of the HIF-2α RNAi agent. In certain embodiments, 1 to 5 (e.g., 1, 2, 3, 4, or 5) targeting ligands are conjugated to internal nucleotides of the sense strand of the HIF-2α RNAi agent. In certain embodiments, 3 to 4 targeting ligands are conjugated to internal nucleotides of the sense strand of the HIF-2α RNAi agent.

[0277] In some embodiments, the positioning of the internal targeting ligand can affect the potency or efficacy of the HIF-2α RNAi agent. In some embodiments of the HIF-2α RNAi agent, the targeting group is conjugated to the 5'-end of the sense strand, and at least 10 nucleotides are located between the tridentate targeting group located at the 5'-end of the sense strand and the next-closest targeting ligand on the sense strand. In some embodiments, at least 5 nucleotides are located between the tridentate targeting group located at the 5'-end of the sense strand and the next-closest targeting ligand on the sense strand.

[0278] In some embodiments in which two or more targeting ligands are conjugated to internal nucleotides located within the sense strand of a HIF-2α RNAi agent, there is a space of at least one nucleotide that is not conjugated to a targeting ligand located between two internal nucleotides that are conjugated to a targeting ligand. In some embodiments in which two or more targeting ligands are conjugated to the sense strand of a HIF-2α RNAi agent, at least two nucleotides that are not conjugated to a targeting ligand are positioned between two internal nucleotides that are conjugated to a targeting ligand.

[0279] In some embodiments, the targeting ligand is conjugated to 2, 4, and 6 nucleotides of the sense strand, numbered from 3' to 5', starting from the 3'-most nucleotide that base pairs with the 5'-terminal nucleotide on the antisense strand. In certain embodiments, the targeting ligand is conjugated to 2, 4, 6, and 8 nucleotides (3'→5') from the 3'-terminal nucleotide that base pairs with the 5'-terminal nucleotide on the antisense strand.

[0280] Pharmacokinetic enhancing drugs In some embodiments, a pharmacokinetic (PK) enhancer is linked to the HIF-2α RNAi agent disclosed herein to facilitate delivery of the RNAi agent to a desired cell or tissue. PK-enhancing compounds can be synthesized with reactive groups, such as maleimide or azide groups, readily present to facilitate attachment to one or more linkers on the HIF-2α RNAi agent. In certain embodiments, the PK enhancer can be synthesized as a maleimide and conjugated to the RNAi agent using the reactions described herein. Other conjugation reactions, such as "click" chemistry or amide conjugation, can also be used.

[0281] In some embodiments, PK enhancers may include molecules that are fatty acids, lipids, albumin binders, antibody binders, polyesters, polyacrylates, polyamino acids, and linear or branched polyethylene glycol (PEG) moieties having between about 20 and 1000 ethylene oxide (CH2-CH2-O) units.

[0282] In some embodiments, the aHIF-2 RNAi agent is linked to a PK enhancer that comprises a compound having a structure of the following formula: where Y is an optionally substituted saturated or unsaturated

[0283] [ka]

[0284] It is an aliphatic chain, and n is an integer of 5 to 25.

[0285] In some embodiments, the aHIF-2 RNAi agent is linked to a PK enhancer that comprises a compound having the following structure:

[0286] [ka]

[0287] In some embodiments, the aHIF-2 RNAi agent is linked to a PK enhancer that comprises a compound having the following structure:

[0288] [ka]

[0289] Table 6 below shows certain exemplary PK-enhancing compounds that can be used as starting materials for linking to the HIF-2α RNAi agents disclosed herein. The PK-enhancing compounds can be added to the HIF-2α RNAi agents using any method known in the art.

[0290] [Table 10-1]

[0291] [Table 10-2]

[0292] [Table 10-3]

[0293] [Table 10-4]

[0294] [Table 10-5]

[0295] In some embodiments, a HIF-2α RNAi agent can comprise one or more PK enhancers, hi certain embodiments, a HIF-2α RNAi agent comprises 1, 2, 3, 4, 5, 6, 7 or more PK enhancers.

[0296] The PK enhancer can be linked to the HIF-2α RNAi agent by any known method in the art.In some embodiments, the PK enhancer can contain a maleimide moiety and can react with an RNAi agent containing a disulfide bond to form an RNAi agent containing the PK enhancer.The disulfide can be reduced and added to the maleimide by Michael-addition reaction.An example of the reaction scheme is shown below.

[0297] [ka]

[0298] where PK comprises a PK enhancer, RNA comprises an RNAi agent, and R can be any suitable group known in the art. In some examples of the above reaction scheme, R is hexyl (CH 13 ) is an alkyl group such as

[0299] In some embodiments, the PK enhancer comprises an azide moiety and can be reacted with an alkyne-containing RNAi agent to form an RNAi agent comprising the PK enhancer. The pair can be reacted using a "click" reaction according to the general reaction scheme below.

[0300] [ka]

[0301] Here, the PK comprises a PK enhancer and the RNA comprises an RNAi agent.

[0302] In some embodiments, the PK enhancer can be conjugated to the 5'-end of the sense or antisense strand, the 3'-end of the sense or antisense strand, or an internal nucleotide of the HIF-2α RNAi agent. In some embodiments, the aHIF-2α RNAi agent is synthesized with a disulfide-containing moiety at the 3'-end of the sense strand, and the PK enhancer can be conjugated to the 3'-end of the sense strand using the general synthesis scheme described above. In certain embodiments, the HIF-2α RNAi agent is synthesized to include 2'-O-propargyl-modified nucleotides (e.g., see Table 7), and the PK enhancer can be conjugated to an internal nucleotide using the general synthesis scheme described above.

[0303] In some embodiments, after the PK enhancer is attached to the RNAi agent, the PK enhancer can have the formula:

[0304] [Table 11-1]

[0305] [Table 11-2]

[0306] [Table 11-3]

[0307] [Table 11-4]

[0308] [Table 11-5]

[0309] where

[0310] [ka]

[0311] indicates the binding site for the RNAi factor.

[0312] Linking Groups and Delivery Vehicles In some embodiments, the HIF-2α RNAi agent contains or is attached to one or more non-nucleotide groups, including, but not limited to, linking groups or delivery vehicles. The non-nucleotide groups can enhance targeting, delivery, or attachment of the RNAi agent. Non-limiting examples of linking groups are shown in Table 7. The non-nucleotide group can be covalently attached to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the HIF-2α RNAi agent comprises a non-nucleotide group attached to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is attached to the 5' end of the HIF-2α RNAi agent sense strand. The non-nucleotide group can be directly or indirectly attached to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is attached to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0313] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate, hi certain embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0314] The HIF-2α RNAi agents described herein can be synthesized to have reactive groups, such as amino groups (also referred to herein as amines), at the 5'- and / or 3'-ends, which can then be used to attach targeting moieties using methods typical in the art.

[0315] For example, in some embodiments, the HIF-2α RNAi agents disclosed herein are synthesized with an NH2-C6 group at the 5'-end of the sense strand of the RNAi agent. The terminal amino group can then be reacted to form a conjugate with, for example, a group comprising a compound having affinity for one or more integrins (integrin targeting ligands) or a PK enhancer. In some embodiments, the HIF-2α RNAi agents disclosed herein are synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent. The terminal alkyne groups can then be reacted to form a conjugate with, for example, a group comprising a targeting ligand.

[0316] In some embodiments, the targeting group comprises an integrin targeting ligand. In certain embodiments, the integrin targeting ligand comprises a compound having affinity for integrin αvβ3 and / or integrin αvβ5. The use of an integrin targeting ligand can facilitate cell-specific targeting to cells having the respective integrins on their respective surfaces, and binding of the integrin targeting ligand can facilitate entry of the HIF-2α RNAi agent to which it is bound into cells, such as ccRCC cells. The targeting ligand, targeting group, and / or PK enhancer can be attached to the 3' and / or 5' end of the HIF-2α RNAi agent and / or to an internal nucleotide of the HIF-2α RNAi agent using methods generally known in the art. Preparation of targeting ligands and targeting groups, such as integrin αvβ3 / αvβ5, is described, for example, in U.S. Provisional Patent Application No. 62 / 663,763, the entire contents of which are incorporated herein.

[0317] Embodiments of the present disclosure include pharmaceutical compositions for delivering a HIF-2α RNAi agent to ccRCC cells in vivo. Such pharmaceutical compositions can include a HIF-2α RNAi agent linked to a targeting group that includes, for example, an integrin targeting ligand having affinity for integrin anb3 and / or integrin αβ. In some embodiments, the targeting ligand includes a compound having affinity for integrin anb3 and / or integrin αβ.

[0318] In some embodiments, a HIF-2α RNAi agent is synthesized with a linking group, which can then facilitate covalent attachment of the HIF-2α RNAi agent to another type of delivery vehicle, such as a targeting ligand, targeting group, PK enhancer, or delivery polymer. The linking group can be attached to the 3'-end and / or 5'-end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5'-end or 3'-end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5'-end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, reactive groups such as primary amines and alkynes, alkyl groups, abasic / nucleotides, amino acids, trialkyne functional groups, ribitol, and / or PTG groups.

[0319] A linker or linking group is a bond between two atoms that connects one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting ligand, targeting group, PK enhancer, or delivery polymer) or segment of interest via one or more covalent bonds. Labile bonds include labile bonds. A bond can optionally contain a spacer that increases the distance between the two bonded atoms. A spacer can further add flexibility and / or length to the bond. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the specification.

[0320] In some embodiments, the targeting group is linked to the HIF-2α RNAi agent without using an additional linker. In some embodiments, the targeting group is designed with a linker that is easily presented to facilitate binding to the HIF-2α RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents can be linked to their respective targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0321] The nucleotide sequences of HIF-2α RNAi agents listed in Tables 2, 3, and 4 (or Tables 4.1, 4.2, or 4.3) may include 3' and / or 5' targeting groups, linking groups, pharmacokinetic enhancers, whether modified or not. Any of the HIF-2α RNAi agent sequences listed in Tables 3 and 4 or described herein that include a 3' or 5' targeting ligand, targeting group, PK enhancer, or linking group may instead include no 3' or 5' targeting ligand, targeting group, PK enhancer, a different 3' or 5' targeting ligand, targeting group, PK enhancer, or a different 3' or 5' targeting ligand, targeting group, PK enhancer, including, but not limited to, those listed in Tables 6 and 7. Any of the HIF-2α RNAi agent duplexes listed in Table 5, whether modified or not, can further include a targeting ligand, targeting group, linking group, or PK enhancer, including but not limited to those shown in Figures 6 and 7, where the targeting group or linking group can be attached to the 3' or 5' end of either the sense or antisense strand of the HIF-2α RNAi agent duplex.

[0322] In some embodiments, a linking group can be synthetically attached to the 5' or 3' end of the sense strand of an aHIF-2α RNAi agent described herein. In certain embodiments, a linking group is synthetically conjugated to the 5' end of the sense strand of an HIF-2α RNAi agent. In certain embodiments, the linking group attached to the HIF-2α RNAi agent can be a trialkyne linking group.

[0323] In some embodiments, the HIF-2α RNAi agent has the following formula:

[0324] [ka]

[0325] or a pharmaceutically acceptable salt thereof; L1 , L 2 and L 3 are each an independent linker comprising an optionally substituted alkylene; L 4 is a linker comprising an optionally substituted alkylene, an optionally substituted aryl, or an optionally substituted cycloalkyl; R 5 is H or optionally substituted alkyl; TL is a targeting ligand; and Y is O or S.

[0326] In other embodiments, the HIF-2α RNAi agent is linked to one or more tridentate targeting groups using a linker having the formula of any one of TriAlk1-14, as shown below in Table 7. Methods for synthesizing compounds of Formula II are described in PCT application PCT / US19 / 18232, entitled "Trialkyne Binders and Methods of Use."

[0327] Examples of specific modified nucleotides and linking groups are shown in Table 7.

[0328] [Table 12-1]

[0329] [Table 12-2]

[0330] [Table 12-3]

[0331] [Table 12-4]

[0332] [Table 12-5]

[0333] [Table 12-6]

[0334] [Table 12-7]

[0335] [Table 12-8]

[0336] [Table 12-9]

[0337] [Table 12-10]

[0338] [Table 12-11]

[0339] [Table 12-12]

[0340] [Table 12-13]

[0341] In some embodiments, the RNAi agent is TriAlk 14:

[0342] [ka]

[0343] Or TriAlk 14s:

[0344] [ka]

[0345] The TL comprises a targeting ligand that is the result of a "click" reaction with a (TriAlk 14) or (Trialk 14)s compound, and an azide-containing targeting ligand.

[0346] Alternatively, other linking groups known in the art may be used.

[0347] In some embodiments, in addition to or alternatively to linking a HIF-2α RNAi agent to one or more targeting ligands, targeting groups, and / or PK enhancers, the RNAi agent can be delivered to a cell or tissue using a delivery vehicle. A delivery vehicle is a compound that can improve delivery of an RNAi agent to a cell or tissue, and can include polymers such as, but not limited to, amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides, lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.

[0348] In some embodiments, RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO2000 / 053722, WO2008 / 022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, which are incorporated herein by reference).

[0349] Pharmaceutical Composition In some embodiments, the present disclosure provides pharmaceutical compositions comprising, consisting of, or consisting essentially of one or more of the HIF-2α RNAi agents disclosed herein.

[0350] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an active pharmaceutical ingredient (API) and, optionally, one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (vehicle) is a substance other than the active pharmaceutical ingredient (API, therapeutic formulation) that is intentionally included in a drug delivery system. An excipient does not, or is not intended to, exert a therapeutic effect at the intended dose. An excipient may a) aid in processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the active pharmaceutical ingredient; c) aid in product identification; and / or d) improve the overall safety, efficacy, or other characteristics of the delivery of the active pharmaceutical ingredient during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0351] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0352] The pharmaceutical compositions described herein may contain other additional ingredients commonly found in pharmaceutical compositions. In some embodiments, the additional ingredient is a pharmaceutically active substance. Pharmaceutically active substances include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.), small molecule drugs, antibodies, antibody fragments, aptamers, and / or vaccines.

[0353] Pharmaceutical compositions may also contain preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, odorants, salts for varying osmotic pressure, buffers, coating agents, or antioxidants. They may also contain other agents with known therapeutic benefits.

[0354] Pharmaceutical compositions can be administered in a number of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be by any method commonly known in the art, such as topical (e.g., via a transdermal patch), pulmonary (e.g., nebulizer, intratracheal, intranasal), epidermal, transdermal, oral, or parenteral (e.g., by inhalation or insufflation of powders or aerosols). Parenteral administration includes, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous (e.g., via an implantation device), intracranial, intraparenchymal, intrathecal, and intraventricular administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. Pharmaceutical compositions can be administered orally, for example, in the form of tablets, coated tablets, dragees, hard or soft gelatin capsules, solutions, emulsions, or suspensions. Administration can be rectally, for example, using suppositories; topically or transdermally, for example, using ointments, creams, gels, or solutions; or parenterally, for example, using injectable solutions.

[0355] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, the maintenance of the required particle size in the case of dispersions, and the use of surfactants. In many cases, it will be preferable to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

[0356] Sterile injectable solution can be prepared by mixing active compound with one or a combination of the above-listed ingredients in a suitable solvent as needed, and then filter sterilization.Generally, dispersion is prepared by incorporating active compound into a sterile vehicle that contains a basic dispersion medium and other ingredients required from the above-listed ingredients.For the preparation of sterile injectable solution, the preparation method includes vacuum drying and freeze-drying, which produces a powder of active ingredient and any additional desired ingredients from its previously sterile-filtered solution.

[0357] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of any of the ligands described herein, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present any of the ligands described herein for both intra-articular and intraocular administration.

[0358] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be clear to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, the method described in U.S. Patent No. 4,522,811.

[0359] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). As used herein, a "pharmacologically effective amount," a "therapeutically effective amount," or simply an "effective amount" refers to that amount of a pharmacologically active agent to produce a pharmacological, therapeutic, or prophylactic result.

[0360] A medium containing a HIF-2α RNAi agent is also an object of the present invention, and a method for producing such a medium comprises bringing one or more compounds containing a HIF-2α RNAi agent, and, if desired, one or more other substances with known therapeutic effects, into a pharmaceutically acceptable form.

[0361] The HIF-2α RNAi agents and pharmaceutical compositions comprising the HIF-2α RNAi agents disclosed herein can be packaged or packaged in kits, containers, packs, or dispensers. The HIF-2α RNAi agents and pharmaceutical compositions comprising the HIF-2α RNAi agents can be packaged in pre-filled syringes or vials.

[0362] Therapeutic methods and inhibition of expression The HIF-2α RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduced and / or inhibited expression of HIF-2α mRNA and / or HIF-2α (EPAS1) protein levels. Examples include subjects diagnosed with or suffering from symptoms associated with cancer, including renal cancer, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, Kaposi's sarcoma-associated herpesvirus, preeclampsia, inflammation, chronic inflammation, angiogenic diseases, and rheumatoid arthritis.

[0363] In some embodiments, a subject is administered a therapeutically effective amount of any one or more HIF-2α RNAi agents. Treatment of a subject can include therapeutic and / or prophylactic treatment. A subject is administered a therapeutically effective amount of any one or more HIF-2α RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein can be to a human or an animal.

[0364] The HIF-2α RNAi agents described herein can be used to treat at least one symptom in a subject having a HIF-2α-related disease or disorder or a disease or disorder mediated at least in part by HIF-2α gene expression. In some embodiments, the HIF-2α RNAi agents are used to treat or manage clinical symptoms in a subject having a disease or disorder that would benefit from, or be at least partially mediated by, a reduction in HIF-2α mRNA. The subject is administered a therapeutically effective amount of one or more HIF-2α RNAi agents or HIF-2α RNAi agent-containing compositions described herein. In some embodiments, the methods disclosed herein include administering a composition comprising a HIF-2α RNAi agent described herein to the subject to be treated. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described HIF-2α RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

[0365] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by HIF-2α gene expression in a patient in need thereof, wherein the method comprises administering to the patient any of the HIF-2α RNAi agents described herein.

[0366] In some embodiments, the gene expression level and / or mRNA level of the HIF-2α gene in a subject administered a described HIF-2α RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to before administration of the HIF-2α RNAi agent or relative to a subject not administered a HIF-2α RNAi agent. Gene expression level and / or mRNA level in a subject can be reduced in cells, cell populations, and / or tissues of the subject.

[0367] In some embodiments, HIF-2α protein levels in a subject administered a described HIF-2α RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to administration of the HIF-2α RNAi agent, or relative to a subject not administered the HIF-2α RNAi agent. Protein levels in a subject can be reduced in cells, cell populations, tissues, blood, and / or other fluids of the subject.

[0368] The reduction of HIF-2α mRNA levels and HIF-2α protein levels can be assessed by any method known in the art. As used herein, a reduction or decrease in HIF-2α mRNA levels and / or protein levels is collectively referred to herein as a reduction or decrease in HIF-2α or suppression or reduction of HIF-2α expression. The examples described herein illustrate known methods for assessing inhibition of HIF-2α gene expression.

[0369] In some embodiments, the HIF-2α RNAi agent can be used in the preparation of a pharmaceutical composition for use in treating a disease, disorder, or condition mediated at least in part by HIF-2α gene expression. In certain embodiments, the disease, disorder, or condition mediated at least in part by HIF-2α gene expression is cancer, renal cancer, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, multiple myeloma, ovarian cancer, metastasis, gingivitis, psoriasis, Kaposi's sarcoma-associated herpesvirus, preeclampsia, inflammation, chronic inflammation, neovascular disease, or rheumatoid arthritis.

[0370] In some embodiments, the method of treating a subject depends on the subject's body weight. In certain embodiments, the HIF-2α RNAi agent can be administered at a dose of about 3 mg / kg to about 80 mg / kg of the subject's body weight. In other embodiments, the HIF-2α RNAi agent can be administered at a dose of about 5 mg / kg to about 20 mg / kg of the subject's body weight.

[0371] In some embodiments, the HIF-2α RNAi agent can be administered in split doses, meaning that two doses are given to a subject within a short time period (e.g., less than 24 hours). In some embodiments, about half of the desired daily dose is administered in a first dose, and about half of the remaining desired daily dose is administered about 4 hours after the first dose.

