Compounds for detecting bacteria causing fire blight on fruit trees and their uses

Abstract

An objective of the present invention is to provide a fluorescent compound for detecting Erwinia amylovora and diagnosing fire blight on fruit trees, as well as a method for diagnosing fire blight on fruit trees using the related compounds. [Solution] The present invention relates to a compound for diagnosing fire blight on fruit trees based on fluorescence and its use. The compound can detect Erwinia amylovora, the causative bacterium of fire blight on fruit trees, and emit red fluorescence. It has a fast diagnostic speed and high sensitivity, so it can be usefully used to diagnose fire blight on fruit trees using various and simple methods such as spraying or using a cotton swab, without requiring specialized equipment.

Description

[Technical Field]

[0001] The present invention relates to a compound for detecting the causative bacterium of fire blight on fruit trees and for diagnosing fire blight on fruit trees, and uses thereof. [Background technology]

[0002] Fire blight is a typical plant disease caused by Erwinia amylovora (E. amylovora), which infects plants of the Rosaceae family, such as pears, apples, and apricots. Plants infected with fire blight exhibit symptoms such as withering and blackening, as if burned, and these symptoms appear on all plant organs, including flowers, leaves, branches, and fruit. The disease cycle of fire blight is characterized by Erwinia amylovora overwintering in low concentrations primarily on tree branches and diseased areas, and then spreading in the spring via insects, rain, and wind. In particular, when flowers, one of the main plant organs, become infected with Erwinia amylovora, it can spread to the entire plant and the surrounding soil.

[0003] Once fire blight on fruit trees has broken out, it is difficult to control and spreads quickly, so infected plants must be immediately burned and buried. In South Korea, the disease first broke out in some orchards in Anseong, Gyeonggi Province in 2015, and since then, cases of the disease have been appearing every year. As the affected areas expand, the time and financial burden of disposing of infected fruit trees continues to increase.

[0004] Therefore, to prevent fire blight on fruit trees, it is essential to accurately detect the causative bacteria present in infected plants before the infection spreads. Existing methods for diagnosing fire blight on fruit trees rely on PCR and DNA-based diagnostic methods. While PCR-based diagnostic methods have high sensitivity, they require experts and specialized equipment, making them less applicable in the field. Furthermore, DNA-based diagnostic methods require a destructive sample collection pretreatment process, which can lead to leakage of the pathogen during diagnosis.

[0005] In response to this, for example, Patent Document 1 discloses a method for imparting fire blight resistance to scions or rootstock cultivars of apple fruit by transforming the scions or rootstock cultivars of apple fruit with a gene encoding a lytic protein. However, no method is known yet that can be applied in the field and enables rapid diagnosis of fire blight on fruit trees.

[0006] Against this background, the present inventors have endeavored to develop a method for diagnosing fire blight in fruit trees that is applicable in the field, non-destructive, and rapid. As a result, they developed a fluorescent substance that can specifically stain Erwinia amylovora, and confirmed that this fluorescent substance can actually be used to detect Erwinia amylovora in fruit trees, thereby completing the present invention. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] Patent Publication No. 8-502169 Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide a compound for detecting Erwinia amylovora and diagnosing fire blight on fruit trees, and a method for diagnosing fire blight on fruit trees using the compound.

[0009] Another object of the present invention is to provide a method for preparing said compound.

[0010] It is yet another object of the present invention to provide a composition for detecting Erwinia amylovora and diagnosing fire blight on fruit trees, which comprises the compound.

[0011] It is still another object of the present invention to provide a method for detecting Erwinia amylovora and a method for diagnosing fire blight on fruit trees using the compound. [Means for solving the problem]

[0012] To achieve the above objectives, The present invention provides a compound represented by the following chemical formula 1 (hereinafter also referred to as "B-1"):

[0013] [ka]

[0014] The present invention also provides a method for producing the compound represented by Chemical Formula 1, comprising the steps of: reacting 6-(dimethylamino)-3-hydroxy-2-naphthaldehyde with bromoacetonitrile and potassium carbonate to obtain compound 3 represented by Chemical Formula 3; reacting compound 3 with phenylboronic acid, trifluoroacetic acid, palladium(II) trifluoroacetate, and 6,6'-dimethyl-2,2'-dipyridyl to obtain compound 2 represented by Chemical Formula 2; and reacting compound 2 with malononitrile to obtain the compound represented by Chemical Formula 1:

[0015] [ka]

[0016] [ka]

[0017] Furthermore, the present invention provides a composition for detecting Erwinia amylovora, comprising the compound represented by Chemical Formula 1.

[0018] The present invention also provides a method for detecting Erwinia amylovora using the compound represented by Chemical Formula 1.

[0019] The present invention also provides a composition for diagnosing fire blight in fruit trees, comprising the compound represented by Chemical Formula 1.

[0020] The present invention also provides a method for diagnosing fire blight on fruit trees using the compound represented by Chemical Formula 1.

[0021] Furthermore, the present invention provides a composition for screening substances for controlling fire blight in fruit trees, comprising the compound represented by Chemical Formula 1 and Erwinia amylovora, and a screening method using the same. [Effects of the Invention]

[0022] The synthesized compound B-1 of the present invention has the property of emitting red fluorescence upon detecting Erwinia amylovora, the causative agent of fire blight on fruit trees, and is highly sensitive to Erwinia amylovora.

