Biomolecular probes for detecting gene and protein expression and detection methods thereof

Abstract

To provide biomolecular probes for detecting gene and protein expression, and detection methods therefor.SOLUTION: The present invention relates to, among other things, probes, compositions, methods and kits for simultaneous, multiplexed detection and quantification of protein and / or nucleic acid expression in a user-defined region of a tissue, a user-defined cell, and / or a user-defined subcellular structure within a cell that are adaptable for use with existing sequencing technologies.SELECTED DRAWING: Figure 20

Description

[Technical Field]

[0001] BACKGROUND OF THE INVENTION This application claims priority to and the benefit of U.S. Provisional Application No. 62 / 629,180, filed February 12, 2018, and U.S. Provisional Application No. 62 / 771,212, filed November 26, 2018. The contents of each of the foregoing patent applications are incorporated herein by reference in their entirety.

[0002] Array List This application contains a sequence listing that has been submitted in ASCII format via EFS-Web, and is incorporated herein by reference in its entirety. The ASCII copy created on February 1, 2019, is named "NATE-037_001WO.txt" and is 48.4 KB in size. [Background technology]

[0003] Standard immunohistochemical and in situ hybridization techniques allow for the simultaneous detection of up to 6-10, and typically 3-4, protein or nucleic acid targets. There is a need for probes, compositions, methods, and kits for the simultaneous, multiplexed detection and quantification of protein and / or nucleic acid expression in user-defined regions of tissue, user-defined cells, and / or user-defined subcellular tissues within cells. Furthermore, there is a need for such systems that are adaptable for use with existing sequencing technologies already utilized by numerous end users. Summary of the Invention

[0004] The present disclosure relates to probes, compositions, methods, and kits for simultaneous, multiplexed, spatial detection and quantification of protein and / or nucleic acid expression in user-defined regions of tissue, user-defined cells, and / or user-defined subcellular tissues within cells.

[0005] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; (4) ligating to the released identifier oligonucleotide at least one nucleic acid adapter comprising a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, a second amplification primer binding site, and optionally a constant nucleic acid sequence to minimize ligation bias; (5) amplifying the ligation product generated in step (4); and (6) sequencing the amplification product generated in step (5) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0006] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising the steps of: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) contacting the released identifier oligonucleotide with a nucleic acid sequence comprising a unique molecular identifier. (4) ligating at least one nucleic acid adapter comprising a first amplification primer binding site, a second amplification primer binding site, and optionally a constant nucleic acid sequence to minimize ligation bias, wherein at least one of the first or second amplification primer binding sites identifies the specific location in the tissue sample from which the identifier oligonucleotide was released; (5) amplifying the ligation product produced in step (4); and (6) sequencing the amplification product produced in step (5) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0007] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) binding the released identifier oligonucleotide to a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, a second amplification primer binding site, and optionally, a linked nucleic acid sequence. (5) ligating at least one nucleic acid adapter comprising a constant nucleic acid sequence to minimize binding bias, wherein at least one of the first and second amplification primers comprises a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released; (6) amplifying the extension product generated in step (4) using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site; and (7) sequencing the amplification product generated in step (5) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0008] The nucleic acid adapter in step (4) may be a partially double-stranded nucleic acid molecule. The partially double-stranded nucleic acid adapter may include a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. The first single-stranded mismatch region and the second single-stranded mismatch region may be located on opposite sides of the double-stranded annealing region.

[0009] The nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released may be present in the double-stranded annealing region of the partially double-stranded nucleic acid adapter.

[0010] A constant nucleic acid sequence to minimize ligation bias may be present in the double-stranded annealing region of a partially double-stranded nucleic acid adapter.

[0011] The unique molecular identifier may be present in at least one of the first or second single-stranded mismatch regions of the partially double-stranded nucleic acid adapter.

[0012] The first amplification primer binding site may be present in a first single-stranded mismatched region of the partially double-stranded nucleic acid adapter, and the second amplification primer binding site may be present in a second single-stranded mismatched region of the same partially double-stranded nucleic acid adapter.

[0013] The method of the present disclosure described above may further comprise the step of performing an end repair reaction before step (4). The method may further comprise the step of performing an addition reaction before step (4) to attach a single nucleotide overhang to the 3' end of the identifier oligonucleotide. The method may further comprise the step of performing an end repair reaction and an addition reaction before step (4) to attach a single nucleotide overhang to the 3' end of the identifier oligonucleotide. The addition reaction and the end repair reaction may be performed sequentially or simultaneously.

[0014] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising an identifier oligonucleotide comprising a target binding domain and a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; (4) ligating to the released identifier oligonucleotide at least one nucleic acid adapter comprising a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, a nucleic acid sequence comprising a unique molecular identifier, a second amplification primer binding site, and optionally a constant nucleic acid sequence to minimize ligation bias; (5) amplifying the ligation product generated in step (4); and (6) sequencing the amplification product generated in step (5) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0015] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; (4) contacting the released identifier oligonucleotide with a nucleic acid sequence comprising a unique molecular identifier, a second amplification primer binding site, and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; and optionally ligating at least one nucleic acid adapter comprising a constant nucleic acid sequence to minimize ligation bias; (5) amplifying the extension product generated in step (4) with a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the amplification primers comprises a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released; and (6) sequencing the amplification product generated in step (5) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0016] The nucleic acid adapter in step (4) may be a partially double-stranded nucleic acid molecule. The partially double-stranded nucleic acid adapter may include a double-stranded annealing region and a single-stranded mismatch region.

[0017] The nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released may be present in the double-stranded annealing region of the partially double-stranded nucleic acid adapter.

[0018] A constant nucleic acid sequence for minimizing ligation bias may be present in the double-stranded annealing region of the partially double-stranded nucleic acid adapter. The constant nucleic acid sequence may also include a cleavable moiety. The cleavable moiety may be an enzymatically cleavable moiety. The enzymatically cleavable moiety may be a USER sequence.

[0019] The unique molecular identifier may be present within a single-stranded mismatch region of a partially double-stranded nucleic acid adapter.

[0020] The second amplification primer binding site may be present in a single-stranded mismatch region of the partially double-stranded nucleic acid adapter.

[0021] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising an identifier oligonucleotide comprising a target binding domain and a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing to the released identifier oligonucleotide a single-stranded nucleic acid template comprising a region complementary to the unique nucleic acid sequence of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, a nucleic acid sequence complementary to the second amplification primer binding site, and optionally an affinity molecule. (5) extending the identifier oligonucleotide of step (4) to generate an extension product complementary to the single-stranded nucleic acid template, the extension product comprising the identifier oligonucleotide, a nucleic acid sequence complementary to the unique molecular identifier, and a second amplification primer binding site; (6) amplifying the extension product generated in step (5) with a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the first and second amplification primers comprises a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released; and (7) sequencing the amplification product generated in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0022] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising an identifier oligonucleotide comprising a target binding domain and a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide at a location in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) contacting the released identifier oligonucleotide with a region complementary to the unique nucleic acid sequence of the identifier oligonucleotide, a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, and a unique nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released. (5) extending the identifier oligonucleotide of step (4) to generate an extension product complementary to the single-stranded nucleic acid template, the extension product comprising the identifier oligonucleotide, a nucleic acid sequence complementary to a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, a nucleic acid sequence complementary to the unique molecular identifier, and the second amplification primer binding site; (6) amplifying the extension product generated in step (5); and (7) sequencing the amplification product generated in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0023] The single-stranded nucleic acid template may further comprise an affinity molecule. In aspects in which the single-stranded nucleic acid template comprises an affinity molecule, the methods of the present disclosure described above may further comprise an affinity purification step between steps (4) and (5).

[0024] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide. (5) performing nick repair such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0025] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site. (4) hybridizing the first and second nucleic acid probes to the identifier oligonucleotide in an adjacent but non-overlapping manner; (5) performing nick repair such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0026] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide. wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, and a first amplification primer binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, and a second amplification primer binding site, wherein the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but non-overlapping; (5) performing a gap extension and nick repair reaction such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0027] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide. and a second amplification primer binding site, wherein at least one of the first or second nucleic acid probes comprises a nucleic acid sequence comprising a unique molecular identifier, wherein at least one of the first or second nucleic acid probes comprises a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released, wherein the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but non-overlapping; (5) performing a gap extension and nick repair reaction such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0028] In aspects in which the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released is located in the first nucleic acid probe, the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released may be located 5' to the first amplification primer binding site.

[0029] In aspects in which the unique molecular identifier is located on the second nucleic acid probe, the unique molecular identifier may be located 3' to the second amplification primer binding site.

[0030] In aspects in which the nucleic acid sequence and unique molecular identifier that identify the specific location in the tissue sample from which the identifier oligonucleotide was released are present in the first nucleic acid probe, the nucleic acid sequence and unique molecular identifier that identify the specific location in the tissue sample from which the identifier oligonucleotide was released may be located 5' to the first amplification primer binding site.

[0031] In aspects where the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released and the unique molecular identifier are present in the second nucleic acid probe, the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released and the unique molecular identifier may be located 3' to the second amplification primer binding site.

[0032] In aspects where the unique molecular identifier is present in a first nucleic acid probe and a nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released is present in a second nucleic acid probe, the unique molecular identifier may be located 5' of the first amplification primer binding site and the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released may be located 3' of the second amplification binding site.

[0033] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, a first amplification primer binding to the first probe. (4) hybridizing the first and second nucleic acid probes to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but not overlapping; (5) performing a nick repair reaction such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation products produced in step (5); and (7) sequencing the amplification products produced in step (6) to identify the released identifier oligonucleotides, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0034] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site. a nucleic acid complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a second unique molecular identifier, and a second flow cell binding site, wherein at least one of the first or second nucleic acid probes comprises a nucleic acid sequence comprising a third unique molecular identifier, wherein at least one of the first or second nucleic acid probes comprises a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released, wherein the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but non-overlapping; step (5) performing nick repair such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0035] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide, a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, a first amplification primer binding site, (5) hybridizing the first and second nucleic acid probes to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but not overlapping; (6) amplifying the ligation products produced in step (5); and (7) sequencing the amplification products produced in step (6) to identify the released identifier oligonucleotides, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0036] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide. a nucleic acid sequence comprising a second unique molecular identifier, a nucleic acid sequence comprising a second unique molecular identifier, and a second flow cell binding site, wherein at least one of the first or second nucleic acid probes comprises a nucleic acid sequence comprising a third unique molecular identifier, wherein at least one of the first or second nucleic acid probes comprises a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released, wherein the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but non-overlapping; (5) performing a gap extension and nick repair reaction such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0037] In aspects where the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released and the first unique molecular identifier are present in the first nucleic acid probe, the nucleic acid sequence identifying the specific location in the tissue sample from which the identifier oligonucleotide was released and the first unique molecular identifier may be located 5' of the first flow cell binding site.

[0038] In aspects in which the second and third unique molecular identifiers are present on the second nucleic acid probe, the second and third unique molecular identifiers may be located 3' to the second flow cell binding site.

[0039] In some aspects, the first unique molecular identifier can be present on a first nucleic acid probe and can be located 5' of the first flow cell binding site, while in other aspects, the second unique molecular identifier can be present on a second nucleic acid probe and can be located 3' of the second flow cell binding site.

[0040] In some aspects, the nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released and the third unique molecular identifier may be present in the first nucleic acid probe and may be located 5' of the first flow cell binding site.

[0041] In some aspects, the nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released and the third unique molecular identifier may be present in a second nucleic acid probe and may be located 3' of the second flow cell binding site.

[0042] In some aspects, the third unique molecular identifier may be present in the first nucleic acid probe and may be located 5' of the first flow cell binding site. In this same aspect, the nucleic acid sequence that identifies the specific location in the tissue sample to which the identifier oligonucleotide was released may be present in the second nucleic acid probe and may be located 3' of the second flow cell binding site.

[0043] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, and a second amplification primer binding site; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) contacting the released identifier oligonucleotide with at least one probe comprising a target binding domain and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, and a second amplification primer binding site; (4) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; and (5) contacting the released identifier oligonucleotide with at least one probe comprising a target binding domain and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, and a second amplification primer binding site. (4) amplifying the released identifier oligonucleotide with a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the first and second amplification primers comprises a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released; and (5) sequencing the amplification product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0044] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a first amplification primer binding site, and a second amplification primer binding site; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; (4) collecting a first amplification primer binding site capable of binding to the first amplification primer binding site; and a second amplification primer capable of binding to a second amplification primer binding site, wherein at least one of the first and second amplification primers comprises a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released, and wherein at least one of the first and second amplification primers comprises a nucleic acid sequence that comprises a unique molecular identifier; and (5) sequencing the amplification product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0045] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain and a capture probe binding site; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; (4) hybridizing the released identifier oligonucleotide with a capture probe comprising an affinity molecule and a region complementary to the capture probe binding site; and (5) sequencing the amplified hybridized product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0046] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising an identifier oligonucleotide comprising a target binding domain and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a capture probe binding site, and a multiplex probe binding site; (2) applying a force sufficient to release the identifier oligonucleotide to the location in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing to the released identifier oligonucleotide a capture probe comprising an affinity molecule and a region complementary to the capture probe binding site, and a multiplex probe comprising a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released and a region complementary to the multiplex probe binding site; and (5) sequencing the hybridization product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0047] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force to the tissue sample location sufficient to release the identifier oligonucleotide; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe is complementary to a portion of the identifier oligonucleotide. (5) hybridizing the first and second nucleic acid probes to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but non-overlapping; (6) ligating the hybridized first and second nucleic acid probes together; (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0048] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, the method comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide comprising a unique nucleic acid sequence identifying the target analyte bound to the target binding domain, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, and a second amplification primer binding site; (2) applying a force to the location in the tissue sample sufficient to release the identifier oligonucleotide; (3) harvesting the released identifier oligonucleotide; (4) amplifying the harvested identifier oligonucleotide; and (5) sequencing the amplification product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte in at least one cell of the tissue sample.

[0049] In all methods of the present disclosure, the ligation step may be a nick-ligation step. The nick-ligation step may be a nick-repair step.

[0050] In all methods of the present disclosure, the sequencing may be an enzyme-free sequencing method.

[0051] In all methods of the present disclosure, the identifier oligonucleotide may be double-stranded. In aspects where the identifier oligonucleotide is double-stranded, at least one of the two strands of the identifier oligonucleotide may comprise at least two different nucleic acid molecules. Alternatively, the 3' end of at least one of the identifier oligonucleotides may comprise a single nucleotide overhang.

[0052] In all methods of the present disclosure, the identifier oligonucleotide may be single-stranded.

[0053] In all methods of the present disclosure, the unique nucleic acid sequence that identifies the target analyte bound to the target binding domain may comprise from about 5 nucleotides to about 40 nucleotides, preferably about 35 nucleotides, and more preferably about 10 nucleotides.

[0054] In all methods of the present disclosure, the nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released may comprise from about 6 nucleotides to about 15 nucleotides, preferably about 12 nucleotides, and more preferably about 10 nucleotides.

[0055] In all of the methods of the present disclosure, at least one of the first or second nucleic acid probes may comprise an affinity molecule, for example, at least one of the first or second nucleic acid probes may comprise biotin.

[0056] In all methods of the present disclosure, the amplification primer binding site may comprise about 18 to about 40 nucleotides, preferably about 32 nucleotides, and more preferably about 25 nucleotides. The amplification primer binding site may comprise an i7 sequence, which comprises the sequence set forth in SEQ ID NO: 1. The amplification primer binding site may comprise an i5 sequence, which comprises the sequence set forth in SEQ ID NO: 2.

[0057] In all methods of the disclosure, the amplification primers may comprise a flow cell adapter sequence, which is suitable for sequencing. The amplification primers may comprise a P5 flow cell adapter sequence, which comprises the sequence set forth in SEQ ID NO: 3. The amplification primers may comprise a P7 flow cell adapter sequence, which comprises the sequence set forth in SEQ ID NO: 4.

[0058] In all methods of the present disclosure, the flow cell binding site may comprise a flow cell adapter sequence, wherein the flow cell adapter sequence is suitable for sequencing. The flow cell binding site may comprise a P5 flow cell adapter sequence, wherein the P5 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 3. The flow cell binding site may comprise a P7 flow cell adapter sequence, wherein the P7 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 4.

[0059] In all methods of the invention, at least one of the first and second amplification primers may comprise an affinity molecule, for example, at least one of the first and second amplification primers may comprise biotin.

[0060] In all methods of the present disclosure, amplifying may include performing PCR, which may include amplification primers.

[0061] The amplification primer may comprise a flow cell binding site. The amplification primer may comprise a nucleic acid sequence that identifies the specific location in the tissue sample where the identifier oligonucleotide was released. The amplification primer may comprise a nucleic acid sequence that is complementary to the amplification primer binding site.

[0062] Any of the above aspects may be combined with any other aspect.

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. As used herein, unless the context clearly dictates otherwise, the singular includes the plural; for example, the terms "a," "an," and "the" are understood to be singular or plural, and the term "or" is understood to be inclusive. By way of example, "an element" means one or more elements. Throughout this specification, the word "comprising," or variations such as "comprises" or "comprising," are understood to mean the inclusion of a stated element, integer, or step, or group of elements, integers, or steps, but not the exclusion of other elements, integers, or steps, or group of elements, integers, or steps. "About" may be understood to mean within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated numerical value. Unless the context makes clear otherwise, all numerical values ​​provided herein are modified by the term "about."

[0064] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. References cited herein are not admitted to be prior art to the claimed invention. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are merely illustrative and not intended to be limiting. Other features and advantages of the present disclosure will become apparent from the following detailed description and claims.

[0065] The above and further features will be more clearly understood from the following detailed description when taken in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0066] [Figure 1] FIG. 1 is a schematic diagram of the two-end adapter ligation method of the present disclosure.

[0067] [Figure 2] FIG. 2 is a schematic diagram of the single-end adapter ligation method of the present disclosure.

[0068] [Figure 3] FIG. 3 is a schematic diagram of the template primer extension method of the present disclosure.

[0069] [Figure 4] FIG. 4 is a schematic diagram of a template-extended identifier oligonucleotide of the present disclosure.

[0070] [Figure 5] FIG. 5 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0071] [Figure 6] FIG. 6 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0072] [Figure 7] FIG. 7 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0073] [Figure 8] FIG. 8 is a schematic diagram of the long probe hybridization method of the present disclosure.