[0372] In some embodiments, the HIF-2α RNAi agent can be administered weekly (once a week). In other embodiments, the HIF-2α RNAi agent can be administered biweekly (once every other week).

[0373] In some embodiments, the administered dose of the HIF-2α RNAi agent is a fixed dose of 225 mg administered once weekly. In some embodiments, the administered dose of the HIF-2α RNAi agent is a fixed dose of 525 mg administered once weekly. In some embodiments, the administered dose of the HIF-2α RNAi agent is a fixed dose of 1,050 mg administered once weekly. In some embodiments, the HIF-2α RNAi agent is administered by intravenous infusion.

[0374] In some embodiments, a HIF-2α RNAi agent or a composition containing a HIF-2α RNAi agent can be used to treat a disease, disorder, or condition mediated at least in part by HIF-2α (EPAS1) gene expression. In certain embodiments, the disease, disorder, or condition mediated at least in part by HIF-2α (EPAS1) gene expression is ccRCC.

[0375] Cells, tissues, and non-human organisms Contemplated herein are cells, tissues, and non-human organisms that contain at least one of the HIF-2α RNAi agents described herein. The cells, tissues, or non-human organisms are produced by delivering the HIF-2α RNAi agent to the cells, tissues, or non-human organisms by any means available in the art. In some embodiments, the cells are mammalian cells, including, but not limited to, human cells.

[0376] The above-described embodiments and items are illustrated in the following non-limiting examples. [Example]

[0377] The following examples are not limiting and are intended to illustrate certain embodiments disclosed herein.

[0378] Example 1. Synthesis of HIF-2α RNAi Agents and Compositions Containing HIF-2α RNAi Agents The following describes general procedures for the synthesis of certain HIF-2α RNAi agents and conjugates thereof, as exemplified in the non-limiting examples provided herein.

[0379] Synthesis of RNAi Agents. RNAi agents can be synthesized using methods commonly known in the art. For the synthesis of RNAi agents exemplified in the Examples described herein, the sense and antisense strands of the RNAi agents were synthesized on the solid phase used for oligonucleotide synthesis using phosphoramidite technology. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or Oligopilot 100 (GE Healthcare) were used. Synthesis was performed on solid supports made of controlled pore glass (CPG, 500A or 600A, obtained from Prime Synthesis, Aston, PA, USA) or polystyrene (obtained from Kinovate, Oceanside, CA, USA). All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA), ChemGenes (Wilmington, MA, USA), or Hongene Biotech (Morrisville, NC, USA). Specifically, the following 2'-O-methyl phosphoramidite was used: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxytrityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N 2The protecting groups used in the synthesis of 5'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite were the same as those used in the synthesis of 5'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The protecting groups used in the synthesis of 5'-O-methyl-guanosine ... The protecting groups used in the synthesis of 5'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite were the same as those used in the synthesis of 5'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The protecting groups used in the synthesis of 5'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite were the same as those used in the synthesis of 5'-O-methyl-guanosine-3'-O-(2-cyanoethyl- Abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes. The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N 6 -(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-secocytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4' 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-secoguanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-secouridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile or xanthan hydride (TCI America, Portland, OR, USA) in pyridine was employed.

[0380] TFA AminoLink phosphoramidite was commercially purchased (ThermoFisher) to incorporate the (NH2-C6) reactive group linker. The TFA AminoLink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). Trialkine-containing phosphoramidites were synthesized to incorporate the respective (TriAlk#) linkers. When used in connection with the RNAi agents presented in specific examples herein, trialkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM); all other amidites were dissolved in anhydrous acetonitrile (50 mM) with the addition of molecular sieves (3'A). 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F).

[0381] For some RNAi agents, a linker such as a C6-SS-C6 or 6-SS-6 group was introduced at the 3' end of the sense strand. Pre-loaded resins were commercially available with the respective linkers. Alternatively, for some sense strands, dT resin was used, and then the respective linker was added via standard phosphoramidite synthesis.

[0382] Cleavage and deprotection of support-bound oligomers. After completion of solid-phase synthesis, the dry solid support was treated with a 1:1 volume solution of 40 wt. 28–31% ammonium hydroxide solution (Aldrich) in water at 30 °C for 1.5 h, and the solid residue was reconstituted in water (see below).

[0383] Purification. The crude oligomer was purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A supplemented with 1.5 M sodium chloride. The UV trace at 260 nm was recorded. Appropriate fractions were then pooled on a size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G25 microparticles in a running buffer of 10 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile, or filtered water.

[0384] Annealing. RNAi agents were formed by combining equimolar RNA solutions (sense and antisense) in 1x PBS (phosphate-buffered saline, 1x, Coming, Cellgro) to mix complementary strands. A portion of the RNAi agent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the solution absorbance with a UV-Vis spectrometer in 1x PBS. The solution absorbance at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. The conversion factor used was 0.037 mg / (mL cm) or calculated from the experimentally determined extinction coefficient.

[0385] Synthesis of the binding agent TriAlk14 In some embodiments, a linking agent such as TriAlk14 can be attached to an RNAi agent in the form of a phosphoramidite by reacting a trialkyne-containing phosphoramidite, or by synthesizing an RNAi agent containing a reactive group such as a terminal amine and, after cleaving the RNAi agent from the resin, reacting the RNAi agent with a trialkyne moiety containing an activated ester. The following procedures provide methods for synthesizing the activated ester version of TriAlk14 (compound 22) or the phosphoramidite version of TriAlk14 (compound 14).

[0386] [ka]

[0387] A 3 L jacketed reactor was charged with 500 mL of DCM and 4 (75.0 g, 0.16 mol). The internal temperature of the reaction was cooled to 0 °C, and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol), while maintaining the internal temperature below 5 °C, followed by slow treatment with DIPEA (72.3 g, 0.56 mol). The internal temperature was maintained below 5 °C. After the reaction was complete, the mixture was warmed to 23 °C over 1 h and stirred for 3 h. A 10% kicker charge of all three reagents was added and stirred for an additional 3 h. The reaction was considered complete when less than 1% of the four components remained. The reaction mixture was washed with saturated ammonium chloride solution (2 × 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. The crude oil was carried on to the next step. 46 H 60 N4O 11 The calculated mass of [M+H] is 846.0.

[0388] [ka]

[0389] 121.2 g of crude oil containing 72 wt% compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while maintaining the internal temperature below 23 °C. Glutaric anhydride (12.8 g, 0.11 mol) was added to the solution, and the intermediate amine 7 was converted to compound 8 within 2 h. Upon completion, the DMF and TEA were removed under reduced pressure at 30 °C, yielding 100 g of crude oil. Due to the high solubility of compound 7 in water, aqueous workup was not possible, and chromatography was the only method for removing DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in three portions using a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-20% methanol / DCM over 30 min to give 42 g of compound 8 (54% yield over three steps). 36 H 55 N4O 12 The calculated mass of this compound is 736.4 m / z. [M+H] is 737.0.

[0390] [ka]

[0391] Compound 8 (42.0 g, 0.057 mol) was stripped with 10 volumes of acetonitrile to remove residual methanol from the chromatography solvent before use. The oil was redissolved in DMF (210 mL) and cooled to 0 °C. The solution was treated with 4-nitrophenol (8.7 g, 0.063 mol) followed by EDC-hydrochloride (12.0 g, 0.063 mol), which was found to be complete within 10 h. The solution was cooled to 0 °C, and 10 volumes of ethyl acetate, followed by 10 volumes of saturated ammonium chloride solution, were added, maintaining the internal temperature below 15 °C. The layers were separated, and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to an oil. The crude oil (55 g) was purified in three portions on a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-10% methanol / DCM over 30 min to give 22 g of pure 9 (compound 22) (50% yield). 42 H 59 N5O 14 The calculated mass of [M+H] is 858.0.

[0392] [ka]

[0393] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by HPLC Method 1 by observing the disappearance of compound 9 and was found to be complete in 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. This crude oil was purified on a Terezin ISCO Combi-flash® purification system using a 330 g silica column. 4-Nitrophenol was eluted with 100% ethyl acetate, and 10 was flushed from the column with 20% methanol / DCM to give a colorless oil (39 g, 81% yield). 42 H 69 N5O 12 The calculated mass of [M+H] is 837.0 m / z.

[0394] [ka]

[0395] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove residual methanol from the chromatography solvent, and then again with dry dichloromethane (KF < 60 ppm) to remove traces of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of dry dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was found to be complete within 3-6 h. The reaction mixture was cooled to 0°C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then warmed to ambient temperature for 1 minute and stirred at 20°C for an additional 3 minutes. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane was added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze any unreacted bisphosphonate reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08 g of compound 14, 94% by weight. 51 H 86 N7O 13 The calculated mass of P is 1035.6 m / z. [M+H] = 1036.

[0396] Post-synthesis conjugation of the trialkyne scaffold. A 5' or 3' amine-functionalized sense strand of an RNAi agent can be conjugated to the trialkyne scaffold before or after annealing. The attachment of the trialkyne scaffold to the annealed duplex is shown below: The amine-functionalized duplex was dissolved in 90% DMSO / 10% HO at ~50-70 mg / mL. 40 equivalents of triethylamine were added, followed by 3 equivalents of trialkyne-PNP. Once complete, the complex was precipitated twice in a 1x phosphate-buffered saline / acetonitrile solvent system (1:14 ratio) and dried.

[0397] Attachment of Targeting Ligands to HIF-2 RNAi Agents. One or more targeting ligands can be attached to the HIF-2 RNAi agents disclosed herein either before or after annealing, and before or after conjugation of a PK enhancer. Below, we describe a general conjugation process used to attach an integrin targeting ligand to an alkyne-functionalized linker (e.g., (TriAlk)) or a 2'-O-propargyl group on an internal nucleotide. This procedure describes the addition of three targeting ligands to a tridentate targeting group scaffold. The same procedure can be used to attach targeting ligands to internal nucleotides, although the number of targeting ligand equivalents can be adjusted in light of the number of targeting ligands being added: Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M Cu(II) sulfate pentahydrate (Cu(II)SO4·5HO), and a 2 M solution of sodium ascorbate were prepared in deionized water. A 75 mg / mL solution of the desired integrin ligand in DMSO was prepared. In the vial containing the sense strand (75 mg / mL in deionized water), the integrin ligand was added to the reaction (2 equivalents / alkyne) with stirring. Triethylamine (40 eq / sense strand) was added to the reaction vial. In a separate vial, 5 parts 0.5 M THPTA was mixed with 1 part 0.5 M Cu(II)SO4·5H2O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, the THPTA / Cu solution (0.5 equivalents Cu / alkyne) was added to the reaction vial. Immediately after, 2 M ascorbate (5 eq / Cu) was added to the reaction vial. Once the reaction was complete (typically within 0.5 hours), it was immediately purified by non-denaturing anion exchange chromatography. Unless otherwise specified, all constructs described in the following examples containing tridentate targeting groups have the structure TriAlk 14:

[0398] [ka]

[0399] TriAlk 14s:

[0400] [ka]

[0401] and a group having the formula: The TL comprises a targeting ligand;

[0402] [ka]

[0403] indicates the binding site for the RNAi factor.

[0404] Conjugation of PK enhancers to HIF-2 RNAi agents. One or more PK enhancers can be linked to the HIF-2α RNAi agents disclosed herein before or after annealing and before or after conjugation of one or more targeting ligands. The following describes a general conjugation process used to link PK enhancers to the constructs shown in the examples presented herein. The following describes a general process used to link a maleimide-functionalized PK enhancer to a (C6-SS-C6) or (6-SS-6) functionalized sense strand of a HIF-2α RNAi agent by dithiothreitol reduction of the disulfide followed by thiol-Michael addition of the respective PK enhancer: In a vial, the functionalized sense strand was dissolved at 75 mg / mL in 0.1 M Hepes pH 8.5 buffer, and 25 equivalents of dithiothreitol were added. Once the reaction was complete (typically within 0.5-1 h), the conjugate was precipitated three times in a 1x phosphate-buffered saline / acetonitrile solvent system (1:40 ratio) and dried. A 75 mg / mL solution of maleimide-functionalized PK enhancer in DMSO was then prepared. The disulfide-reduced (3'C6-SH, 5'HS-C6, or 3'6-SH functionalized) sense strand was dissolved in deionized water at 100 mg / mL, and 3 equivalents of maleimide-functionalized PK enhancer were added. Once the reaction was complete (typically within 1 h-3 h), the conjugate was precipitated in a 1x phosphate-buffered saline / acetonitrile solvent system (1:40 ratio) and dried.

[0405] Methods for producing targeting ligands Some of the abbreviations used in the following Experimental Details for the synthesis of the Examples are defined as follows: h or hr = hour; min = minute; mol = mole; mmol = mmol; M = mole; mM = micromole; g = gram; μg = microgram; rt or RT = room temperature; L = liter; mL = milliliter; wt = weight; EtO = diethyl ether; THF = tetrahydrofuran; DMSO = dimethyl sulfoxide; EtOAc = ethyl acetate; EtN or TEA = triethylamine; i-PrNEt or DIPEA or DIEA = diisopropylethylamine; CHCl or DCM = methylene chloride; CHCl = chloroform; CDCl = deuterated chloroform; CCl = carbon tetrachloride; MeOH = methanol; EtOH = ethanol; DMF = dimethylformamide; BOC = t-butoxycarbonyl; CBZ = benzyloxycarbonyl; TBS = t-butyldimethylsilyl; TBSCl or TBDMSCl = t-butyldichloromethane. Methylsilyl chloride; TFA = trifluoroacetic acid; DMAP = 4-dimethylaminopyridine; NaN = sodium azide; NaSO = sodium sulfate; NaHCO = sodium bicarbonate; NaOH = sodium hydroxide; NaSO = magnesium sulfate; KCO = potassium carbonate; KOH = potassium hydroxide; NH OH = ammonium hydroxide; NHCl = ammonium chloride; SiO = silica; Pd-C = palladium on carbon; HCl = hydrogen chloride or hydrochloric acid; NMM = N-methylmorpholine; H = hydrogen gas; KF = potassium fluoride; EDC-HCl = N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride; MTBE = methyl tert-butyl ether; MeOH = methanol; Ar = argon; N = nitrogen; SiO = silica; RT = retention time; PTSA = paratoluenesulfonic acid; PPTS = pyridinium paratoluenesulfonate.

[0406] Synthesis of Structure 1c ((S)-3-(6-((1-azido-15-oxo-3,6,9,12-tetraoxa-16-azanonadecan-19-yl)oxy)pyridin-3-yl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0407] [ka]

[0408] A mixture containing compound 1 (1.03 g, 8.23 ​​mmol), compound 2 (0.92 g, 14.8 mol), and PTSA hydrate (156 mg, 0.82 mmol) in benzene (25 mL) was refluxed overnight in a Dean-Stark apparatus. The next morning, the reaction mixture was poured into saturated sodium bicarbonate, followed by addition of ethyl acetate. The organic phase was separated, filtered over sodium sulfate, and concentrated to give compound 3 in 95% yield, which was subsequently used without further purification.

[0409] [ka]

[0410] To a solution containing compound 4 (5.39 g, 53.3 mmol) and 3 Å molecular sieves in DMF (100 mL) was added sodium hydride (60 wt%, 2.13 g, 53.3 mmol), and the reaction was stirred for 1 hour. Subsequently, a solution of compound 3 (7.52 g, 7.52 g) in DMF (20 mL) was added, and the suspension was heated at 80 °C overnight. Upon completion, the suspension was filtered through a cotton plug and concentrated under reduced pressure. The residue was partitioned between diethyl ether and water, and the organic phase was separated, filtered over sodium sulfate, and concentrated under reduced pressure. The residue was treated with 20 mL of 10% FLO in TFA and stirred for 30 minutes. Upon completion, the solution was cooled to 0 °C, and the pH was adjusted to 11 with 6 M NaOH, upon which the product precipitated as an oil. Compound 5 was extracted from the oily suspension three times with diethyl ether. The organic phases were combined, filtered over sodium sulfate, and concentrated. Compound 5 was then isolated in 26% yield by separation on silica eluting with a gradient of ethyl acetate in hexane.

[0411] [ka]

[0412] A mixture containing compound 5 (2.29 g, 9.94 mmol), compound 6 (4.82 g, 39.8 mmol), PPTS (125 mg, 0.50 mmol), magnesium sulfate (3 g, 24.9 mmol), copper sulfate (3.97 g, 24.9 mmol), and 3 Å molecular sieves in DCM (22 mL) was heated to reflux overnight. Upon completion, the mixture was filtered and concentrated under reduced pressure. Compound 7 was then isolated in 76% yield by separation on silica eluting with a gradient of ethyl acetate in hexanes.

[0413] [ka]

[0414] A flame-dried flask was charged with THF (40 mL) and diisopropylamine (2.29 g, 22.6 mmol). It was cooled to -20 °C, and n-BuLi (2.5 M, 8.64 mL, 21.6 mmol) was added via cannula. The solution was stirred at -20 °C for 10 min, then cooled to -78 °C, and compound 8 (2.02 mL, 20.6 mmol) was added dropwise with vigorous stirring. After the addition, the solution was stirred at -78 °C for 30 min, and then ClTi(iPrO)3 ​​(11.26 g, 43.2 mmol) as a solution in THF (10 mL) was added via an addition funnel with vigorous stirring over approximately 10 min. The reaction was stirred at -78 °C for 30 min, ultimately yielding compound 7 (2.29 g). (6.86 mmol) was added dropwise as a suspension in THF and stirred at -78 °C for 1.25 h until the reaction was complete. To the reaction at -78 °C was added saturated aqueous ammonium chloride solution. The reaction was then removed from the cooling system, and the aqueous phase was slowly thawed and quenched (the yellow-orange color disappeared). The mixture was partitioned between EtOAc and saturated aqueous ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted twice with EtOAc. The organic phases were combined, dried over brine, then dried over sodium sulfate, then filtered, and concentrated. The residue was purified on silica, eluting with a gradient of ethyl acetate in hexanes. After purification, compound 9 was obtained as a single diastereomer in 75% yield.

[0415] [ka]

[0416] Compound 9 (1.28 g, 3.21 mmol) in MeOH (3.2 mL) was treated with HCl in dioxane (4 M, 3.2 mL, 12.9 mmol) and stirred at room temperature for 30 minutes. After completion, the reaction mixture was diluted with water and washed with diethyl ether. The pH was then adjusted to 11 using 2N aqueous NaOH, and the product was extracted with ethyl acetate. The organic phase was dried over sodium sulfate, filtered, and concentrated to give compound 10 in 92% yield, which was then used without further purification.

[0417] [ka]

[0418] To a mixture of compound 10 (0.78 g, 2.67 mmol) and compound 11 (0.60 g, 3.46 mmol) in THF (6 mL) at 15 °C, STAB-H (1.29 g, 6.12 mmol) was added as a solid in portions. After removing the cooling, the mixture was stirred for approximately 2.5 h to completion. The reaction was quenched by the addition of saturated aqueous sodium bicarbonate solution to bring the pH to 9. The product was extracted three times with EtOAc, and the organic phases were combined, dried with brine, filtered over sodium sulfate, and concentrated. Compound 12 was isolated in 85% yield by separation on silica gel eluting with a gradient of ethyl acetate in hexanes.

[0419] [ka]

[0420] To DIPEA (7.53 mL, 53.75 mmol) in THF (35 mL), n-BuLi (2.5 M, 19.9 mL, 49.8 mmol) was added via oven-dried gas-tight syringe over 2 min at -10 °C. The mixture was stirred at -10 °C for 10 min, cooled to -60 °C, and a solution of dimethylphosphonate (6.42 g, 51.8 mmol) in THF (8 mL) was added dropwise over 5–10 min. After aging at -60 °C for approximately 1 h, compound 13 (7.37 g, 39.82 mmol) was added dropwise over 5 min at -60 °C as a solution in THF (15 mL). The reaction mixture was stirred at -60 °C for 1 h and then at -41 °C for approximately 1.5 h. The reaction was quenched by adding 2.6 equivalents of H2SO4 (2.0 M) and extracted three times with ethyl acetate (approximately 50 mL). The combined organic phases were dried with brine, filtered over sodium sulfate, and briefly concentrated to determine the crude weight and sample for NMR. Once the dry weight was determined, compound 14 was dissolved in MeOH for use in the next reaction without further purification. Calculated yield: 75.83%. Crude wt / wt% by NMR: 76.3%. 1HNMR: 400MHz CDCl3δ4.75(s, 1H), 3.81(s, 3H), 3.78(s, 3H), 3.10~3.14(m, 2H), 3.04~3.09(m, 2H), 2.68(t, 2H), 1.82-1.75(m, 2H), 1.44(s, 9H).