[0023] Furthermore, compound B-1 can be used without requiring specialized equipment by simply applying it to a sample using a variety of simple methods, such as coating, impregnation, spraying, dripping, and immersion. Furthermore, the compound that reacts with Erwinia amylovora can be used to diagnose the presence or absence of fire blight in fruit trees simply by irradiating it with UV light and checking for fluorescence, making it useful for diagnosing fire blight in fruit trees. In particular, compared to existing methods for diagnosing fire blight in fruit trees, such as PCR and DNA-based diagnostic methods, compound B-1 has faster speed and higher sensitivity, allowing for the detection of Erwinia amylovora in a short period of time, making it suitable for use in the field, such as at fruit farms. [Brief explanation of the drawings]

[0024] [Figure 1] 1 is a schematic diagram showing the synthesis method of B-1 of the present invention. Each synthesis step was carried out under the following conditions: (a) bromoacetonitrile, K2CO3, DMF, 50°C, 2 hours; (b) phenylboronic acid, Pd(TFA)2, 6,6'-dimethyl-2,2'-dipyridyl, trifluoroacetic acid (TFA), 2-MeTHF, 80°C, 24 hours; and (c) malononitrile, pyridine, 70°C, overnight. [Figure 2] 1 is a graph showing changes in absorption and fluorescence of B-1 caused by Erwinia amylovora. [Figure 3] 1 is a graph showing the increase in B-1 fluorescence depending on the concentration of Erwinia amylovora. [Figure 4] This is a graph showing the detection limit of Erwinia amylovora B-1. [Figure 5] This is a graph showing the change in fluorescence of Erwinia amylovora in B-1 over reaction time. [Figure 6] This is a diagram showing the staining ability of B-1 for Erwinia amylovora, stained with both B-1 and DAPI. [Figure 7] This figure shows the method for spraying B-1 to detect Erwinia amylovora on plant surfaces and the results. (a) Schematic diagram of the method for detecting Erwinia amylovora by spraying B-1, (b) Results of spraying B-1 to detect various concentrations of Erwinia amylovora on immature apples and apple tree flowers, (c, d) Graphs showing the fluorescence changes in (b), and (e) Results of PCR performed to cross-validate the experiment in (b). [Figure 8] These figures show the method for detecting Erwinia amylovora actually present on the surface of plants by spraying B-1 or using a cotton swab, and the results: (a) Schematic diagram showing the method for detecting Erwinia amylovora actually present on the surface of plants by spraying B-1 or using a cotton swab, (b) The result of detecting Erwinia amylovora present on apple tree branches after spraying B-1, and (c, d) The result of detecting Erwinia amylovora present on apple tree flowers and leaves after dipping a cotton swab in B-1 solution. [Figure 9] The diagrams show the method for spraying B-1 and detecting Erwinia amylovora on the surface of agricultural machinery and the results: (a) Schematic diagram showing the method for spraying B-1 and detecting Erwinia amylovora on the surface of agricultural machinery, and (b) Results of spraying B-1 and detecting Erwinia amylovora on the surface of agricultural machinery. BEST MODE FOR CARRYING OUT THE INVENTION

[0025] The present inventors have endeavored to develop a new diagnostic method that overcomes the time and space problems inherent in existing PCR- or DNA-based diagnostic methods for fire blight on fruit trees. As a result, they devised a compound that reacts specifically with Erwinia amylovora, the causative agent of fire blight on fruit trees. They then noticed that this compound has the property of emitting fluorescence when it reacts with Erwinia amylovora, leading to the development of the compound of the present invention.

[0026] One aspect of the present invention is a compound represented by the following chemical formula 1:

[0027] [ka]

[0028] In the examples of the present invention, the compound represented by Chemical Formula 1 is also referred to as "B-1."

[0029] In one embodiment of the present invention, the compound represented by Chemical Formula 1 has the property of emitting fluorescence when detecting Erwinia amylovora, a pathogen causing fire blight in fruit trees.

[0030] In one embodiment of the present invention, the compound represented by Chemical Formula 1 specifically reacts with Erwinia amylovora, and emits red fluorescence upon reacting with Erwinia amylovora. The higher the concentration of Erwinia amylovora bacteria, the stronger the emitted fluorescence.

[0031] In another embodiment of the present invention, the compound represented by Chemical Formula 1 reacts with Erwinia amylovora, which is present in not only plants but also in various other things, to fluoresce and thus can be visualized.

[0032] In one example of the present invention, it was confirmed that when the compound represented by Chemical Formula 1 was reacted with Erwinia amylovora, fluorescence intensity increased significantly under UV light of 686 nm (Example 2), and that the intensity of fluorescence also increased as the concentration of Erwinia amylovora increased (Example 3).

[0033] In another embodiment of the present invention, the compound represented by Formula 1 may be present in an amount of up to 10 2 It was confirmed that Erwinia amylovora could be detected up to CFU / mL (Example 4), and an increase in fluorescence was observed within 10 minutes (Example 5).

[0034] In another example, it was confirmed that the compound represented by Chemical Formula 1 reacted with live Erwinia amylovora and emitted red fluorescence through confocal laser scanning microscopy (Example 6).

[0035] In other examples of the present invention, it was confirmed that the compound represented by Chemical Formula 1 can detect Erwinia amylovora present on the surface of objects and plants (Examples 7 to 9). In Examples 7 and 8, 10% of Erwinia amylovora was detected from the fruit, branches, flowers, etc. of an apple tree. 2 The method effectively detected Erwinia amylovora down to CFU / mL, and confirmed the applicability of spraying and swabbing methods. In Example 9, it was also confirmed that Erwinia amylovora present on the surface of agricultural machinery could be efficiently detected.