[0074] [Figure 9] FIG. 9 is a schematic diagram of the long probe hybridization method of the present disclosure.

[0075] [Figure 10] FIG. 10 is a schematic diagram of the long probe hybridization method of the present disclosure.

[0076] [Figure 11] FIG. 11 is a schematic diagram of the direct PCR method of the present disclosure.

[0077] [Figure 12] FIG. 12 is a schematic diagram of the enzyme-free method of the present disclosure.

[0078] [Figure 13] FIG. 13 is a schematic diagram of the multiplexed enzyme-free method of the present disclosure.

[0079] [Figure 14] FIG. 14 is a schematic diagram of a probe of the present disclosure that indirectly binds to a target nucleic acid.

[0080] [Figure 15] FIG. 15 is a schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex of the present disclosure.

[0081] [Figure 16] FIG. 16 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0082] [Figure 17] FIG. 17 is a schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex of the present disclosure.

[0083] [Figure 18] FIG. 18 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0084] [Figure 19] FIG. 19 is a schematic diagram of the direct PCR method of the present disclosure.

[0085] [Figure 20] FIG. 20 is an overall schematic diagram of the method of the present disclosure.

[0086] [Figure 21-1] FIG. 21 illustrates the spatial detection of a protein target analyte using the methods of the present disclosure. [Figure 21-2] (same as above) [Figure 21-3] (same as above) [Figure 21-4] (same as above)

[0087] [Figure 22-1] FIG. 22 shows the spatial detection of an RNA target analyte using the methods of the present disclosure. [Figure 22-2] (same as above) [Figure 22-3] (same as above) [Figure 22-4] (same as above)

[0088] [Figure 23] FIG. 23 shows the spatial detection of a protein target analyte using the methods of the present disclosure.

[0089] [Figure 24] FIG. 24 shows the spatial detection of an RNA target analyte using the methods of the present disclosure.

[0090] [Figure 25] FIG. 25 illustrates the spatial detection of protein target analytes using the methods of the present disclosure.

[0091] [Figure 26] FIG. 26 is a schematic diagram of a probe of the present disclosure.

[0092] [Figure 27] FIG. 27 illustrates the use of probe tiling in the methods of the present disclosure.

[0093] [Figure 28] Figure 28 shows selected regions of interest on a tissue microarray.

[0094] [Figure 29] FIG. 29 is a series of graphs showing the read depth achieved using the methods of the present disclosure.

[0095] [Figure 30] FIG. 30 is a series of graphs showing spatial detection of RNA target analytes in negative control samples using the methods of the present disclosure.

[0096] [Figure 31] FIG. 31 is a series of graphs showing spatial detection of RNA target analytes in a HEK293 sample (top panel) and a Jurkat cell sample (bottom panel) using the methods of the present disclosure.

[0097] [Figure 32-1] FIG. 32 is a series of graphs showing spatial detection of RNA target analytes in 16 FFPE samples using the methods of the present disclosure. [Figure 32-2] (same as above) [Figure 32-3] (same as above) [Figure 32-4] (same as above)

[0098] [Figure 33] FIG. 33 is a graph showing spatial detection of RNA target analytes in HEK293 samples using the methods of the present disclosure.

[0099] [Figure 34] FIG. 34 is a graph showing spatial detection of RNA target analytes in Jurkat cell samples using the methods of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0100] Detailed Description of the Invention The present disclosure is based in part on probes, compositions, methods, and kits for simultaneous, multiplexed, spatial detection and quantification of protein and / or nucleic acid expression in user-defined regions in tissues, user-defined cells, and / or user-defined subcellular tissues within cells using existing sequencing methods.

[0101] The present disclosure compares the identity and abundance of target proteins and / or target nucleic acids present in a first region of interest (e.g., a tissue type, a cell (including normal and abnormal cells), and a subcellular tissue within a cell) with the identity and abundance of target proteins and / or target nucleic acids present in a second region of interest. There is no predetermined upper limit to the number of regions of interest and the number of comparisons that can be performed; the upper limit is related to the size of the regions of interest relative to the size of the sample. As an example, if a single cell is a region of interest, there may be hundreds to thousands of regions of interest in a single fragment, but if a tissue fragment contains only two cell types, there will only be two regions of interest (each containing only one cell type) in the fragment.

[0102] The present disclosure provides greater multiplexing than is possible with standard immunohistochemistry or in situ hybridization methods. Standard immunohistochemistry methods allow for simultaneous detection of up to 6-10, and more typically 3-4, protein targets. Similarly, in situ hybridization methods are limited to simultaneous detection of fewer than 10 nucleic acid targets. The present disclosure provides for the detection of many combinations of nucleic acid and / or protein targets from defined regions of a sample. The present disclosure allows for increased observational frequency through digital quantification, improving reliability and consistency, thereby enabling comparison of results across multiple subjects.

[0103] The various compositions and methods of the present disclosure are described in detail herein.

[0104] In one aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as "two-end adapter ligation."

[0105] The two-end adapter ligation method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The probes and samples of the present disclosure are described in further detail herein. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain.

[0106] After contacting the at least one target analyte with the at least one probe, the two-end adapter ligation method may further include (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0107] After releasing the identifier oligonucleotide, the two-end adapter ligation method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific position in step (2), the identifier oligonucleotide is released only from the probe within that position, and not from the probe outside that position. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that position, thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that position.

[0108] After harvesting the released identifier oligonucleotides, the two-end adaptor ligation method may further comprise the step of (4) ligating at least one nucleic acid adaptor to the released identifier oligonucleotides harvested in step (3).

[0109] The nucleic acid adapter may include a nucleic acid sequence that identifies a particular location in the sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide is released from a location in the sample designated "ROI#1," the nucleic acid adapter would include a nucleic acid sequence corresponding to "ROI#1."

[0110] The nucleic acid adapter may also include a unique molecular identifier.

[0111] The nucleic acid adapter may also comprise a first amplification primer binding site. In another aspect, the nucleic acid adapter may also comprise a second amplification primer binding site.

[0112] In some aspects, the nucleic acid adapters may also contain constant nucleic acid sequences to minimize ligation bias caused by sequence differences in particular identifier oligonucleotides.

[0113] The nucleic acid adapter may be a partially double-stranded nucleic acid molecule. In an aspect where the nucleic acid adapter is partially double-stranded, the nucleic acid adapter comprises a double-stranded annealing region, a first single-stranded mismatched region, and a second single-stranded mismatched region. The first single-stranded mismatched region and the second single-stranded mismatched region may be located on opposite sides of the double-stranded annealing region.

[0114] In aspects where the nucleic acid adapter is partially double-stranded and the identifier oligonucleotide comprises a nucleic acid sequence that identifies a specific location in the sample from which the identifier oligonucleotide was released, the nucleic acid sequence that identifies the specific location in the sample from which the identifier oligonucleotide was released may be present in the double-stranded annealing region of the nucleic acid adapter.

[0115] In aspects where the nucleic acid adapter is partially double-stranded and includes a constant nucleic acid sequence to minimize ligation bias, the constant nucleic acid sequence to minimize ligation bias may be present in the double-stranded annealing region of the nucleic acid adapter.

[0116] In aspects in which the nucleic acid adapter is partially double-stranded and includes a unique molecular identifier, the unique molecular identifier may be present in at least one of the first or second single-stranded mismatch regions of the nucleic acid adapter.

[0117] In aspects where the nucleic acid adapter is partially double-stranded and comprises first and second amplification primer binding sites, the first amplification primer binding site can be present in a first single-stranded mismatched region of the nucleic acid adapter, and the second amplification primer binding site can be present in a second single-stranded mismatched region of the nucleic acid adapter.

[0118] After ligation of the at least one nucleic acid adapter, the two-terminal adapter ligation method may further include (5) amplifying the ligation product produced in step (4) using amplification primers that bind to the first and second amplification primer binding sites, and (6) sequencing the amplification product produced in step (5) to identify the released oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0119] The two-end adaptor ligation method of the present disclosure may further include, prior to step (4), performing an end repair reaction using methods known in the art. The method may further include, prior to step (4), performing an addition reaction to attach a single nucleotide overhang to the 3' end of the identifier oligonucleotide using methods known in the art. In some aspects, the end repair reaction and the addition reaction may be performed sequentially or simultaneously.

[0120] In a preferred aspect of the two-end adaptor ligation method, nucleic acid adaptors are ligated to both ends of the released and harvested identifier oligonucleotide.

[0121] In another aspect of the two-ended adapter ligation method, at least one of the first and second amplification primers used in step (5) to amplify the ligation product generated in step (4) contains a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide was released from a location in the sample designated "ROI#1," then at least one of the first and second amplification primers would contain a nucleic acid sequence corresponding to "ROI#1."

[0122] Figure 1 shows a schematic diagram of a preferred aspect of the disclosed two-ended adapter ligation method. In this aspect, the probe contains a target binding domain comprising an antibody that binds to the target protein. In the upper left illustration, the probe is bound to the target protein. In the upper right illustration, a UV photocleavable linker located between the target binding domain and the identifier oligonucleotide is cleaved, releasing the identifier oligonucleotide. The identifier oligonucleotide contains a unique nucleic acid sequence that identifies the target protein bound to the target binding domain. In the lower illustration, nucleic acid adapters are ligated to both ends of the identifier oligonucleotide. In this non-limiting example, the nucleic acid adapter is partially double-stranded and contains a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. The double-stranded annealing region contains a constant nucleic acid sequence to minimize ligation bias and a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released. The first single-stranded mismatch region contains a first amplification primer binding site. The second single-stranded mismatch region contains a unique molecular identifier and a second amplification primer binding site. After ligation of the nucleic acid adapter to the identifier oligonucleotide, the product is amplified using amplification primers that bind the first and second amplification primer binding sites and sequenced to identify the target protein to which the probe binds.

[0123] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide dual-linked to two nucleic acid adapters for spatially detecting at least one target analyte in a sample. The identifier oligonucleotide dual-linked to two nucleic acid adapters includes an identifier oligonucleotide containing a unique nucleic acid sequence capable of identifying a target analyte in a sample. Each end of the identifier oligonucleotide is bound to a nucleic acid adapter molecule, which is partially double-stranded and contains a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. The first single-stranded mismatch region and the second single-stranded mismatch region are located on opposite sides of the double-stranded annealing region. The double-stranded mismatch region contains a constant nucleic acid sequence to minimize ligation bias and a nucleic acid sequence capable of identifying a specific location in the sample. The first single-stranded mismatch region contains a first amplification primer binding site. The second single-stranded mismatch region contains a second amplification primer binding site and a nucleic acid sequence containing a unique molecular identifier. A schematic diagram of an identifier oligonucleotide dual-linked to two nucleic acid adaptors is shown in the bottom diagram of FIG.

[0124] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure, in a method referred to herein as the "single-ended adapter ligation method."

[0125] The single-end adapter ligation method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a first amplification primer binding site. In some aspects, the identifier oligonucleotide also includes at least one 3' end with a single nucleotide overhang.

[0126] After contacting the at least one target analyte with the at least one probe, the single-end adapter ligation method may further include (2) applying a force to a specific location of the sample sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0127] After releasing the identifier oligonucleotide, the single-end adapter ligation method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within that location, and not from the probe outside that location. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that location in step (3), thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that location.

[0128] After collecting the released identifier oligonucleotides, the single-end adaptor ligation method may further include the step of (4) ligating at least one nucleic acid adaptor to the released oligonucleotides collected in step (3).

[0129] The nucleic acid adapter may include a nucleic acid sequence that identifies the specific location in the sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide is released from a location in the sample designated "ROI#1," the nucleic acid adapter would include a nucleic acid sequence corresponding to "ROI#1." The nucleic acid adapter may also include a unique molecular identifier. The nucleic acid adapter may also include a second amplification primer binding site.

[0130] In some aspects, the nucleic acid adapter may also include a constant nucleic acid sequence to minimize ligation bias caused by differences in the sequence of a particular identifier oligonucleotide. The constant nucleic acid sequence may include a cleavable portion. The cleavable portion may be enzymatically cleavable. In a non-limiting example, the enzymatically cleavable portion may be a USER sequence, where the USER sequence includes the sequence GUGUATUG.

[0131] The nucleic acid adapter may comprise any combination of the above traits.

[0132] The nucleic acid adapter may be a partially double-stranded nucleic acid molecule. In aspects where the nucleic acid adapter is partially double-stranded, the nucleic acid adapter comprises a double-stranded annealing region and a single-stranded mismatch region.

[0133] In aspects where the nucleic acid adapter is partially double-stranded and the identifier oligonucleotide comprises a nucleic acid sequence that identifies a specific location in the sample from which the identifier oligonucleotide was released, the nucleic acid sequence that identifies the specific location in the sample from which the identifier oligonucleotide was released may be present in the double-stranded annealing region of the nucleic acid adapter.

[0134] In aspects where the nucleic acid adapter is partially double-stranded and includes a constant nucleic acid sequence to minimize ligation bias, the constant nucleic acid sequence that minimizes ligation bias may be present in the double-stranded annealing region of the nucleic acid adapter.

[0135] In aspects where the nucleic acid adapter is partially double-stranded and includes a unique molecular identifier, the unique molecular identifier may be present in a single-stranded mismatched region.

[0136] In aspects where the nucleic acid adapter is partially double-stranded and includes a second amplification primer binding site, the second amplification primer binding site may be present in a single-stranded mismatched region of the nucleic acid adapter.

[0137] After ligation of the at least one nucleic acid adapter, the two-end adapter ligation method may further include (5) amplifying the ligation product produced in step (4), and (6) sequencing the amplification product produced in step (5) to identify the released oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0138] In another aspect of the single-end adapter ligation method of the present disclosure, at least one of the first and second amplification primers used in step (5) to amplify the ligation product generated in step (4) contains a nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide is to be released from a location in the sample designated "ROI#1," at least one of the amplification primers would contain a nucleic acid sequence corresponding to "ROI#1."

[0139] Figure 2 shows a schematic diagram of a preferred aspect of the disclosed single-end adapter ligation method. In this aspect, the probe includes a target binding domain that is an antibody that binds to the target protein. In the upper left illustration, the probe is bound to the target protein. In the upper right illustration, a UV photocleavable linker disposed between the target binding domain and the identifier oligonucleotide has been cleaved, releasing the identifier oligonucleotide. The identifier oligonucleotide includes a unique nucleic acid sequence that identifies the target protein and a first amplification primer binding site. In this non-limiting example, the identifier oligonucleotide is double-stranded, with one strand containing three different nucleic acid molecules. The identifier oligonucleotide also includes one 3' end with a single nucleotide overhang.

[0140] In the bottom diagram of Figure 2, a nucleic acid adapter is ligated to the end of an identifier oligonucleotide that includes a 3' single-nucleotide overhang. In this non-limiting example, the nucleic acid adapter is partially double-stranded and includes a double-stranded annealing region and a single-stranded mismatch region. The double-stranded annealing region contains a constant nucleic acid sequence to minimize ligation bias and a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released. The single-stranded mismatch region contains a unique molecular identifier and a second amplification primer binding site. After ligation of the nucleic acid adapter to the identifier oligonucleotide, the product is amplified using amplification primers that bind to the first and second amplification primer binding sites and sequenced to identify the target protein to which the probe binds.

[0141] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide linked to a nucleic acid adapter for spatially detecting at least one target analyte in a sample. The identifier oligonucleotide linked to a nucleic acid adapter includes a unique nucleic acid sequence capable of identifying the target analyte in the sample and an identifier oligonucleotide including a first amplification primer binding site. One end of the identifier oligonucleotide is linked to a nucleic acid adapter molecule, which is partially double-stranded and includes a double-stranded annealing region, a single-stranded mismatch region, and a second single-stranded mismatch region. The double-stranded mismatch region includes a constant nucleic acid sequence to minimize ligation bias and a nucleic acid sequence capable of identifying a specific location in the sample. The single-stranded mismatch region includes a second amplification primer binding site. A schematic diagram of an identifier oligonucleotide linked to a nucleic acid adapter is shown in the bottom diagram of Figure 2.

[0142] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "template-primer extension method."

[0143] The template primer extension method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a first amplification primer binding site.

[0144] After contacting the at least one target analyte with the at least one probe, the template primer extension method may further include (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0145] After releasing the identifier oligonucleotide, the template primer extension method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within that location, and not from the probe outside that location. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that location in step (3), thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that location.

[0146] After collecting the released identifier oligonucleotide, the template primer extension method may further include (4) hybridizing a single-stranded nucleic acid template to the released identifier oligonucleotide collected in step (3).

[0147] The single-stranded nucleic acid template may include a region that is complementary to the unique nucleic acid sequence of the identifier oligonucleotide, thereby allowing the single-stranded nucleic acid template to hybridize with the harvested identifier oligonucleotide.

[0148] The single-stranded nucleic acid template may also comprise a nucleic acid sequence that includes a unique molecular identifier.

[0149] The single-stranded nucleic acid template may also include a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released.

[0150] The single-stranded nucleic acid template may also include a nucleic acid sequence that is complementary to a second amplification primer binding site.

[0151] The single-stranded nucleic acid template may comprise any combination of the above-mentioned traits.

[0152] After hybridization of the identifier oligonucleotide to the single-stranded nucleic acid template, the template primer extension method may further include (5) extending the identifier oligonucleotide of step (4) to generate an extension product complementary to the single-stranded nucleic acid template, wherein the extension product comprises a sequence complementary to the identifier oligonucleotide and the single-stranded nucleic acid template; (6) amplifying the extension product of step (6) with amplification primers that hybridize to the first and second amplification primer binding sites; and (7) sequencing the amplification products generated in step (6) to identify the released identifier oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0153] In some aspects, the single-stranded nucleic acid template can include an affinity molecule. In aspects in which the single-stranded nucleic acid template includes an affinity molecule, the template primer extension method can further include an affinity purification step between steps (4) and (5).