[0421] [ka]

[0422] To compound 14 (approximately 12 g crude from NMR, 9.33 g weight of 30.16 mmol) in MeOH (40 mL) was added a solution of NaOH (1.45 g, 36.2 mmol) in water (1.5 mL). The mixture was heated to 50 °C, and compound 15 (2.76 g, 22.62 mmol) was added. After stirring for 30 min, a second portion of compound 15 (736 mg, 6.03 mmol) was added, and the reaction mixture was stirred at 50 °C overnight. The reaction mixture was then concentrated to an oil, partitioned between 2 volumes of EtOAc and 1 volume of HO, and the organic phase was separated and washed with 1 volume of water. The aqueous washes were combined and back-extracted with EtOAc (2 x 1 vol). The combined organic phase was dried over sodium sulfate, filtered, and concentrated. The crude material was dried onto approximately 20 g of silica compound 16 and isolated in 69% yield by separation on silica eluting with a gradient of ethyl acetate in hexane containing 1% triethylamine. 1 H NMR:400MHz CDCl9.09(dd, 1H), 8.17(dd, 1H), 8.12(d, 1H), 7.46(dd, 1H), 7.41(d, 1H), 4.78(s, 1H), 3.24(q, 2H), 3.10(t,2H), 2.12(quin, 2H), 1.43(s,9H).

[0423] [ka]

[0424] A solution of compound 16 (5.98 g, 20.8 mmol) in EtOH (50 mL) was charged with palladium (10% on carbon, 2.22 g, 2.08 mmol) and hydrogen at 1 atmosphere. The reaction mixture was stirred at room temperature overnight. Upon completion, the reaction mixture was filtered over Celite® and concentrated. Compound 17 was isolated in 79% yield by separation on silica gel eluting with a gradient of ethyl acetate in hexane containing 1% triethylamine. 1 HNMR:400MHz CDCl3δ7.05(d, 1H), 6.34(d, 1H), 5.48(s, 1H), 4.81(s, 1H), 3.36~3.43(m, 2H), 3. 16(q, 2H), 2.68(t, 2H), 2.59(t, 2H), 1.90(dt, 2H), 1.83, (quin, 2H), 1.44(s, 9H).

[0425] [ka]

[0426] Compound 17 (4.81 g, 16.53 mmol) was dissolved in 6 M aqueous HCl (16.4 mL) and heated at 42 °C for 2 h. An additional portion of 6 M HCl (2.8 mL) was then added, and the reaction mixture was stirred for an additional 2 h. Sodium chloride was added to the reaction, followed by aqueous 2 N NaOH, and the product precipitated as an oil (pH > 12). The mixture was extracted three times with 2-butanol. The combined organic phases were dried over sodium sulfate, filtered, and concentrated. Compound 18 was obtained in 85% yield and was subsequently used without further purification. 1 HNMR:400MHz CDCl3δ7.06(d, 1H), 6.35(d, 1H), 4.83(s, 1H), 3.35~3.46(m, 2H), 2.75~2.67(m, 4H), 2.58(t, 2H), 1.88-1.95(m, 2H), 1.84-1.76(m, 4H).

[0427] [ka]

[0428] To a solution of triphosgene (85 mg, 0.28 mmol) in THF (0.9 mL) in a flame-dried flask at -10 °C, a solution of compound 18 (236 mg, 0.62 mmol) and TEA (0.134 mL, 0.96 mmol) in THF (0.5 mL) was added dropwise. The reaction mixture was allowed to warm to room temperature. After TLC indicated a complete reaction, additional TEA (0.134 mL) was added, followed by compound 12 (166 mg, 0.87 mmol) as a solid. The heterogeneous mixture was heated at 50 °C with vigorous stirring for 2 h. Upon completion, the reaction mixture was quenched with 1 volume of water and extracted three times with EtOAc. The combined organic phase was dried with brine, filtered over sodium sulfate, and concentrated. Compound 19 was obtained in an assumed 100% yield and was subsequently used without further purification.

[0429] [ka]

[0430] To crude compound 19 (assumed 400 mg, 0.62 mmol) dissolved in THF (37 mL) was added H2SO4 (2 M, 0.6 mL), and the mixture was stirred at room temperature overnight. The next morning, H2SO4 (0.65 equiv.) was added. After 4 h, the reaction was complete. The reaction mixture was diluted with ethyl acetate. The organic phase was separated, and the aqueous phase was re-extracted once with ethyl acetate. The combined organic phases were filtered over sodium sulfate and concentrated. Compound 20 was isolated in 75% yield by separation on silica eluting with a gradient of MeOH in DCM.

[0431] [ka]

[0432] A suspension of compound 20 (251 mg, 0.47 mmol) and Pd / C (10 wt%, 100 mg, 0.094 mmol) in ethanol (9 mL) was charged with 1 atmosphere of H2 and stirred at 35 °C overnight. Upon completion, the palladium was removed by filtration over Celite®. Compound 21 was purified by C elution with a gradient of acetonitrile in FLO containing 1% TFA. 18 It was isolated in 20% yield as the TFA salt by reverse phase HPLC using a 5u 19 x 250 mm BEH column (Waters Corp.).

[0433] [ka]

[0434] To a solution of compound 21 (61 mg, 0.097 mmol) in DCM (250 μL) was added TEA (8 μL, 0.24 mmol), followed by NHS-PEG4-N3 (41.4 mg, 0.11 mmol) as a solution in DCM (275 μL). The reaction mixture was stirred for 15 minutes and checked by LC-MS, which indicated the reaction was complete. All volatiles were removed and the residue was dissolved in EtOH (0.4 mL) and water (0.4 mL). LiOH (11.2 mg, 0.47 mmol) was added and the reaction mixture was heated at 40° C. for 2 hours. Upon completion, the reaction mixture was concentrated under reduced pressure. Compound 22 (structure 1c) was obtained by C elution with a gradient of acetonitrile in HO containing 1% TFA. 18 It was isolated in 42% yield by reverse phase HPLC using a 5u 19 x 250 mm BEH column (Waters Corp.).

[0435] Structure 2c ((S)-3-(4-(2-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0436] [ka]

[0437] To a solution of compound 23 (10 g, 43.4 mmol) in toluene (80 mL) was added compound 6 (21). 1 g, 0.17 mol, PPTS (0.55 g, 2.2 mmol), followed by acetic acid (1.24 mL, 21.7 mmol) were added. The reaction vessel was equipped with a Dean-Stark trap and then heated to reflux overnight. Upon completion, the reaction mixture was concentrated, dried over 60 grams of silica, and purified on SiO2 with a gradient of ethyl acetate in hexane to give compound 24 in 66% yield. NMR: 400 MHz CDCl3 δ 8.47 (s, 1H), 7.68 (d, 1H), 7.31-7.56 (m, 6H), 6.98-7.16 (m, 1H), 5.23 (s, 2H), 1.26 (s, 9H).

[0438] [ka]

[0439] A flame-dried flask was charged with THF (190 mL) and DIPEA (9.07 g, 89.7 mmol), cooled to −20° C., and then n-BuLi (2.5 M, 34.2 mL, 85.6 mmol) was added via cannula. The solution was stirred at −20° C. for 10 min, then cooled to −78° C., and compound 8 (8 mL, 81.5 mmol) was added dropwise with vigorous stirring. After addition, the mixture was stirred at −78° C. for 30 min, and then ClTi(iPrO) (44.6 g, 0.171 mol) as a solution in THF (40 mL) was added via an addition funnel over 10 min. The reaction was stirred at −78°C for 30 minutes, and finally, compound 24 (9.06 g, 27.2 mmol) was added dropwise as a suspension in THF (20 mL) and stirred at −78°C for 1.25 hours until the reaction was complete. To the reaction at −78°C, saturated aqueous ammonium chloride solution was added. The reaction was then removed from the cooling system, and the aqueous phase was slowly thawed and quenched (the yellow-orange color disappeared). The mixture was partitioned between EtOAc and saturated aqueous ammonium chloride solution. The organic phase was separated, and the aqueous phase was washed twice with EtOAc. The organic phases were combined, dried over brine, then dried over sodium sulfate, filtered, and concentrated. Compound 25 was obtained in 70% yield as a single diastereomer by separation on silica gel eluting with a gradient of ethyl acetate in hexanes. 1 HNMR:400MHz CDCl3δ7.31~7.48(m, 5H), 7.09(dd, 1H), 6.89~7.04(m, 2H), 5.13(s, 2H), 4.59~4.76(m, 2H), 4.13(q, 2H), 2.81(dd, 2H), 1.21~1.25(m, 12H).

[0440] [ka]

[0441] To compound 25 (8.07 g, 19.1 mmol) was added aqueous HCl (6 M, 20.7 mL, 0.124 mol), followed by MeOH (60 mL). THF was added until a homogeneous solution was obtained, and the reaction mixture was stirred at room temperature for 6 h. The reaction mixture was basified to pH 10 with 2 N aqueous NaOH and then extracted three times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate, and concentrated. Compound 26 was obtained in 95% yield and was subsequently used without further purification. 1 HNMR:400MHz CDCl3δ7.28~7.46(m, 6H), 7.18(d, 1H), 6.99(t, 1H), 5.11(s, 2H), 4.57(t, 1H), 4.09(q, 2H), 2.97~3.09(m, 1H), 2.81~2.93(m, 1H), 1.18(t, 3H).

[0442] [ka]

[0443] To a mixture of Compound 26 (5.76 g, 18.2 mmol) and Compound 27 (4.09 g, 23.6 mmol) in THF (40 mL) at 0 °C, STAB-H (8.85 g, 41.8 mmol) was added portionwise as a solid. After the final addition, the cooling was removed, and the mixture was stirred for approximately 2.5 h to completion. The reaction mixture was quenched by adding saturated aqueous sodium bicarbonate solution. The mixture was extracted three times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate, and concentrated. Compound 28 was isolated in 73% yield by separation on silica gel eluting with a gradient of ethyl acetate in hexanes. 1 HNMR:400MHz CDCl3δ7.30~7.49(m, 5H), 7.11(dd, 1H), 6.88~7.02(m, 2H), 5.13(s, 2H), 4.40(t, 1H), 4.10(q, 2H), 4.00(dd, 1H), 3.35(s, 3H), 3.31(s, 3H), 2.47~2.75(m, 4H), 1.20(t, 3H).

[0444] [ka]

[0445] To a solution of triphosgene (1.2 g, 4.04 mmol) in THF (24 mL) in a flame-dried flask at -10 °C was added a solution of compound 19 (3.64 g, 8.99 mmol) and TEA (1.94 mmol, 13.9 mmol) in THF (6 mL) dropwise. The reaction mixture was allowed to warm to room temperature. After TLC indicated a complete reaction, additional TEA (3.3 mL, 23.6 mmol) was added, followed by compound 28 (2.61 g, 13.7 mmol) as a solid. The heterogeneous mixture was heated at 50 °C with vigorous stirring for 2 h. Upon completion, the reaction mixture was quenched with 1 volume of water and extracted three times with EtOAc. The combined organic phase was dried with brine, filtered over sodium sulfate, and concentrated. Compound 29 was obtained in an assumed 100% yield and was used crude without further purification.

[0446] [ka]

[0447] Compound 29 (5.59 g, 8.97 mmol) dissolved in THF (37 mL) was added with water (0.8 mL) and H2SO4 (2 M, 8.07 mL, 16.2 mmol), and the reaction mixture was stirred at 28 °C overnight. The next morning, the pH of the mixture was adjusted to 9 with sodium bicarbonate and extracted three times with DCM. The combined organic phases were dried with brine, filtered over sodium sulfate, and concentrated. Compound 30 was isolated in 82% yield by separation on silica eluting with a gradient of MeOH in DCM containing 1% TEA.

[0448] [ka]

[0449] Compound 30 (4.13 g, 7.39 mmol) dissolved in EtOH (30 mL) was charged with Degussa® palladium (10 wt%, 3.15 g, 2.96 mmol) and hydrogen at 50 psi. The mixture was stirred at room temperature overnight. The next day, the reaction was 64% complete. The reaction mixture was filtered over Celite® and concentrated. The residue was dissolved in EtOH and charged with palladium (10 wt%, 1.57 g, 1.48 mmol) and hydrogen at 50 psi. After stirring for 48 h, the reaction mixture was heated to 30° C. and stirred for an additional 24 h. Upon completion, the suspension was filtered over Celite® and all volatiles were removed under reduced pressure. The residue was purified on silica eluting with a gradient of MeOH in DCM to give compound 31 in 72% yield. 1 HNMR:400MHz DMSO-d69.88(s, 1H), 7.02~7.14(m, 2H), 6.86~6.93(m, 2H), 6.50~6.76(m, 1H), 6.31(m, 1H), 6.31(d, 1H), 5.17(t, 1H), 4.00(q, 2H), 3.23~3.28(m, 4H), 2.79~3.18(m, 7H), 2.61(t, 2H), 2.41(t, 2H), 1.65~1.78(m, 4H), 1.09(t, 3H).

[0450] [ka]

[0451] To a solution of PPh3 (699 mg, 2.66 mmol) in THF (0.47 mL) at −10° C., the solution of DEAD was added dropwise. The mixture was warmed to room temperature and added to a neat mixture of compound 31 (600 mg, 1.33 mmol) and HO-PEG4-N3 (466 mg, 3.06 mmol) and stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified on silica gel eluting with a gradient of MeOH in DCM to give compound 32 in 50% yield. 1HNMR: 400MHz DMSO-d6δ7.10~7.19(m, 2H), 6.97~7.06(m, 2H), 6.18~6.31(m, 2H), 2.5(m, 1H), 4.13~4.16(m, 1H), 3.98~4.04(m, 2H), 3.71~3.80 (m, 3.52~3.61(m, H), 3.38~3.37(m, 5H), 3.10~3.25(m, 5H), 2.79~3.08( m, 5H), 2.59(t, 2H), 2.31~2.42(m, 2H), 1.65~1.75(m, 4H), 1.10(t, 3H).

[0452] [ka]

[0453] To compound 32 (826 mg, 1.23 mmol) was added EtOH (3 mL) and HO (3 mL), followed by LiOH (97 mg, 4.05 mmol). The mixture was stirred at 30 °C overnight. Upon completion, the mixture was neutralized to pH = 5 with 6 M aqueous HCl and concentrated. The residue was purified by reverse-phase HPLC using a Phenomenex Gemini C18, 50 × 250 mm, 10 pm column, eluting with a gradient of acetonitrile in water containing 0.1% to give compound 33 (structure 2c) in 81% yield. NMR:400MHzD2Oδ7.30(d, 1H), 7.01~7.19(m, 3H), 6.45(d, 1H), 5.24(t, 1H), 4.14~4.32(m, 2H), 3.84~3.92(m, 2H), 3.5 9~3.77(m, 10H), 3.14~3.45(m, 8H), .02~3.12(m, 1H), 2.97(d, 2H), 2.85(q, 1H), 2.50~2.72(m, 4H), 1.68~1.94(m, 4H).

[0454] Synthesis of Structure 2.1c (((S)-3-(4-(11-azidondecyl)oxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0455] [ka]

[0456] To a solution of PPh3 in THF, a solution of DEAD was added dropwise at room temperature. The mixture was treated with compound 31 and OH-(CH2) 11 The mixture was transferred to a vial containing a mixture of -N3 and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture and the crude was dissolved in EtOH. LiOH was added as a solution in H2O, and additional water / EtOH was added until the reaction mixture was homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reverse-phase HPLC (Phenomenex Gemini C18, 50 x 250 mm, 10 pm, acetonitrile / 0.1% TFA in water, gradient elution).

[0457] Synthesis of Structure 2.2c ((S)-3-(4-(2-(1-(6-azidohexanoyl)piperidin-4-yl)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0458] [ka]

[0459] Compound 35, dissolved in DCM at 0° C., was treated with EDTA and acetonitrile was added to aid solubility. After 5 min, TEA and compound 36 were added, the cooling was removed, and stirring was continued for 2 h. Upon completion, saturated ammonium chloride was added, and the organic phase was separated, filtered over sodium sulfate, and concentrated. The resulting crude material was then used without further purification.

[0460] [ka]

[0461] To a solution of PPh3 in THF, the solution of DEAD was added dropwise at room temperature with vigorous stirring. The mixture was transferred to a vial containing a mixture of compounds 31 and 37, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture, and the crude material was dissolved in EtOH. LiOH was added as a solution in HO, and additional water was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reverse-phase HPLC (Phenomenex Gemini C18, 50 x 250 mm, 10 pm, 0.1% TFA in acetonitrile / water, gradient elution) to give compound 38 (structure 2.2c).

[0462] Synthesis of Structure 2.3c (((S)-3-(4-(2-(1r,4S)-4-(5-azidopentanamido)cyclohexyl)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0463] [ka]

[0464] To a suspension of compound 35 in DCM at 0 °C, EDAC was added as a solution in DCM. After 5 min, the cooling was removed, and compound 39 was added, followed by TEA. The heterogeneous mixture was stirred overnight at room temperature. The next day, the reaction was diluted with DCM to dissolve the precipitate. The mixture was washed twice with 5% KHSO4 and once with brine. The organic phase was filtered over sodium sulfate and concentrated. The crude residue containing compound 40 was used without further purification.

[0465] [ka]

[0466] To a solution of PPh3 in THF, the solution of DEAD was added dropwise with vigorous stirring at room temperature. The mixture was transferred to a vial containing a mixture of 31 and 40, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture, and the crude material was dissolved in EtOH. LiOH was added as a solution in HO, and the reaction mixture was stirred at room temperature for 1.5 hours. After that, more water was added, and the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reverse-phase HPLC (Phenomenex Gemini C18, 50 x 250 mm, 10 pm, 0.1% TFA in acetonitrile / water, gradient elution) to give compound 41 (structure 2.3c).

[0467] Synthesis of Structure 2.4c (((S)-3-(4-(4-(5-azidopentanamido)phenetoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0468] [ka]

[0469] To a mixture of compound 35 and compound 42 in DCM, EEDQ was added, and the solution was stirred at room temperature overnight. The reaction mixture was then diluted with DCM and washed three times with 1 M HCl and once with brine. The organic phase was dried over sodium sulfate, filtered, and concentrated. Compound 43 was then used without further purification.

[0470] [ka]

[0471] To a solution of PPh3 in THF, the solution of DEAD was added dropwise with vigorous stirring at room temperature. The mixture was transferred to a vial containing a mixture of compounds 31 and 43, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture, and the crude material was dissolved in EtOH. LiOH was added as a solution in HO, and additional water was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reverse-phase HPLC (Phenomenex Gemini C18, 50 x 250 mm, 10 pm, 0.1% TFA in acetonitrile / water, gradient elution) to give compound 44 (structure 2.4c).

[0472] Synthesis of Structure 2.5c ((S)-3-(4-(4-((5-azidopentyl)oxy)phenethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0473] [ka]

[0474] To a solution of compound 45 and compound 46 in acetone was added potassium carbonate. The mixture was heated to 65°C in a sealed vial as a suspension with vigorous stirring overnight under N2 protection. The reaction was then filtered, concentrated, and purified on silica gel eluting with a gradient of ethyl acetate in hexane to give compound 47.

[0475] [ka]

[0476] Sodium azide was added to a solution of compound 47 in DMF, and the mixture was stirred overnight at 80 °C in a sealed vial under nitrogen protection. After completion, one volume of water was added, and the product was extracted with ethyl acetate. The separated organic phase was filtered over sodium sulfate and concentrated. Crude compound 48 was used without further purification.