[0036] From the above results, it was revealed that the compound represented by the above chemical formula 1 can be used to confirm whether or not fruit trees are infected with fire blight by utilizing its property of emitting fluorescence specific to Erwinia amylovora, the causative agent of fire blight in fruit trees.

[0037] In one embodiment of the present invention, the compound represented by Chemical Formula 1 can be used for diagnosing fire blight in fruit trees.

[0038] In another embodiment of the present invention, the compound represented by Chemical Formula 1 exhibits fluorescence in a subject infected with Erwinia amylovora, the causative agent of fire blight in fruit trees.

[0039] Objects contaminated with Erwinia amylovora, the causative agent of fire blight, include plants susceptible to fire blight, soil in which fire blight-infected plants are planted, and equipment or tools that have come into contact with fire blight-infected plants or soil. The plants include fruit trees, such as, but not limited to, apple, rowan, and plants of the Rosaceae family, and the tools or tools include agricultural tools, such as, but not limited to, pruning shears and trowels.

[0040] In one embodiment of the present invention, the compound represented by Chemical Formula 1 is applied to the surface of a target contaminated with Erwinia amylovora, the causative bacterium of fire blight of fruit trees, by various methods such as coating, impregnation, spraying, dripping, immersion, etc., and the fluorescence generated when irradiated with UV light is measured to diagnose the presence or absence of contamination with Erwinia amylovora, the causative bacterium of fire blight of fruit trees.

[0041] In another embodiment of the present invention, the UV light may be irradiated using a flashlight, lantern, or lamp, and may have a wavelength of 350 to 370 nm, preferably 360 to 370 nm, and most preferably 365 nm.

[0042] Another aspect of the present invention is a method for producing a compound represented by Chemical Formula 1, comprising the step of reacting Compound 2 represented by Chemical Formula 2 below with malononitrile to produce the compound represented by Chemical Formula 1:

[0043] [ka]

[0044] To prepare the compound represented by Formula 1, Compound 2 and malononitrile are dissolved in pyridine and reacted.

[0045] In one embodiment of the present invention, compound 2 is prepared by reacting compound 3 represented by the following chemical formula 3 with phenylboronic acid, trifluoroacetic acid, palladium(II) trifluoroacetate, and 6,6'-dimethyl-2,2'-dipyridyl.

[0046] [ka]

[0047] To prepare the compound 2, the compound 3 is prepared by dissolving phenylboronic acid, trifluoroacetic acid, palladium(II) trifluoroacetate, and 6,6'-dimethyl-2,2'-dipyridyl in 2-methyltetrahydrofuran (2-MeTHF) and reacting them.

[0048] In one embodiment of the present invention, compound 3 is prepared by reacting 6-(dimethylamino)-3-hydroxy-2-naphthaldehyde with bromoacetonitrile and potassium carbonate.

[0049] To prepare the compound 3, 6-(dimethylamino)-3-hydroxy-2-naphthaldehyde, bromoacetonitrile, and potassium carbonate are mixed and reacted in dimethylformamide (N,N-dimethylmethanamide; DMF).

[0050] In one embodiment of the present invention, a method for preparing the compound represented by Chemical Formula 1 may be illustrated in FIG. 1, and preferably includes the steps of: reacting 6-(dimethylamino)-3-hydroxy-2-naphthaldehyde with bromoacetonitrile and potassium carbonate to obtain compound 3 represented by Chemical Formula 3; reacting compound 3 with phenylboronic acid, trifluoroacetic acid, palladium(II) trifluoroacetate and 6,6′-dimethyl-2,2′-dipyridyl to obtain compound 2 represented by Chemical Formula 2; and reacting compound 2 with malononitrile to obtain the compound represented by Chemical Formula 1.

[0051] Another aspect of the present invention is a composition for detecting Erwinia amylovora, which comprises a compound represented by Chemical Formula 1 of the present invention.

[0052] Another aspect of the present invention is a method for detecting Erwinia amylovora, comprising a step of measuring the fluorescence of a sample to which a compound represented by Chemical Formula 1 of the present invention has been attached by various methods such as coating, impregnation, spraying, dropping, or immersion.

[0053] In one embodiment of the present invention, the composition for detecting Erwinia amylovora detects Erwinia amylovora in a sample.

[0054] In another embodiment of the present invention, the composition for detecting Erwinia amylovora may further comprise one or more selected from a solvent, an acid, a base, and a buffer solution. The composition for detecting Erwinia amylovora may be prepared by adding the aforementioned compound to a solvent, a buffer solution, or a mixture thereof, followed by the addition of an acid and / or a base. The composition for detecting Erwinia amylovora may also comprise other additives available in the art. The amounts of the solvent, acid, base, and buffer solution contained in the composition may be adjusted appropriately depending on the desired performance. The solvent may include water, THF, methanol, ethanol, an aqueous HI solution, N,N-dimethylformamide, or a combination thereof. A detection kit may also be prepared by pre-contain- ing a compound or a detection composition.

[0055] In one embodiment of the present invention, the method for detecting Erwinia amylovora may include a step of confirming whether or not a change has occurred in the amount and intensity of fluorescence emitted from a sample to be detected, compared with a sample before addition of the compound represented by Chemical Formula 1 or a composition for detecting Erwinia amylovora containing the compound, or a normal control sample. Preferably, it can be determined that Erwinia amylovora is present (detected) when the amount and intensity of fluorescence emitted from the sample to be detected increases compared with a sample before addition of the compound represented by Chemical Formula 1 or a composition for detecting Erwinia amylovora containing the compound, or a normal control sample.