[0154] Figure 3 shows a schematic diagram of a preferred aspect of the disclosed template primer extension method. In this aspect, the probe includes a target binding domain that is an antibody that binds to the target protein. In the upper left diagram, the probe is bound to the target protein. In the upper right diagram, a UV photocleavable linker disposed between the target binding domain and the identifier oligonucleotide is cleaved, releasing the identifier oligonucleotide. The identifier oligonucleotide includes a unique nucleic acid sequence that identifies the target protein and a first amplification primer binding site. In the lower right diagram, the identifier oligonucleotide is hybridized to a single-stranded nucleic acid template. In this non-limiting example, the single-stranded nucleic acid template includes an affinity molecule, a nucleic acid sequence complementary to the unique nucleic acid sequence of the identifier oligonucleotide, a first unique molecular identifier, and a sequence complementary to the second amplification primer binding site. The identifier oligonucleotide is extended to generate an extension product complementary to the single-stranded nucleic acid template. As shown in the lower left diagram, the extension product includes the identifier oligonucleotide, a nucleic acid sequence complementary to the first unique molecular identifier, and a second amplification primer binding site. Following the extension reaction, the primer extension product is amplified using amplification primers that bind to the first and second amplification primer binding sites. In this non-limiting example, one of the first and second amplification primers contains a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released. The amplification product is then sequenced to identify the target protein to which the probe bound.

[0155] In one aspect, the present disclosure provides a template-extension identifier oligonucleotide composition for spatially detecting at least one target analyte in a sample. The template-extension identifier oligonucleotide comprises a first flow cell adapter sequence suitable for sequencing, followed by a first unique molecular identifier, followed by an identifier oligonucleotide, followed by a second unique molecular identifier, followed by a second amplification primer binding site, followed by a third unique molecular identifier, followed by a second flow cell adapter sequence suitable for sequencing. The identifier oligonucleotide comprises a first amplification primer binding site and a unique nucleic acid sequence capable of identifying the target analyte in the sample. A schematic diagram of the template-extension identifier oligonucleotide is shown in the bottom diagram of Figure 4.

[0156] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "short probe hybridization method."

[0157] The short probe hybridization method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain.

[0158] After contacting the at least one target analyte with the at least one probe, the short probe hybridization method may further include (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0159] After the identifier oligonucleotide is released, the short probe hybridization method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within that location, and not from the probe outside that location. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that location in step (3), thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that location.

[0160] After collecting the released identifier oligonucleotide, the short probe hybridization method may further include the step of (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide.

[0161] The first or second nucleic acid probe may comprise a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The first or second nucleic acid probe may also comprise a nucleic acid sequence that identifies a specific location in the sample from which the identifier oligonucleotide was released. The first or second nucleic acid probe may also comprise a nucleic acid sequence that includes a unique molecular identifier. The first nucleic acid probe may comprise a first amplification primer binding site. The second nucleic acid probe may comprise a second amplification primer binding site.

[0162] The first or second nucleic acid probe may comprise any combination of the above-described features. In a preferred aspect shown in Figure 5, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site, a nucleic acid sequence that includes a unique molecular identifier, and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In this preferred aspect, the nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released is located 5' of the first amplification primer binding site, and the unique molecular identifier is located 3' of the second amplification primer binding site.

[0163] In another preferred aspect shown in Figure 6, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, a nucleic acid sequence that includes a unique molecular identifier, and a nucleic acid sequence that is complementary to a portion of the identifier oligonucleotide. In this same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In this preferred aspect, the nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released and the unique molecular identifier are located 5' to the first amplification primer binding site.

[0164] In another preferred aspect shown in Figure 7, the first nucleic acid probe comprises a first amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In this same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site, a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, a nucleic acid sequence that includes a unique molecular identifier, and a nucleic acid sequence complementary to the identifier oligonucleotide. In this preferred aspect, the nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released and the unique molecular identifier are located 3' to the second amplification primer binding site.

[0165] In another preferred aspect shown in Figure 15, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier, and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In this preferred aspect, the nucleic acid sequence comprising the unique molecular identifier is located 3' of the first amplification binding site.

[0166] In another preferred aspect shown in Figure 17, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier, and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In this preferred aspect, the nucleic acid sequence comprising the unique molecular identifier is located 5' of the first amplification binding site.

[0167] The first and second nucleic acid probes may hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but not overlapping. Alternatively, the first and second nucleic acid probes may hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are non-adjacent and non-overlapping.

[0168] After hybridization of the first and second nucleic acid probes to the identifier oligonucleotide, the short probe hybridization method may further include (5) ligating the first and second nucleic acid probes together, e.g., by performing a nick repair reaction, in aspects where the first and second nucleic acid probes hybridize to the identifier oligonucleotide so that they are adjacent but not overlapping. Alternatively, in aspects where the first and second nucleic acid probes hybridize to the identifier oligonucleotide so that they are not adjacent or overlapping, the method includes ligating the first and second nucleic acid probes together, e.g., by performing a gap extension reaction and a nick repair reaction, so that the first and second nucleic acid probes are ligated together.

[0169] After ligation of the first and second nucleic acid probes, the short probe hybridization method may further include (6) amplifying the ligation product produced in step (5) using amplification primers that hybridize to the first and second amplification primer binding sites, and (7) sequencing the amplification product produced in step (6) to identify the released identifier oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0170] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-short nucleic acid probe complex for spatially detecting at least one target analyte in a sample. The identifier oligonucleotide-short nucleic acid probe complex comprises an identifier oligonucleotide hybridized to a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying the target analyte in the sample. The first nucleic acid probe comprises a first amplification primer binding site, followed by a unique nucleic acid sequence capable of identifying a specific location in the sample, followed by a region complementary to the identifier oligonucleotide. The second nucleic acid probe comprises a second amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex is shown in Figure 5.

[0171] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-short nucleic acid probe complex for spatially detecting at least one target analyte in a sample. The identifier oligonucleotide-short nucleic acid probe complex comprises an identifier oligonucleotide hybridized to a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying the target analyte in the sample. The first nucleic acid probe comprises a first amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a region complementary to the identifier oligonucleotide, the nucleic acid sequence comprising the unique molecular identifier being located 3' of the first amplification primer binding site. The second nucleic acid probe comprises a second amplification primer binding site, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex is shown in Figure 15.

[0172] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-short nucleic acid probe complex for spatially detecting at least one target analyte in a sample. The identifier oligonucleotide-short nucleic acid probe complex comprises an identifier oligonucleotide hybridized to a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying the target analyte in the sample. The first nucleic acid probe comprises a first amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a region complementary to the identifier oligonucleotide, the nucleic acid sequence comprising the unique molecular identifier being located 5' of the first amplification primer binding site. The second nucleic acid probe comprises a second amplification primer binding site, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex is shown in Figure 17.

[0173] Figure 16 shows an overall schematic diagram of a typical short probe hybridization method of the present disclosure. First, at least one target analyte in a sample is contacted with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target protein binding domain that is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region that can hybridize directly or indirectly to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target domain.

[0174] After contacting at least one target analyte with at least one probe, a force sufficient to release the identifier oligonucleotide is applied to a specific location on the sample, which is then collected, as shown in the top diagram of Figure 16.

[0175] As shown in the second diagram from the top of Figure 16, the released identifier oligonucleotide is then hybridized to a first nucleic acid probe and a second nucleic acid probe. In this non-limiting example, the first nucleic acid probe includes a first amplification primer binding site, a nucleic acid sequence containing a unique molecular identifier, and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The nucleic acid sequence containing the unique molecular identifier is located 3' of the first amplification primer binding site. The second nucleic acid probe includes a second amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In this non-limiting example, the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but do not overlap. After hybridization to the identifier oligonucleotide, the first and second probes are ligated together, for example, by performing a nick repair reaction.

[0176] After ligation of the first and second nucleic acid probes, the ligation product is amplified by PCR using amplification primers that hybridize to the first and second amplification primer binding sites. As shown in the second-to-bottom diagram of Figure 16, the amplification primer that hybridizes to the second amplification primer binding site includes a first flow cell binding site, a first nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the second amplification primer binding site. The amplification primer that hybridizes to the first amplification primer binding site includes a second flow cell binding site, a second nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the first amplification primer binding site. The PCR product shown in the bottom diagram of Figure 16 is then sequenced to identify the released oligonucleotide, thereby spatially detecting at least one target analyte in the sample.

[0177] Figure 18 shows an overall schematic diagram of a typical short probe hybridization method of the present disclosure. First, at least one target analyte in a sample is contacted with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target domain.

[0178] After contacting at least one target analyte with at least one probe, a force sufficient to release the identifier oligonucleotide is applied to the sample location, which is then collected as shown in the top diagram of Figure 18.

[0179] As shown in the second diagram from the top of Figure 18, the released identifier oligonucleotide is then hybridized to a first nucleic acid probe and a second nucleic acid probe. In this non-limiting example, the first nucleic acid probe includes a first amplification primer binding site, a nucleic acid sequence containing a unique molecular identifier, and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The nucleic acid sequence containing the unique molecular identifier is located 5' of the first amplification primer binding site. The second nucleic acid probe includes a second amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In this non-limiting example, the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but do not overlap. After hybridization to the identifier oligonucleotide, the first and second probes are ligated together, for example, by performing a nick repair reaction.

[0180] After ligation of the first and second nucleic acid probes, the ligation product is amplified by PCR using amplification primers that hybridize to the first and second amplification primer binding sites. As shown in the second-to-bottom diagram of Figure 18, the amplification primer that hybridizes to the second amplification primer binding site includes a first flow cell binding site, a first nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the second amplification primer binding site. The amplification primer that hybridizes to the first amplification primer binding site includes a second flow cell binding site, a second nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the first amplification primer binding site. The PCR product, shown at the bottom of Figure 18, is then sequenced to identify the released oligonucleotide, thereby spatially detecting at least one target analyte in the sample.

[0181] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "long probe hybridization method."

[0182] The long probe hybridization method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain.

[0183] After contacting the at least one target analyte with the at least one probe, the long probe hybridization method may further include (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0184] After releasing the identifier oligonucleotide, the long probe hybridization method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within that location, and not from the probe outside that location. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that location in step (3), thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that location.

[0185] After collecting the released identifier oligonucleotide, the long probe hybridization method may further include the step of (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide.

[0186] The first or second nucleic acid probe may comprise a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The first or second nucleic acid probe may also comprise a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released.

[0187] The first or second nucleic acid probe may also include a first unique molecular identifier. The first or second nucleic acid probe may also include a second unique molecular identifier. The first or second nucleic acid probe may also include a third unique molecular identifier.

[0188] The first nucleic acid probe may comprise a first amplification primer binding site.

[0189] The first nucleic acid probe may also include a first flow cell binding site. The second nucleic acid probe may include a second flow cell binding site.

[0190] The first and second nucleic acid probes may comprise any combination of the above-described features. In a preferred aspect shown in Figure 8, the first nucleic acid probe comprises a first flow cell binding site, a first unique molecular identifier, a first amplification primer binding site, a nucleic acid sequence identifying the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second flow cell binding site, a second unique molecular identifier, a third unique molecular identifier, and a nucleic acid sequence complementary to the identifier oligonucleotide. In this preferred aspect, the nucleic acid sequence identifying the specific location in the sample where the identifier oligonucleotide was released and the first unique molecular identifier are located 5' of the first flow cell binding site, and the second and third unique molecular identifiers are located 3' of the second flow cell binding site.

[0191] In another preferred aspect shown in Figure 9, the first nucleic acid probe comprises a first flow cell binding site, a first unique molecular identifier, a second unique molecular identifier, a first amplification primer binding site, a nucleic acid sequence identifying a specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second flow cell binding site, a third unique molecular identifier, and a nucleic acid sequence complementary to the identifier oligonucleotide. In this preferred aspect, the first unique molecular identifier, the second unique molecular identifier, and the nucleic acid sequence identifying a specific location in the sample where the identifier oligonucleotide was released are located 5' of the first flow cell binding site, and the third unique molecular identifier is located 3' of the second flow cell binding site.

[0192] In another preferred aspect shown in Figure 10, the first nucleic acid probe comprises a first flow cell binding site, a first unique molecular identifier, a first amplification primer binding site, and a nucleic acid sequence complementary to the identifier oligonucleotide. In this same preferred aspect, the second nucleic acid probe comprises a second flow cell binding site, a second unique molecular identifier, a third unique molecular identifier, a nucleic acid sequence identifying a specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the identifier oligonucleotide. In this preferred aspect, the first unique molecular identifier is located 5' to the first flow cell binding site, and the second unique molecular identifier, the third unique molecular identifier, and the nucleic acid sequence identifying a specific location in the sample where the identifier oligonucleotide was released are located 3' to the second amplification primer binding site.

[0193] The first and second nucleic acid probes may hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but not overlapping, or alternatively, the first and second nucleic acid probes may hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are non-adjacent and non-overlapping.

[0194] After hybridization of the first and second nucleic acid probes to the identifier oligonucleotide, the long probe hybridization method may further include (5) performing a nick repair reaction such that the first and second nucleic acid probes are ligated together in aspects where the first and second nucleic acid probes hybridize to the identifier oligonucleotide in an adjacent but non-overlapping manner. Alternatively, in aspects where the first and second nucleic acid probes hybridize to the identifier oligonucleotide in a non-adjacent and non-overlapping manner, the method includes performing a gap extension and nick repair reaction such that the first and second nucleic acid probes are ligated together.

[0195] The method may further include (6) amplifying the ligation products produced in step (5) with amplification primers that hybridize to the first and second amplification primer binding sites, and (7) sequencing the amplification products produced in step (6) to identify the released identifier oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0196] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-long nucleic acid probe complex for spatially detecting at least one target analyte in a sample. The identifier oligonucleotide-long nucleic acid probe complex comprises an identifier oligonucleotide hybridized to a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying the target analyte in the sample. The first nucleic acid probe comprises a first flow cell binding site suitable for sequencing, followed by a first unique molecular identifier, followed by a first amplification primer binding site, followed by a unique nucleic acid sequence capable of identifying a specific location in the sample, followed by a region complementary to the identifier oligonucleotide. The second nucleic acid probe comprises a second flow cell binding site, followed by a second unique molecular identifier, followed by a third unique molecular identifier, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex is shown in Figure 8.

[0197] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as "direct PCR."

[0198] The direct PCR method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target protein binding domain that is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region that can hybridize directly or indirectly to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a first amplification primer binding site, a second amplification primer binding site, or a unique molecular identifier. The identifier oligonucleotide may include any combination of these features. Any of these features may be flanked by a region comprising a constant nucleic acid sequence of about 1 to about 10 nucleotides.

[0199] After contacting the at least one sample with the at least one probe, the direct PCR method further includes (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0200] The direct PCR method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within that location, and not from the probe outside that location. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that location in step (3), thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that location.

[0201] After releasing the identifier oligonucleotide, the direct PCR method may further include (4) amplifying the released identifier oligonucleotide using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site. In some aspects, at least one of the first and second amplification primers includes a nucleic acid sequence that identifies the specific location in the sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide is released from a location in the sample designated "ROI#1," at least one of the first and second amplification primers would include a nucleic acid sequence corresponding to "ROI#1." In yet other aspects, at least one of the first and second amplification primers includes a unique molecular identifier.

[0202] After amplification, the direct PCR method of the present disclosure may further include the step of (5) sequencing the amplification products produced in step (5) to identify the released oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0203] Figure 11 shows a schematic diagram of a preferred aspect of the direct PCR method of the present disclosure. In this aspect, the probe contains a target-binding domain that includes a nucleic acid sequence complementary to the target nucleic acid. In the top diagram, the probe is hybridized to the target nucleic acid. In the bottom diagram, a UV photocleavable linker between the target-binding domain and the identifier oligonucleotide is cleaved, releasing the identifier oligonucleotide. The identifier oligonucleotide contains a first amplification primer binding site, a second amplification primer binding site, a unique molecular identifier, and a unique nucleic acid sequence that identifies the target analyte bound to the target-binding domain. A constant spacer region 3 nucleotides in length is located between these four features. The identifier oligonucleotide is double-stranded, with one strand containing three different nucleic acid molecules. After release, the identifier oligonucleotide is amplified using a first amplification primer that hybridizes to the first amplification primer binding site and includes a nucleic acid sequence that identifies the specific location in the sample from which the identifier oligonucleotide was released, and a second amplification primer that hybridizes to the second amplification primer binding site. The amplified product is then sequenced to identify the target nucleic acid to which the probe bound.

[0204] Figure 19 shows a schematic diagram of a preferred aspect of the direct PCR method of the present disclosure. In this aspect, the identifier oligonucleotide comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier, a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, and a second amplification primer binding site, as shown in the top diagram of Figure 19. The identifier oligonucleotide is amplified using amplification primers that hybridize to the first and second amplification primer binding sites. As shown in the middle diagram of Figure 19, the amplification primer that hybridizes to the second amplification primer binding site comprises a first flow cell binding site, a first nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the second amplification primer binding site. The amplification primer that hybridizes to the first amplification primer binding site comprises a second flow cell binding site, a second nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a nucleic acid sequence complementary to the first amplification primer binding site. The PCR products shown in the bottom diagram of Figure 19 are sequenced to identify the released oligonucleotides and thereby spatially detect at least one target analyte in the sample.

[0205] In one aspect, the present disclosure provides a composition of identifier oligonucleotides compatible with direct PCR for spatially detecting at least one target analyte in a sample. The identifier oligonucleotides compatible with direct PCR include a first amplification primer binding site, followed by a unique nucleic acid sequence capable of identifying the target analyte in the sample, followed by a unique molecular identifier, followed by a second amplification primer binding site. A schematic diagram of an identifier oligonucleotide compatible with direct PCR is shown in the bottom diagram of Figure 11.

[0206] In one aspect, the present disclosure provides a composition of identifier oligonucleotides compatible with direct PCR for spatially detecting at least one target analyte in a sample. The identifier oligonucleotides compatible with direct PCR include a first amplification primer binding site, followed by a nucleic acid sequence containing a unique molecular identifier, followed by a unique nucleic acid sequence capable of identifying the target analyte in the sample, followed by a second amplification primer binding site. A schematic diagram of an identifier oligonucleotide compatible with direct PCR is shown in the top diagram of Figure 19.