[0477] [ka]

[0478] To a solution of PPh3 in THF, the solution of DEAD was added dropwise at room temperature with vigorous stirring. The mixture was transferred to a vial containing a mixture of compound 31 and compound 48, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture, and the crude material was dissolved in EtOH. LiOH was added as a solution in HO, and additional water was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reverse-phase HPLC (Phenomenex Gemini C18, 50 x 250 mm, 10 pm, 0.1% TFA in acetonitrile / water, gradient elution) to give compound 49 (structure 2.5c).

[0479] Synthesis of Structure 2.6c (((S)-3-(3-(3-(17-azido-3-oxo-6,9,12,15-tetraoxa-2-azaheptadecyl)-5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)-2-oxoimidazolidin-1-yl)-3-(3-fluoro-methoxyphenyl)propanoic acid)

[0480] [ka]

[0481] The solution of DEAD was added dropwise to a solution of PPh3 in THF at 0 °C. After complete addition, the mixture was transferred to a vial containing a pure mixture of compound 31 and MeOH. The vial was capped with N2 and stirred at room temperature overnight. Upon completion, all volatiles were removed and the resulting crude product was purified on silica gel eluting with a gradient of MeOH in DCM to give compound 50.

[0482] [ka]

[0483] Bromine was added to a solution of compound 50 in AcOH, and the mixture was stirred for 0.5 hours. Upon completion, the reaction was diluted with 5 volumes of ethyl acetate and 2.5 volumes of water. The aqueous layer was neutralized to pH 7 with saturated aqueous sodium bicarbonate, and the organic layer was separated. The aqueous layer was extracted twice more with ethyl acetate. The combined organic layers were dried over sodium sulfate, filtered, and concentrated. The resulting crude compound 51 was then used without further purification.

[0484] [ka]

[0485] A solution of compound 51, Pd(PPh3)4, and Zn(CN)2 in DMAC was degassed with nitrogen for 30 minutes, and the mixture was heated in a sealed vial at 128 °C overnight. Upon completion, the mixture was diluted with 5 volumes of EtOAc. The organic phase was separated and then washed twice with water and twice with brine. The organic phase was then filtered over sodium sulfate and concentrated. The residue was purified on silica eluting with 100% EtOAc to give compound 52.

[0486] [ka]

[0487] Ammonia was added to a solution of compound 52 in MeOH, followed by a slurry of Raney nickel that had been pre-washed three times with methanol. The Parr® flask was charged with hydrogen to 60 psi and stirred at room temperature for 16 hours. Upon completion, the suspension was filtered and concentrated. The resulting crude residue was redissolved in DMF. DIEA and NHS-PEG4-N3 were added, and the mixture was stirred for 1 hour. Upon completion, all volatiles were removed, and the crude residue was redissolved in a mixture of MeOH and THF. LiOH in HO was added, and the mixture was stirred at room temperature for 17 hours. Upon completion, the pH was adjusted to 3 with TFA, and the mixture was injected directly onto a semi-preparative reverse-phase HPLC (Phenomenex Gemini C18, 250 × 21.2 mm, pm, 0.1% TFA in water / ACN, gradient elution) to give compound 53 (structure 2.6c).

[0488] Synthesis of Structure 2.7c ((S)—N-(2-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-3-(3-fluoro-4-methoxyphenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridine-2,8-propyl)imidazolidin-1-yl)propanamide), Structure 2.8c, Structure 2.9c, and Structure 2.10c

[0489] [ka]

[0490] A solution of THF, PPh3, and DEAD was added dropwise to compound 31 at 0 °C, and the mixture was stirred at room temperature for 16 h. The mixture was then cooled to -20 °C for 1 h and filtered to remove triphenylphosphine oxide. The filtrate was concentrated, and the O-alkylated intermediate was isolated by purification on silica gel eluting with a gradient of ethyl acetate in hexane containing 1% TEA. The isolated intermediate was then suspended in a mixture of THF and HO, treated with LiOH in HO, and stirred at 35 °C for 16 h. Upon completion, the pH was adjusted to 7 with 2 M HCl, and all volatiles were removed. The crude was suspended in HO, sodium chloride was added, and compound 54 was extracted five times with ethyl acetate. The organic phases were combined, filtered over sodium sulfate, and concentrated. Compound 54 was then used without further purification.

[0491] [ka]

[0492] A solution of compound 54 in DMF was treated with HBTU and stirred for 5 minutes. DIEA and N3-PEG3-NH2 were then added, and the mixture was stirred at room temperature for 16 hours. Upon completion, the pH was adjusted to 3 with TFA, and compound 55 was isolated by direct injection onto a semi-preparative reverse-phase HPLC column (Phenomenex Gemini C18, 250 x 21.2 mm, pm, 5 pm, 0.1% TFA in water / ACN, gradient elution) to give compound 55.

[0493] Compounds 2.8c, 2.9c, and 2.10c were synthesized using N3-PEG11-NH2, N3-PEG 23 -NH2, N3-PEG 35 A similar method was used with -NH2.

[0494] Synthesis of Structure 2.11c (((R)-3-(4-(2-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid)

[0495] [ka]

[0496] A 3-L, 4-neck round-bottom flask purged and maintained under an inert nitrogen atmosphere was charged with THF (1.50 L), DIPEA (150.00 mL, 716,000 mmol, 0.88 equiv.), and n-BuLi (430.00 mL, 680,000 mmol, 0.84 equiv.). Trimethyl phosphite (195.00 mL) was then added at −60°C and stirred for 1 hour. t-Butyl 2-oxopyrrolidine-1-carboxylate (150.00 g, 809.835 mmol, 1.00 equiv.) was then added at −60°C. The resulting solution was stirred for 1 hour at −60°C in a liquid nitrogen bath. The reaction was then quenched with 350 mL of 2N HSO, diluted with 1.5 L of HO, and extracted with 2 × 1 L of ethyl acetate. The resulting mixture was washed with 1×1 L of HO, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give 200 g (crude) of tert-butyl N-[5-(dimethoxyphosphoryl)-4-oxopentyl]carbamate as a yellow oil.

[0497] [ka]

[0498] A 3-L round-bottom flask was charged with tert-butyl N-[5-(dimethoxyphosphoryl)-4-oxopentyl]carbamate (200.00 g, 1500.00 mmol, 1.50 equiv.), MeOH (1.50 L), 2-aminopyridine-3-carbaldehyde (53.00 g, 1000.00 mmol, 1.00 equiv.), and NaOH (50.00 g, 1500.00 mmol, 1.50 equiv.). The resulting solution was stirred in an oil bath at 50 °C for 16 hours. The pH of the solution was adjusted to 8 with NaHCO3 (aqueous). The resulting mixture was concentrated. The reaction was then quenched with 1.5 L of water and extracted with 2 × 1.5 L of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This gave 160 g (crude) of tert-butyl N-[3-(1,8-naphthyridin-2-yl)propyl]carbamate as a yellow oil.

[0499] [ka]

[0500] A 5-L round-bottom flask was charged with tert-butyl N-[3-(1,8-naphthyridin-2-yl)propyl]carbamate (160.00 g, 556.787 mmol, 1.00 equiv), MeOH (2.00 L), Rh / C (140.00 g, 1.360 mmol), and H (40 Psi). The resulting solution was stirred at 25 °C for 16 h, and the solid was filtered. The resulting mixture was concentrated. This resulted in 106 g (65.33%) of tert-butyl N-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]carbamate as a yellow solid.

[0501] [ka]

[0502] A 1-L round-bottom flask was charged with tert-butyl N-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]carbamate (106.00 g, 363.767 mmol, 1.00 equiv), EtOAc (500.00 mL), and HCl in EtOAc (4 M, 400.00 mL). The resulting solution was stirred at 25 °C for 3 h. The resulting solution was diluted with 1 L of HO and the pH was adjusted to 11 with NaOH (aqueous). The resulting solution was extracted with 2 × 1 L of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 56 g (80.48%) of 3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propan-1-amine as a yellow solid.

[0503] [ka]

[0504] A 2-L round-bottom flask was charged with 3-fluoro-4-hydroxybenzaldehyde (140.00 g, 999.194 mmol, 1.00 equiv.), ACN (1000 mL), (bromomethyl)benzene (205.08 g, 1199.039 mmol, 1.20 equiv.), and K2CO3 (414.28 g, 2997.581 mmol, 3.00 equiv.). The resulting solution was stirred at 25 °C for 16 h, and the solid was filtered. The resulting mixture was concentrated. This afforded 230 g (99.98%) of 4-(benzyloxy)-3-fluorobenzaldehyde as a white solid.

[0505] [ka]

[0506] A 3-L round-bottom flask was charged with 4-(benzyloxy)-3-fluorobenzaldehyde (230.00 g, 998.966 mmol, 1.00 equiv.), DCM (1600 mL), (S)-2-methylpropane-2-sulfamide (145.29 g, 1198.762 mmol, 1.20 equiv.), and CsCO (650.97 g, 1997.933 mmol, 2.00 equiv.). The resulting solution was stirred in an oil bath at 50 °C for 6 h. The solid was filtered off. The resulting mixture was concentrated. This afforded 260 g (78.06%) of (S)-N-[[[4-(benzyloxy)-3-fluorophenyl]methylidene]-2-methylpropane-2-sulfamide as a white solid.

[0507] [ka]

[0508] A 3 L round-bottom flask purged and maintained under an inert atmosphere of nitrogen was charged with THF (2.0 L), Zn (1.02 kg, 15595.945 mmol, 20.00 equiv.), CuCl (115.80 g, 1169.696 mmol, 1.50 equiv.), ethyl 2-bromoacetate (325.57 g, 1949.498 mmol, 2.50 equiv.), and (S)—N-[[4-(benzyloxy)-3-fluorophenyl]methylidene]-2-methylpropane-2-sulfumamide (260.00 g, 779.797 mmol, 1.00 equiv.). The resulting solution was stirred in a water / ice bath at 0° C. for 30 minutes. The resulting solution was allowed to react, with stirring, for an additional 2 hours while the temperature was maintained at 50° C. in an oil bath. The solids were filtered off. The resulting mixture was concentrated. The reaction was then quenched with 2 L of water and extracted with 2 x 2 L of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum to give 150 g (45.63%) of ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[[(S)-2-methylpropane-2-sulfomyl]amino]propanoate as a yellow oil.

[0509] [ka]

[0510] In a 1-L round-bottom flask, ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(S)-2-methylpropane-2-sulfomyl]amino]propanoate (150.00 g, 355.847 mmol, 1.00 equiv.) was added to a 1-L round-bottom flask. The resulting solution in 1,4-dioxane was stirred at 25 °C for 2 hours, and the resulting mixture was concentrated. 1 L of water was then added to quench the reaction. The pH was adjusted to 8 using NaHCO (aqueous). The resulting solution was extracted with 2 × 1 L of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. This afforded 100 g (88.55%) of ethyl (3R)-3-amino-3-[4-(benzyloxy)-3-fluorophenyl]propanoate as a yellow oil.

[0511] [ka]

[0512] A 2-L round-bottom flask was charged with ethyl (3R)-3-amino-3-[4-(benzyloxy)-3-fluorophenyl]propanoate (100.00 g, 315.100 mmol, 1.00 equiv.), THF (1.00 L), 2,2-dimethoxyacetaldehyde (49.21 g, 472.696 mmol, 1.50 equiv.), and NaBH(OAc) (133.57 g, 630.199 mmol, 2.00 equiv.). The resulting solution was stirred at 25 °C for 2 h, then quenched with 1 L of water. The resulting solution was washed with 2 × 1 L of ethyl acetate, dried over NaSO, and concentrated under reduced pressure. This resulted in 80 g (62.62%) of ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)amino]propanoate as a yellow oil.

[0513] [ka]

[0514] A 2-L, 3-neck round-bottom flask was charged with triphosgene (22.25 g, 74.975 mmol, 0.38 equiv.), THF (500 mL), ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-methoxyethyl)amino]propanoate (80.00 g, 197.304 mmol, 1.00 equiv.), TEA (29.95 g, 295.956 mmol, 1.50 equiv.), and 3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propan-1-amine (Compound 177, 33.97 g, 177.573 mmol, 0.90 equiv.). The resulting solution was stirred in an oil bath at 50 °C for 1 hour. The reaction was then quenched by adding 1 L of water. The pH was adjusted to 8 with NaHCO (aqueous). The resulting solution was extracted with 2 × 1 L of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated to yield 96 g (78.13%) of ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)([[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]carbamoyl])amino]propanoate as a crude yellow oil.

[0515] [ka]

[0516] A 1000 mL round-bottom flask was charged with ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)([[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]carbamoyl]amino]propanoate (96.00 g, 154.158 mmol, 1.00 equiv), THF (500.00 mL), and H2SO4 (180.00 mL, 2 M). The resulting solution was stirred at 25 °C for 16 h and the pH was adjusted to 8 with NaOH (5 M). The resulting solution was then cooled to 200°C for 2 h. The mixture was extracted with 1×1 L of dichloromethane, dried over anhydrous sodium sulfate, and concentrated. The residue was applied to a silica gel column containing dichloromethane / methanol (50 / 1). The collected fractions were combined and concentrated. This resulted in 73 g (84.76%) of ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[2-oxo-3-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]-2,3-dihydro-1H-imidazol-1-yl]propanoate as a yellow oil.

[0517] [ka]

[0518] A 3-L round-bottom flask was charged with ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[2-oxo-3-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]-2,3-dihydro-1H-imidazol-1-yl]propanoate (73.00 g, 130.671 mmol, 1.00 equiv.), EtOH (1.50 L), Pd(OH)2 / C (60.00 g, 427.259 mmol, 3.27 equiv.), and Eh (50 atm). The resulting solution was stirred at 25 °C for 72 h, and the solid was filtered. The residue was applied to a silica gel column containing dichloromethane / methanol (9 / 1). The collected fractions were combined and concentrated. This resulted in 41.0415 g (66.75%) of ethyl (3R)-3-(3-fluoro-4-hydroxyphenyl)-3-[2-oxo-3-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]imidazolidin-1-yl]propanoate as a yellow oil.

[0519] LCMS-PH-ARP-052-0:[MS+1]+=471

[0520] Optical rotation [a] D 20.0 =+37.5°(C=1g / 100ml in MeOH); H-NMR: (300MHz, DMSO-d6, ppm) δ9.84(s, 1H), 7.07~7.00(m, 2H), 6.95~6.850(m, 2H), 6.2 4(d, 2H), 5.18(t, 1H), 4.06~3.96(m, 2H), 3.32~2.75(m, 10H), 2.60(t, 2H), 2.37(t, 2H), 1.77~1.67(m, 4H), 1.10(t, 3H).

[0521] [ka]

[0522] To a solution of PPh3 in THF at -10 °C, the solution of DEAD was added dropwise. The mixture was warmed to room temperature and added to a neat mixture of compound 185 and HO-PEG4-N3 and stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified on silica gel eluting with a gradient of MeOH in DCM to give compound 186.

[0523] [ka]

[0524] To compound 186 was added EtOH and HO, followed by LiOH. The mixture was stirred at 30° C. overnight. Upon completion, the mixture was neutralized to pH=5 with 6 M aqueous HCl and concentrated. The residue was purified by reverse-phase HPLC using a Phenomenex Gemini C18, 50×250 mm, 10 pm column eluting with a gradient of acetonitrile in water containing 0.1% to give compound 187 (structure 2.11c).

[0525] Synthesis of Structure 28c (Compound 118a), Structure 29c (Compound 118b), Structure 31c (Compound 119a), and Structure 30c (Compound 119b)

[0526] [ka]

[0527] To a solution of LHMDS (1.0 M in THF, 95 mL, 95 mmol) and THF (60 mL) was added dropwise a solution of compound 103 (2-methyl-[1,8]naphthyridine (12.5 g, 86.7 mmol)) in THF (180 mL) at −78° C. After stirring for 30 minutes, compound 104 (5-bromo-1-pentene (19.4 g, 130 mmol)) in THF (120 mL) was added dropwise to the reaction mixture. The reaction mixture was stirred for 0.5 hours. The mixture was warmed to °C and stirred for 4 h. The reaction mixture was quenched with saturated aqueous NH4Cl (100 mL) and deionized water (100 mL) and then extracted with ethyl acetate (2 x 400 mL). The combined organic phases were dried over Na2SO4, filtered, concentrated, and compound 105 was isolated by CombiFlash® eluting with a gradient of 50-100% ethyl acetate in hexane. Yield of compound 105: 7.93 g (43%).

[0528] [ka]

[0529] To a solution of compound 105 (2.50 g, 11.8 mmol) in acetone (67.5 mL), water (7.5 mL), and 2,6-lutidine (2.74 mL, 23.6 mmol) were added 4-methylmorpholine N-oxide (2.07 g, 17.7 mmol) and osmium tetroxide (2.5 wt% in t-butanol, 2.40 g, 0.24 mmol) at room temperature. After stirring for 75 min, (diacetoxyiodo)benzene (5.69 g, 17.7 mmol) was added to the reaction mixture. The reaction mixture was stirred for 2 h, then quenched with saturated aqueous sodium thiosulfate (100 mL) and extracted with ethyl acetate (2 × 100 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated. Compound 106 was isolated by CombiFlash® elution with a gradient of 0–5% methanol in ethyl acetate. Yield of compound 106: 1.12 g (44%).

[0530] [ka]

[0531] To a suspension of sodium hydride (60% dispersion in mineral oil, 0.185 g, 4.64 mmol) in THF (9 mL) was added a solution of compound 107 (diethyl (N-methoxy-N-methylcarbamoylmethyl)phosphonate) (1.06 g, 4.43 mmol) in THF (5 mL) at 0 °C. After stirring for 30 minutes, a solution of compound 106 (0.903 g, 4.21 mmol) in THF (9 mL) was added dropwise. The reaction mixture was stirred at 0 °C for 10 minutes, then quenched with saturated aqueous NH Cl (30 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic phase was washed twice with half-saturated aqueous NaHCO solution. The organic phase was dried over Na SO , filtered, and concentrated. Compound 108: Yield 1.40 g (assuming 100% yield and used in the next step without further purification).

[0532] [ka]

[0533] To a solution of compound 108 (1.31 g, 4.38 mmol) in ethyl acetate (20 mL) was added Pd / C (10% loading, 0.466 g, 0.44 mmol). The reaction vessel was pressurized with H2 to 50 PSI. After stirring for 3.5 h, the reaction mixture was filtered through Celite® and washed with methanol. The filtrate was concentrated and compound 109 was isolated by CombiFlash® eluting with a gradient of 50-100% ethyl acetate in hexane containing 1% triethylamine. Yield of compound 109: 0.833 g (62%).

[0534] [ka]

[0535] To a solution of compound 109 (0.833 g, 2.73 mmol) in THF (10 mL) was added DIEA (0.590 mL, 3.41 mmol) and di-tert-butyl dicarbonate (0.744 g, 3.41 mmol). The reaction mixture was heated to 50° C. for 5 h. Based on LC / MS, the reaction was incomplete, and an additional portion of DIEA (0.590 mL, 3.41 mmol) and di-tert-butyl dicarbonate (0.744 g, 3.41 mmol) was added. The reaction mixture was heated at 50° C. for an additional 16 h. The reaction mixture was concentrated, and compound 110 was isolated by CombiFlash® eluting with a gradient of 50-100% ethyl acetate / hexanes. Yield of compound 110: 0.934 g (84%).

[0536] [ka]

[0537] To a solution of n-butyllithium (2.5 M in hexanes, 0.70 mL, 1.8 mmol) and THF (1.5 mL) was added compound 111 (5-bromo-2-(phenylmethoxy)-pyridine) (0.465 g, 1.8 mmol) as a solution in THF (0.8 mL) dropwise over 3 min at −78 °C, followed by compound 110 (0.535 g, 1.3 mmol) as a solution in THF (1 mL). After stirring for 30 min, the reaction was warmed to 0 °C, quenched with saturated aqueous NH4Cl (10 mL), and acidified to pH 7 with 6 M aqueous HCl. The mixture was extracted with ethyl acetate (3 × 10 mL). The combined organic phase was dried over Na2SO4, filtered, and concentrated. To the crude solution in THF (8 mL) was added DIEA (0.94 mL, 5.4 mmol) and di-tert-butyl dicarbonate (1.18 g, 5.4 mmol). The mixture was stirred at 40° C. overnight. The reaction mixture was concentrated and compound 112 was isolated by CombiFlash® eluting with a gradient of 0-40% ethyl acetate in hexanes. Yield of compound 112: 471 mg (50%).