[0056] In another embodiment of the present invention, the step of confirming the change in fluorescence may be performed using, for example, a confocal fluorescence microscope, a two-photon fluorescence microscope, an optical coherence tomography (OCT), or a combination of a two-photon fluorescence microscope and an optical coherence tomography (OCT). Alternatively, the step may be performed by irradiating a sample containing the compound represented by Chemical Formula 1 or a composition for detecting Erwinia amylovora containing the compound with UV light using a flashlight, lantern, or lamp, and observing the change in emitted fluorescence.

[0057] In another embodiment of the present invention, the UV wavelength light may have a wavelength of 350 to 370 nm, preferably a wavelength of 360 to 370 nm, and most preferably a wavelength of 365 nm.

[0058] In one embodiment of the present invention, the sample includes any plant, soil, or object suspected of containing Erwinia amylovora. The plant may be a fruit tree, such as, but not limited to, pear, apple, rowan, or a Rosaceae plant. The object may be a tool or equipment such as agricultural machinery, such as, but not limited to, pruning shears or trowels. In other words, the compound represented by Chemical Formula 1 according to the present invention can be applied to any object, regardless of the Erwinia amylovora fungus concentration, and the presence or absence of fire blight infection can be diagnosed by observing whether or not the object emits fluorescence.

[0059] Another aspect of the present invention provides a composition for diagnosing fire blight on fruit trees, comprising a compound represented by Chemical Formula 1 of the present invention.

[0060] Another aspect of the present invention provides a method for diagnosing fire blight on fruit trees, comprising the steps of attaching a compound represented by Chemical Formula 1 of the present invention to a sample suspected of being infected with fire blight on fruit trees and measuring the emitted fluorescence.

[0061] In one embodiment of the present invention, the composition for diagnosing fire blight on fruit trees diagnoses fire blight on fruit trees by detecting Erwinia amylovora present in a sample.

[0062] In another embodiment of the present invention, the composition for diagnosing fire blight on fruit trees may further comprise one or more selected from a solvent, an acid, a base, and a buffer solution. The composition for diagnosing fire blight on fruit trees may be prepared by adding the above-described compound to a solvent, a buffer solution, or a mixture thereof, and then adding an acid and / or a base thereto. The composition for diagnosing fire blight on fruit trees may further comprise other additives available in the art. The amounts of the solvent, acid, base, and buffer solution contained in the composition may be adjusted appropriately depending on the required performance. The solvent may include water, THF, methanol, ethanol, an aqueous HI solution, N,N-dimethylformamide, or a combination thereof. A diagnostic kit may also be prepared by pre-contain- ing a compound or a composition for diagnosing fire blight on fruit trees.

[0063] In one embodiment of the present invention, the method for diagnosing fire blight on fruit trees may include a step of confirming that the amount and intensity of fluorescence emitted from a sample to be diagnosed are increased compared to the amount and intensity of fluorescence emitted from a sample before addition of the compound represented by Chemical Formula 1 or a composition for diagnosing fire blight on fruit trees containing the compound, or a normal control sample. Preferably, red fluorescence is emitted when infected with fire blight on fruit trees, and if the amount or intensity of fluorescence emitted from the sample to be measured is increased compared to the amount and intensity of fluorescence emitted from a sample before addition of the compound represented by Chemical Formula 1 or a composition for diagnosing fire blight on fruit trees containing the compound, it can be determined that the sample is infected with fire blight on fruit trees.

[0064] In one embodiment of the present invention, the addition to the sample is carried out by applying the compound represented by Chemical Formula 1 or a composition for diagnosing fire blight on the surface of the sample suspected of being infected with fire blight to the surface of the sample by various methods such as dropping, coating, impregnation, spraying, dropping, immersion, etc. The fluorescence is measured by irradiating the sample with UV light.

[0065] In another embodiment of the present invention, the method for measuring the fluorescence may be performed using any one device selected from the group consisting of a confocal fluorescence microscope, a two-photon fluorescence microscope, an optical coherence tomography (OCT), and a two-photon fluorescence microscope and an optical coherence tomography (OCT). Alternatively, the method may be performed by irradiating a sample containing the compound represented by Chemical Formula 1 or a composition for diagnosing fire blight on fruit trees with UV light using a flashlight, lantern, or lamp, and observing a change in the emitted fluorescence.

[0066] In another embodiment of the present invention, the UV wavelength light may have a wavelength of 350 to 370 nm, preferably a wavelength of 360 to 370 nm, and most preferably a wavelength of 365 nm.

[0067] In one embodiment of the present invention, the sample suspected of being infected with fire blight includes any plant, soil, or object suspected of being infected with fire blight. The plant may be a fruit tree, such as, but not limited to, pear, apple, rowan, or a plant of the Rosaceae family. The object may be a tool or equipment such as agricultural machinery, such as, but not limited to, pruning shears or trowels. That is, a composition for diagnosing fire blight on fruit trees, including a compound represented by Formula 1 according to the present invention, can be applied to any object, regardless of the concentration of Erwinia amylovora, and the presence or absence of fire blight infection can be diagnosed by observing whether or not the object emits fluorescence.

[0068] In another embodiment of the present invention, the composition for diagnosing fire blight on fruit trees and the method for diagnosing fire blight on fruit trees using the same are applied in the field, such as at fruit farms.