[0207] In some aspects of the disclosed methods, one or more, or two or more, or three or more, or four or more, or five or more, or six or more, or seven or more, or eight or more, or nine or more, or ten or more, or eleven or more, or twelve or more, or thirteen or more, or fourteen or more, or fifteen or more, or sixteen or more, or seventeen or more, or eighteen or more, or nineteen or more, or twenty or more, or thirty or more, or forty or more, or fifty or more, or sixty or more, or seventy or more, or eighty or more, or ninety or more, or one hundred or more probes may correspond to a single target analyte. As used herein, the term "tiling" is used to describe when two or more probes of the present disclosure are bound to a target analyte. The top diagram of Figure 27 shows tiling of multiple probes to a single target RNA. This demonstrates that tiling multiple probes to a single target analyte allows each portion of the target analyte to be detected individually multiple times, improving the overall accuracy of the measurement. In a non-limiting example, as shown in the bottom diagram of Figure 27, when 10 probes are tiled to a single target RNA, one of the probes may be erroneously detected very frequently (an aberrant high-count probe) and another may be erroneously detected very rarely (an aberrant low-count probe). However, the other eight probes are detectable with comparable counts, demonstrating that the two outliers can be discarded during analysis, resulting in a more accurate measurement of the target RNA abundance using the signals from the eight probes.

[0208] The present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in what is referred to herein as an "enzyme-free method."

[0209] The enzyme-free method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a capture probe binding site.

[0210] After contacting the at least one target analyte with the at least one probe, the enzyme-free method may further include (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0211] After releasing the identifier oligonucleotide, the enzyme-free method may further include a step (3) of collecting the released identifier oligonucleotide. By directing a force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within that location, and not from the probe outside that location. Therefore, the identifier oligonucleotide is collected only for the probe bound to the target within that location in step (3), thereby enabling the identification and detection of the amount of the target (protein and / or nucleic acid) located only within that location.

[0212] After harvesting the released identifier oligonucleotides, the enzyme-free method may further comprise the step of (4) hybridizing a capture probe to the released identifier oligonucleotides.

[0213] The capture probe may comprise a region complementary to the capture probe binding site. The capture probe may also comprise an affinity molecule.

[0214] After hybridization of the capture probe, the enzyme-free method may further include (5) sequencing the hybridization product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0215] The hybridized product produced in step (4) may be sequenced using enzyme-free sequencing methods, such as those described in U.S. Patent No. 2014946386 and U.S. Patent No. 15 / 819,151, each of which is incorporated by reference in its entirety.

[0216] Figure 12 shows a schematic diagram of a preferred aspect of the enzyme-free method of the present disclosure. In this aspect, the probe includes a target binding domain that includes a nucleic acid sequence that is complementary to the target nucleic acid. In the top diagram, the probe is hybridized to the target nucleic acid. In the middle diagram, a UV photocleavable linker between the target binding domain and the identifier oligonucleotide is cleaved, releasing the identifier oligonucleotide. The identifier oligonucleotide includes a unique nucleic acid sequence that identifies the target nucleic acid bound to the target binding domain and a capture probe binding site. After release, the identifier oligonucleotide is hybridized to a capture probe as shown in the bottom diagram. The capture probe includes a nucleic acid sequence and an affinity molecule that is complementary to the capture probe binding site. The hybridization product is then sequenced using enzyme-free sequencing to identify the target nucleic acid to which the probe is bound.

[0217] In one aspect, the present disclosure provides a composition of a hybridized identifier oligonucleotide-capture probe complex for spatially detecting at least one target analyte in a sample. The hybridized identifier oligonucleotide-capture probe complex comprises an identifier oligonucleotide hybridized to a capture probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a specific target analyte in a sample and a capture probe binding site. The capture probe comprises an affinity molecule and a region complementary to the capture probe binding site. A schematic diagram of the hybridized identifier oligonucleotide-capture probe complex is shown in the bottom diagram of Figure 12.

[0218] The present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "multiplexed enzyme-free method."

[0219] The multiplexed enzyme-free method of the present disclosure may include (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region capable of specifically binding to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region capable of directly or indirectly hybridizing to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a capture probe binding site. The identifier oligonucleotide may also include a multiplex probe binding site.

[0220] After contacting the at least one target analyte with the at least one probe, the multiplexed enzyme-free method may further include (2) applying a force to the sample location sufficient to release the identifier oligonucleotide. In a non-limiting example, in aspects where the probe includes a photocleavable linker between the identifier oligonucleotide and the target binding domain, the region of interest (ROI) is excited with light of a wavelength sufficient to cleave the photocleavable linker.

[0221] After releasing the identifier oligonucleotides, the multiplexed enzyme-free method may further include a step (3) of collecting the released identifier oligonucleotides. By directing a force only to a specific location in step (2), the identifier oligonucleotides are released only from probes within that location, and not from probes outside that location. Thus, in step (3), the identifier oligonucleotides are collected only for probes bound to targets within that location, thereby enabling the identification and detection of the amount of targets (proteins and / or nucleic acids) located only within that location.

[0222] After harvesting the released identifier oligonucleotides, the multiplexed enzyme-free method may further comprise the step of (4) hybridizing a capture probe and a multiplex probe to the released identifier oligonucleotides.

[0223] The capture probe may comprise a region complementary to the capture probe binding site. The capture probe may also comprise an affinity molecule.

[0224] The multiplex probe may include a region complementary to the multiplex probe binding site. The multiplex probe may also include a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released and a region complementary to the multiplex probe binding site.

[0225] After hybridization of the capture probe and the multiplex probe, the multiplexed enzyme-free method may further include (5) sequencing the hybridization product produced in step (4) to identify the released identifier oligonucleotide, thereby spatially detecting at least one target analyte within at least one cell in the tissue sample.

[0226] The hybridized product produced in step (4) may be sequenced using enzyme-free sequencing methods, such as those described in U.S. Patent No. 2014946386 and U.S. Patent No. 15 / 819,151, each of which is incorporated by reference in its entirety.

[0227] Figure 13 shows a schematic diagram of a preferred aspect of the multiplexed enzyme-free method of the present disclosure. In this aspect, the probe includes a target-binding domain that includes a nucleic acid sequence complementary to the target nucleic acid. In the top diagram, the probe is hybridized to the target nucleic acid. In the middle diagram, a UV photocleavable linker between the target-binding domain and the identifier oligonucleotide is cleaved, releasing the identifier oligonucleotide. The identifier oligonucleotide includes a unique nucleic acid sequence that identifies the target analyte bound to the target-binding domain, a capture probe binding site, and a multiplex probe binding site, as shown in the middle diagram. After release, the identifier oligonucleotide hybridizes to a capture probe and a multiplex probe, as shown in the bottom diagram. The capture probe includes a nucleic acid sequence complementary to the capture probe binding site and an affinity molecule. The multiplex probe includes a nucleic acid sequence complementary to the multiplex probe binding site and a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released. The hybridization product is then sequenced using an enzyme-free sequencing method to identify the target nucleic acid to which the probe bound.

[0228] In one aspect, the present disclosure provides a composition of a hybridized identifier oligonucleotide-capture probe-multiple probe complex for spatially detecting at least one target analyte in a sample. The hybridized identifier oligonucleotide-capture probe-multiple probe complex includes a capture probe and an identifier oligonucleotide hybridized to a multiple probe. The identifier oligonucleotide includes a unique nucleic acid sequence capable of identifying a specific target analyte in a sample, a capture probe binding site, and a multiple probe binding site. The capture probe includes an affinity molecule and a region complementary to the capture probe binding site. The multiple probe includes a nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released and a region complementary to the multiple probe binding site. A schematic diagram of a hybridized identifier oligonucleotide-capture probe-multiple probe complex is shown in the bottom diagram of Figure 13.

[0229] Figure 20 is an overall schematic diagram of an exemplary method of the present disclosure. First, a sample on a microscope slide is contacted with multiple probes of the present disclosure (step 1 in Figure 20). Next, the slide is imaged to select specific regions of interest (ROIs) (step 2 in Figure 20). Next, the specific ROIs are illuminated with UV light to release identifier oligonucleotides from the bound probes within the ROIs. The released identifier oligonucleotides are then collected by aspiration using a microcapillary. After aspiration, the identifier oligonucleotides are transferred to specific wells in a 96-well plate. Next, steps 4 and 5 are repeated for each ROI identified in step 2. After all ROIs have been illuminated and all released identifier oligonucleotides have been collected, the identifier oligonucleotides are sequenced using next-generation sequencing methods to spatially detect at least one target analyte in the sample.

[0230] As mentioned above, the present disclosure provides a probe suitable for the composition and method for spatially detecting at least one target analyte in a sample.The present disclosure provides a probe comprising a target binding domain and an identifier oligonucleotide.The target binding domain is a predetermined region of the probe that specifically binds to at least one target analyte in a sample.

[0231] The probes of the present disclosure can be used to spatially detect target nucleic acids. In this aspect, the target binding domain can be a target nucleic acid binding region. The target nucleic acid binding region is preferably at least 15 nucleotides in length, more preferably at least 20 nucleotides in length. In certain aspects, the target nucleic acid binding region is about 10-500, 20-400, 25, 30-300, 35, 40-200, or 50-100 nucleotides in length. Probes and methods for binding and identifying target nucleic acids are described, for example, in U.S. Patent Nos. 2003 / 0013091, 2007 / 0166708, 2010 / 0015607, 2010 / 0261026, 2010 / 0262374, 2010 / 0112710, 2010 / 0047924, and 2014 / 0371088, each of which is incorporated by reference in its entirety.

[0232] The target nucleic acid binding region may hybridize directly to the target nucleic acid present in the sample. Alternatively, the probes of the present disclosure may indirectly hybridize to the target nucleic acid present in the sample (via an intermediate oligonucleotide). Figure 14 illustrates a probe (or composition) of this aspect. The probe comprises a target nucleic acid binding domain that binds to a synthetic oligonucleotide (intermediate oligonucleotide), which in turn binds to the target nucleic acid in the biological sample. The intermediate oligonucleotide comprises a nucleic acid backbone and is capable of binding to the target nucleic acid, making it a probe as defined herein. In these aspects, the target nucleic acid binding region of the probe hybridizes to a region of the intermediate oligonucleotide (i.e., the synthetic oligonucleotide) that is different from the target nucleic acid present in the sample. Thus, the target binding region of the probe is not dependent on the final target nucleic acid in the sample. This allows the target-specific components of the assay (present in the sample) to be contained in inexpensive, widely available synthetic DNA oligonucleotides rather than expensive probes, providing flexibility in economical and rapid assay design. The synthetic oligonucleotide can be easily designed to include a region that hybridizes to the target nucleic acid present in the sample and a region that hybridizes to the probe. Thus, a set of indirect binding probes can be used to detect a vast variety of target nucleic acids (present in a sample) in a variety of tests simply by replacing the target-specific (synthetic) oligonucleotide portion of the assay.

[0233] The target nucleic acid may be DNA or RNA, preferably messenger RNA (mRNA) or miRNA.

[0234] The probes of the present disclosure can be used to detect target proteins. In this aspect, the target-binding domain can be a target protein-binding region. A target protein-binding region includes a molecule or construct designed to bind to at least one target protein, at least one target protein surrogate, or both, and capable of generating a molecular complex containing the probe and the target protein under appropriate conditions. The target protein-binding region can include an antibody, peptide, aptamer, or peptoid. Antibodies can be obtained from a variety of sources, including, but not limited to, polyclonal antibodies, monoclonal antibodies, monospecific antibodies, recombinantly expressed antibodies, humanized antibodies, plant antibodies, and the like. The terms protein, polypeptide, peptide, and amino acid sequence are used interchangeably herein to refer to amino acid polymers of any length. The polymers can be linear or branched, can contain modified amino acids, and can be separated by non-amino acids or synthetic amino acids. The term also encompasses amino acid polymers modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or other manipulations, such as conjugation with a labeling moiety. The term amino acid, as used herein, refers to natural and / or unnatural or synthetic amino acids, including, but not limited to, glycine and both the D or L optical isomers, as well as amino acid analogs and peptidomimetics. Probes and methods for binding and identifying target proteins are described, for example, in U.S. Patent No. 2011 / 0086774, the contents of which are incorporated herein by reference in their entirety.

[0235] An identifier oligonucleotide is a nucleic acid molecule that identifies a target analyte bound to a target binding domain. The identifier oligonucleotide comprises a unique nucleic acid sequence that identifies a target analyte bound to the target binding domain of the probe. In a non-limiting example, a probe having a target binding domain that binds to the protein P53 comprises an identifier oligonucleotide having a unique nucleic acid sequence corresponding to P53, and a probe having a target binding domain that binds to the protein P97 comprises an identifier oligonucleotide having a unique nucleic acid sequence corresponding to P97.

[0236] The identifier oligonucleotides may be DNA, RNA, or a combination of DNA and RNA.

[0237] In some aspects, the identifier oligonucleotide may comprise at least one amplification primer binding site. An amplification primer binding site is a nucleic acid sequence capable of binding to an amplification primer. The amplification primer may be used to amplify the nucleic acid molecule to which it is bound using methods known in the art, such as, but not limited to, polymerase chain reaction (PCR).

[0238] In some aspects, the identifier oligonucleotide may comprise at least one unique molecular identifier.

[0239] The identifier oligonucleotide may be a single-stranded, double-stranded, or partially double-stranded nucleic acid molecule. In aspects where the identifier oligonucleotide is double-stranded or partially double-stranded, at least one of the two strands may comprise at least two different nucleic acid molecules, which, without being bound by theory, allows for denaturation of the identifier oligonucleotide at low temperatures.

[0240] The identifier oligonucleotide may also include at least one 3' end that includes a single nucleotide overhang.

[0241] The identifier oligonucleotide may also comprise a capture probe binding site, which is a nucleic acid sequence to which a capture probe can bind.

[0242] A capture probe of the present disclosure may comprise a nucleic acid sequence complementary to a capture probe binding site. The capture probe may also comprise an affinity molecule.

[0243] The identifier oligonucleotide may also include a multiple probe binding site, which is a nucleic acid sequence to which multiple probes can bind.

[0244] The multiplexed probes of the present disclosure may comprise nucleic acid sequences complementary to the multiplexed probe binding sites. The multiplexed probes may also comprise nucleic acid sequences that identify the specific locations in the tissue sample from which the identifier oligonucleotides were released.

[0245] The probes of the present disclosure may include a region that allows the release of the identifier oligonucleotide after application of an appropriate force. In one non-limiting example, this region is a cleavable motif (e.g., a restriction enzyme site or a cleavable linker). The cleavable motif releases the identifier oligonucleotide from the bound target nucleic acid or protein, and the identifier oligonucleotide is then collected and detected. The region that allows the identifier oligonucleotide to be releasable is located between the target binding domain and the identifier oligonucleotide and allows the identifier oligonucleotide to be released from the target binding domain. The identifier oligonucleotide is said to be releasable when it is separated (i.e., cleaved and released) from the remainder of the probe. Examples of cleavable motifs include, but are not limited to, photocleavable linkers. Photocleavable linkers can be cleaved by light provided by a suitable coherent light source (e.g., a laser and a UV light source) or a suitable incoherent light source (e.g., an arc lamp and a light-emitting diode (LED)).

[0246] In some aspects, the identifier oligonucleotides are collected from a solution proximal to the point where the identifier oligonucleotides are released or to at least one cell, e.g., at least immediately above or around the point. The proximal solution may be collected by suction, e.g., a pipette, a capillary, a microarray pin, a flow cell containing holes, or another suitable suction system known in the art, or any combination thereof. The capillary may include an optical device capable of delivering optical force, e.g., UV light, to at least one cell. One pipette or microarray pin may be attached to an array containing multiple pipettes or microarray pins. The proximal solution may include an anionic polymer, e.g., dextran sulfate and / or salmon sperm DNA, and / or the collected signal oligonucleotide may be added to a solution containing the anionic polymer, e.g., dextran sulfate and / or salmon sperm DNA. Other non-specific blocking agents known in the art may be used in addition to or instead of salmon sperm DNA.

[0247] In some aspects, the identifier oligonucleotides are collected from the tissue, at least one cell, or proximal to the point where the identifier oligonucleotides are released via laminar, turbulent, or transitional flow of a liquid, for example, through a channel having a depth of 25-500 mm between the tissue and a fluidic device or impermeable barrier positioned above the tissue.

[0248] In aspects where the target-binding domain of the probe is an antibody, the probe may be prepared using a cysteine ​​bioconjugation method that is stable and site-specific, preferably to the hinge region heavy chain of the antibody. This preparation method provides identifier oligonucleotides with relative control over the stoichiometry of the antibody. The probe may contain multiple identifier oligonucleotides (i.e., two or more, e.g., 2, 3, 4, 5, or more) per antibody. In general, "heavier" probes containing three or four identifier oligonucleotides per antibody are significantly less sensitive than "lighter" probes containing fewer identifier oligonucleotides, i.e., one or two identifier oligonucleotides per antibody.

[0249] In some aspects, probes are typically provided to a sample at a concentration lower than that used for immunohistochemistry (IHC) or in situ hybridization (ISH). Alternatively, the concentration may be significantly lower than that used for IHC or ISH. For example, the probe concentration may be 2-fold less, 5-fold less, 10-fold less, 20-fold less, 25-fold less, 30-fold less, 50-fold less, 60-fold less, 70-fold less, 80-fold less, 90-fold less, 100-fold less, 200-fold less, 300-fold less, 400-fold less, 500-fold less, 600-fold less, 700-fold less, 800-fold less, 900-fold less, 1000-fold less, 2000-fold less, or more, and multiples therebetween. In some aspects, the probes are provided at concentrations of 100 nM, 70 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.9 nM, 0.8 nM, 0.7 nM, 0.6 nM, 0.5 nM, 0.4 nM, 0.3 nM, 0.2 nM, 0.1 nM, 0.09 nM, 0.08 nM, 0.07 nM, 0.06 nM, 0.05 nM, 0.04 nM, 0.03 nM, 0.02 nM, 0.01 nM, and less, as well as any concentration therebetween.

[0250] Background noise during protein detection can be reduced by negative purification of the intact probe molecules. This can be done by affinity purification of antibodies or photocleavable linkers after collecting the eluate from the region of interest. Typically, the released signal oligonucleotide cannot be pulled out of solution. This step can be performed using protein-G or protein-O mechanisms in pipette tips, tubes, or dishes. Equipment and reagents for this purpose are commercially available.

[0251] Background noise during nucleic acid detection can be reduced by negative purification of intact probe molecules. This can be achieved by affinity purification of the target-binding domain or photocleavable linker after collecting eluate from the region of interest. Typically, the released signal oligonucleotide cannot be pulled out of solution. To facilitate negative purification, a universal purification sequence can be included in the probe, for example, within the target-binding domain.