[0538] [ka]

[0539] To a suspension of sodium hydride (60% dispersion in mineral oil, 0.106 g, 2.65 mmol) in dimethoxyethane (2 mL) was added compound 113 (triethyl phosphonoacetate) (0.593 g, 2.65 mmol) as a solution in dimethoxyethane (1 mL) at 0 °C. After stirring for 20 min, the reaction mixture was warmed to room temperature, and a solution of compound 112 (0.467 g, 0.88 mmol) in dimethoxyethane (2 mL) was added. The reaction mixture was heated at 70 °C for 4 h. The reaction was quenched with saturated aqueous NH4Cl (10 mL), and the product was extracted with ethyl acetate (3 × 15 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. Compound 114 was isolated as a 1:1 mixture of cis:trans isomers by CombiFlash® elution with a gradient of 0–30% ethyl acetate in hexanes. Yield of compound 114: 392 mg (74%).

[0540] [ka]

[0541] To a solution of compound 114 (390 mg, 0.65 mmol) in ethanol (6 mL) was added Pd / C (10% loading, 69 mg, 0.07 mmol). The reaction vessel was pressurized with H2 to 50 PSI. After stirring for 4 h, the reaction mixture was filtered through Celite® and washed with methanol. The filtrate was concentrated and compound 115 was isolated as a racemic mixture by CombiFlash® eluting with a gradient of 0-10% methanol in DCM. Yield of compound 115: 95 mg (29%). Chiral semi-preparative HPLC (250 x 21 mm ChiralPak® AD column, 5 pm, 90 / 10 hexane / EtOH, 40 mL / min) was used to isolate 42 mg of the first-eluting R-isomer (RT = 12-14 m, >99% ee, compound 115a) and 40 mg of the second-eluting S-isomer (RT = 15-18 m, >98% ee, compound 115b). Identification of the R and S isomers was based on the elution order of structurally similar compounds reported by Coleman et al. (2004) J. Med. Chem. 4834 (2004).

[0542] Structure 28c ((R)-3-(2-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)pyridin-3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid) and 31c ((R)-3-(1-(2-(2-(2-(2-(2-(azidoethoxy)ethoxy)ethoxy)ethoxy)ethyl)-6-oxo-1,6-dihydropyridin-3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid)

[0543] [ka]

[0544] To a solution of compound 115a (41 mg, 0.08 mmol) and N3-PEG4-OTS (61 mg, 0.16 mmol) in DMF (0.5 mL) was added cesium carbonate (53 mg, 0.16 mmol). The reaction mixture was stirred at 40 °C for 1 h. The reaction mixture was quenched with aqueous NaHCO3 (1 mL) and then extracted with ethyl acetate (3 × 3 mL). The organic phase was concentrated under reduced pressure. The crude mixture of N- and O-alkylated regioisomers was subsequently used without further purification.

[0545] [ka]

[0546] To a solution of compounds 116a and 117a (58 mg, 0.08 mmol, 4:6 mixture of 9a:10a) in THF (1.0 mL) and deionized water (1.0 mL) was added lithium hydroxide (6 mg, 0.25 mmol). The reaction mixture was stirred at room temperature for 1 h and then at 35 °C for 2 h. An additional portion of lithium hydroxide (4 mg, 0.16 mmol) was added, and the reaction temperature was raised to 40 °C and stirred for 3 h. After that, the final portion of lithium hydroxide (4 mg, 0.25 mmol, total 16 mg, 0.66 mmol) was added. The reaction mixture was stirred at 50 °C for 3 h. The reaction mixture was acidified to pH 7 with 6 N aqueous HCl and concentrated under reduced pressure. The regioisomers, compounds 118a and 119a, were separated by CombiFlash® elution with a gradient of 0–5% methanol in DCM containing 0.5% acetic acid. Compound 118a was further purified by reverse-phase HPLC (Thermo Scientific™ Aquasil™ C18, 250 x 21.2 mm, 5 μm) at 20 mL / min in 0.1% TFA water / ACN gradient elution to give 13 mg of compound 118a (structure 28c). Compound 119a was purified under the same conditions to give 16 mg of compound 119a (structure 31c).

[0547] Structure 29c ((S)-3-(6-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)pyridin-3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid) and 30c ((S)-3-(1-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-6-oxo-1,6-dihydropyridin-3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid).

[0548] [ka]

[0549] To a solution of compound 115b (40 mg, 0.08 mmol) and N3-PEG4-OTS (58 mg, 0.16 mmol) in DMF (0.5 mL) was added cesium carbonate (51 mg, 0.16 mmol). The reaction mixture was stirred at 40 °C for 30 min. The reaction mixture was quenched with aqueous NaHCO3 (1 mL) and then extracted with ethyl acetate (3 × 3 mL). The organic phase was concentrated under reduced pressure. The crude mixture of N- and O-alkylated regioisomers was subsequently used without further purification.

[0550] [ka]

[0551] To a solution of compounds 116b and 117b (56 mg, 0.08 mmol, 4:6 mixture of 9a:10a) in THF (0.75 mL) and deionized water (0.75 mL) was added lithium hydroxide (6 mg, 0.25 mmol). The reaction mixture was stirred at 45 °C for 2.5 h. An additional portion of lithium hydroxide (6 mg, 0.25 mmol) was added, and the reaction mixture was stirred for 2.5 h. The reaction temperature was lowered to 35 °C, and the mixture was stirred overnight. The reaction mixture was acidified to pH = 7 with 6 N aqueous HCl and concentrated under reduced pressure. The regioisomers, compounds 118b and 119b, were separated by CombiFlash elution using a gradient of 0 to 5% methanol in DCM containing 0.5% acetic acid. Compound 118b was further purified by reverse-phase HPLC (Thermo Scientific™ Aquasil™ C18, 250 x 21.2 mm, 5 pm, 20 mL / min, 0.1% TFA in water / ACN, gradient elution) to give 14 mg of compound 118b (structure 29c). Compound 119b was purified under the same conditions to give 18 mg of compound 119b (structure 30c).

[0552] Synthesis of Structure 32c (((R)-3-(4-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(N-methyl-5-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)pentamido)propanoic acid

[0553] [ka]

[0554] 120 (2.75 g, 11.94 mmol) in toluene (80 mL) was sieved to 3 Å sieves and compound 121 (5.79 g, 47.78 mmol) was added, followed by PPTS (300 mg, 1.19 mmol), followed by AcOH (683 μL, 11.94 mmol). The reaction was refluxed overnight. Upon completion, the reaction was quenched by the addition of saturated sodium bicarbonate. The organic layer was diluted with two volumes of ethyl acetate, separated, and filtered through sodium sulfate. The product was isolated on silica gel eluting with a gradient of ethyl acetate (0-30%) in hexanes to give 2.054 g (54%).

[0555] [ka]

[0556] To DIA (2.85 mL, 20.33 mmol) in THF (15 mL) at −78° C., a 2.5 M solution of n-BuLi (7.76 mL, 19.41 mmol) was added dropwise. Stirring was continued at −78° C. for 5 minutes, and ethyl acetate (1.81 mL, 18.48 mmol) was added dropwise. Stirring was continued at −78° C. for an additional 10 minutes, and a solution of chlorotitanium triisopropoxide (9.27 mL, 38.381 mmol) in THF (10 mL) was added dropwise. Stirring was continued at −78° C. for an additional 15 minutes, and a solution of compound 122 (2.054 g, 6.16 mmol) in THF (10 mL) was added dropwise. Stirring was continued at −78° C. for 1.5 hours, and upon completion of the reaction, the reaction was quenched by the addition of saturated ammonium bicarbonate. The suspension was diluted with 6 volumes of ethyl acetate, and the organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was isolated on silica eluting with a gradient of ethyl acetate in hexane to give 1.043 g (53%).

[0557] [ka]

[0558] To compound 123 (1.043 g, 2.47 mmol) stirred in MeOH (3 mL) was added 4 M HCl solution in dioxane (3.09 mL, 12.37 mmol). After complete deprotection, the solution was diluted with water (8 mL) and washed twice with diethyl ether (6 mL). The aqueous layer was adjusted to pH 11 with sodium hydroxide. The precipitate was extracted with ethyl acetate, and the combined organic extracts were dried over sodium sulfate, filtered, and concentrated to give 0.616 g (78.5%) of product 124, which was used without further purification.

[0559] [ka]

[0560] To compound 125 (92.1 mg, 0.275 mmol) in THF (1.5 mL) at 0 °C was added DCC (68.1 mg, 0.331 mmol). After 5 min, PNP (106.1 mg, 0.331 mmol) was added, the ice bath was removed, and stirring was continued for 1 h. Upon completion, the suspension was cooled to -20 °C for 1 h, and the precipitate was removed by filtration. The supernatant was concentrated to give 129 mg (103%) of crude product 126, which was used without further purification.

[0561] [ka]

[0562] A mixture containing compound 124 (148.6 mg, 0.468 mmol) and potassium carbonate (129 mg, 0.937 mmol) in DMF (2 mL) was treated with methyl iodide (66.5 mg, 0.468 mmol) and stirred for 3 h at 50° C. Upon completion of the alkylation, all volatiles were removed and the product was isolated on silica eluting with a gradient of ethyl acetate in hexanes, each buffered with 1% TEA, to give 94.6 mg (61%).

[0563] [ka]

[0564] To compound 127 (94.5 mg, 0.285 mmol) in DMF (2 mL) was added DIEA (149 μL, 0.856 mmol), followed by compound 126 (129.9 mg, 0.285 mmol), and the mixture was stirred at 80 °C for 1 hour. Upon completion, all volatiles were removed, the crude was dissolved in MeOH, treated with 10% palladium on carbon (20 mg), and the flask was charged with hydrogen at 60 PSI. Upon completion, the suspension was filtered. The supernatant was concentrated, and the resulting crude product was used without further purification.

[0565] [ka]

[0566] A mixture containing compound 128 (159 mg, 0.285 mmol), bromo-PEG-azide (74.7 mg, 0.314 mmol), and cesium carbonate (204 mg, 0.627 mmol) in DMF (2 mL) was heated to 60° C. for 2 h. Upon completion, all volatiles were removed, and the crude material was treated with 4 M HCl in dioxane (0.5 mL, 2 mmol) and heated to 40° C. for 3 h. Upon completion, all volatiles were removed. The crude material was suspended in a mixture of THF (1 mL), MeOH (1.5 mL), and FLO (1.5 mL), treated with lithium hydroxide (83.5 mg, 3.48 mmol), and heated to 40° C. for 16 h. Upon completion, the pH was adjusted to 3 with TFA and the product was separated on a Phenomenex® Gemini® C18 column (21.2 x 250 mm, 5 micron) eluted with a gradient of acetonitrile in water containing 0.1% TFA to give 33.1 mg (20%).

[0567] Synthesis of Structure 33c (((R)-1-azido-13-(3-fluoro-4-methoxyphenyl)-12-(5-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)pentanoyl)-3,6,9-trioxa-12-azapentadecan-15-oic acid)

[0568] [ka]

[0569] A mixture containing compound 130 (1.5 g, 9.73 mmol), (R) t-butylsulfinamide (2.36 g, 19.46 mmol), and AcOH (0.14 mL) in toluene (45 mL) was refluxed in a flask equipped with a Dean-Stark trap. Upon completion, the reaction was quenched by the addition of saturated sodium bicarbonate. The organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was isolated on silica gel and eluted with a gradient of ethyl acetate in hexane to give 1.714 g (68.4%).

[0570] [ka]

[0571] To DIA (3.056 mL, 21.80 mmol) in THF (18 mL) at −78°C, a 2.5 M solution of n-BuLi (8.324 mL, 20.81 mmol) was added dropwise. Stirring was continued at −78°C for 5 minutes, and ethyl acetate (1.94 mL, 19.82 mmol) was added dropwise. Stirring was continued for an additional 10 minutes at −78°C, and a solution of chlorotitanium triisopropoxide (9.94 mL, 41.62 mmol) in THF (10 mL) was added dropwise. Stirring was continued for an additional 15 minutes at −78°C, and a solution of compound 131 (1.70 g, 6.61 mmol) in THF (12 mL) was added dropwise. Stirring was continued for 1.5 hours at −78°C, and upon completion of the reaction, the reaction was quenched by the addition of saturated ammonium bicarbonate. The suspension was diluted with 7 volumes of ethyl acetate, and the organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was isolated on silica eluting with a gradient of ethyl acetate in hexane to give 0.984 g (43%).

[0572] [ka]

[0573] To compound 132 (0.975 g, 2.82 mmol) in EtOH (6 mL) at 0 °C was added 4 M HCl in dioxane (2.12 mL, 8.47 mmol) and stirred for 30 minutes. After the reaction was complete, it was diluted with water (15 mL) and washed with diethyl ether. The organic layer was separated and the pH of the aqueous layer was adjusted to 12 with sodium hydroxide. The aqueous layer was washed with 5 volumes of ethyl acetate, the organic layer was separated, filtered through sodium sulfate, and concentrated. The product was separated on silica gel and eluted with a gradient of ethyl acetate in hexane containing 1% TEA to give 0.434 g (64%).

[0574] [ka]

[0575] To a mixture of compound 133 (0.120 g, 0.497 mmol) and PEG (0.151 g, 0.696 mmol) in THF (2 mL) over 3 Å molecular sieves, STAB-H (0.253 g, 1.19 mmol) was added, and the suspension was stirred at room temperature for 16 hours. Upon completion, the reaction was quenched by adding saturated sodium bicarbonate, and the crude product was extracted with three portions of ethyl acetate. The separated organic extracts were combined, dried over sodium sulfate, filtered, and concentrated. The resulting crude product was subsequently used without further purification.

[0576] [ka]

[0577] Compound 134 (0.200 g, 0.597 mmol) in DMF (2 mL) was treated with HATU (0.227 g, 0.597 mmol) and stirred for 5 min. DIEA (0.259 mL, 1.49 mmol) was added to the activated ester, followed by compound 125 (0.220 g, 0.497 mmol) in DMF (1 mL), and the resulting mixture was stirred for 1 h. All volatiles were removed, and the resulting crude was treated with neat TFA (3.8 mL) and stirred at 40 °C for 3 h. After completion of BOC removal, all volatiles were removed, and the crude was suspended in a mixture of THF (4 mL), water (8 mL), and MeOH (8 mL). The resulting mixture was treated with LiOH (71.6 mg, 2.98 mmol) and heated to 40 °C for 16 h. Upon completion, the pH was adjusted to 3 with TFA and the product was separated on a Phenomenex® Gemini® C18 column (21.2 × 250 mm, 5 micron) eluted with a gradient of acetonitrile in water containing 0.1% TFA to give 56.2 mg (18%, 3 steps).

[0578] Synthesis of Structure 34c (((S)-1-azido-13-(3-fluoro-4-methoxyphenyl)-12-(5-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)pentyl)-3,6,9-trioxa-12-azapentadecan-15-oic acid)

[0579] [ka]

[0580] Compound 136 (0.500 g, 1.45 mmol) was treated in a mixture of THF (9.0 mL) and MeOH (0.5 mL) at 0 °C. Cooling was removed and stirring was continued until gas evolution ceased. The reaction mixture was diluted with 5 volumes of EtOAc. The organic layer was washed with ammonium bicarbonate, dried over sodium sulfate, filtered, and concentrated. The product was isolated by elution on silica with a gradient of ethyl acetate in hexanes to yield 309 mg (67%).

[0581] [ka]

[0582] To a solution containing compound 137 (0.305 g, 0.952 mmol) in DCM (9 mL) at 0 °C, Martin's reagent was added in several portions. A few drops of water were added, the cooling was removed, and the reaction was stirred for 3 h. Upon completion, the mixture was washed with saturated sodium bicarbonate and then saturated sodium thiosulfate. The separated organics were dried over sodium sulfate, filtered, and concentrated. The product 138 was separated on silica, eluting with a gradient of MeOH in DCM to give 140 mg (46%).

[0583] [ka]

[0584] To a mixture containing compound 1 (85.2 mg, 0.353 mmol) and 138 (134.9 mg, 0.424 mmol) in THF (2.5 mL) was added STAB-H (0.150 g, 0.706 mmol), and the resulting suspension was heated to 40 °C for 16 h. Upon completion of the reaction, it was diluted with 5 volumes of ethyl acetate and treated with saturated sodium bicarbonate. The organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was isolated by separation on silica eluting with a gradient of MeOH in DCM containing 1% TEA to yield 64 mg (33%).

[0585] [ka]

[0586] To a mixture of compound 140 (60 mg, 0.110 mmol), Ald-PEG3-N3 (71.9 mg, 0.331 mmol), and AcOH (3 μL, 0.0276 mmol) in MeOH (1 mL) on 3 Å molecular sieves, sodium cyanoborohydride (28.9 mg, 0.276 mmol) was added, and the reaction was stirred at 40 °C for 3 h. Upon completion, the mixture was cooled to 0 °C, water (0.15 mL) was added, and the solution was acidified to pH 7 with 4 M HCl in dioxane. Then, all methanol was removed, and 4 M HCl in dioxane (0.138 mL, 0.552 mmol) was added, and the mixture was stirred at 40 °C for 2 h. After complete BOC removal, all volatiles were removed and the crude material was suspended in a mixture of THF (1 mL), water (2 mL), and MeOH (2 mL) and treated with lithium hydroxide (26.5 mg, 1.104 mmol). After complete ester removal, the pH was adjusted to 3 by the addition of TFA, and the product was isolated by separation on a Phenomenex® (21.2 × 250 mm) C18 column eluted with a gradient of acetonitrile in water containing 0.1% TFA to give 16.4 mg (24%, 3 steps).

[0587] Synthesis of Structure 36c ((S)-3-(4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)-3-fluorophenyl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid)

[0588] [ka]

[0589] To a solution of 6-oxoheptanoic acid (9.74 g, 68 mmol) in DCM (30 mL) and MeOH (75 mL) was added Cohn. H2SO4 (0.18 mL, 3.4 mmol) at room temperature. The reaction mixture was refluxed overnight. The reaction mixture was then concentrated to an oil, redissolved in DCM (150 mL), and washed with saturated aqueous NaHCO3 (2 x 40 mL) and brine (40 mL). The organic layer was dried over Na2SO4, filtered, and concentrated. This product was used in the next step without further purification. Yield of compound 141: 10.2 g (95%). 1 H NMR (400MHz, DMSO-d6): δ3.58(s, 3H), 2.43(t, 2H), 2.29(t, 2H), 1.46(m, 4H).

[0590] [ka]

[0591] To a solution of compound 141 (10.2 g, 65 mmol) and 2-amino-3-formylpyridine (7.89 g, 65 mmol) in EtOH (80 mL) was added L-proline (3.72 g, 32 mmol). The reaction mixture was heated under reflux overnight. The reaction mixture was then concentrated, dissolved in EtOAc (50 mL), and washed with water (3 × 30 mL). The organic phase was dried over NaSO, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc in DCM (10-100%). Yield of compound 142: 6.08 g (39%). 14 H 16 N2O2[M+H] + :245.13 Calculated mass:245.21.

[0592] [ka]

[0593] To a solution of compound 142 (6.08 g, 24.9 mmol) in MeOH (50 mL) was added Pd / C (10% loading, Degussatype, 1.99 g, 1.87 mmol). The reaction flask was filled with nitrogen, evacuated, and filled with nitrogen three times. This process was repeated with hydrogen, and the reaction vessel was finally charged with hydrogen (1 atm) and stirred at room temperature overnight. The reaction mixture was filtered over Celite®, the pad was washed with MeOH, and the filtrate was concentrated. The product, compound 143, was used in the next step without further purification assuming 100% yield. 14 H 20 N2O2[M+H] + :249.16 Calculated mass:249.08.