[0069] Another aspect of the present invention provides a composition for screening for a substance for controlling fire blight on fruit trees, comprising a compound represented by Chemical Formula 1 of the present invention and Erwinia amylovora.

[0070] In addition, another aspect of the present invention provides a method for screening for a substance for controlling fire blight on fruit trees, comprising the steps of adding a candidate substance to Erwinia amylovora to which a compound represented by Chemical Formula 1 of the present invention has been attached, and measuring a change in fluorescence.

[0071] In one embodiment of the present invention, the screening composition and screening method for a substance for controlling fire blight on fruit trees involve treating Erwinia amylovora (a measurement sample) treated with a compound represented by Chemical Formula 1 with a sample (candidate substance) that is expected to be a substance for controlling fire blight on fruit trees, and determining whether a decrease in the concentration / number or inhibition of the increase of Erwinia amylovora, the causative agent of fire blight on fruit trees, occurs, thereby screening for a substance for controlling fire blight on fruit trees.

[0072] In another embodiment of the present invention, the screening composition and screening method for a substance for controlling fire blight on fruit trees may include the steps of adding a sample (candidate substance) suspected to be a substance for controlling fire blight on fruit trees to a test sample containing the compound represented by Chemical Formula 1 and Erwinia amylovora, and confirming that the amount and intensity of fluorescence emitted from the test sample are reduced compared to the amount and intensity of fluorescence emitted from the test sample before the addition of the candidate substance for controlling fire blight on fruit trees. Preferably, in the presence of Erwinia amylovora, red fluorescence is emitted upon reaction with the compound represented by Chemical Formula 1. If the amount or intensity of fluorescence emitted from the test sample after the addition of the candidate substance is reduced compared to the amount or intensity of fluorescence emitted from the test sample before the addition of the candidate substance, the candidate substance can be determined to be a substance capable of ameliorating, suppressing, reducing, or preventing fire blight on fruit trees.

[0073] In other embodiments of the present invention, the checking step can be performed using, for example, a confocal fluorescence microscope, a two-photon fluorescence microscope, an optical coherence tomography (OCT), or a two-photon fluorescence microscope and an optical coherence tomography (OCT). Alternatively, the sample to be measured can be irradiated with UV light using a flashlight, lantern, or lamp, and changes in the emitted fluorescence can be observed.

[0074] In another embodiment of the present invention, the UV wavelength light may have a wavelength of 350 to 370 nm, preferably 360 to 370 nm, and most preferably 365 nm wavelength light.

[0075] Preferred examples are presented below to aid in understanding the present invention. However, the following examples are provided merely to facilitate understanding of the present invention, and the contents of the present invention are not limited to the following examples.

[0076] Example 1. Synthesis and purification of compound (B-1) To develop compound (B-1), the present inventors performed organic synthesis as shown in FIG. 1 based on the compound of Korean Patent Registration No. 10-1524915.

[0077] 1-1. Synthesis of Compound 3 Specifically, the synthetic starting materials, 6-(dimethylamino)-3-hydroxy-2-naphthaldehyde (DMHNA, 30 mg, 0.139 mmol), bromoacetonitrile (14 μL, 0.209 mmol), and potassium carbonate (29 mg, 0.209 mmol), were placed in dimethylformamide (DMF, 1.5 mL) in a flame-dried 5 mL round flask. The mixture was then stirred at 50 °C for 2 h using an argon balloon and a silicone oil container. The resulting organic material was then extracted with ethyl acetate (EtOAc, 100 mL), deionized water (DI HO, 100 mL), and saturated brine (30 mL). The collected organic material was dried over anhydrous sodium sulfate (NaSO, 5 g), and the solvent was removed by rotary evaporation. The residue was then separated by silica column chromatography using 30% EtOAc / hexane (v / v) as a developing solvent to give compound 3 as a yellowish color (yield: 92%).

[0078] 1 H NMR (500MHz, CDCl3): 3.13(s,6H),4.97(s,2H),6.77(d,1H),7.04(s,1H),7.05-7.07(m,1H),7.74-7.78(d,1H),8.25(s,1H),10.34(s,1H). 13 C NMR (125MHz, CDCl3): 40.5, 53.8, 104.4, 106.0, 115.0, 115.3, 121.6, 121.8, 131.4, 132.9, 139.3, 151.1, 155.1, 188.6. HRMS(ESI) m / z:[M+H] + calcd for C 15 H 14 N2O2, 254.1055; found, 254.1057

[0079] 1-2. Synthesis of compound 2 Specifically, the synthetic starting materials, compound 3 (29 mg, 0.115 mmol), phenylboronic acid (28 mg, 0.230 mmol), trifluoroacetic acid (88 μL, 1.15 mmol), palladium(II) trifluoroacetate (30 mg, 0.09 mmol), and 6,6'-dimethyl-2,2'-dipyridyl (33 mg, 0.180 mmol), were dissolved in 2-methyltetrahydrofuran (1.5 mL), placed in a flame-dried Schlenk tube, and stirred at room temperature for 15 minutes. The mixture was then heated to 80 °C using a silicone oil container and allowed to react for 24 hours. The resulting organic material was extracted with 100 mL of EtOAc, 100 mL of distilled water, and 30 mL of saturated brine. The combined organic material was dried over anhydrous sodium sulfate (NaSO, 5 g) and the solvent was removed by rotary evaporation. The product was then separated by silica column chromatography using 10% EtOAc / Hex (v / v) as a eluent to obtain the orange-colored compound 2 (41% yield).