[0252] The protein target probe and the nucleic acid target probe may be applied simultaneously, so long as conditions allow for binding of both the protein target and the nucleic acid target, or, if conditions that allow for binding of both the protein target and the nucleic acid target are not acceptable, the protein target probe and the nucleic acid target probe may be applied sequentially.

[0253] A set of probes is synonymous with a mixture of multiple probes. A set of probes includes at least one probe, i.e., a probe directed to one target. A set of probes preferably includes two or more probes, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more probes. A set of probes may include one or more copies of each type of probe.

[0254] Only the first set of probes may be applied to the sample. Alternatively, a second (or more) set of probes may be subsequently applied to the sample. The first and second (or more) sets may target only nucleic acids, only proteins, or a combination thereof.

[0255] In the present disclosure, two or more targets (i.e., proteins, nucleic acids, or combinations thereof) are detected, including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more targets, and any number in between.

[0256] The set of probes may be predefined based on the cell type or tissue type to be targeted. For example, if the tissue is breast cancer, the set of probes may include probes directed to proteins associated with breast cancer cells (e.g., Her2, EGFR, PR) and / or probes directed to proteins associated with normal breast tissue. Furthermore, the set of probes may be predefined based on the developmental state of the targeted cells or tissue. Alternatively, the set of probes may be predefined for the location within the target cells, such as the nucleus, cytoplasm, and membrane. For example, antibodies directed to Foxp3, histone H3, or P-S6 label the nucleus; antibodies directed to CD3, CD4, PD-1, or CD45RO label the cytoplasm; and antibodies directed to PD-L1 label the membrane.

[0257] Probes may be chemically synthesized or may be biologically produced using a vector into which a nucleic acid encoding the probe has been cloned.

[0258] Any probe or any set of probes described herein can be used in the methods and kits of the disclosure.

[0259] With respect to the probes described herein, the association of a specific nucleic acid sequence to a particular target nucleic acid or target protein is not fixed.

[0260] As described above, the probes of the present disclosure can be used to detect target nucleic acids or target proteins present in any sample, for example, a biological sample. As will be appreciated by those skilled in the art, samples can include many things, including, but not limited to, cells (including both primary cells and cultured cell lines) and tissues (including cultured or explanted tissues). In some aspects, tissue samples (typical or untypical) are embedded, serially sectioned, and fixed onto a microscope slide. As is well known, in a pair of serial sections, at least one cell is present in both serial sections. Structures and cell types present in the first serial section are also present in the same location in the adjacent serial section. The sample can be cultured cells (typical or untypical) or dissociated cells fixed onto a slide. The sample can also be a formalin-fixed, paraffin-embedded (FFPE) tissue sample.

[0261] In some aspects, the tissue sample is a biopsied tumor or portion thereof, i.e., a clinically relevant tissue sample. For example, the tumor may be from a breast cancer. The sample may also be a resected lymph node.

[0262] The sample may be from virtually any organism, including, for example, plants, fungi, and multicellular organisms of the animal kingdom; preferably, the sample is from an animal, such as a mammal. Samples from humans are particularly preferred.

[0263] In some aspects, the probes, compositions, methods, and kits described herein are used for diagnosing disease. As used herein, the term "diagnosis or disease diagnosis" includes predicting or diagnosing a disease, determining a predisposition to a disease, monitoring the treatment of a disease, diagnosing the response to treatment of a disease, and diagnosing the prognosis of a disease, the progression of a disease, and the response of a disease to a particular treatment. For example, a tissue sample can be examined according to any of the probes, methods, or kits described herein to determine the presence and / or amount of a disease marker or a marker of a malignant cell type in the sample (compared to a non-diseased state), thereby diagnosing or staging a disease or cancer.

[0264] Generally, slide-mounted samples are first imaged using fluorescence (e.g., fluorescent antibodies or fluorescent stains such as DAPI) to identify morphology, regions of interest, cell types of interest, and single cells, and then protein and / or nucleic acid expression may be digitally counted from samples on the same slide.

[0265] The compositions and kits of the present disclosure may include probes and other reagents, such as buffers and other reagents known in the art, to promote binding of proteins and / or nucleic acids in a sample, i.e., to cause a hybridization reaction.

[0266] The kit also includes instructions for use of the components of the kit, including, but not limited to, the information necessary to hybridize a labeled oligonucleotide to a probe, to hybridize a probe to a target-specific oligonucleotide, to hybridize a target-specific oligonucleotide to a target nucleic acid, and / or to hybridize a probe to a target protein.

[0267] The region of interest may be a tissue type, cell type, cell, or subcellular tissue within a cell present in the sample.

[0268] At the same time, the methods of the present disclosure may be used to compare the identity and abundance of target proteins and / or target nucleic acids present in a first region of interest (e.g., tissue type, cell type (including normal and abnormal cells), and subcellular tissues within a cell) with the identity and abundance of target proteins and / or target nucleic acids present in a second region of interest or more regions of interest.

[0269] As mentioned above, the products produced by the methods of the present disclosure may be used for nucleic acid amplification. In a preferred aspect, the nucleic acid amplification may be solid-phase nucleic acid amplification. Thus, in a further aspect, the present invention provides a method for solid-phase nucleic acid amplification of template polynucleotide molecules, comprising using the methods of the present disclosure to generate a library of template polynucleotide molecules having a common sequence at the 5'-end and the 3'-end, and performing a solid-phase nucleic acid amplification reaction in which the template polynucleotide molecules are amplified. Compositions and methods for nucleic acid amplification and sequencing are described, for example, in U.S. Patent No. 9,376,678, the entire contents of which are incorporated herein by reference.

[0270] As used herein, the term "solid-phase amplification" refers to any nucleic acid amplification reaction carried out on or in conjunction with a solid support, such that all or a portion of the amplification product is immobilized to the solid support as it is generated. In particular, the term encompasses solid-phase polymerase chain reaction (solid-phase PCR), a reaction similar to standard liquid-phase PCR, except that one or both of the forward and reverse amplification primers are immobilized to a solid support.

[0271] Although the present invention also encompasses "solid-phase" amplification methods in which only one amplification primer is immobilized (the other primer is typically in free solution), it is preferred that the solid support be provided with both immobilized forward and reverse primers. In practice, since the PCR process requires an excess of primers to continue amplification, there will be "multiple" identical forward primers and / or "multiple" identical reverse primers immobilized to the solid support. References herein to forward primers and reverse primers should be interpreted accordingly to encompass both "multiple" primers, unless the context indicates otherwise.

[0272] As those skilled in the art will appreciate, any given PCR reaction requires at least one forward primer and at least one reverse primer specific to the template to be amplified. However, in certain aspects, the forward and reverse primers may contain template-specific portions of the same sequence and may have completely identical nucleotide sequences and structures (including any non-nucleotide modifications). In other words, solid-phase amplification may be performed using only one primer, and this single-primer method is also within the scope of the present invention. In other aspects, forward and reverse primers may be used that contain the same template-specific sequence but differ in some other structural features. For example, one primer may contain a non-nucleotide modification that is not present in the other primer.

[0273] In other aspects of the invention, the forward and reverse primers may comprise template-specific portions of different sequences.

[0274] Amplification primers for solid-phase PCR are preferably covalently immobilized to the solid support at or near their 5' ends, with the template-specific portion of the primer remaining free for annealing to its cognate template and the 3' hydroxyl group remaining free for primer extension. Any suitable covalent attachment means known in the art may be used for this purpose. The attachment chemistry is selected depending on the nature of the solid support and any derivatization or functionalization applied to it. The primer itself may contain a moiety, which may be a non-nucleotide chemical modification, to facilitate attachment. In a particularly preferred aspect, the primer may contain a sulfur-containing nucleophile, such as a phosphorothioate or thiophosphate, at its 5' end. In the case of a solid-supported polyacrylamide hydrogel (described below), this nucleophile binds to a "C" group present within the hydrogel. The most preferred means of attaching the primer and template to the solid support is via a 5' phosphorothioate linkage to a hydrogel composed of polymerized acrylamide and N-(5-bromoacetamidylpentyl)acrylamide (BRAPA).

[0275] The terms "cluster" and "colony" are used interchangeably herein to refer to individual sites on a solid support consisting of a plurality of identical, fixed nucleic acid strands and a plurality of identical, fixed, complementary nucleic acid strands. The term "clustered array" refers to an array formed from these clusters or colonies. In this context, the term "array" should not be considered to require an ordered arrangement of the clusters.

[0276] The present invention also includes methods for sequencing amplified nucleic acids produced by solid-phase amplification. Accordingly, the present invention provides a method for nucleic acid sequencing comprising amplifying a library of nucleic acid templates by the methods of the present disclosure described above, amplifying the library on a solid support using solid-phase amplification described above, and performing a nucleic acid sequencing reaction to determine the sequence of all or a portion of at least one amplified nucleic acid strand produced in the solid-phase amplification reaction.

[0277] Sequencing, as referred to herein, may be performed using any suitable "sequencing by synthesis" technique, in which multiple nucleotides are added sequentially to a free 3' hydroxyl group, resulting in the synthesis of a polynucleotide chain in the 5' to 3' direction. The identity of the added nucleotide is preferably determined after the addition of each nucleotide.

[0278] The starting point for the sequencing reaction may be provided by annealing a sequencing primer to the products of a whole genome or solid-phase amplification reaction. In this regard, one or both of the adapters added during formation of the template library may comprise a nucleotide sequence that allows the sequencing primer to anneal to the amplification products derived from the whole genome or solid-phase amplification of the template library.

[0279] The product of a solid-phase amplification reaction, in which both forward and reverse amplification primers are covalently immobilized on a solid surface, is a so-called "bridged" structure formed by annealing a pair of immobilized polynucleotide strands and immobilized complementary strands, both strands attached at their 5' ends to the solid support. Arrays consisting of this bridged structure provide inefficient templates for nucleic acid sequencing, because hybridization of a conventional sequencing primer to one of these immobilized strands is less efficient than annealing of this immobilized strand to its immobilized complementary strand under standard conditions for hybridization.

[0280] To provide a more suitable template for nucleic acid sequencing, it is preferable to remove substantially all or at least a portion of one of the fixed strands in the "bridged" structure to generate a template that is at least partially single-stranded.Therefore, a portion of the single-stranded template is available for hybridization to a sequencing primer.The process of removing all or a portion of one of the fixed strands in the "bridged" double-stranded nucleic acid structure may be referred to herein as "linearization".

[0281] The bridged template structure may be linearized by cleavage of one or both strands with a restriction endonuclease, or by cleavage of one strand with a nicking endonuclease. As alternatives to restriction or nicking enzymes, other cleavage methods may be used, such as chemical cleavage between α-nucleotides (e.g., cleavage of diol bonds with periodate), cleavage of abasic sites by endonucleolytic cleavage or exposure to heat or alkali, cleavage of ribonucleotides otherwise incorporated into amplification products composed of deoxyribonucleotides, photochemical cleavage, or cleavage of peptide linkers.

[0282] It has been found that the linearization step may not be necessary if the solid-phase amplification reaction is carried out with only one primer covalently immobilized and the other primer in free solution.

[0283] To generate a linearized template suitable for sequencing, it is necessary to remove "unequal" amounts of the complementary strand in the bridge structure formed by amplification, leaving a linearized template for sequencing that is completely or partially single-stranded. Most preferably, one strand of the bridge structure is substantially or completely removed.

[0284] After the cleavage step, regardless of the method used for cleavage, the product of the cleavage reaction may be subjected to denaturing conditions to remove the portion of the cleaved strand that is not bound to the solid support. Suitable denaturing conditions will be apparent to those skilled in the art with reference to standard molecular biology procedures.

[0285] Denaturation (and subsequent reannealing of the cleaved strands) produces a sequencing template that is partially or substantially single-stranded. The sequencing reaction may then be initiated by hybridization of a sequencing primer to the single-stranded portion of the template.

[0286] Thus, a nucleic acid sequencing reaction involves hybridizing a sequencing primer to a single-stranded region of the linearized amplification product, sequentially incorporating one or more nucleotides into a polynucleotide strand complementary to the region of the amplified template strand to be sequenced, identifying the bases present in the one or more incorporated nucleotides, and thereby determining the sequence of the region of the template strand.

[0287] One preferred sequencing method that can be used in accordance with the present invention relies on the use of modified nucleotides that can function as chain terminators. When a modified nucleotide is incorporated into a growing polynucleotide strand complementary to a region of the template to be sequenced, the polymerase cannot add additional nucleotides because there is no free 3'-OH group available to guide further sequence extension. Once the nature of the base incorporated into the growing strand is determined, the 3' section can be removed and the next successive nucleotide added. The products derived using these modified nucleotides can be sequenced to deduce the DNA sequence of the DNA template. This reaction can be performed in a single experiment if each modified nucleotide carries a different label known to correspond to a specific base, facilitating discrimination between the bases added at each incorporation step. Alternatively, individual reactions containing each modified nucleotide individually can be performed.

[0288] The modified nucleotides may carry a label to facilitate their detection. Preferably, the label is a fluorescent label. Different types of nucleotides may carry different fluorescent labels. However, the detectable label does not have to be a fluorescent label. Any label that allows the detection of the incorporated nucleotide may be used.

[0289] One method for detecting fluorescently labeled nucleotides involves the use of laser light of a wavelength specific to the labeled nucleotide, or other suitable illumination source. Fluorescence from the nucleotide label may be detected by a CCD camera or other suitable detection means.

[0290] The present invention is not intended to be limited to the use of the sequencing methods outlined above, as essentially any sequencing method based on the sequential incorporation of nucleotides into a polynucleotide chain can be used. Suitable alternative techniques include, for example, pyrosequencing, FISSEQ (fluorescent in situ sequencing), MPSS (massively parallel signature sequencing), and ligation-based sequencing methods.

[0291] In the disclosed methods, the unique nucleic acid sequence present in the identifier oligonucleotide of the probe that identifies the target analyte bound to the target binding domain of the probe may comprise from about 5 nucleotides to about 50 nucleotides. Preferably, the sequence comprises from about 20 nucleotides to about 40 nucleotides. Even more preferably, the sequence comprises about 35 nucleotides. In some preferred aspects, the sequence comprises 10 nucleotides.

[0292] In the disclosed methods, the nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released comprises from about 6 to about 15 nucleotides. Preferably, the sequence comprises about 12 nucleotides.

[0293] In the disclosed methods, the amplification primer binding site comprises from about 18 nucleotides to about 40 nucleotides. Preferably, the amplification primer binding site comprises about 32 nucleotides.

[0294] In some aspects of the disclosed methods, the amplification primer binding site can comprise an i7 sequence, which comprises the sequence set forth in SEQ ID NO:1.

[0295] In some aspects of the disclosed methods, the amplification primer binding site can comprise an i5 sequence, which comprises the sequence set forth in SEQ ID NO:2.

[0296] In some aspects of the disclosed methods, amplification primers may comprise a flow cell adapter sequence, wherein the flow cell adapter sequence is suitable for sequencing. Preferably, at least one amplification primer used in the disclosed methods comprises a P5 flow cell adapter sequence, wherein the P5 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 3. Even more preferably, at least one amplification primer used in the disclosed methods comprises a P7 flow cell adapter sequence, wherein the P7 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 4.

[0297] In the methods of the present disclosure, the unique molecular identifier may comprise about 6 nucleotides to about 30 nucleotides. Preferably, the unique molecular identifier may comprise about 15 nucleotides. The terms "unique molecular identifier and random molecular tag" are used interchangeably herein. When using methods known in the art, the unique molecular identifier is a random sequence that can be used to correct for amplification bias before sequencing.

[0298] In the methods of the present disclosure, the constant nucleic acid sequence for minimizing ligation bias comprises from about 1 nucleotide to about 15 nucleotides. Preferably, the constant sequence comprises about 8 nucleotides.

[0299] In some aspects, the flow cell binding site may comprise about 15 to about 40 nucleotides. The flow cell binding site may comprise about 29 nucleotides. The flow cell binding site may comprise about 24 nucleotides.

[0300] In some aspects, the target binding domain may comprise from about 10 to about 70 nucleotides. The target binding domain may comprise from about 30 to about 55 nucleotides. The target binding domain may comprise from about 35 to about 50 nucleotides.

[0301] In some aspects, the unique nucleic acid sequence that identifies the target analyte bound to the target binding domain can comprise about 20 to about 40 nucleotides. The unique nucleic acid sequence that identifies the target analyte bound to the target binding domain can be about 25 nucleotides, or about 35 nucleotides, or about 12 nucleotides.

[0302] In some aspects, the amplification primer binding site may comprise from about 20 to about 50 nucleotides. The amplification primer binding site may comprise about 33 nucleotides, or about 34 nucleotides.

[0303] In some aspects, the nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released can comprise from about 1 to about 20 nucleotides. The nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released can comprise about 8 nucleotides.

[0304] In some aspects, the nucleic acid sequence comprising the unique molecular identifier may comprise from about 5 to about 20 nucleotides. The nucleic acid sequence comprising the unique molecular identifier may comprise about 14 nucleotides.

[0305] As used herein, the terms "region of interest" and "ROI" are used in their broadest sense to refer to a specific location within a sample that is analyzed using the methods of the present disclosure.

[0306] As used herein, the term "adjacent" means within about 1 nucleotide, or within about 2 nucleotides, or within about 3 nucleotides, or within about 4 nucleotides, or within about 5 nucleotides, or within about 6 nucleotides, or within about 7 nucleotides, or within about 8 nucleotides, or within about 9 nucleotides, or within about 10 nucleotides, or within about 11 nucleotides, or within about 12 nucleotides, or within about 13 nucleotides, or within about 14 nucleotides, or within about 15 nucleotides, or within about 16 nucleotides, or within about 17 nucleotides, or within about 18 nucleotides, or within about 19 nucleotides. It may mean within about 20 nucleotides, or within about 21 nucleotides, or within about 22 nucleotides, or within about 23 nucleotides, or within about 24 nucleotides, or within about 25 nucleotides, or within about 26 nucleotides, or within about 27 nucleotides, or within about 28 nucleotides, or within about 29 nucleotides, or within about 30 nucleotides, or within about 40 nucleotides, or within about 50 nucleotides, or within about 60 nucleotides, or within about 70 nucleotides, or within about 80 nucleotides, or within about 90 nucleotides, or within about 100 nucleotides.