[0594] [ka]

[0595] To a solution of dimethylphosphonic acid (12.3 g, 100 mmol) in anhydrous THF (120 mL), n-BuLi solution (2.5 M in hexane, 40 mL, 100 mmol) was added via syringe pump at −78° C. over 1 h. A solution of compound 143 (6.175 g, 24.9 mmol) in THF (40 mL) was added to the reaction mixture at −78° C. over 45 min. After stirring at −78° C. for 20 min, saturated aqueous NH4Cl solution (200 mL) was added, warmed to room temperature, and extracted with EtOAc (400 mL). The organic layer was washed with water (200 mL) and brine (200 mL). The organic phase was separated, dried over Na2SO4, filtered, and concentrated. This product was used in the next step without further purification. Yield of compound 144: 7.86 g (93%). C 16 H 25 N2O4P[M+H] + Calculated mass: 341.17, Found mass: 341.17.

[0596] [ka]

[0597] A suspension of 3-fluoro-4-(phenylmethoxy)-benzaldehyde (0.38 g, 1.65 mmol), compound 144 (0.67 g, 1.98 mmol), and anhydrous potassium carbonate (0.547 g, 3.96 mmol) in THF (13.5 mL) was heated at reflux overnight. Additional 3-fluoro-4-(phenylmethoxy)-benzaldehyde (0.19 g, 0.83 mmol) and potassium carbonate (0.23 g, 1.65 mmol) were added, and the reaction mixture was refluxed for an additional 4 h. The mixture was diluted with EtOAc (100 mL) and washed with water (30 mL) and brine (30 mL). The organic phase was separated, dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH in DCM (0–10%). Compound 145: Yield 446 mg (61%). 28 H 29 FN2O2[M+H] + :445.23 Calculated mass:445.41.

[0598] [ka]

[0599] Preparation of R-BINAL: To a slurry of LAH (0.396 g, 10.4 mmol, 0.98 equiv.) in dry THF (34 mL) was added EtOH (0.492 g, 10.65 mmol, 1.00 equiv.) as a solution in THF (3.2 mL) over 10 min, maintaining the internal temperature below 35 °C. After aging for 30 min, R-BINOL (3.05 g, 10.65 mmol, 1.00 equiv.) was added as a solution in THF (10 mL), maintaining the internal temperature below 35 °C (approximately 10 min). After stirring at room temperature for 2 h, the reaction mixture was cooled to -78 °C on a dry ice / acetone bath.

[0600] Compound 145 (1.18 g, 2.65 mmol) was azeotropically dried with anhydrous toluene (50 mL) and dissolved in anhydrous THF (12 mL). The solution of compound 145 was added dropwise to the solution of R-BINAL over 45 m via syringe pump at -78 °C. After 1.5 h, the reaction vessel was transferred to a very large sewer, filled with dry ice / acetone, and covered with aluminum foil. The reaction mixture was stirred ON at -78 °C. Most of the conversion occurred within the first 1.5 h, with a small amount of additional conversion occurring overnight. The reaction was quenched by adding saturated aqueous NH4Cl (150 mL) and warming to room temperature. The mixture was further acidified to pH = 7 using 6 N HCl and then extracted with EtOAc (2 × 250 mL). The combined organic phase was washed with water (125 mL) and brine (125 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The residue was purified by Combiflash using silica gel as the stationary phase and eluted with a gradient of MeOH (0-5%) in DCM. Yield of compound 146: 634 mg (53%). Chiral purity was determined by analytical chiral HPLC using a Chiralpak AD-H column 4.6 x 250 mm, 5 microns, EtOH 0.1% diethylamine isocratic, 1.75 mL / min. The first-eluting R isomer was 86% area pure, corresponding to 72% ee. Compound 146 was further purified by chiral semi-preparative HPLC (Chiralpak AD-H 21.2 x 250 mm, 5 microns, EtOH 0.1% diethylamine, 20 mL / min). Final yield of compound 146: 445 mg (98% ee). 28 H 31 FN2O2[M+H] + Calculated mass: 447.25, measured mass: 447.30.

[0601] [ka]

[0602] To a solution of compound 146 (0.325 g, 0.73 mmol) and malonic acid monomethyl ester (0.103 g, 0.87 mmol) in DCM (3 mL) was added a solution of DMAP (9 mg, 0.073 mmol) in DCM. The mixture was cooled to 0° C., and DCC (0.180 g, 0.87 mmol) was added. The cooling bath was removed, and the reaction was stirred at room temperature. The reaction mixture was then diluted with DCM (10 mL) and filtered. The filtrate was concentrated and purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH (0-5%) in DCM. Compound 147: Yield 142 mg (37%). C 32 H 35 FN2O5[M+H] + Calculated mass: 547.26, found mass: 547.58.

[0603] [ka]

[0604] To a solution of compound 147 (0.232 g, 0.42 mmol) in NMP (0.5 mL) at room temperature was added N,O-bis(trimethylsilyl(acetamide) (0.229 g, 1.12 mmol). The mixture was heated at 60° C. for 30 min. Brine (58 μL) was added in two portions over 5 min. The reaction mixture was then heated at 90° C. for 3 h and then at room temperature overnight. The reaction mixture was diluted with EtOAc (12 mL) and washed with water (3 mL). The aqueous layer was back-extracted with EtOAc (12 mL). The combined organic layers were concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH in DCM. Compound 148: Yield 140 mg (66%). C 31 H 35 FN2O3[M+H] + Calculated mass: 503.27, calculated mass: 503.29.

[0605] [ka]

[0606] To a solution of compound 148 (0.169 g, 0.34 mmol) in EtOH (3 mL) was added a slurry of Pd / C (10% loading, 36 mg, 0.034 mmol) in EtOH (1 mL). The reaction vessel was pressurized and vented with hydrogen three times. The reaction vessel was repressurized to 55 psi for 3 hours. The reaction mixture was diluted with MeOH (5 mL) and filtered. The filtrate was concentrated, and the product, compound 149, was used in the next step without further purification assuming 100% yield. 24 H 31 FN2O3[M+H] + :415.24 and the calculated mass was 415.07.

[0607] [ka]

[0608] To a solution of compound 149 (139 mg, 0.34 mmol) and azide-PEGMosylate (0.188 mg, 0.50 mmol) in DMF (2.5 mL) was added cesium carbonate (164 mg, 0.50 mmol). The reaction mixture was heated at 40° C. for 1 h and then quenched with saturated aqueous sodium bicarbonate (3 mL). The mixture was extracted with EtOAc (3×10 mL). The combined organic phase was washed with water (2×5 mL). The organic phase was dried over Na2SO4, filtered, concentrated, and used in the next step without further purification. 32 H 46 FN5O6[M+H] + :616.35 Calculated mass:616.90.

[0609] [ka]

[0610] To a solution of compound 150 (0.207 mg, 0.34 mmol) in THF (1.5 mL) and water (1.5 mL) was added lithium hydroxide (0.040 g, 1.68 mmol). The reaction mixture was heated to 40° C. overnight. The next morning, the reaction mixture was acidified to pH=7 with 6N HCl and concentrated under reduced pressure. The residue was dissolved in 35% ACN, 0.1% TFA in H2O and purified by RP-HPLC (ThermoAquasil C18, 250×21 mm, 5 pm, 20 mL / min, gradient of ACN in H2O with 0.1% TFA). Compound 151 (SM36): Yield 125 mg (52% over three steps). C 31 H 44 FN5O6[M+H] + :602.34 Calculated mass:602.85.

[0611] Synthesis of Structure 37c ((S)-3-(4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(5-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)pentanamido)propanoic acid)

[0612] [ka]

[0613] Compound 169 (90 mg, 0.268 mmol) in DMF (1.5 mL) was treated with HATU (112 mg, 0.295 mmol) and stirred for 5 min. A mixture containing compound 170 (94 mg, 0.295 mmol) and DIEA (0.154 mL, 0.884 mmol) in DMF (0.5 mL) was then added and stirring continued for 1 h. Upon completion, all volatiles were removed and compound 171 was isolated by separation on silica eluting with a gradient of MeOH in DCM to yield 123 mg (72%).

[0614] [ka]

[0615] A suspension of 10% palladium on carbon (21 mg, 0.0194 mmol) and compound 171 (123 mg, 0.194 mmol) in MeOH (2 mL) was charged with 60 PSI hydrogen and stirred for 1 h. Upon completion, the suspension was filtered through Celite® and concentrated to give 88 mg (83%) of crude material, which was used without further purification.

[0616] [ka]

[0617] A suspension of compound 172 (87 mg, 0.160 mmol), Br-PEG3-N3 (50 mg, 0.176 mmol), and cesium carbonate (115 mg, 0.352 mmol) in DMF (1 mL) was heated to 60 °C and stirred for 2 h. Upon completion, all volatiles were removed and compound 173 was isolated by separation on silica eluting with a gradient of MeOH in DCM to yield 91 mg (76%).

[0618] [ka]

[0619] Compound 173 (50 mg, 0.067 mmol) in dioxane (0.5 mL) was treated with a solution of 4 M HCl in dioxane (0.671 mmol, 0.168 mL) and stirred at 40 °C for 3 h. Upon completion, all volatiles were removed. The crude product was dissolved in a mixture of HO (0.4 mL), THF (0.2 mL), and MeOH (0.4 mL), treated with LiOH (8 mg, 0.356 mmol), and stirred at 40 °C for 16 h. Upon completion, the pH was adjusted to 3 with TFA and the product was isolated on a Phenomenx Gemini C18 column (21.2 x 250 mm, 5 micron) eluting with a gradient of acetonitrile in water containing 0.1% TFA in a yield of 25 mg (60%, 2 steps).

[0620] Synthesis of Structure 38c ((S)-3-(2-(3-(2-(2-(2-(2-azidoethoxy)ethoxy)ethyl)amino)-3-oxopropyl)pyrimidin-5-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid) and Structure 39c ((S)-3-(2-(1-azido-12-oxo-3,6,9-trioxa-13-azahexadecan-16-yl)pyrimidin-5-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)nonanoic acid)

[0621] [ka]

[0622] To a solution of 5-bromo-2-iodo-pyrimidine (8.00 g, 28.1 mmol) in anhydrous THF (95 mL) was added a solution of i-PrMgBr in THF (0.75 M, 56 mL, 42.0 mmol) at -78 °C, while maintaining the internal temperature below -70 °C (approximately 15 min). The resulting solution was then stirred for 15 min, after which a CuCN·2LiCl solution was added to THF (1 M, 31 mL, 31.0 mmol), followed by the addition of allyl bromide (5.10 g, 42 mmol) as a solution in THF (10 mL). The reaction mixture was warmed to room temperature and stirred for 1 h. The reaction mixture was quenched with MeOH (40 mL) and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of 0-20% EtOAc in hexanes. Compound 152: 4.13 g (74%) yield. C7H7BrN2[M+H] + The calculated mass for :198.99 was :199.05.

[0623] [ka]

[0624] To a solution of compound 152 (7.70 g, 38.7 mmol) in THF (115 mL) was added a solution of 9-BBN in THF (0.5 M, 131 mL, 65.8 mmol) over 30 min at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. To the reaction mixture was added a slurry of NaHCO (48.7 g, 580 mmol) in water (100 mL), followed by a slurry of NaBO monohydrate (43.3 g, 464 mmol) in water (100 mL) at 0 °C. The cooling bath was removed, and the mixture was stirred vigorously for 1 h. The reaction mixture was transferred to a separatory funnel, and the layers were separated. The aqueous layer was extracted with EtOAc (200 mL). The organic phases were combined and washed with brine (100 mL). The brine layer was re-extracted with EtOAc (100 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated to give approximately 15 g of a crude yellow oil. This crude material was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc in hexanes (50-100%). Compound 153: 3.44 g (41%) yield. C7H9BrN2O [M+H] + The calculated mass was 216.97 for :217.00.

[0625] [ka]

[0626] To a solution of compound 153 (3.44 g, 15.8 mmol) in DCM (40 mL) was added a solution of imidazole (1.73 g, 25.4 mmol) and TBDPSC1 (5.23 g, 19.0 mmol) in DCM (12 mL) at 0 °C, and the reaction was allowed to warm to room temperature. The reaction mixture was diluted with DCM (75 mL) and washed with water (50 mL) and brine (50 mL). The organic layer was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc (0-8%) in hexanes. Yield of compound 154: 5.56 g (77%). 23 H 27 BrN2OSi[M+H] + :455.12 and the calculated mass was 455.44.

[0627] [ka]

[0628] To a solution of compound 154 (6.07 g, 13.3 mmol) in THF (150 mL) at −75° C. was added a solution of nBuLi in THF (2.5 M, 5.6 mL, 14.0 mmol) dropwise, maintaining the internal temperature below −70° C. (approximately 10 min). After 3 min, a solution of ethyl formate (1.04 g, 1.13 mL, 14.0 mmol) in THF (5 mL) was added dropwise, maintaining the internal temperature below −70° C. The mixture was stirred at −78° C. for 20 min and then quenched with HCl in dioxane (4 M, 3.67 mL, 14.7 mmol), further diluted with THF (5 mL), maintaining the internal temperature below −65° C. The cooling bath was removed, and the reaction was allowed to warm to ambient temperature and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc in hexanes (0-20%). Yield of compound 155: 1.79 g (33%). 1 HNMR (400MHz, CDCl3): δ10.09(s, 1H), 9.06(s, 2H), 7.64(m, 4H), 7.38(m, 6H), 3.77(t, 2H), 3.20(t, 2H), 2.17(q, 2H), 1.03(s, 9H).

[0629] [ka]

[0630] To a solution of compound 144 (1.68 g, 4.15 mmol) and compound 155 (1.70 g, 4.98 mmol) in THF (25 mL) was added K2CO3 (0.861 g, 6.23 mmol). The reaction mixture was heated to 40 °C for 2.5 h and then to 50 °C for 12 h. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL) and brine (50 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc (0-100%) in hexane containing 1% triethylamine. Yield of compound 156: 2.04 g (79%). 38 H 46 N4O2Si[M+H] + The calculated mass was 619.69.

[0631] [ka]

[0632] The preparation of R-BINAL:LAH (1.169 g, 30.8 mmol) was slurried in dry THF (90 mL). int EtOH was added as a THF solution (6 M, 5.2 mL, 31.4 mmol) maintained at <40° C., and the mixture was cooled to 35° C. for 40 min and then cooled to 30° C. A solution of R-(BINOL) (9.00 g, 31.4 mmol) in THF (45 mL) was added and maintained at <40° C. The mixture was aged at 50° C. for 1 h, cooled to ambient temperature, heated to 50° C., and TMEDA (14.1 mL, 11.0 g, 94.3 mmol) was added. The mixture was aged at 50° C. for 1 h, cooled to ambient temperature, and then used with Compound 156.

[0633] To a solution of R-BINAL (0.2 M, 110 mL, 22.0 mmol) in THF was added a solution of compound 16 (1.16 g, 1.88 mmol) in THF (12 mL) over 5 min at −78° C. After 30 min, the reaction mixture was quenched with saturated aqueous NH4Cl solution. The mixture was warmed to room temperature, and the product was extracted with EtOAc (3 × 125 mL). The organic layer was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH (0-5%) in EtOAc containing 1% triethylamine. Yield of compound 157: 0.96 g (82%). Chiral purity was determined using analytical chiral HPLC, Chiralpak AD-H column 4.6 x 250 mm, 5 micron, 25% EtOH, 75% hexane, 0.1% diethylamine isocratic, 2 mL / min. The second-eluting R isomer was -95% area pure, corresponding to -90% ee. 38 H 48 Calculated mass for N4O2Si [M+H] + ::621.36, Actual value: 621.71.

[0634] [ka]

[0635] To a solution of compound 157 (0.925 g, 1.49 mmol) in triethyl orthoacetate (9.25 mL) was added a solution of propionic acid in trimethyl orthoacetate (0.15 M, 0.55 mL, 0.08 mmol). The reaction mixture was heated in a sealed vial at 140 °C for 1.5 h. The reaction mixture was concentrated, and the residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc (0-50%) in hexane containing 1% triethylamine. Yield of compound 158: 0.898 g (87%). 42 H 54 N4O3Si[M+H] + :691.41 and the calculated mass was 691.93.

[0636] [ka]

[0637] To a solution of compound 158 (0.893 g, 1.30 mmol) in EtOH (10 mL) was added a Pd / C slurry (loading: 10 wt%, 0.138 g, 0.13 mmol) in EtOH (4 mL). The reaction mixture was charged with H2 at 50 psi and stirred for 4.5 hours. The reaction mixture was filtered, concentrated, and used in the next step without further purification. Yield of compound 159: 0.885 g (99%). 42 H 56 N4O3Si[M+H] + :693.42 and the calculated mass was 693.82.

[0638] [ka]

[0639] A solution of Boc anhydride (0.836 g, 3.83 mmol) in THF (2.5 mL) was added to compound 159 (0.885 g, 1.28 mmol), then DMAP (20 mg / mL in THF, 155 μL, 0.0031 g, 0.026 mmol) was heated to 60 °C for 6 h. The reaction mixture was concentrated, and the residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc (0-50%) in hexanes. Yield of compound 160: 0.721 g (71%). 42 H 64 N4O5Si[M+H] + :793.47 Calculated mass:794.28.

[0640] [ka]

[0641] To a solution of compound 160 (0.621 g, 0.783 mmol) in THF (6 mL) was added a solution of TBAF in THF (1 M, 1.2 mL, 1.2 mmol) at 0 °C. The reaction mixture was warmed to room temperature and stirred for 2 h. The reaction mixture was diluted with EtOAc (30 mL) and washed with saturated aqueous NH4Cl (2 × 10 mL). The organic layer was concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of 50–100% EtOAc in hexane. Yield of compound 21: 0.362 g (83%). Chiral purity was determined by analytical chiral HPLC using a Chiralpak AD-H column, 4.6 × 250 mm, 5 micron, 20% EtOH, 80% hexane, 0.1% diethylamine, isocratic, 1.5 mL / min. The second eluting R isomer was 93% pure, corresponding to 86% ee. Compound 161 was further purified by chiral semi-preparative HPLC (Chiralpak AD-H2 1.2 x 250 mm, 5 micron, 20% EtOH, 80% hexane, 0.1% diethylamine, 60 mL / min). Final yield of compound 161: 308 mg (99% ee). 31 H 46 N4O5[M+H] + :555.36 and the calculated mass was 555.72.

[0642] [ka]

[0643] To a solution of compound 161 (0.030 g, 0.054 mmol) in ACN (0.30 mL) was added BAIB (0.042 g, 0.130 mmol) and TEMPO (2.5 mg, 0.016 mmol), followed by water (0.30 mL) at room temperature. After 2 hours, the reaction mixture was concentrated. The residue was purified by RP-HPLC (Phenomenex Gemini C18 21.2 x 250 mm, 5 microns, 0.1% TFA water / ACN, 30-80% ACN gradient). Yield of compound 162: 0.030 g (97%). 31 H 44 N4O6[M+H] +The calculated mass was 569.68 for 569.34.

[0644] [ka]

[0645] To a solution of compound 162 (33 mg, 0.058 mmol) and amino-PEG-azide (15 mg, 0.087 mmol) in DMF (0.5 mL) was added TBTU (32 mg, 0.099 mmol) followed by DIEA (35 μL, 26 mg, 0.203 mmol) at 0° C. The reaction mixture was concentrated, and the product, compound 163, was used in the next step without purification. 37 H 56 N8O7[M+H] + :725.44 and the calculated mass was 725.77.

[0646] [ka]

[0647] To a solution of compound 163 (42 mg, 0.058 mmol) in THF (0.30 mL) was added a 1 M solution of LiOH (0.174 mL, 0.174 mmol). The reaction mixture was heated at 40° C. for 1 h. An additional portion of LiOH (0.174 mL, 0.174 mmol) was added. After 3 h, the reaction was stopped and an additional portion of LiOH (0.174 mL, 0.174 mmol) was added. The reaction was stirred for an additional 2 h (9 equivalents of LiOH, 5 h total). The reaction mixture was neutralized to pH=5 with 3 N HCl and concentrated. The residue was dissolved in TFA:water [95:5] and stirred at room temperature for 2 h. The reaction mixture was concentrated, and the residue was purified by RP-HPLC (Phenomenex Gemini C18 21.2×250 mm, 5 micron, 0.1% TFA in water / ACN, 20-50% ACN gradient). Compound 164 (structure 38c): Yield 23 mg (66%). 30 H 44 N8O5[M+H] +Calculated mass: 597.35, found mass: 597.85.