[0080] 1 H NMR(500MHz,(CD3)2SO,δ):3.06(s,6H),7.02-7.03(d,1H),7.25-7.28(m,1H),7.61-7.64( m,2H),7.71-7.75(m,1H),7.83(d,1H),7.89-7.92(m,2H),7.99-8.01(m,2H),8.23(s,1H). 13 C NMR(125MHz,(CD3)2SO,δ):40.8,105.1,105.4,116.1,117.7,122.3,124.4,1 25.1,128.7,129.5,129.6,132.8,136.1,137.8,148.8,152.6,155.4,184.7. HRMS(ESI) m / z:[M+H] +calcd for C 21 H 17 NO2,315.1259;found,315.1261

[0081] 1-3. Synthesis of Compound B-1 Specifically, the starting materials, compound 2 (10 mg, 0.032 mmol), malononitrile (4 mg, 0.063 mmol), and pyridine (1.5 mL) were placed in a flame-dried round flask, connected to a reflux apparatus, and stirred overnight at 70 °C with an argon balloon. The solvent was then removed using a rotary evaporator, and the resulting organic material was extracted with EtOAc, DI H2O, and saturated brine. The organic material was then separated by silica column chromatography using 20% ​​EtOAc / Hex (v / v) as a eluent to obtain the purple compound B-1 (yield: 41%).

[0082] 1 H NMR(500MHz,CD3COCD3,δ):3.14(s,6H),7.10(d,1H),7.21(d,1H),7.27-7.30(m,1H),7.64(t,1H),7. 66(t,1H),7.68-7.70(m,1H),7.71-7.73(m,2H),7.79(s,1H),7.79(s,1H),7.87(d,1H),8.14(s.1H). 13 C NMR(500MHz,CD3COCD3):40.5,78.8,105.0,105.3,114.9,115.3,117.2,122.7,123.6,12 5.3,126.1,129.7,130.5,130.8,132.0,132.2,134.8,138.0,150.4,152.3,156.4,157.4. HRMS(ESI) m / z:[M+H] + calcd for C 24 H 17 N3O,363.1372;found,363.1369

[0083] Example 2. Confirmation of absorption and fluorescence properties of B-1 To confirm the absorption and fluorescence properties of compound B-1 prepared in Example 1, the changes in the absorption and fluorescence spectra of B-1 were measured in the presence of Erwinia amylovora, the causative agent of fire blight in fruit trees. The results are shown in Figure 2.

[0084] Specifically, the Erwinia amylovora used in the experiment was cultured overnight at 26°C in LB (Luria-Bertani) liquid medium. Afterwards, the Erwinia amylovora was obtained by centrifugation at 10,000 rcf. First, B-1 was added to the aqueous solution to analyze the absorption and fluorescence spectra. Then, Erwinia amylovora (4.3 × 10) was added to the aqueous solution containing B-1. 8 CFU) were added, and the absorption and fluorescence spectra were analyzed. A UV / Vis spectrophotometer (Agilent, USA) was used to analyze the absorbance spectra, and a fluorometer (SHIMADZU CORP. RF-6000, Japan) was used to analyze the fluorescence spectra. A standard quartz cell (Hellma Analytics, Germany) with four sides measuring 1 cm thick was used for each spectrum measurement.

[0085] The measurement results are shown in Figure 2, where the absorption and fluorescence spectra of B-1 (10 μM) in aqueous solution are shown by dashed lines, and the absorption and fluorescence spectra after reaction with Erwinia amylovora are shown by solid lines.

[0086] In aqueous solution, B-1 showed maximum absorption at 550 nm, and when fluorescence was measured using this as the excitation wavelength, almost no fluorescence was observed. 8When B-1 was added (50 ...

[0087] Example 3. Changes in B-1 fluorescence depending on Erwinia amylovora concentration The change in fluorescence of the phosphor compound B-1 prepared in Example 1 depending on the concentration of Erwinia amylovora was measured, and the results are shown in FIG.

[0088] Specifically, to measure the concentration of Erwinia amylovora obtained as in Example 2, the absorbance at 600 nm (OD) was calculated. 600 0.1=1×10 8 Then, using DI H2O, Erwinia amylovora was cultured at 2 × 10 6 -4×10 8 The cells were diluted to 100 CFU / mL and reacted with 10 μM B-1. The graph shows the fluorescence intensity at 686 nm with an excitation wavelength of 550 nm. The results confirmed that the fluorescence of B-1 increased as the concentration of Erwinia amylovora increased. The photographs in the graph show the reaction of Erwinia amylovora and B-1 at the above concentrations in a 96-well plate, taken using a fluorescence signal analysis system (VISQUE In Vivo Smart-LF, Korea). Similar to the previous results, an increase in fluorescence was confirmed with increasing Erwinia amylovora concentration.

[0089] Example 4. Confirmation of the minimum sensing ability of Erwinia amylovora in B-1 Erwinia amylovora was serially diluted and reacted with the phosphor compound B-1 prepared in Example 1 to confirm the minimum sensing ability, and the results are shown in FIG.

[0090] Specifically, Erwinia amylovora quantified as in Example 3 was reacted with 5 μM B-1 in DI H2O. Then, the fluorescence intensity at 686 nm was measured using an excitation wavelength of 551 nm and the results were shown in a graph.

[0091] When reacted with serially diluted Erwinia amylovora, up to 10 2 It was confirmed that it can detect Erwinia amylovora up to CFU / mL. 2 The CFU / mL was close to the concentration of Erwinia amylovora that overwintered during the winter, and it was confirmed that the test showed very high sensitivity compared to existing diagnostic methods such as PCR and DNA-based diagnostic methods.