[0307] As used herein, the term "spatially detecting" is used in its broadest sense to refer to the identification of the presence of a specific target analyte within a specific region of interest in a sample. Spatially detecting may include determining the amount of a specific target analyte present within a specific region of interest in a sample. Spatially detecting may further include determining the relative amount of a first target analyte within a specific region of interest in a sample compared to the amount of at least a second target analyte within the specific region of interest in the sample. Spatially detecting may also include determining the relative amount of a specific target analyte within a first region of interest in a sample compared to the amount of the same target analyte in at least a second region of interest in the same sample or a different sample.

[0308] In some aspects of the disclosed methods and compositions, a target analyte may be any molecule in a sample that is spatially detected. Target analytes include, but are not limited to, nucleic acid molecules and protein molecules. When a target analyte is a protein, the protein may be referred to as a target protein. When a target analyte is a nucleic acid, the nucleic acid may be referred to as a target nucleic acid. Target nucleic acids may include, but are not limited to, mRNA molecules, microRNA (miRNA) molecules, tRNA molecules, rRNA molecules, gDNA, or other nucleic acids present in a sample.

[0309] In some aspects of the methods and compositions of the present disclosure, the term "target binding domain" is used in its broadest sense to refer to a portion of a probe of the present disclosure that directly or indirectly binds to a target analyte present in a sample. The target binding domain may comprise a nucleic acid, a protein, at least one antibody, an aptamer, or any combination thereof. The target binding domain may comprise DNA, RNA, or any combination thereof. The target binding domain may comprise any number of modified nucleotides and / or nucleic acid analogs.

[0310] In aspects where the spatially detected target analyte is a target protein, the target binding domain may be a protein target binding domain. The protein target binding domain may comprise an antibody or antibody fragment that binds to the target protein.

[0311] In aspects where the target analyte to be spatially detected is a target nucleic acid, the target binding domain may be a target nucleic acid binding region. The target nucleic acid binding region may comprise a nucleic acid that is complementary to the target nucleic acid to be spatially detected. The target nucleic acid binding region may comprise a nucleic acid that hybridizes to the target nucleic acid to be detected.

[0312] The term "hybridize" as used herein is used in its broadest sense to refer to the formation of a stable nucleic acid duplex. In one aspect, a "stable duplex" means that the duplex structure is not disrupted even by harsh washing conditions, such as temperatures about 5°C lower or higher than the Tm of one strand of the duplex and low monovalent salt concentrations, such as less than 0.2M, or less than 0.1M, or salt concentrations known to those skilled in the art. A duplex can be "perfectly matched" so that all nucleotides in each strand form Watson-Crick base pairs with nucleotides in the other strand, so that the polynucleotide and / or oligonucleotide strands constituting the duplex form a double-stranded structure with each other. The term "duplex" encompasses pairs of nucleoside analogs that can be used, such as, but not limited to, deoxyinosine, nucleosides with 2-aminopurine bases, and PNAs. The duplex may contain at least one mismatch, the term "mismatch" meaning that a pair of nucleotides in the duplex cannot undergo Watson-Crick bonding.

[0313] As used herein, the term "hybridization conditions" typically encompasses salt concentrations of less than about 1 M, more typically less than about 500 mM, and even more typically less than about 200 mM. Hybridization temperatures can be as low as 5°C, but are typically above 22°C, more typically above about 30°C, and often above about 37°C. Hybridization is generally performed under stringent conditions, e.g., conditions under which the probe specifically hybridizes to its target analyte. These stringent conditions are sequence-dependent and vary from environment to environment. Longer fragments may require higher hybridization temperatures for specific hybridization. Because other factors, such as the base composition and length of the complementary strand, the presence of organic solvents, and the extent of base mismatches, can affect hybridization stringency, the combination of these parameters is more important than the unconditional determination of any single parameter. Specific hybridization conditions promote the formation of a duplex between the entire length of the target-binding domain and the target analyte. Other hybridization conditions favor duplex formation only along specific portions of the target binding domain.

[0314] In some aspects of the disclosed methods and compositions, a probe may include a target binding domain linked directly or indirectly to an identifier oligonucleotide. In the context of a probe, the identifier oligonucleotide is a polynucleotide comprising a nucleic acid sequence that identifies the target analyte that binds to the target binding domain of the probe. That is, the identifier oligonucleotide comprises a specific nucleic acid sequence that is a priori assigned to the specific target analyte bound to the target binding domain to which the identifier oligonucleotide is attached. In a non-limiting example, a probe designated "probe X" designed to spatially detect "target analyte X" comprises a target binding domain designated "target binding domain X" linked to an identifier oligonucleotide designated "identifier oligonucleotide X." The target binding domain X binds to target analyte X, and the identifier oligonucleotide X comprises a nucleic acid sequence designated "nucleic acid sequence X" that corresponds to target analyte X. Thus, if a skilled artisan practicing the disclosed methods collects an identifier oligonucleotide released from a region of interest in a sample and sequences it to obtain nucleic acid sequence X, the skilled artisan will know that target analyte X was present in the region of interest. The amount or sequencing read of nucleic acid sequence X can be used to determine the amount of target analyte X in the region of interest in absolute or relative terms.

[0315] As used herein, the term "amplification primer binding site" is used in its broadest sense to refer to a nucleic acid sequence that is complementary or at least partially complementary to at least one amplification primer, which is a short single-stranded or partially single-stranded oligonucleotide that is sufficient to prime DNA and / or RNA synthesis, e.g., by PCR.

[0316] In some aspects of the methods and compositions of the present disclosure, the target binding domain may be linked to the identifier oligonucleotide by a cleavable linker. Suitable cleavable linkers include, but are not limited to, chemically cleavable linkers (e.g., linkers that are cleaved when exposed to a specific chemical or combination of chemicals or reaction conditions), photocleavable linkers (e.g., linkers that are cleaved when exposed to light of a sufficient wavelength or a sufficient range of wavelengths), or enzyme-cleavable linkers (e.g., linkers that are cleaved by a specific enzyme or enzymes). Thus, as used herein, the phrase "applying a force to a location in the sample sufficient to release the identifier oligonucleotide" is used in its broadest sense to describe altering the conditions within a specific region of interest within the sample such that, for any probe that binds to the target analyte within the region of interest, the linker between the target binding domain of the probe and the identifier oligonucleotide of the probe is cleaved, thereby separating the identifier oligonucleotide from the target binding domain and allowing the identifier oligonucleotide to be subsequently collected from solution. For example, in aspects where the probe comprises a chemically cleavable linker between the target binding domain and the identifier oligonucleotide, applying a force sufficient to release the identifier oligonucleotide at the sample location may include exposing the sample location to a particular chemical or combination of chemicals or reaction conditions that catalyzes cleavage of the linker. In another non-limiting example, in aspects where the probe comprises a photocleavable linker between the target binding domain and the identifier oligonucleotide, applying a force sufficient to release the identifier oligonucleotide at the sample location may include exposing / exciting the sample location with light of a wavelength sufficient to cleave the photocleavable linker. In another non-limiting example, in aspects where the probe comprises an enzyme-cleavable linker between the target binding domain and the identifier oligonucleotide, applying a force sufficient to release the identifier oligonucleotide at the sample location may include exposing the sample location to an amount of enzyme sufficient to catalyze cleavage of the linker.

[0317] Upon application of a force sufficient to release the identifier oligonucleotides to a sample location, about 10% or more, or about 20% or more, or about 30% or more, or about 40% or more, or about 50% or more, or about 60% or more, or about 70% or more, or about 80% or more, or about 85% or more, or about 90% or more, or about 95% or more, or about 99% or more of the probes that bind to the target analyte within that sample location will undergo cleavage of the linker connecting the target binding domain and the identifier oligonucleotide.

[0318] As will be appreciated by those skilled in the art, the term "unique molecular identifier" or "UMI" refers to a short nucleic acid sequence that is used to measure and reduce the amount of bias caused by nucleic acid amplification prior to a sequencing reaction.

[0319] In some aspects of the methods and compositions of the present disclosure, the affinity moiety may comprise biotin, avidin, streptavidin, a nucleic acid, or any combination thereof.

[0320] In some aspects of the disclosed methods and compositions, the probe may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0321] In some aspects of the disclosed methods and compositions, a target binding domain may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0322] In some aspects of the disclosed methods and compositions, the identifier oligonucleotide may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0323] In some aspects of the disclosed methods and compositions, an amplification primer may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0324] In some aspects of the disclosed methods and compositions, a nucleic acid probe may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0325] In some aspects of the disclosed methods and compositions, a nucleic acid complementary to a portion of an identifier oligonucleotide may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 nucleotides.

[0326] In some aspects of the disclosed methods and compositions, a nucleic acid sequence comprising a molecular identifier may comprise at least about 5, or at least about 10, or at least about 15, or at least about 20, or at least about 25, or at least about 30, or at least about 35, or at least about 40, or at least about 45, or at least about 50 nucleotides.

[0327] In some aspects of the disclosed methods and compositions, the amplification primer binding site may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, or at least about 70 nucleotides.

[0328] In some aspects of the methods and compositions of the disclosure, a flow cell adapter sequence suitable for sequencing may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 nucleotides.

[0329] In some aspects of the disclosed methods and compositions, the flow cell binding site may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 90, at least about 95, or at least about 100 nucleotides.

[0330] In some aspects of the disclosed methods and compositions, the nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released may comprise at least about 5, or at least about 10 nucleotides, or at least about 15, or at least about 20, or at least about 25, or at least about 30, or at least about 35, or at least about 40, or at least about 45, or at least about 50 nucleotides.

[0331] In some aspects of the disclosed methods and compositions, the unique nucleic acid sequence that identifies the target analyte bound to the target binding domain may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 90, at least about 95, or at least about 100 nucleotides.

[0332] In some aspects of the methods and compositions of the present disclosure, the probe, target binding domain, identifier oligonucleotide, amplification primer, nucleic acid probe, nucleic acid complementary to a portion of the identifier oligonucleotide, nucleic acid sequence comprising a molecular identifier, amplification primer binding site, flow cell adapter sequence, flow cell binding site, nucleic acid sequence identifying a specific location in the tissue sample to which the identifier oligonucleotide was released, unique nucleic acid sequence identifying the target analyte bound to the target binding domain, or any combination thereof, may comprise at least one natural base, may comprise no natural bases, may comprise at least one modified nucleotide or nucleic acid analog, may comprise no modified nucleotides or nucleic acid analogs, may comprise at least one universal base, may comprise no universal bases, may comprise at least one degenerate base, or may comprise no degenerate bases.

[0333] In some aspects of the disclosed methods and compositions, the probe, target binding domain, identifier oligonucleotide, amplification primer, nucleic acid probe, nucleic acid complementary to a portion of the identifier oligonucleotide, nucleic acid sequence comprising a molecular identifier, amplification primer binding site, flow cell adapter sequence, flow cell binding site, nucleic acid sequence identifying a specific location in the tissue sample to which the identifier oligonucleotide was released, unique nucleic acid sequence identifying the target analyte bound to the target binding domain, or any combination thereof, may comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural bases), modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified nucleotides or analog nucleotides), universal bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more universal bases), or degenerate bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more degenerate bases). When present in combination, natural bases, modified nucleotides or nucleic acid analogs, universal bases, and degenerate bases may be arranged in any order.

[0334] The term "modified nucleotide" or "nucleic acid analog" includes, but is not limited to, locked nucleic acid (LNA), bridged nucleic acid (BNA), propyne-modified nucleic acid, zip nucleic acid (ZNA®), isoguanine, and isocytosine. Preferably, the modified nucleotide or nucleic acid analog is a locked nucleic acid (LNA).

[0335] The term "locked nucleic acid (LNA)" as used herein includes, but is not limited to, modified RNA nucleotides in which the ribose moiety contains a methylene bridge connecting the 2' oxygen and 4' carbon. This methylene bridge anchors the ribose to a 3' internal confirmation, also known as a North confirmation, found in A-form RNA duplexes. The term "sequestered RNA" can be used interchangeably with LNA. The term "bridged nucleic acid (BNA)" as used herein includes, but is not limited to, modified RNA molecules containing a five- or six-membered bridge structure with a fixed 3' internal confirmation, also known as a North confirmation. The bridge structure links the 2' oxygen of ribose to the 4' carbon of ribose. A variety of different bridge structures are possible, including carbon, nitrogen, and hydrogen atoms. The term "propyne-modified nucleic acid" as used herein includes, but is not limited to, pyrimidines, i.e., cytosine and thymine / uracil, containing a propyne modification at the C5 position of the nucleobase. As used herein, the term "zip nucleic acid (ZNA®)" includes, but is not limited to, an oligonucleotide conjugated to a cationic spermine moiety.

[0336] As used herein, the term "universal base" includes, but is not limited to, a nucleotide base that does not follow the Watson-Crick base pairing rules, but rather can bind to any of the four standard bases (A, T / U, C, G) located in a target nucleic acid. As used herein, the term "degenerate base" includes, but is not limited to, a nucleotide base that does not follow the Watson-Crick base pairing rules, but rather can bind to at least two, but not all four, of the four standard bases (A, T / U, C, G). Degenerate bases are also called wobble bases, and these terms are used interchangeably herein.

[0337] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0338] As used herein, the term "or" is understood to be inclusive and includes both "or" and "and" unless specifically stated otherwise or clearly indicated by context.

[0339] As used herein, the term "about" is understood to mean within a normal range of tolerance in the art, for example, within two standard deviations of the mean, unless otherwise specified or clearly indicated by the context. "About" may be interpreted as 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about."

[0340] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present invention pertains.Other probes, compositions, methods, and kits similar or equivalent to those described herein can be used to implement the present disclosure, but preferred materials and methods are described herein.Note that the terms used herein are only intended to describe specific aspects and are not intended to be limiting. [Example]

[0341] Example 1: Two-end adapter ligation method for 96 multiplexed samples

[0342] In this example, identifier oligonucleotides collected from 96 multiplexed samples were sequenced using the disclosed two-terminal adapter ligation method. The nucleic acid adapter used in this experiment was partially double-stranded. The nucleic acid adapter contained a first strand and a second strand. The first strand contained a 5' phosphate moiety for ligation. The first strand also contained a constant nucleic acid sequence (GCGTAGTG) to minimize ligation bias, a nucleic acid sequence containing a unique molecular identifier, a unique nucleic acid sequence identifying the specific location in the sample from which the identifier oligonucleotide was released, and a first amplification primer binding site (SEQ ID NO: 2). The second strand contained a single overhanging thymine nucleotide at its 3' end, a sequence complementary to the constant nucleic acid sequence present in the first strand to minimize ligation bias, a sequence complementary to the unique nucleic acid sequence present in the first strand identifying the specific location in the sample from which the identifier oligonucleotide was released, and a second amplification primer binding site (SEQ ID NO: 1).

[0343] To generate partially double-stranded nucleic acid adapters, the first-strand and second-strand oligonucleotides were combined in an equimolar ratio to yield a final total oligonucleotide concentration of 28 μM in a buffer containing 50 mM NaCl. The oligonucleotide mixture was heated to 95°C for 2 minutes and cooled to ambient temperature for 30 minutes, thereby annealing the first- and second-strand oligonucleotides together to generate partially double-stranded nucleic acid adapters. The annealed nucleic acid adapters were diluted to final concentrations ranging from 0.02 μM to 0.002 μM in a solution of 10 mM Tris, pH 8, and 0.05% Tween 20.

[0344] The collected identifier oligonucleotides were end-repaired and A-added using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to a modified procedure. The end-repair / A-addition master mix was prepared by combining 627.8 μL of PCR-grade HO, 143.9 μL of NEBNext Ultra II End Prep reaction buffer, and 61.7 μL of NEBNext Ultra II End Prep enzyme mix. 8.3 μL of the end-repair / A-addition master mix was added to each 4 μL of identifier oligonucleotide sample. With the lid heated to >75°C, the reaction was incubated at 20°C for 30 minutes, followed by a second incubation at 65°C for 30 minutes. The repaired / A-addition identifier oligonucleotide mixture was then stored at 4°C.

[0345] Following end repair and A-addition, 6.4 μL of NEBNext Ultra II Ligation Master Mix, 0.2 μL of NEBNext Ligation Enhancer, and 1 μL of nucleic acid adapter diluent were added to each of the repair / A-addition identifier oligonucleotide mixtures to ligate the nucleic acid adapters to the repair / A-addition identifier oligonucleotides. These reactions were incubated at 20°C for 15 minutes with the heated lid removed and then stopped with 1 μL of 0.5 M EDTA. All reactions were then pooled in a single 15 mL conical tube to create the adapter-ligated pool sample.

[0346] The pooled adapter-ligated samples were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.). The magnetic beads were prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG 8000). AMPure XP bead purification was performed using 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20. AMPure XP bead purification was then repeated using 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20 to obtain the purified adapter-ligated samples.

[0347] Following AMPure XP purification, PCR reactions were prepared using the purified adapter-ligated sample to amplify the adapter-ligated identifier oligonucleotides. To 6 μL of purified adapter-ligated sample, 10 μL of NEBNext Ultra II Q5 Master Mix, 0.2 μL of 100 μM forward and reverse primers, and 3.6 μL of PCR-grade HO were added. The forward primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the first strand of the nucleic acid adapter. The sequences of the forward primers used are listed in Table 1. Table 1. Forward primers for two-terminal adapter ligation [Table 1]

[0348] The reverse primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the second strand of the nucleic acid adapter. The sequences of the reverse primers used are shown in Table 2. Table 2. Reverse primers for ligating both ends of the adapter [Table 2]

[0349] The optimal number of PCR cycles was empirically determined by running triplicate PCR reactions. Alternatively, real-time / qPCR could be used to determine the optimal number of PCR cycles. The PCR program used included the following steps: (1) 30 seconds at 98°C, (2) 10 seconds at 98°C, (3) 1 minute at 65°C, (4) 9 cycles of (2) and (3), and (5) 5 minutes at 65°C.

[0350] The amplification product was purified using 18 μL of AMPure XP beads and eluted with 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0351] The amplification products were assayed using a high-sensitivity DNA fragment on the 2100 Bioanalyzer (Agilent Genomics) and the KAPA Library Quantification Kit (Kapa Biosystems) for the Illumina platform. The amplification products were also diluted to 15 pM and sequenced on a MiSeq (Illumina) using a custom spike-in primer containing the nucleotide sequence ACACTCTTTAAGACGACGTCGCTATGGCCTCTCC (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq Reagent Kit v3 2 × 75 bp).