[0648] [ka]

[0649] To a solution of compound 161 (30 mg, 0.054 mmol) in THF (150 μL) was added diphenylphosphoryl azide (35 μL, 45 mg, 0.162 mmol), followed by DBU (12 μL, 12 mg, 0.081 mmol) at 0° C. The reaction mixture was warmed to room temperature and stirred overnight. The next morning, the reaction mixture was heated at 60° C. for 7 hours. The reaction mixture was concentrated and purified by RP-HPLC (Phenomenex Gemini C18 21.2×250 mm, 5 microns, 0.1% TFA water / ACN, 32-60% ACN gradient). Yield of compound 165: 14 mg (44%). 31 H 45 N7O4[M+H] + Calculated mass: 580.36, found mass: 580.66.

[0650] [ka]

[0651] To a solution of compound 165 (18 mg, 0.031 mmol) in EtOH (100 μL) was added a slurry of Pd / C (10% loading, 3.3 mg, 0.003 mmol) in EtOH (170 μL). The reaction vessel was filled with H2, then evacuated three times, then filled with H2 (1 atm). After 30 min, the reaction mixture was filtered, concentrated, and used in the next step without further purification. Yield of compound 166: 17 mg (99%). 31 H 47 NO4[M+H] + Calculated mass: 554.37, found mass: 554.73.

[0652] [ka]

[0653] To a solution of compound 166 (17 mg, 0.031 mmol) and azido-PEG3-NHS ester (14 mg, 0.040 mmol) in DMF (170 μL) was added DIEA (16 μL, 12 mg, 0.092 mmol) at room temperature. The reaction mixture was stirred at room temperature for 1 hour, concentrated, and used in the next step without purification. 40 H 62 N8O8[M+H] + Calculated mass: 783.48, found mass: 783.84.

[0654] [ka]

[0655] To a solution of compound 167 (24 mg, 0.031 mmol) in THF (180 μL) was added a 1 M solution of LiOH (153 μL, 0.153 mmol). The reaction mixture was heated at 40° C., and after 1 hour, an additional portion of LiOH (153 μL, 0.153 mmol, 5 equiv.) was added. The reaction mixture was stirred at 40° C. for 3 hours and then at room temperature overnight. The reaction mixture was neutralized to pH=5 with 3N HCl and concentrated. The residue was dissolved in TFA:water [95:5] and stirred at room temperature for 3 hours. The reaction mixture was concentrated, and the residue was purified by RP-HPLC (Phenomenex Gemini C18 21.2×250 mm, 5 microns, 0.1% TFA in water / ACN, 15-45% ACN gradient). Compound 168 (structure 39c): Yield 9.8 mg (49%). C 33 H 50 N8O6[M+H] + The calculated mass was 655.40 and 656.01.

[0656] Synthesis of Pharmacokinetic Enhancers Mal-C22-diacid

[0657] [ka]

[0658] Compound 1 (0.200 g) was mixed with TBTU (0.182 g) in 2 mL of DMF. DIPEA (0.207 mL) was added dropwise. Compound 2 (0.227 g) was then added after 5 minutes. The mixture was stirred for 1 hour. The mixture was then diluted with 40 mL of DCM, washed with 5% citric acid (4 × 30 mL), dried over NaSO, filtered, and concentrated. The product was dried on a rotary evaporator and then dried under high vacuum. The resulting solid was dry loaded onto a 12 G Redi-Sep Rf column on a CombiFlash® column with Hex: EtOAc 0 => 80% for 30 minutes. Yield: 53 mg (39.2%).

[0659] [ka]

[0660] Compound 1 was azeotropically distilled twice with toluene, 20% piperidine in DMF, and a mixture of EtN. The yield was 50 mg.

[0661] [ka]

[0662] Compounds 1 (0.0350 g) and 2 (0.105 g) were combined in DMF, and EtN (0.095 mL) was added. The reaction was complete after 1 h. The mixture was then diluted with DCM, washed with 5% citric acid (3 × 8 mL), dried over NaSO, filtered, and concentrated. The product was taken up in 1 mL of toluene and loaded onto a 4G Redi-Sep Rf column on a CombiFlash® with Hex:EtOAc 0 → 100% EtOAc over 15 min. The mobile phase was then switched to DCM:DCM with 20% MeOH 0 → 100% over 20 min. Yield: 12 mg (24.9%).

[0663] [ka]

[0664] Compound 1 (0.012 g) was dissolved in 1 mL of a 1:1 mixture of DCM / TFA. The reaction was stirred for 3 hours. The product was dried on a rotary evaporator and then dried under high vacuum. Yield: 0.0110 g (99.6%).

[0665] C18-Diacid-N3

[0666] [ka]

[0667] Compound 1 (0.500 g, Asta Tech® #64704) and compound 2 (0.454 g, Chem-Impex #16167) were dissolved in DMF, and TBTU (0.442 g) and DIPEA (0.586 mL) were added. The mixture was stirred for 2 hours. The mixture was then diluted with DCM (40 mL), washed with HO (4 x 40 mL), dried over NaSO, filtered, and concentrated. The product was taken up in 2 mL of DCM and loaded onto a Redi-Sep Rf column on a CombiFlash® (mobile phase DCM:DCM, 20% MeOH 0 => 20%, 25 min). The product was concentrated under high vacuum. Yield: 740 mg (85%)

[0668] [ka]

[0669] Compound 1 (0.720 g) was dissolved in 5 mL of MeOH in a flask. A septum was placed on the flask, and the atmosphere was evacuated and replaced with nitrogen twice. Pd / C 30% (0.200 g) was then added via weighing paper. The septum was replaced, and the atmosphere was then evacuated and replaced with hydrogen twice. The reaction was stirred at room temperature for 1 hour. The mixture was filtered, and the filtrate was dried on a rotary evaporator and then dried under high vacuum. Yield: 665 mg.

[0670] [ka]

[0671] Compound 1 (0.150 g) and compound 2 (0.0618 g) were dissolved in DMF, and TBTU (0.0884 g) and DIPEA (0.117 mL) were added to the mixture. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted with DCM (12 mL), washed with water (4 × 8 mL), dried over NaSO, filtered, and concentrated under high vacuum. The product was taken up in DCM (1 mL) and loaded onto a 4G Redi-Sep Rf column on a CombiFlash® (mobile phase DCM:DCM, 20% methanol, 0 => 50%, 25 min). Yield: 162 mg (79%)

[0672] [ka]

[0673] Compound 1 (0.155 g) was dissolved in a 1:1 mixture of DCM:TFA. The reaction was stirred at room temperature for 2 hours. The product was concentrated on a rotary evaporator and placed under high vacuum. Yield: 129 mg (97%)

[0674] Mal-C18-diacid (D version)

[0675] [ka]

[0676] Compound 1 (0.500 g) and compound 2 (0.4539 g) were dissolved in DMF, and TBTU (0.4418 g) and DIPEA (0.586 mL) were added to the mixture. The reaction was stirred at room temperature for 2 hours. The mixture was then diluted with DCM (40 mL), washed with water (4 × 40 mL), dried over NaSO, filtered, and concentrated under high vacuum. The product was taken up in DCM (2 mL) and loaded onto a 4G Redi-Sep Rf column on a CombiFlash® (mobile phase DCM:DCM, 20% methanol, 0 => 50%, 25 min). Yield: 740 mg (85%)

[0677] [ka]

[0678] Compound 1 (0.720 g) was dissolved in 5 mL of MeOH, then a septum was placed on the flask and flushed twice with N2. Pd / C (0.200 g) was then added via weighing paper, then the septum was replaced and the flask was vacuumed and flushed twice with H2. The reaction was stirred at room temperature for 1 hour. The product was filtered, and the filtrate was dried on a rotavap and high vacuum. Yield: 655 mg.

[0679] [ka]

[0680] Compound 1 (0.100 g) and compound 2 (0.0318 g) were dissolved in DMF, and TBTU (0.0589 g) and DIPEA (0.078 mL) were added to the mixture. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted with DCM (10 mL), washed with water (4 × 7 mL), dried over NaSO, filtered, and concentrated under high vacuum. The product was taken up in DCM (0.5 mL) and loaded onto a 4G Redi-Sep Rf column on a CombiFlash® (mobile phase DCM:DCM, 20% methanol, 0 => 50%, 25 min). Yield: 100 mg (82%)

[0681] [ka]

[0682] Compound 1 (96 mg) was dissolved in a 1:1 mixture of TFA:DCM. The reaction was stirred at room temperature for 2 hours. The product was concentrated and placed under high vacuum. Yield 80 mg (99%)

[0683] Mal-C18-methyl-triacid

[0684] [ka]

[0685] Compound 2 (Sigma® #254487, 0.405 g) was added to a suspension of NaH (3.5 mL) in THF at 0° C., and the reaction was warmed to room temperature and stirred for 20 minutes. The reaction was mixed until clear. Compound 1 (Sigma® #684511, 0.436 g) in 2 mL of THF was then added dropwise at 0° C. and stirred for 0.5 hours. The ice bath was then removed, and the reaction was stirred overnight at room temperature. The reaction was then diluted with DCM (35 mL) and washed with NH4Cl solution (1 × 8 mL). The organics were back-extracted with DCM (1 × 8 mL). The organics were combined and washed with HO (2 × 8 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The product was purified by chromatography (wet packed in toluene (1 mL)) on a CombiFlash® 12 G RediSep Rf Gold, mobile phase hexane:hexane (10% EA => 0 => 50%, 25 min). Yield: 390 mg (64.5%)

[0686] [ka]

[0687] Compound 1 (0.100 g / 0.5 mL THF) was added to a suspension of NaH in 0.75 mL THF at 0° C., and the reaction was warmed to room temperature and stirred for 20 minutes. The reaction mixture became clear. Compound 2 (Sigma® 67692, 0.016 mL / 0.5 mL THF) was then added dropwise at 0° C. and stirred for 0.5 hours. The ice bath was removed, and the reaction was stirred overnight at room temperature. The reaction was diluted with DCM (20 mL) and washed with NH4Cl (1 × 5 mL). The organic layer was back-extracted with DCM (1 × 5 mL). The organics were combined and washed with HO (2 × 5 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The product was purified by chromatography (wet packed in toluene (1 mL)) on a CombiFlash® 12 G RediSep Rf Gold, mobile phase hexane:hexane (10% EA0 => 50%, 25 min). Yield: 30 mg (29.2%).

[0688] [ka]

[0689] Compound 1 (0.0300 g) was dissolved in 0.4 mL of THF. Then, LiOH (480 mg in 10 mL of THF) was added. The reaction was stirred for 16 hours. The reaction was acidified to pH=3 with citric acid. The organic layer was extracted with 2×6 mL of DCM, and the organic layers were combined, dried over Na2SO4, filtered, and concentrated. Yield: 25 mg (85.7%).

[0690] [ka]

[0691] Compound 1 (0.0250 g) and compound 2 (Chem Impex® #30487, 0.0238 g) were dissolved in DMF, and TBTU (0.0190 g) and DIPEA (0.022 mL) were added to the mixture. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted to 9 mL with DCM, washed with water (3 × 7 mL), dried over NaSO, filtered, and concentrated under high vacuum. The product was taken up in DCM (0.5 mL) and loaded onto a 4G Redi-Sep Rf column on a CombiFlash® (mobile phase DCM:DCM, 20% methanol, 0 => 25%, 15 min). Yield: 37.1 mg (84.7%).

[0692] [ka]

[0693] Compound 1 (0.0320 g) was dissolved in 0.5 mL of 20% piperidine in DMF. The reaction was stirred at room temperature for 1 hour. The product was concentrated under high vacuum, then dissolved in toluene and concentrated under high vacuum. The product was wet-loaded in 0.5 mL of DCM with 2 x 0.25 mL rinses onto a 4 g RediSep Gold Rf column pre-equilibrated with CombiFlash® 20% MeOH 0->50% for 20 minutes, mobile phase DCM->DCM. Yield: 0.020 g (84.7%).

[0694] [ka]

[0695] Compound 1 (0.0200 g) was added to a solution of EtN (0.022 mL) in DMF (0.4 mL). Compound 2 (AsiaTech® #24961, 0.0246 g) was then added. The reaction was stirred at room temperature for 1 hour. The reaction was diluted to 10 mL with DCM, washed with 5% citric acid in water (3 × 5 mL), dried over NaSO, filtered, and concentrated under high vacuum. The product was wet-loaded in 0.5 mL of DCM with 2 × 0.3 mL rinses onto a pre-equilibrated 4 g Redi Sep Gold Rf column, mobile phase DCM => 20% MeOH, DCM 0 => 30%, for 20 minutes. Yield: 20 mg.

[0696] The product was then taken up in 2 mL of a 1:1 mixture of TFA:DCM and stirred for 2 h. The product was concentrated on a rotary evaporator and high vacuum. Yield: 13 mg.

[0697] Mal-C 17 -Fluoro-PO3 monoacid

[0698] [ka]

[0699] Compound 1 (Sigma® #177490, 5.00 g) was dissolved in a mixture of 70 mL of THF and 20 mL of DMF. Dess-Martin Periodinane (Sigma® #274623, 11.7 g) was then added. The reaction was stirred for 3 hours. The mixture was concentrated on a rotary evaporator and high vacuum, then dry-loaded onto a 120 g Redi-Sep Gold Rf column using CombiFlash®, mobile phase hexane:EtOAc with 10% DCM, 0 => 30% in 30 minutes. Yield: 2.86 g.

[0700] [ka]

[0701] Compound 1 (2.85 g) and benzyl alcohol (1.36 mL) were mixed in 50 mL of DCM and cooled to 0 °C. EDC (2.53 g) and DMAP (0.257 g) were then added sequentially. The reaction was warmed to room temperature and then stirred for 2 h while being monitored by TLC. The mixture was extracted with NH4Cl (1 x 50 mL) solution and DCM. The organic phase was dried over Na2SO4, concentrated, and dry loaded onto an 80 g RediSep Gold Rf column, mobile phase ethyl acetate:hexane, 0 => 15% in 30 min. Yield: 2.31 g (61.0%).

[0702] [ka]

[0703] NaH (60% in oil, 0.047 mL) was added to the flask, and the flask was charged with 15 mL of THF. The flask was cooled to 0 °C, and compound 1 (AK Scientific #J91196, 0.500 g) in 2 mL of THF was added dropwise. The reaction was stirred for 5 minutes, then the ice was removed, and the reaction was stirred at room temperature for 15 minutes. The reaction was cooled to 0 °C to give compound 2 (Tokyo Chemical Industry). #f0358, 0.768 g, was added as one solid portion. 0.3 mL of anhydrous DMF was then added, and the ice bath was then removed. The reaction was stirred at room temperature overnight. The reaction was then diluted with DCM (50 mL) and washed with saturated NH4Cl (1 × 12 mL). The aqueous layer was washed with DCM (1 × 10 mL). The organics were combined, washed with HO (2 × 10 mL), dried over Na2SO4, filtered, and concentrated on a rotary evaporator and high vacuum. The product was loaded in 1.5 mL of DCM on a 4G Redi-Sep Gold Rf column on a CombiFlash, mobile phase DCM: DCM with 20% MeOH, 0 => 30% in 20 min. Yield 157 mg (36.2%). [ka]

[0704] Compound 2 (0.149 g / 0.5 mL THF) was added to a suspension of NaH in THF (0.75 mL) at 0° C., and the reaction was warmed to room temperature and stirred for 20 min. A solution of compound 1 (0.140 g) in 1.25 mL of THF was added slowly at 0° C. and stirred for 0.5 h. The reaction was then diluted with DCM (20 mL) and washed with saturated NH4Cl (1 × 5 mL). The product was back-extracted with DCM (1 × 5 mL). The combined organic layers were washed with H2O (2 × 5 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The product was dry-loaded onto 1 g of silica, 4G RediSep Rf Gold, mobile phase hexane:EtOAc 0 => 50%. Yield 67 mg (33.7%)

[0705] [ka]

[0706] Compound 1 (0.0530 g) was dissolved in 2 mL of MeOH, then a septum was placed on the flask and flushed twice with N2. Pd / C (0.0250 g) was then added via weighing paper, then the septum was replaced and the flask was evacuated and flushed twice with H2. The reaction was stirred at room temperature for 2 hours. The product was filtered through a syringe filter, and the filtrate was dried in a rotavape and high vacuum. Yield: 36 mg (82.0%)

[0707] [ka]

[0708] Compound 1 (0.0200 g) was dissolved in 0.3 mL of DMF, followed by the addition of TBTU (0.0174 g) and then 0.021 mL of DIPEA. The mixture was stirred for 5 minutes, and then compound 2 (Chem Impex® #30487, 0.0217 g) was added. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted with 6 mL of DCM, washed with HO (3 × 3 mL), dried over NaSO, filtered, and concentrated on a rotary evaporator and high vacuum. The product was loaded in 1 mL of DCM onto a RediSep 4G Gold Rf column on a CombiFlash® mobile phase: DCM:20% MeOH, 0 => 30% DCM over 15 minutes. Yield: 10 mg (88.8%)

[0709] [ka]

[0710] Compound 1 (0.0330 g) was dissolved in 0.5 mL of DMF with 20% piperidine. The reaction was stirred at room temperature for 1 hour. The reaction was concentrated on a rotary evaporator and high vacuum. The product was loaded in 1 mL of DCM onto a 4G RediSep Gold Rf column on a CombiFlash, mobile phase: DCM with 20% MeOH, 0 => 50% in 20 minutes. Yield: 11.5 mg (48.5%)

[0711] [ka]

[0712] Compound 1 (0.0115 g) was dissolved in 0.3 mL of DMF, and compound 2 (Asta Tech® #24961, 0.0156 g) and EtN (0.014 mL) were added. The reaction was stirred overnight at room temperature. The reaction was then diluted with DCM (6 mL), washed with 5% citric acid (3 × 3 mL), dried over NaSO, filtered, and concentrated. The product was loaded in 1 mL of DCM onto a 4G RediSep Gold Rf column on a CombiFlash, mobile phase: DCM with 20% MeOH at 0% to 35% in 20 min. Yield: 10 mg (64.9%)

[0713] [ka]

[0714] Compound 1 (0.0100 g) was dissolved in 0.3 mL of DCM, and the mixture was cooled to 0° C. After that, 0.051 mL of TMS-Br was added, and the reaction was stirred at 0° C. for 4 hours, then at room temperature for 3 hours. The reaction was dried, and 1 mL of MeOH was added. The reaction was stirred overnight. The product was dried on a rotary evaporator and high-vacuumed with toluene (3×1 mL). The reaction was then taken up in 1 mL of DCM:TFA 1:1 and stirred at room temperature. After 1.5 hours, the reaction was concentrated on a rotary evaporator and high-vacuum. Yield: 8.5 mg (99%)

[0715] Mal-C 17 -Fluoro-PO3

[0716] [ka]

[0717] Compound 1 (0.0150 g) was dissolved in 0.25 mL of DMF. TBTU (0.0125) was then added to the mixture, followed by DIEA (0.015 mL), and the mixture was stirred for 5 minutes. Compound 2 (0.0062 g) was then added to the mixture, and the reaction was stirred at room temperature for 1 hour. The reaction was then diluted with DCM (6 mL), washed with FLO (3 × 3 mL), dried over NaSO, filtered, and concentrated on a rotary evaporator and high vacuum. The product was loaded in 1 mL of DCM over 15 minutes onto a 4G RediSep Gold Rf column on a CombiFlash, mobile phase DCM:0 => 30% DCM with 20% MeOH. Yield: 12.5 mg (64.7%)

[0718] [ka]

[0719] A solution of compound 1 (0.0125 g) in 0.4 mL of DCM was cooled to 0° C. and TMSBr was added dropwise. The reaction was stirred at 0° C. for 3 hours. The volatiles were completely removed by rotary evaporation and high vacuum. The residue was stirred with MeOH for 2 hours to remove TMS. The mixture was dried on a rotary evaporator and then dried under high vacuum. Yield: 11.5 mg (98.8%)

[0720] Synthesis of Mal-C18-diacid and related compounds

[0721] [ka]

[0722] Step 1: Compound 1 (MW = 370.57, 0.741 g, 2 mmol) was dissolved in 10 mL of DMF. TBTU (MW = 321, 0.642 g, 2 mmol) and DIPEA (MW = 129, 0.87 mL, 5 mmol) were added sequentially, and the mixture was stirred for 5 min. Compound 2 (MW = 418.9, 0.838 g, 2 mmol) was added. The solution was stirred for 1 h. The solution was diluted with 40 mL of DCM and washed three times with water (40 mL each time). The organic phase was evaporated and purified using column chromatography (EA:HEX = 0% to 100%) to give compound 3 (80% yield). (Observed mass, M+1 = 736).