[0092] Example 5. Verification of B-1's ability to sense Erwinia amylovora over time The fluorescence change characteristics of Compound B-1 prepared in Example 1 over time in the presence of Erwinia amylovora were examined, and the results are shown in FIG.

[0093] Specifically, 10 μM of B-1 was added to 10 8 CFU / mL Erwinia amylovora assayed as in Example 3 was reacted with DI H2O. Then, fluorescence changes at 686 nm were observed for up to 40 minutes using an excitation wavelength of 550 nm. As a result, as shown in Figure 5, B-1 showed a rapid fluorescence change within 10 minutes of reacting with Erwinia amylovora. This confirmed that B-1 has rapid sensing properties for Erwinia amylovora.

[0094] Example 6. Confirmation of the staining ability of B-1 for Erwinia amylovora The staining ability of the phosphor compound B-1 prepared in Example 1 for Erwinia amylovora was confirmed, and the results are shown in FIG.

[0095] Specifically, Erwinia amylovora obtained as described in Example 2 was stained by reacting with 30 μM B-1 in phosphate-buffered saline (PBS) for 1 hour. To identify live Erwinia amylovora, 300 nM 4',6-diamidino-2-phenylindole (DAPI) was added as a counterstain. The stained specimens were then washed three times with PBS to remove residual B-1 and DAPI. After heat fixation, the specimens were mounted on glass slides and photographed using a confocal laser scanning microscope (Carl Zeiss, Germany). Differential interference contrast (DIC) images were also taken during the confocal laser scanning microscope. The wavelengths used for B-1 and DAPI imaging were as follows: [DAPI] excitation wavelength: 405 nm, emission wavelength: 410-530 nm; [B-1] excitation wavelength: 561 nm, emission wavelength: 600-700 nm.

[0096] Figure 6 shows the results of confocal laser scanning microscopy, showing DIC, DAPI, B-1, and a combined image of all three. The results confirmed that both DAPI and B-1 fluorescence were observed in Erwinia amylovora observed with DIC. The overlapping of the fluorescent signals confirmed that B-1 can stain live Erwinia amylovora, exhibiting strong red fluorescence.

[0097] Example 7. Confirmation of the sensitivity of plant surfaces to Erwinia amylovora using B-1 (spraying) To confirm whether Erwinia amylovora present on the surface of plants can be detected using the fluorescent compound B-1 prepared in Example 1, detection was performed by spraying B-1 onto the tissues (organs: fruit and flowers) of an apple tree (Fuji apple tree). The process and results are shown in Figure 7.

[0098] Specifically, as shown in FIG. 7(a), in order to mimic the plants infected with fire blight, 10 2 ~10 8 CFU / mL of Erwinia amylovora was applied to immature apples and apple blossoms using a brush. The apples were allowed to air dry for 10 minutes to allow the Erwinia amylovora to adhere to the surface. After that, the apples were sprayed twice with 100 μM B-1 solution diluted in DI H2O. After 10 minutes, the fluorescence was observed under a 365 nm flashlight.

[0099] As a result, red fluorescence was observed at all concentrations of Erwinia amylovora present on immature apples and apple flowers (Figure 7B). Using the Image-J program, we analyzed the fluorescence intensity of B-1 depending on the concentration of Erwinia amylovora applied to each region of interest and plotted the results as graphs in Figures 7(c) and 7(d). It was found that the fluorescence of B-1 significantly increased with increasing Erwinia amylovora concentration. Indeed, even on the surface of the plant, the fluorescence intensity increased by 10%. 2 It was confirmed that Erwinia amylovora can be detected up to CFU / mL.

[0100] To cross-validate Erwinia amylovora detected through the B-1 fluorescence change, PCR analysis, an existing method for diagnosing fire blight in fruit trees, was performed. The results are shown in Figure 7(e). PCR analysis was performed using the pEA29 plasmid, a DNA marker for Erwinia amylovora, as the target. The templates used were the petals that showed a fluorescent change after spraying B-1 (Figure 7(a)) and Erwinia amylovora (positive control). A single petal was detached from the flower that showed a fluorescent change, placed in a 1.75 mL tube with 100 μL of DI H2O, and crushed at least 10 times using a pipette tip. The primer sequences used were as follows: Forward: GCACTGAGGTTTTTAGGGATATCCGCTG (SEQ ID NO: 1), Reverse: GCTCAATCGCCAGGGAAATGATATCGGC (SEQ ID NO: 2). PCR reactions were carried out using Invitrogen's Platinum™ II Taq Hot-Start DNA polymerase according to the manufacturer's instructions.

[0101] The results were almost identical to those obtained by spraying B-1 and detecting Erwinia amylovora, confirming that B-1 can detect Erwinia amylovora on plant surfaces with high sensitivity.

[0102] Example 8. Confirmation of the sensitivity of plant surfaces to Erwinia amylovora using B-1 (spray, cotton swab) The fluorescent compound B-1 prepared in Example 1 was used in various ways to detect Erwinia amylovora on the surface of plants, and the results are shown in FIG.

[0103] Specifically, as shown in Figure 8A, to infect apple tree tissues (branches, flowers, and leaves) with fire blight, Erwinia amylovora (10 8Tissues from apple tree twigs, blossoms, and leaves were placed on the plates along with 100 μM B-1 (CFU / mL) and incubated overnight at 26°C. Erwinia amylovora was then detected in each plant tissue by spraying with 100 μM B-1 solution or swabbing with a cotton swab soaked in B-1, and fluorescence changes were observed under a 365 nm flashlight.