[0352] Example 2: Single-end adapter ligation method for 96 multiplexed samples

[0353] In this example, the single-end adapter ligation method of the present disclosure was used to sequence identifier oligonucleotides collected from 96 multiplexed samples. The nucleic acid adapters used in this experiment were partially double-stranded. The nucleic acid adapters contained a first strand and a second strand. The first strand contained a 5' phosphate moiety for ligation. The first strand also contained a constant nucleic acid sequence (CACTACGC) to minimize ligation bias, a nucleic acid sequence containing a unique molecular identifier, a unique nucleic acid sequence identifying the specific location in the sample from which the identifier oligonucleotide was released, and a first amplification primer binding site (SEQ ID NO: 1). The second strand contained a single overhanging thymine nucleotide at its 3' end, a sequence complementary to the constant nucleic acid sequence present in the first strand to minimize ligation bias, and a sequence complementary to the unique nucleic acid sequence present in the first strand that identifies the specific location in the sample from which the identifier oligonucleotide was released.

[0354] To generate partially double-stranded nucleic acid adapters, the first-strand and second-strand oligonucleotides were combined in an equimolar ratio to yield a final total oligonucleotide concentration of 28 μM in 50 mM NaCl. The oligonucleotide mixture was heated to 95°C for 2 minutes and cooled to ambient temperature for 30 minutes, thereby annealing the first- and second-strand oligonucleotides together to generate partially double-stranded nucleic acid adapters. The annealed nucleic acid adapters were diluted in a solution of 10 mM Tris, pH 8, and 0.05% Tween 20 to final concentrations ranging from 0.02 μM to 0.002 μM.

[0355] To each sample of the extracted identifier oligonucleotides, 10 μL of 2X Fast Ligation Buffer (Enzymatics), 1 μL of T4 DNA Fast Ligation Enzyme (Enzymatics), and 1 μL of annealed nucleic acid adapter dilution were added to ligate the nucleic acid adapters to the extracted identifier oligonucleotides. The samples were incubated at 20°C for 15 minutes with the heated lid removed, followed by quenching with 1 μL of 0.5 M EDTA. All reactions were then pooled in a single 15 mL conical tube to generate the pool adapter-ligated sample.

[0356] The pooled adapter-ligated samples were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.). The magnetic beads were prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG 8000). AMPure XP bead purification was performed using 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20. AMPure XP bead purification was then repeated using 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20 to obtain the purified adapter-ligated samples.

[0357] Following AMPure XP purification, PCR reactions were prepared using the purified adapter-ligated sample to amplify the adapter-ligated identifier oligonucleotides. To 6 μL of purified adapter-ligated sample, 10 μL of NEBNext Ultra II Q5 Master Mix, 0.2 μL of 100 μM forward and reverse primers, and 3.6 μL of PCR-grade HO were added. The forward primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the first strand of the nucleic acid adapter. The sequences of the forward primers used are listed in Table 3. Table 3. Forward primers for two-terminal adapter ligation [Table 3]

[0358] The reverse primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the second strand of the nucleic acid adapter. The sequences of the reverse primers used are shown in Table 4. Table 4. Reverse primers for two-terminal adapter ligation [Table 4]

[0359] The optimal number of PCR cycles was empirically determined by running triplicate PCR reactions. Alternatively, real-time / qPCR could be used to determine the optimal number of PCR cycles. The PCR program used included the following steps: (1) 98°C for 30 seconds; (2) 98°C for 10 seconds; (3) 65°C for 1 minute; (4) (2) and (3) repeated 9 times; (5) 65°C for 5 minutes.

[0360] The amplification product was purified using 18 μL of AMPure XP beads and eluted with 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0361] The amplification products were evaluated using a high-sensitivity DNA section on the 2100 Bioanalyzer (Agilent Genomics) and the KAPA Library Quantification Kit (Kapa Biosystems) for the Illumina platform. The amplification products were also diluted to 15 pM and sequenced by MiSeq (Illumina) according to the manufacturer's instructions (MiSeq Reagent Kit v3 2 × 75 bp) using a custom spike-in primer containing the nucleotide sequence ACACTCTTTAAGACGACGTCGCTATGGCCTCTCC (SEQ ID NO: 25).

[0362] Example 3: Template Primer Extension Method for 96 Multiplexed Samples

[0363] In this example, the template primer extension method of the present disclosure was used to sequence identifier oligonucleotides collected from 96 multiplexed samples. The single-stranded nucleic acid template used in this example contained a 3' biotin moiety, a region complementary to the unique nucleic acid sequence present in the collected identifier oligonucleotide, a nucleic acid sequence containing a unique molecular identifier, and a second amplification primer binding sequence (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, SEQ ID NO: 26). The sequence of the single-stranded nucleic acid template used in this example is shown in Table 5. Table 5. Single-stranded nucleic acid templates for template primer extension methods [Table 5-1] [Table 5-2]

[0364] Single-stranded nucleic acid templates were ordered from Integrated DNA Technologies, Inc. and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Individual single-stranded nucleic acid templates were normalized to a standard concentration and then equimolarly stocked. The single-stranded nucleic acid template stock was diluted to 0.83 nM in a buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0365] The collected identifier oligonucleotides were hybridized to the single-stranded nucleic acid template and extended by adding 10 μL of NEBNext Ultra II Q5 Master Mix (New England Biolabs), 4 μL of diluted single-stranded nucleic acid template stock, and 4 μL of HO to each sample of 2 μL of identifier oligonucleotide. The following PCR program was used to extend the identifier oligonucleotides. (1) 98°C for 30 seconds, 10 times (2) 98°C for 1 minute (3) 68°C for 1 minute (4) 72°C for 1 minute (5) Repeat steps (2) to (4) 10 times. (6) 72°C for 2 minutes

[0366] The extension products were stored at 4°C. Streptavidin magnetic beads (MyOne Streptavidin C1 beads, Thermo Fisher Scientific) were washed with 1X Binding and Washing Buffer (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl), and 5 μL of streptavidin beads was added to each extension product sample. The extension product samples were incubated with the beads on an orbital shaker for a minimum of 15 minutes. After incubation, the samples were heated at 95°C for 3 minutes and transferred to a magnetic dish. After thorough bead pelleting, the supernatant was extracted immediately to obtain purified extension product samples.

[0367] To each 7.5 μL purified extension product sample, 12.5 μL of NEBNext Ultra II Q5 Master Mix, 0.25 μL of 100 μM forward primer, 1 μL of 25 μM reverse primer, and 3.8 μL of PCR-grade HO were added to amplify the purified extension product samples. The forward primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located in the identifier oligonucleotide. The sequences of the forward primers used in this example are listed in Table 6. Table 6. Forward primers for template primer extension [Table 6]

[0368] The reverse primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located in the single-stranded nucleic acid template. The sequences of the reverse primers used are shown in Table 7. Table 7. Reverse primers for template primer extension [Table 7-1] [Table 7-2] [Table 7-3]

[0369] The PCR program used to amplify the purified extension products included the following steps: (1) 98°C for 30 seconds (2) 98°C for 10 seconds (3) 65°C for 30 seconds (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 18 times. (6) 72°C for 2 minutes

[0370] The amplified extension products were stored at 4° C. 4 μL of each PCR reaction was pooled into four pools of 24 samples per pool.

[0371] The pooled PCR reaction mixture was purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.). The magnetic beads were prepared by combining 100 μL of AMPure XP beads and 400 μL of AMPure XP buffer (2.5 M NaCl, 20% PEG 8000). Purification was performed using 76.8 μL of diluted AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20. The beads were retained and the purification step was repeated using 24 μL of AMPure XP buffer and eluted in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0372] The purified PCR products were evaluated using a high-sensitivity DNA fragment on the 2100 Bioanalyzer (Agilent Genomics) and the KAPA Library Quantification Kit (Kapa Biosystems) for the Illumina platform. The purified PCR products were also diluted to 15 pM and sequenced by MiSeq (Illumina) according to the manufacturer's instructions (MiSeq Reagent Kit v3 2 × 75 bp) using a custom spike-in primer containing the nucleotide sequence ACACTCTTTAAGACGACGTCGCTATGGCCTCTCC (SEQ ID NO: 25).

[0373] Example 4: Long probe hybridization method for 96 multiplexed samples

[0374] In this example, identifier oligonucleotides from 96 multiplexed samples were sequenced using the disclosed long probe hybridization method. In this example, the first nucleic acid probe contains a 5' phosphate moiety, a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site comprising the i7 sequence (SEQ ID NO: 1), a unique nucleic acid sequence that identifies the specific location in the sample where the identifier oligonucleotide was released, and a P7 flow cell adapter sequence (SEQ ID NO: 4). The second nucleic acid probe contains a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, a second amplification primer binding site comprising the i5 sequence (SEQ ID NO: 2), and a P5 flow cell adapter sequence (SEQ ID NO: 3).

[0375] The first and second nucleic acid probes were ordered from Integrated DNA Technologies, Inc. and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Individual nucleic acid probes were normalized to a standard concentration, stocked equimolar, and diluted to 0.83 nM in a buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20. The nucleic acid probe and identifier oligonucleotide were hybridized by combining 0.5 μL of the diluted nucleic acid probe stock with a mixture of 2 μL of identifier oligonucleotide taken from the sample solution in a buffer containing 50 mM NaCl. The mixture was heated to 95° C. for 2 minutes and cooled to ambient temperature for 30 minutes to generate an annealed identifier oligonucleotide-nucleic acid probe mixture.

[0376] A gap extension reaction was performed when the first and second nucleic acid probes hybridized to the identifier oligonucleotide such that they were non-adjacent and non-overlapping. To each 2.5 μL of the annealed identifier oligonucleotide-nucleic acid probe mixture, 3.8 μL of NEBNext Ultra II Q5 Master Mix and 1.3 μL of PCR-grade H2O were added. The mixtures were then subjected to the following temperature cycles for gap extension: (1) 98°C for 30 seconds; (2) 98°C for 1 minute (3) 68°C for 1 minute (4) 72°C for 1 minute (5) Repeat steps (2) to (4) 10 times. (6) 72°C for 2 minutes

[0377] The gap extension products were then stored at 4° C. The first and second nucleic acid probes were then ligated together by adding 10 μL of 2× Fast Ligation Buffer (Enzymatics), 1 μL of T4 DNA Fast Ligation Enzyme (Enzymatics), and 8 μL of PCR-grade HO to 1 μL of the gap extension product. These ligation reactions were incubated at 20° C. for 15 minutes, then stopped with 1 μL of 0.5 M EDTA and stored in a single 15 mL conical tube.

[0378] Nick repair ligation reactions were performed when the first and second nucleic acid probes hybridized to the identifier oligonucleotides such that they were adjacent but not overlapping. To each 2.5 μL of the annealed identifier oligonucleotide-nucleic acid probe mixture, 10 μL of 2X Fast Ligation Buffer (Enzymatics), 1 μL of T4 DNA Fast Ligation Enzyme (Enzymatics), and 1 μL of PCR-grade HO were added. These ligation reactions were incubated at 20°C for 15 minutes, then stopped with 1 μL of 0.5 M EDTA and pooled in a single 15 mL conical tube.

[0379] The stopped ligation reaction pool was then purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.). The magnetic beads were prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG 8000). Purification was performed using 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20. The AMPure XP bead purification was then repeated with 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0380] To amplify the purified ligation product, a PCR reaction mixture containing the purified ligation product and primers was prepared. 6 μL of the purified ligation product was added with 10 μL of NEBNext Ultra II Q5 Master Mix, 0.2 μL of 100 μM forward primer (CAAGCAGAAGACGGCATACGA, SEQ ID NO: 153) and reverse primer (AATGATACGGCGACCACCGA, SEQ ID NO: 154), and 3.6 μL of PCR-grade HO. The PCR program used to amplify the purified extension product included the following steps: (1) 98°C for 30 seconds (2) 98°C for 10 seconds (3) 65°C for 30 seconds (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 18 times. (6) 72°C for 2 minutes

[0381] The amplified products were stored at 4°C. Each 4 μL PCR reaction was pooled into 6 pools with 16 samples per pool. The amplified products were further purified using AMPure XP bead purification with 64 μL of AMPure XP beads and elution in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0382] The purified amplification products were evaluated using a high-sensitivity DNA fragment on the 2100 Bioanalyzer (Agilent Genomics) and the KAPA Library Quantification Kit (Kapa Biosystems) for the Illumina platform. The purified amplification products were also diluted to 15 pM and sequenced by MiSeq (Illumina) according to the manufacturer's instructions (MiSeq Reagent Kit v3 2 × 75 bp) using either standard sequencing primers or a custom spike-in Read1 primer (SEQ ID NO: 25).

[0383] Example 5: Short probe hybridization method for 96 multiplexed samples

[0384] In this example, the short probe hybridization method of the present disclosure was used to sequence identifier oligonucleotides from 96 multiplexed samples. In this example, the first nucleic acid probe contains a 5' phosphate moiety, a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site comprising the i7 sequence (SEQ ID NO: 1), and a unique nucleic acid sequence that identifies the specific location in the sample from which the identifier oligonucleotide was released. The second nucleic acid probe contains a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, and a second amplification primer binding site comprising the i5 sequence (SEQ ID NO: 2).

[0385] The first and second nucleic acid probes were ordered from Integrated DNA Technologies, Inc. and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Individual nucleic acid probes were normalized to a standard concentration, stocked equimolar, and diluted to 0.83 nM in a buffer containing 10 mM Tris and 0.05% Tween 20 at pH 8. The nucleic acid probe and identifier oligonucleotide were hybridized by combining 0.5 μL of the diluted nucleic acid probe stock with a mixture of 2 μL of identifier oligonucleotide taken from the sample solution in a buffer containing 50 mM NaCl. The mixture was heated to 95° C. for 2 minutes and cooled to ambient temperature for 30 minutes to generate an annealed identifier oligonucleotide-nucleic acid probe mixture.

[0386] A gap extension reaction was performed when the first and second nucleic acid probes hybridized to the identifier oligonucleotide such that they were non-adjacent and non-overlapping. 3.8 μL of NEBNext Ultra II Q5 Master Mix and 1.3 μL of PCR-grade HO were added to each 2.5 μL of the annealed identifier oligonucleotide-nucleic acid probe mixture. The mixture was then subjected to the following gap extension temperature cycles: (1) 98°C for 30 seconds (2) 98°C for 1 minute (3) 68°C for 1 minute (4) 72°C for 1 minute (5) Repeat steps (2) to (4) 10 times. (6) 72°C for 2 minutes

[0387] The gap extension products were then stored at 4° C. Subsequently, 10 μL of 2× Fast Ligation Buffer (Enzymatics), 1 μL of T4 DNA Fast Ligation Enzyme (Enzymatics), and 8 μL of PCR-grade HO were added to 1 μL of the gap extension product to ligate the first and second nucleic acid probes together. These ligation reactions were incubated at 20° C. for 15 minutes, then stopped with 1 μL of 0.5 M EDTA and stored in a single 15 mL conical tube.

[0388] Nick repair ligation reactions were performed when the first and second nucleic acid probes hybridized to the identifier oligonucleotide such that they were adjacent but not overlapping. To each 2.5 μL of the annealed identifier oligonucleotide-nucleic acid probe mixture, 10 μL of 2× Fast Ligation Buffer (Enzymatics), 1 μL of T4 DNA Fast Ligation Enzyme (Enzymatics), and 1 μL of PCR-grade HO were added. These ligation reactions were incubated at 20°C for 15 minutes, then stopped with 1 μL of 0.5 M EDTA and pooled in a single 15 mL conical tube.

[0389] The stopped ligation reaction pool was then purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.). The magnetic beads were prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG 8000). Purification was performed using 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20. The AMPure XP bead purification was then repeated with 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0390] To amplify the purified ligation product, a PCR reaction mixture containing the purified ligation product and primers was prepared. To 6 μL of purified ligation product, 10 μL of NEBNext Ultra II Q5 Master Mix, 0.2 μL of 100 μM forward and reverse primers, and 3.6 μL of PCR-grade HO were added. The forward primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the first strand of the nucleic acid adapter. The sequences of the forward primers used are listed in Table 8. Table 8. Forward primers for short probe hybridization [Table 8]

[0391] The reverse primer contained a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the second strand of the nucleic acid adapter. The sequences of the reverse primers used are shown in Table 9. Table 9. Reverse primers for short probe hybridization [Table 9]

[0392] The PCR program used to amplify the purified extension products included the following steps: (1) 98°C for 30 seconds (2) 98°C for 10 seconds (3) 65°C for 30 seconds (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 18 times. (6) 72°C for 2 minutes

[0393] The amplified products were stored at 4°C. 4 μL of each PCR reaction was pooled into 6 pools with 16 samples per pool. The amplified products were further purified using AMPure XP bead purification with 64 μL of AMPure XP beads and elution with 20 μL of buffer containing 10 mM Tris, pH 8, and 0.05% Tween 20.

[0394] The purified amplification products were evaluated using high-sensitivity DNA fragments on the 2100 Bioanalyzer (Agilent Genomics) and the KAPA Library Quantification Kit (Kapa Biosystems) for the Illumina platform. The purified amplification products were also diluted to 15 pM and sequenced by MiSeq (Illumina) according to the manufacturer's instructions (MiSeq Reagent Kit v3 2 × 75 bp) using either standard sequencing primers or a custom spike-in Read1 primer (SEQ ID NO: 25).

[0395] Example 6: Direct PCR method for 96 multiplexed samples

[0396] In this example, the direct PCR method of the present disclosure was used to sequence identifier oligonucleotides from 96 multiplexed samples. Eight forward amplification primers and 12 reverse amplification primers were used in this example. The forward primers contained a P5 flow cell adapter (SEQ ID NO: 3), a nucleic acid sequence containing a unique molecular identifier, and a region complementary to the first amplification primer binding site present in the identifier oligonucleotide. The sequences of the forward amplification primers used are listed in Table 10. Table 10. Forward amplification primers for direct PCR. [Table 10]

[0397] The reverse primer contained a P7 flow cell adapter (SEQ ID NO: 4), a nucleic acid sequence containing a unique molecular identifier, and a region complementary to the second amplification primer binding site present in the identifier oligonucleotide. The sequences of the reverse amplification primers used are shown in Table 11. Table 11. Reverse amplification primers for direct PCR. [Table 11]

[0398] With 8 forward amplification primers and 12 reverse amplification primers, combining the unique molecular identifiers from pairs of forward and reverse primers can result in a total of 96 unique combinations, allowing for multiplexing of 96 samples.