[0723] Step 2: Compound 3 was treated with 20% piperidine in DMF for 30 minutes. The solvent was evaporated, and the residue was purified by chromatography (MeOH:DCM = 0-10%). (Observed mass, M+1 = 514). (Observed mass, M+1 = 707).

[0724] Step 3: Compound 4 (Mw = 513, 50 mg, 0.0975 mmol) was dissolved in 1 ml of DMF. Compound 5 (Mw = 308, 36 mg, 1.2 eq) and TEA (0.041 ml, 3 eq) were added. The reaction was stirred for 2 h. The solution was diluted with DCM and washed three times with water. The organic phase was evaporated and purified by chromatography (EA:HEX = 0%-100%) to give compound 6. (Observed mass, M+1 = 594).

[0725] Step 4: Compound 6 was treated with 50% TFA in DCM for 2 hours. The solvent was evaporated to give compound 7 (Mal-C18-diacid) (mass observed, M+1=594).

[0726] Mal-C18-triacid

[0727] [ka]

[0728] Step 1: Compound 9 (1.2 equiv.) was added to a solution of NaH (1.2 equiv.) in 3 ml of THF at 0 °C and stirred at room temperature for 0.5 h. Compound 8 (1 mmol, 1 equiv.) in 1 ml of THF was then added dropwise to the mixture at 0 °C, and the mixture was stirred at 0 °C for 0.5 h until the solution became clear. The solution was then warmed to room temperature, gradually forming a slurry. After 5 h, the reaction was quenched with NHCl and extracted with DCM. The product was purified by column (Hex:10% EtOAc in hexane), with a peak of approximately 0% to 3% EtOAc. (Yield 42%, 200 mg) (mass observed, M+1 = 486).

[0729] Step 2: Compound 10 was dissolved in THF (3 mL) and 1M LiOH (3 mL) was added. The reaction was stirred at 25° C. for 16 hours, then acidified with citric acid to pH=3 and extracted with DCM (3×10 mL). The organic phases were combined and concentrated in vacuo without further purification. (Observed mass, M+1=472).

[0730] Mal-C18-triacid was synthesized using the same synthesis as described for Mal-C18-diacid, substituting compound 11 for compound 1. (Observed mass, M+1=638).

[0731] Mal-C 18 -Diacid-PO3

[0732] [ka]

[0733] Step 1: Compound 12 (2.64 mmol, 1 eq.) and compound 13 (2.909 mmol, 1.1 eq.) were mixed together in DCM and the mixture was cooled to 0 °C. EDC (1.1 eq.) and DMAP (0.2 eq.) were added sequentially. The reaction was allowed to warm to room temperature. The reaction was stirred for 2 h and monitored by TLC (hexane: EtOAc 8:2). The organics were extracted with NH4Cl solution and DCM. The organic phase was dried over Na2SO4, concentrated, and purified using chromatography (EA:HEX = 0% to 10%). The product spot accounted for approximately 2% of EA. (Observed mass, M+1 = 426).

[0734] Step 2: Compound 15 (1.2 equiv.) was added to a solution of NaH (1.2 equiv.) in 3 mL of THF at 0 °C and stirred at room temperature for 0.5 h. Compound 14 (0.470 mmol, 1 equiv.) in 1 mL of THF was added dropwise to the mixture at 0 °C and stirred at 0 °C for 0.5 h, at which point the solution was clear. The mixture was then warmed to room temperature, and the solution gradually became a slurry. After 5 h, the reaction was quenched with NH4Cl and extracted with DCM. On column chromatography (hexagonal: 10% EtOAc in hexane), the peak reached approximately 3% of EtOAc. (Yield 16%, 45 mg) (mass observed, M+1 = 598).

[0735] Step 3: Compound 16 (0.0519 mmol, 1 equiv.) was dissolved in MeOH. Pd / C (60 mg) was then added to the reaction, and several purging and refilling cycles were performed with H. The reaction was stirred at 25° C. for 12 h. The mixture was filtered through silica and concentrated in vacuo to give the product (24 mg, 92% yield) (observed mass, M+1=508).

[0736] Mal-C 18 -diacid-PO3 was synthesized similarly to Mal-C18-diacid by substituting compound 17 for compound 1 in the synthesis of Mal-C18-diacid. (Observed mass, M+1 = 674).

[0737] Mal-C6-PEG2-C18-diacid

[0738] [ka]

[0739] Step 1: Compound 1 (1 equiv., 2 mmol) was dissolved in 10 mL of DMF. TBTU (1 equiv., 2 mmol) and DIPEA (2.5 equiv., 5 mmol) were added successively, and the mixture was stirred for 5 min. Compound 2 (1 equiv., 2 mmol) was added. The solution was stirred for 1 h. The solution was diluted with 40 mL of DCM and washed three times with water (40 mL each time). The organic phase was evaporated and purified by chromatography (DCM: 20% MeOH = 0% to 25% DCM) to give compound 3 (80% yield). (Observed mass, M+1 = 647). (Observed mass, M+1 = 767)

[0740] Step 2: Compound 3 (1.6 mmol, 1 equiv.) was dissolved in MeOH. Pd / C (150 mg) was added to the reaction, and several purging and refilling cycles were performed with H. The reaction was stirred at 25° C. for 12 h. The reaction was filtered through silica and concentrated in vacuo to give the product (1.5 mmol, 94% yield) (observed mass, M+1=557).

[0741] Step 3: Compound 4 (1 eq., 1.5 mmol) was dissolved in 10 ml of DMF. TBTU (1 eq.) and DIPEA (2.5 eq.) were added successively, and the mixture was stirred for 5 min. Compound 5 (1 eq., 1.5 mmol) was added. The solution was stirred for 1 h. The solution was diluted with 40 mL of DCM and washed three times with water (40 mL each time). The organic phase was evaporated and chromatographed (DCM:DCM with 20% MeOH = 0% to 25%) to give compound 6 (80% yield). (Observed mass, M+1 = 909).

[0742] Step 4: Compound 6 (1 equiv., 1.2 mmol) was treated with 20% piperidine in DMF for 30 min. The solvent was evaporated, and the residue was purified by chromatography (DCM:20% MeOH = 0% to 30% in DCM) to give compound 7 (0.984 mmol, 82% yield) (mass observed, M+1 = 687).

[0743] Step 5: Compound 7 (1 eq., 0.984 mmol) was dissolved in 1 mL of DMF. Compound 8 (1.2 eq., 1.18 mmol) and TEA (3 eq., 2.952 mmol) were added. The reaction was stirred for 2 h. The solution was diluted with DCM (30 mL) and washed three times with water (15 mL each time). The organic phase was evaporated and chromatographed (DCM:20% MeOH = 0% to 30% DCM) to give compound 9 (0.738 mmol, 75% yield). (Observed mass, M+1 = 880).

[0744] Step 6: Compound 9 was treated with 50% TFA in DCM for 2 hours. The mixture was concentrated in vacuo to give compound 10. (Observed mass, M+1=768).

[0745] Mal-C6-PEG4-C18-diacid

[0746] Mal-C6-PEG4-C18-diacid was synthesized similarly to Mal-C18-diacid, except that compound 7 was treated with NHFmoc-PEG2-NH2. The Fmoc protecting group was removed by 20% piperidine deprotection as described in step 4, and then steps 5 and 6 were repeated as described above (mass observed, M+1=912).

[0747] Mal-Bis C18-diacid

[0748] [ka]

[0749] Steps 1 and 2: Compound 4 was synthesized as described in the synthesis of Mal-C18-diacid above.

[0750] Step 3: Compound 5 (1.0 mmol, 1 eq.), compound 6 (1.3 eq.), and TEA (5.0 eq.) were thoroughly mixed in 3 mL of DMF. The reaction was stirred overnight. The mixture was concentrated on a rotary evaporator and purified by column chromatography. The product eluted with approximately 4% MeOH in 1% HOAc in DCM. LC-MS showed the desired peak with an impurity. The final product weighed 170 mg in 45% yield.

[0751] Step 4: Compound 7 (0.12 mmol, 1 equiv.), compound 8 (2.4 equiv.), TBTU (2.4 equiv.), and DIPEA (5.0 equiv.) were thoroughly mixed in 1 mL of DMF. The reaction was stirred overnight. LC-MS showed the product, one major by-product (overproduct), and three minor impurities. The mixture was concentrated on a rotary evaporator and purified on a column with DCM / MeOH. The product eluted with approximately 6-12% MeOH. The final product was obtained as 78 mg (oil) in 42% yield.

[0752] Step 5: Compound 9 (0.05 mmol) was dissolved in 2 mL of DCM / TFA (1 / 1, v / v). The reaction was stirred for 1 hour. The solvent was evaporated to give 72 mg of compound 10 in 99% yield.

[0753] Step 6: Compound 10 (0.05 mmol, 1 equiv.), compound 4 (2.2 equiv.), TBTU (2.2 equiv.), and DIPEA (8.0 equiv.) were thoroughly mixed in 0.5 mL of DMF. The reaction was stirred for 1 h. LC-MS showed the product as well as one major by-product (non-polar TFA method). The mixture was concentrated on a rotary evaporator and purified on a column with DCM / MeOH. The product eluted with approximately 8-12% MeOH. Compound 11 was obtained as 60 mg, a 49% yield.

[0754] Step 7: Compound 11 (0.025 mmol) was dissolved in 0.5 mL of DCM / TFA (1 / 1, v / v). The reaction was stirred for 1 h. The solvent was evaporated to give compound 12, 53 mg, in 97% yield.

[0755] Mal-C 18-Synthesis of acids and related compounds

[0756] [ka]

[0757] Step 1: Compound 1 (0.27 mmol, 1 eq.) was dissolved in 1 mL of DMF. TBTU (1 eq.) and DIPEA (2.5 eq.) were added successively, and the mixture was stirred for 5 min. Compound 2 was added (1 eq.). The solution was stirred for 1 h. The solution was diluted with 40 ml of DCM and washed with water three times (40 mL each time). The organic phase was concentrated using a rotary evaporator and purified using column chromatography (EA:HEX = 0%-100%) to give compound 3. (Observed mass, M+1 = 494).

[0758] Step 2: Compound 3 was treated with 50% TFA in DCM for 2 hours. The product was concentrated using a rotary evaporator to give compound 4. (Observed mass, M+1=437).

[0759] Mal-C 20 -acid

[0760] Mal-C 20 -Acid was obtained by using commercially available C instead of compound 1. 20 Synthesized similarly to Mal-C18-acid using starting material (mass observed, M+1=465).

[0761] Mal-C 17 -PO3

[0762] [ka]

[0763] Step 1: DMP (1.3 eq, 4.78 mmol) and compound 5 (1 eq, 3.68 mmol) were mixed in DMF (15 mL). After 2 h, the reaction was complete as indicated by TLC. Some solid precipitate formed. Workup: Filtration to remove solids, rinsing with DCM. The product was concentrated in vacuo and purified using chromatography (10% DCM:EtOAC ≥ 0%-20% Hex) eluting the product with 5%-10% (0.8136 mmol, 22% yield) (observed mass, M+1 = 271).

[0764] Step 2: Compound 6 (1 equiv., 0.8136 mmol) and compound 7 (1.1 equiv., 0.8949 mmol) were mixed in DCM (5 mL) and cooled to 0 °C. EDC (1.1 equiv.) and DMAP (0.2 equiv.) were added sequentially. The reaction was allowed to warm to room temperature. The reaction was stirred for 2 h and monitored by TLC (hexane:EtOAc 8:2). The product was extracted with NH4Cl solution and DCM. The organic phase was dried over Na2SO4, concentrated, and purified by chromatography (Hex:EtOAC = 0% to 10%). The product spot was obtained with 4% EtOAc (0.4438 mmol, 54.5% yield). (Observed mass, M+1 = 361).

[0765] Step 3: Compound 9 (1.4 equiv.) was added to a solution of NaH (1.2 equiv.) in 1.5 ml of THF at 0 °C and stirred at room temperature for 0.5 h. Compound 8 (1 equiv., 0.4438 mmol) in 1 ml of THF was added dropwise to the mixture at 0 °C and stirred at 0 °C for 0.5 h, at which point the solution remained clear. The mixture was allowed to warm to room temperature, gradually forming a slurry. After 5 h, the reaction was quenched with NH4Cl and extracted with DCM. Column (Hex: EtOAc >= 0% to 50%), 35% EtOAc afforded the product (0.2020 mmol, 45.5% yield) (observed mass, M+1 = 496).

[0766] Step 4: Compound 10 (1 equiv., 0.2020 mmol) was dissolved in a 1:1:1 mixture of MeOH, THF, and 1 M LiOH (total solution 3 mL). The mixture was stirred at 25 °C for 2 h, and the reaction was acidified to pH = 3 with citric acid and extracted with DCM (3 × 10 mL). The organic phases were combined, dried over Na SO , filtered, and concentrated in vacuo. No further purification was required. (Observed mass, M + 1 = 405).

[0767] Step 5: Compound 11 (1 eq., 0.0938 mmol) was dissolved in 1 mL of DMF. TBTU (1 eq.) and DIPEA (2.5 eq.) were added successively, and the mixture was stirred for 5 min. Compound 2 was added (1 eq.). The solution was stirred for 1 h. The solution was diluted with 10 mL of DCM and washed three times with water (5 mL each time). The organic phase was evaporated and purified by chromatography (DCM:20% MeOH = 0% to 30% DCM) to give compound 12 (0.0683, 73% yield) (mass observed, M+1 = 528).

[0768] Step 6: A solution of compound 12 in DCM was cooled to 0°C and TMS-Br was added dropwise. The reaction was stirred at 0°C and monitored by LC-MS. The reaction was complete within 2.5 hours. The volatiles were completely removed by rotary evaporation and high vacuum (to completely remove the acid). The residue was stirred with MeOH for 2 hours to remove TMS. The product was concentrated in vacuo to give the desired product. (Yield taken as 100%) (Observed mass, M+1 = 471).

[0769] Mal-C 18 -Diacid (L version)

[0770] Mal-C18-diacid (L-version) was synthesized in the same manner as Mal-C18-Mal-C18-Glu(L)-diacid, but using Glu(D) instead of Glu(L) (mass observation, M+1 = 567).

[0771] Synthesis of Mal-C6-C12-PEG2-C18 diacid and related compounds

[0772] [ka]

[0773] Steps 1 and 2: Compound 4 was synthesized as described in the synthesis of Mal-C18-diacid above.

[0774] Step 3: Compound 5 (1 mmol, 1 eq) was treated with 3 mL 20% piperidine in DMF for 20 min. The resin was then rinsed three times with DMF and used in the next step without further p...

Claims

1. An RNAi agent for inhibiting expression of the HIF-2α (EPAS1) gene, comprising an antisense strand and a sense strand, (i) the antisense strand comprises the nucleobase sequence UUUCAUGAAAUCGUUACGUUG (SEQ ID NO: 827); wherein all nucleotides of the antisense strand are modified nucleotides; (ii) the sense strand is Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z UG Z aa Z sa(invAb)(6-S)-X (SEQ ID NO: 761), wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s represents a phosphorothioate bond; u Z , a Z , g Z , and c Z represent uridine, adenosine, guanosine, and cytidine, respectively, and the Z-containing pharmacological moiety Z is linked to the 2' position of the nucleotide; Y-(NH-C6) is 【Chemistry 1】 represents; (invAb) represents an inverted abasic moiety; (6-S) represents 【Chemistry 2】 represents; Y represents a targeting group comprising one or more targeting ligands, wherein the targeting ligands are selected from the group consisting of Structure 2a, Structure 2.11a, Structure 29a, and Structure 32a; Z represents a targeting ligand having a structure selected from the group consisting of structure 2a, structure 2.11a, structure 29a, and structure 32a; Structure 2a, Structure 2.11a, Structure 29a, and Structure 32a are respectively as follows: 【Transformation 3】 and X is a C-18 diacid, a C-18 triacid, Mal-C 17 -vinyl-PO 3 and Mal-C20 acid, and a C-18 diacid, a C-18 triacid, Mal-C 17 -vinyl-PO 3 The structures of Mal-C20 acid and Mal-C20 acid are as follows: 【Chemistry 4】 The RNAi agent.

2. 2. The RNAi agent of claim 1, wherein the at least one modified nucleotide is selected from the group consisting of a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2',3'-seconucleotide mimic, a locked nucleotide, a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted 2'-O-methyl nucleotide, an inverted 2'-deoxy nucleotide, an inverted 2'-amino modified nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a vinylphosphonate modified ribonucleotide, a cyclopropylphosphonate modified nucleotide, a 2'-O-propargyl modified nucleotide, a 2'-O-triazole modified nucleotide, and a 3'-O-methyl nucleotide.

3. 3. The RNAi agent of claim 2, wherein each modified nucleotide is independently selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, and 2'-O-triazole modified nucleotides.

4. The antisense strand is usUfsuCfaUfgAfaAfucgUfuAfcGfususg (SEQ ID NO: 29); usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30); usUfsusCfaUfgAfaAfuCfgUfuAfcGfusUfsg (SEQ ID NO: 72); usUfsusCfsasUfgAfaAfuCfgUfuAfscsGfsusUfsg (SEQ ID NO: 73); and usUfsuCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 77) The RNAi agent according to any one of claims 1 to 3, comprising any one nucleotide sequence of modified antisense strand sequences selected from the group consisting of:

5. 5. The targeting ligand has the structure: 【Transformation 5】 The RNAi agent according to any one of claims 1 to 4,

6. Each Z is represented by structure 2a: 【Transformation 6】 is a targeting ligand having the structure 【Transformation 7】 The RNAi agent of any one of claims 1 to 5, wherein indicates a binding point.

7. X is a C-18 diacid: 【Transformation 8】 is a PK enhancer having the structure 【Chemistry 9】 The RNAi agent of any one of claims 1 to 6, wherein indicates a binding point.

8. Y is TriAlk 14: 【Chemistry 10】 Or TriAlk 14S: 【Chemistry 11】 is a targeting group having the structure 2. The RNAi agent of claim 1, wherein TL comprises a targeting ligand selected from the group consisting of structure 2a, structure 2.11a, structure 29a, and structure 32a.

9. Each TL has the structure 2a: 【Chemistry 12】 Including, 【Chemistry 13】 The RNAi agent of claim 8, wherein indicates a binding point.

10. 10. A composition comprising an RNAi agent as defined in any one of claims 1 to 9, and comprising a pharmaceutically acceptable excipient.

11. 11. The composition of claim 10, further comprising one or more additional therapeutic agents.

12. 12. The RNAi agent of any one of claims 1 to 9 or the composition of claim 10 or 11 for use in treating a disease, disorder, or condition mediated at least in part by HIF-2α (EPAS1) gene expression.

13. The RNAi agent or composition of claim 12, wherein the disease is ccRCC.

14. Use of an RNAi agent according to any one of claims 1 to 9 or a composition according to claim 10 or 11 for the preparation of a pharmaceutical composition for treating a disease, disorder or condition mediated at least in part by HIF-2α (EPAS1) gene expression.

15. 15. The use according to claim 14, wherein the disease is ccRCC.

Citation Information

Patent Citations

  • Compositions and methods for inhibiting gene expression of hif2α

    JP2018516595A