[0104] As a result, when B-1 was sprayed on the branches of apple trees infected with fire blight, red fluorescence was observed (Figure 8(b)). Similarly, when the flowers and leaves of apple trees infected with fire blight were swabbed with a cotton swab onto which B-1 had been absorbed, red fluorescence was observed to be emitted from the swab (Figure 8(c) and Figure 8(d)). This confirmed that the use of B-1 to detect Erwinia amylovora has various applications.

[0105] Example 9. Confirmation of the sensitivity of Erwinia amylovora to the surface of agricultural equipment using B-1 To confirm whether the fluorescent compound B-1 prepared in Example 1 can detect Erwinia amylovora present in an object, a detection attempt was made by spraying B-1. The object used for the detection was farming tools, which are one of the causes of cross-contamination from fruit trees infected with fire blight in fruit farms. The process and results are shown in Figure 9.

[0106] Specifically, to mimic agricultural equipment exposed to Erwinia amylovora, pruning shears and a trowel were used to directly cut fire blight-infected plants or rub them against Erwinia amylovora-contaminated soil, as shown in Figure 9(a). Erwinia amylovora was detected by spraying the plants twice with 100 μM B-1 solution and photographing them under a 365 nm flashlight.

[0107] As a result, as shown in Figure 9(b), the areas where Erwinia amylovora was present on both the pruning shears and the trowel emitted red fluorescence, confirming that B-1 can be used to detect Erwinia amylovora in objects.

[0108] The above description of the present invention is for illustrative purposes only, and those skilled in the art can easily modify the present invention into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, the above-described embodiments are illustrative in all respects and are not limiting.

Claims

1. A compound represented by the following chemical formula 1. 【Chemistry 1】

2. The compound according to claim 1, which has the property of emitting fluorescence when reacting with Erwinia amylovora, a fungus that causes fire blight on fruit trees.

3. The compound according to claim 2, which has the property of emitting red fluorescence when reacting with Erwinia amylovora, a causative fungus of fire blight on fruit trees.

4. The compound according to claim 2, wherein when the compound reacts with Erwinia amylovora, a causative fungus of fire blight on fruit trees, the compound emits an increased amount of red fluorescence depending on the concentration of Erwinia amylovora.

5. A composition for detecting Erwinia amylovora, the causative agent of fire blight on fruit trees, comprising the compound of any one of claims 1 to 4.

6. A composition for diagnosing fire blight on fruit trees, comprising the compound of any one of claims 1 to 4, for diagnosing the presence or absence of fire blight infection on fruit trees.

7. A detection or diagnostic kit for detecting Erwinia amylovora or diagnosing the presence or absence of infection with fruit tree fire blight, comprising a compound according to any one of claims 1 to 4, a composition for detecting Erwinia amylovora according to claim 5, or a composition for diagnosing fruit tree fire blight according to claim 6.

8. A method for detecting Erwinia amylovora or a method for diagnosing fire blight on fruit trees, comprising attaching a compound according to any one of claims 1 to 4, a composition for detecting Erwinia amylovora according to claim 5, or a composition for diagnosing fire blight on fruit trees according to claim 6 to a surface of a target contaminated or infected with Erwinia amylovora, and measuring the fluorescence generated when irradiated with UV light.

9. A method for producing a compound, comprising the step of reacting compound 2 represented by the following chemical formula 2 with malononitrile to produce a compound represented by the following chemical formula 1: 【Chemistry 1】 【Chemistry 2】

10. A method for producing a compound, comprising: reacting compound 3 represented by the following chemical formula 3 with phenylboronic acid, trifluoroacetic acid, palladium trifluoroacetate (II), and 6,6'-dimethyl-2,2'-dipyridyl to produce compound 2 represented by the following chemical formula 2; and reacting compound 2 with malononitrile to produce a compound represented by the following chemical formula 1. 【Chemistry 1】 【Chemistry 2】 【Transformation 3】

11. A method for producing a compound, comprising the steps of: reacting 6-(dimethylamino)-3-hydroxy-2-naphthaldehyde with bromoacetonitrile and potassium carbonate to produce compound 3 represented by the following chemical formula 3; reacting compound 3 with phenylboronic acid, trifluoroacetic acid, palladium trifluoroacetate (II), and 6,6'-dimethyl-2,2'-dipyridyl to produce compound 2 represented by the following chemical formula 2; and reacting compound 2 with malononitrile to produce a compound represented by the following chemical formula 1. 【Chemistry 1】 【Chemistry 2】 【Transformation 3】

12. A composition for detecting Erwinia amylovora, comprising a compound produced by the production method according to any one of claims 9 to 11.

13. A method for detecting Erwinia amylovora, comprising the steps of attaching a compound produced by the production method described in any one of claims 9 to 11 or the composition for detecting Erwinia amylovora described in claim 12 to a sample and measuring the fluorescence generated.

14. A composition for diagnosing fire blight on fruit trees, comprising a compound produced by the production method according to any one of claims 9 to 11.

15. A method for diagnosing fire blight on fruit trees, comprising the steps of adding a compound produced by the manufacturing method described in claims 9 to 11 or a composition for diagnosing fire blight on fruit trees described in claim 14 to a sample suspected of being infected with fire blight on fruit trees, and measuring the fluorescence generated.

16. A composition for screening for substances for controlling fire blight on fruit trees, comprising the compound according to any one of claims 1 to 4.

Images