[0399] To amplify the collected identifier oligonucleotides for sequencing, PCR reactions containing the collected identifier oligonucleotides and forward and reverse amplification primers were prepared in a 96-well plate with 2 μL of each identifier oligonucleotide sample, 10 μL of NEBNext Ultra II Q5 Master Mix, 2 μL of 10 μM forward amplification primer, 2 μL of reverse amplification primer, and 4 μL of PCR-grade HO. Each well in the 96-well plate contained a unique combination of identifier oligonucleotide sample and forward and reverse amplification primers. The PCR program used included the following steps: (1) 98°C for 30 seconds (2) 98°C for 10 seconds (3) 65°C for 30 seconds (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 6 to 10 times. (6) 72°C for 2 minutes

[0400] The amplified products were stored at 4° C. 10 μL of each PCR reaction mixture was pooled in a 15 mL conical tube.

[0401] The pooled PCR reactions were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.). The magnetic beads were prepared by combining 115.2 μL of AMPure XP beads with 1036.8 μL of AMPure XP buffer (2.5 M NaCl, 20% PEG 8000). Purification was performed with 1152 μL of diluted AMPure XP beads and eluted in 60 μL of buffer containing 10 mM Tris, pH 8. The purification step was repeated with 60 μL of AMPure XP beads and eluted in 70 μL of buffer containing 10 mM Tris, pH 8.

[0402] Following AMPure XP purification, a PCR reaction with universal primers was prepared using 9 μL of the pooled direct PCR product, 15 μL of NEBNext Ultra II Q5 Master Mix, 3 μL of 10 μM universal P7 primer (SEQ ID NO: 153), and 2 μL of 10 μM universal P5 primer (SEQ ID NO: 154). The PCR program used was as follows: (1) 98°C for 30 seconds (2) 98°C for 10 seconds (3) 65°C for 30 seconds (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 15 to 24 times. (6) 72°C for 2 minutes

[0403] Two AMPure XP bead purifications were performed: the first with 30 μL of beads and eluted with 20 μL of buffer containing 10 mM Tris, pH 8, and the second with 20 μL of beads and eluted with 11 μL of buffer containing 10 mM Tris, pH 8.

[0404] These purified PCR products were evaluated using high-sensitivity DNA analysis on a 2100 Bioanalyzer (Agilent Genomics). The purified PCR products were also diluted and sequenced by MiSeq (Illumina) using a custom spike-in primer (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq Reagent Kit v3 2 × 75 bp).

[0405] Example 7: Spatial detection of target analytes in FFPE samples

[0406] The methods of the present invention were used to spatially detect multiple different target analytes, including target proteins and target RNAs, in FFPE section samples of inflamed human tonsil tissue.

[0407] In one experiment, the disclosed method was used to spatially detect 30 different target proteins in two serial sections cut from FFPE fragments of inflamed human tonsil tissue. The 30 target proteins are shown in Table 12. The 30 target proteins included IgG rabbit and IgG mouse isotypes as negative controls, which should not be present in inflamed human tonsil samples and therefore should not be detected. Table 12. Target proteins [Table 12]

[0408] Thirty different probes of the present disclosure were used to spatially detect 30 target proteins. Each probe contained a target-binding domain comprising an antibody that specifically binds to one of the 30 target proteins in Table 12. Two serial sections were contacted with most of the 30 different probes. 96 regions of interest (ROIs) were then identified. In each ROI, the ROI was irradiated with UV light to release identifier oligonucleotides from the probes bound within the ROI. The released identifier oligonucleotides were then collected and identified using the short-probe hybridization method of the present disclosure, thereby spatially detecting the 30 target proteins in the two serial sections. As shown in Figure 21, the numerical readouts for each target protein in each ROI in the two serial sections were well correlated, indicating that this method leads to reproducible results.

[0409] In a second experiment, the disclosed method was used to spatially detect 20 different target RNAs in two different serial sections cut from FFPE fragments of inflamed human tonsil tissue. The 20 different target RNAs are shown in Table 13. The 20 target RNAs included six negative controls (negative probes) that should not be detected in the sample. Table 13. Target RNA [Table 13]

[0410] Twenty different probes of the present disclosure were used to spatially detect 20 target RNAs. Each probe contained a target-binding domain with a nucleic acid sequence complementary to at least a portion of one of the 20 target RNAs. Two serial sections were contacted with most of the 20 different probes. 96 regions of interest (ROIs) were then identified. In each ROI, the ROI was irradiated with UV light to release identifier oligonucleotides from the probes bound within the ROI. The released identifier oligonucleotides were then collected and identified using the direct PCR method of the present disclosure, thereby spatially detecting the 20 target RNAs in the two serial sections. As shown in Figure 22, the readout values ​​for each target RNA in each ROI in the two serial sections were well correlated, indicating that this method leads to reproducible results.

[0411] Example 8: Spatial detection of target proteins in fluorescently stained FFPE samples

[0412] In another experiment, 5-μm FFPE sections of inflamed human tonsil tissue were stained with four fluorescently visualized markers, namely, (1) CD3E (a T cell marker), (2) PanCK (an epithelial cell marker), (3) Ki-67 (a proliferation marker), and (4) SYTO83 (a DNA stain), as shown in the left panel of FIG. 23 . The stained FFPE sections were then contacted with probes targeting 30 target proteins, as described in Example 7. As shown in the left panel of FIG. 23 , 96 regions of interest (ROIs) were selected. Each ROI was circular, 500 μm in diameter. For each ROI, the ROI was illuminated with UV light to release identifier oligonucleotides from the probes bound within the ROI. The released identifier oligonucleotides were then collected and identified using the short-probe hybridization method of the present disclosure, thereby spatially detecting the 30 target proteins within the FFPE sections. As shown in the right panel of Figure 23, PanCK, CD3E, and Ki67 were spatially detected in the ROIs associated with their fluorescently visualized markers. Thus, the results obtained by the disclosed method correlate with those obtained using established immunohistochemical methods.

[0413] Example 9: Spatial detection of target RNA in FFPE samples

[0414] In another experiment, 5 μm sections from an FFPE block of inflamed human tonsil tissue were contacted with probes targeting 20 target RNAs, as described in Example 7. Next, 96 regions of interest (ROIs) were selected. Each ROI was circular, 500 μm in diameter. For each ROI, the ROI was illuminated with UV light to release identifier oligonucleotides from the probes bound within the ROI. The released identifier oligonucleotides were then collected and identified using the disclosed direct PCR method, thereby spatially detecting the 20 target RNAs in two consecutive sections. Next, total RNA from a 20 μm section of the same FFPE block of inflamed human tonsil tissue was isolated. All RNA was analyzed using the NanoString nCounter® System. Figure 24 shows that the average counts for 11 different RNA targets recorded using the disclosed method correlate well with the average counts for the same 11 different RNA targets recorded using the nCounter® System. Thus, results obtained using the methods of the present disclosure correlate with results obtained using established direct detection methods.

[0415] Example 10: Spatial detection of target RNA in specific subregions of an ROI

[0416] In another experiment, 5 μm sections from FFPE blocks of inflamed human tonsil tissue were contacted with probes targeting 30 target proteins, as described in Example 7. The same 5 μm sections were also stained with four fluorescent visualization markers: (1) CD3E (a T cell marker), (2) PanCK (an epithelial cell marker), (3) Ki-67 (a proliferation marker), and (4) SYTO83 (a DNA stain). Forty-eight regions of interest (ROIs) were identified, as shown in FIG. 25. Within each ROI, two subregions were then identified based on fluorescent staining. As shown in FIG. 25, the area of ​​the ROI that fluorescently stained positively for PanCK (PanCK+) was designated the "tumor" subregion, and the area of ​​the ROI that did not exhibit fluorescent staining for PanCK was designated the "microenvironment" subregion. For each ROI, the tumor subregion and the microenvironment subregion were separately irradiated with UV light, and a custom mask based on the intensity of PanCK fluorescent staining was created to release the identifier oligonucleotides from the probes bound within each subregion. The released identifier oligonucleotides were then collected separately. The collected identifier oligonucleotides were then analyzed using the disclosed short probe hybridization method and the NanoString nCounter® System. As shown in the bottom panel of Figure 25, the results using both the NanoString nCounter® System and the disclosed short probe hybridization method correlated well. Furthermore, significantly higher concentrations of PanCK were detected in the tumor subregion compared to the microenvironment subregion. Therefore, the spatial detection results obtained by the disclosed method are consistent with established fluorescent immunohistochemistry methods, demonstrating the feasibility of spatial detection within highly specific regions of the sample.

[0417] Example 11: 96-item human immuno-oncology panel

[0418] A 96-item human immuno-oncology panel was designed for use in the direct PCR method of the present invention. This panel contained multiple probes that could be used to spatially detect 96 different human target RNAs using the direct PCR method of the present disclosure. The 96 target RNAs are listed in Table 14. Table 14. Target RNA [Table 14]

[0419] Overall, the panel contained 928 different probes. Each probe contained an identifier oligonucleotide containing a first amplification primer binding site, a nucleic acid sequence containing a unique molecular identifier, a unique nucleic acid sequence that identified the target RNA bound to the target binding domain, and a second amplification primer binding site. Figure 26 shows a schematic diagram of the probes used in the panel. Each of the 96 target RNAs had at least one probe from the 928 probe sets that contained a target binding domain that directly or indirectly hybridized to that target RNA. For the majority of the 96 target RNAs, there were 10 different probes that directly or indirectly hybridized to a particular target RNA. As shown in the top diagram of Figure 27, these 10 different probes directly or indirectly hybridized to different positions on the target RNA, creating a "tiling" effect. Tiling a target RNA with multiple probes allows each target RNA to be detected individually multiple times, improving the overall accuracy of the measurements. For example, as shown in the bottom panel of Figure 27, when 10 probes are tiled to a single target RNA, one of the probes may be erroneously detected very frequently (an aberrant high-count probe) and another may be erroneously detected very rarely (an aberrant low-count probe). However, the other eight probes can be detected with comparable counts, so it is better to discard the two outliers during analysis and use the signals from the eight probes to obtain a more accurate measure of the abundance of the target RNA.

[0420] The set of 928 probes also included 80 negative control probes. Each of the 80 negative control probes contained a target-binding domain containing a modified nonspecific nucleic acid sequence, designed using guidelines from the External RNA Controls Consortium, so that the target-binding domain was not complementary to RNA molecules present in human samples. Thus, these 80 negative control probes should not be detected during the analysis.

[0421] A 96-item human immuno-oncology panel was used to analyze tissue microarrays containing FFPE samples of 22 common human cell lines, including normal and cancerous cell types. Some cell lines are listed in Table 15.

[0422] Table 15. Cell lines [Table 15]

[0423] The tissue microarray also contained one mouse cell line (3T3) as a negative control. Each FFPE sample on the microarray was contacted with most of the 928 different probes in the immuno-oncology panel. As shown in Figure 28, at least three circular regions of interest (ROIs) with a diameter of 300 μm were selected for each FFPE sample. As a negative control, ROIs were also selected in areas of the microarray that did not contain FFPE samples (glass negative control). For each ROI, the ROI was irradiated with UV light to release identifier oligonucleotides from the probes bound within the ROI. The released identifier oligonucleotides were then collected and identified using the direct PCR method disclosed herein, thereby spatially detecting 96 target RNAs in each FFPE sample on the tissue microarray.

[0424] Figure 29 shows that sufficient read depth was achieved using the MiSeq v3 flow cell. The top image in Figure 30 shows that target RNAs were not spatially detected in the glass negative control ROI. Similarly, the bottom image in Figure 30 shows that target RNAs were barely detected in the negative control mouse 3T3 FFPE sample. In contrast, as shown in Figures 31, 33, and 34, specific target RNAs were successfully detected in FFPE HEK293 (human embryonic kidney) and Jurkat (human T-cell lymphocyte) samples. Figures 31, 33, and 34 show that "tiled" probe populations were detected for specific target RNAs, including AKT1, B2M, CD3E, HIF1A, PTEN, RPS6, STAT1, STAT2, STAT3, VEGF, PTPRC (CD45), and KRT1 / 10 / 18 / 19. These results indicate that specific target RNAs are differentially transcribed in the two distinct cell lines. The results of this experiment were also validated using the NanoString nCounter system to identify the collected identifier oligonucleotides. As shown in Figure 27, the results using the direct PCR method of the present disclosure were consistent with the results obtained using the NanoString nCounter system.

Claims

1. (1) contacting at least one target analyte in a tissue sample with at least three probes, thereby tiling the probes on the at least one target analyte; wherein each of said probes: a target binding domain that binds to the at least one target analyte; and a single-stranded identifier oligonucleotide comprising a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain Including, wherein each of said probes comprises a photocleavable linker between said single-stranded identifier oligonucleotide and said target binding domain; (2) contacting the tissue sample with one or more fluorescently labeled antibodies and / or fluorescent stains; (3) detecting the one or more fluorescently labeled antibodies and / or fluorescent stains; (4) exciting at least one region on the tissue sample with light to cleave the photocleavable linker, thereby releasing the single-stranded identifier oligonucleotide; (5) collecting the released single-stranded identifier oligonucleotide; (6) determining the sequence of the released single-stranded identifier oligonucleotide; and (7) identifying the sequenced single-stranded identifier oligonucleotides, thereby spatially detecting the at least one target analyte in the tissue sample. A method comprising:

2. 2. The method of claim 1, further comprising, after step (3), identifying at least one region of interest on the tissue sample based on the detected fluorescently labeled antibody and / or fluorescent staining.

3. 3. The method of claim 2, wherein the at least one region excited in step (4) is the at least one region of interest.

4. 10. The method of claim 1, wherein determining the sequence of the released single-stranded identifier oligonucleotide comprises amplifying the harvested single-stranded identifier oligonucleotide.

5. 5. The method of claim 4, wherein the single-stranded identifier oligonucleotide further comprises a nucleic acid sequence comprising a unique molecular identifier.

6. 5. The method of claim 4, wherein the single-stranded identifier oligonucleotide further comprises a first amplification primer binding site and a second amplification primer binding site.

7. 7. The method of claim 6, wherein amplifying the harvested single-stranded identifier oligonucleotide comprises performing PCR.

8. performing the PCR includes using a first amplification primer and a second amplification primer; wherein the first amplification primer is: a first nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released; and a nucleic acid sequence complementary to the second amplification primer binding site Including; wherein the second amplification primer is: a second nucleic acid sequence that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released; and a nucleic acid sequence complementary to the first amplification primer binding site The method of claim 7, comprising:

9. 9. The method of claim 8, wherein the first amplification primer further comprises a first flow cell binding site and the second amplification primer further comprises a second flow cell binding site.

10. The method of claim 1 , wherein the at least one target analyte is a nucleic acid molecule.

11. 11. The method of claim 10, wherein the nucleic acid molecule is an mRNA molecule, a miRNA molecule, a tRNA molecule, a rRNA molecule, or a gDNA molecule.

12. The method of claim 11 , wherein the nucleic acid molecule is an mRNA molecule.

13. 11. The method of claim 10, wherein the target binding domain comprises a nucleic acid molecule.

14. 14. The method of claim 13, wherein the target binding domain comprises 10 to 70 nucleotides.

15. 15. The method of claim 14, wherein the target binding domain comprises 35 to 50 nucleotides.

16. 10. The method of claim 1, wherein detecting one or more fluorescently labeled antibodies and / or fluorescent stains from step (2) to identify at least one region of interest on the tissue sample comprises identifying the at least one region of interest based on morphology, cell type of interest, or any combination thereof.

17. 2. The method of claim 1, wherein the one or more fluorescently labeled antibodies and / or fluorescent stains comprise a fluorescently labeled anti-CD3E antibody, a fluorescently labeled anti-PanCK antibody, a fluorescently labeled anti-Ki-67 antibody, DAPI, SYT083, or any combination thereof.

18. 10. The method of claim 1, wherein step (1) comprises contacting the at least one target analyte in at least one cell in a tissue sample with at least five probes.

19. 10. The method of claim 9, wherein at least one of the flow cell binding sites comprises a flow cell adapter sequence suitable for sequencing.

20. 20. The method of claim 19, wherein at least one of the flow cell binding sites comprises a P5 flow cell adapter sequence, wherein the P5 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO:

3.

21. 20. The method of claim 19, wherein at least one of the flow cell binding sites comprises a P7 flow cell adapter sequence, and the P7 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO:

4.

22. 2. The method of claim 1, wherein the unique nucleic acid sequence that identifies the target analyte bound to the target binding domain comprises between 5 and 25 nucleotides.

23. 23. The method of claim 22, wherein the nucleic acid sequence that identifies the target analyte bound to the target binding domain comprises 12 nucleotides.

24. 2. The method of claim 1, wherein at least one of the amplification primer binding sites comprises 10 to 40 nucleotides.

25. 25. The method of claim 24, wherein at least one of the amplification primer binding sites comprises 34 nucleotides.

26. 25. The method of claim 24, wherein at least one of the amplification primer binding sites comprises 33 nucleotides.

27. 2. The method of claim 1, wherein at least one of the amplification primer binding sites comprises an i7 sequence, wherein the i7 sequence comprises the sequence set forth in SEQ ID NO:

1.

28. 2. The method of claim 1, wherein at least one of the amplification primer binding sites comprises an i5 sequence, wherein the i5 sequence comprises the sequence set forth in SEQ ID NO:

2.

29. 9. The method of claim 8, wherein at least one of the nucleic acid sequences that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released comprises 1 to 20 nucleotides.

30. 30. The method of claim 29, wherein at least one of the nucleic acid sequences that identifies the specific location in the tissue sample from which the identifier oligonucleotide was released comprises 8 nucleotides.

31. 6. The method of claim 5, wherein the nucleic acid sequence comprising the unique molecular identifier comprises 5 to 20 nucleotides.

32. 32. The method of claim 31 , wherein the nucleic acid sequence comprising the unique molecular identifier comprises 14 nucleotides.

Images