RNA sequencing library construction method, sequencing method and kit

Abstract

The present invention provides a method for constructing an RNA sequencing library, a sequencing method and a kit, in which the construction method includes the steps of obtaining a single-stranded cDNA, which is a reverse transcription product of mRNA, and the single-stranded cDNA contains a cDNA tag sequence at its 3' end, circularizing the single-stranded cDNA to obtain a single-stranded circularized cDNA, amplifying the single-stranded circularized cDNA using a primer combination consisting of a random primer or a gene-specific primer and a cDNA tag primer to obtain an amplified fragment, the cDNA tag primer being at least a part of the cDNA tag sequence, and constructing a fragmentation library for the amplified fragment to obtain an RNA sequencing library.

Description

[Technical Field]

[0001] The present invention relates to the field of sequencing, and more particularly to a method for constructing an RNA sequencing library, a sequencing method and a kit. [Background technology]

[0002] The rapid development of single-cell technologies has quickly ushered in the era of single-cell sequencing. Single-cell technologies have undergone constant evolution, from single-tube amplification to the current high-throughput droplet-based technologies, resulting in significant changes in manpower, time, cost, and cell capture volume. However, due to sequencing read-length limitations, full-length cDNA often needs to be fragmented for sequencing and library construction. Smart-seq2 technology employs a single-tube amplification strategy, using techniques such as flow cytometry and microscopic fragmentation to separate single cells into corresponding single wells, followed by lysis, transcription and amplification, fragmentation, and library construction. Because single-tube library construction lacks a specific barcode to distinguish cell origins, it is only possible to tag all sequences from a single cell during library construction and then combine libraries from different cells for sequencing. While this sequencing strategy achieves full-length sequences, it limits cell throughput and significantly increases sequencing costs.

[0003] Current strategies based on droplet high-throughput sequencing specifically capture sequences at both ends of a cDNA by synthesizing a single fragment of the sequence bearing a specific molecular tag on microbeads. However, due to sequencing read-length limitations, direct sequencing of the tagged full-length cDNA is not possible and further truncation is required. Sequences in the middle of the truncated cDNA sequence are screened without tagging, resulting in the loss of full-length sequences and the loss of important information, such as alternative splicing. The specific steps of the droplet high-throughput sequencing strategy are as follows:

[0004] Using droplet microfluidics technology, water-in-oil droplets are used to encase cells and microbeads, resulting in droplets containing one cell and one magnetic bead simultaneously. Other components within the droplet include a lysate, where the microbeads contain a large amount of DNA sequences (barcodes) with specific molecular tags and TSO sequences. As droplets are continuously generated, the cells within the droplets are cleaved by the lysate, releasing large amounts of mRNA. At the same time, the mRNA is captured by free poly(dT) and undergoes RT reaction within the droplet. The TSO sequence is then added to the mRNA end, and the complementary sequence of the TSO at the end of the first-strand cDNA extension binds to the TSO sequence on the microbeads, capturing the mRNA on the microbeads. PCR amplification then attaches a specific molecular tag to the 5' sequence, further enabling high-throughput single-cell sequencing of 5' RNA, such as that achieved by 10x genomics. However, a major drawback of 10x genomics is its high cost.

[0005] The main providers of single-cell sequencing equipment and services on the market include 10X Genomics, BD, and Dolomite's Nadia. Other than 10X Genomics, there are currently no high-throughput 5' RNA sequencing methods. However, 5' RNA sequencing is an essential part of acquiring the immune repertoire. For example, the 5' TCR / BCR is an important component of immune cells, so acquiring TCR / BCR sequences is crucial for a deeper understanding of immune mechanisms. Furthermore, while droplet-based high-throughput full-length mRNA single-cell sequencing technology has not yet been reported, full-length sequencing plays an important role in understanding gene diversity and controlling mechanisms.

[0006] These findings demonstrate that current single-tube, full-length RNA sequencing techniques are difficult to implement for high-throughput single-cell sequencing. The limitations of droplet microfluidics technology mean that molecular tags can only be placed at the 3' or 5' ends of cDNA. Therefore, after cutting and screening the cDNA library, the intermediate sequences lack specific molecular tags, making it impossible to trace their origin and discard them, resulting in failure to obtain full-length sequences. Furthermore, while 10x genomics currently achieves high-throughput 5' RNA single-cell sequencing, the mRNA capture efficiency based on TSO complementation is not as high as that based on poly(dT), and the cost is high.

[0007] Therefore, there is still a need to improve existing methods to achieve high-throughput sequencing of the RNA 5'-end or full-length RNA of single cells. Summary of the Invention [Problem to be solved by the invention]

[0008] The main objective of the present invention is to provide a method for constructing an RNA sequencing library, a sequencing method, and a kit to solve the problem that it is difficult to achieve high-throughput sequencing of the 5' end or full length of RNA in conventional techniques. [Means for solving the problem]

[0009] To achieve the above object, one aspect of the present invention provides a method for constructing an RNA sequencing library, the method comprising the steps of obtaining single-stranded cDNA, which is a reverse transcription product of mRNA, and which contains a cDNA tag sequence at the 3' end of the single-stranded cDNA; circularizing the single-stranded cDNA to obtain single-stranded circularized cDNA; amplifying the single-stranded circularized cDNA using a primer combination consisting of a random primer or a gene-specific primer and a cDNA tag primer to obtain amplified fragments, wherein the cDNA tag primer is at least a part of the cDNA tag sequence; and constructing a fragmentation library from the amplified fragments to obtain an RNA sequencing library.

[0010] Furthermore, the step of obtaining single-stranded cDNA, which is a reverse transcription product of mRNA, and which includes a cDNA tag sequence at the 3' end of the single-stranded cDNA includes the steps of reverse transcribing mRNA to obtain first-strand cDNA, amplifying the first-strand cDNA to obtain double-stranded cDNA, which includes a cDNA tag sequence at the 3' end of second-strand cDNA complementary to the first-strand cDNA, the cDNA tag sequence including poly(A), and melting the double-stranded cDNA to obtain single-stranded cDNA.

[0011] Furthermore, the cDNA tag sequence includes, in the 3' to 5' direction, a second PCR linker, a second cell tag, a second unique molecular tag, and poly(A).

[0012] Furthermore, the mRNA is from a single cell sample and the mRNA is single cell mRNA.

[0013] Furthermore, the single-cell mRNA is prepared using a droplet method so that the single-cell mRNA is attached to a solid support, and preferably the solid support is a microbead.

[0014] Furthermore, the step of preparing single-cell mRNA using the droplet method so that the single-cell mRNA is connected to microbeads includes the steps of respectively providing a single-cell suspension and microbeads, where the microbeads carry a microbead tag sequence and contain poly(dT) at the end of the microbead tag sequence; and encapsulating the single-cell suspension and microbeads into droplets, each droplet containing one single cell and one microbead, where the microbeads bind to the poly(A) of the mRNA in the single-cell suspension via poly(dT), thereby connecting the mRNA in the single-cell suspension to the microbeads and obtaining single-cell mRNA.

[0015] Furthermore, the microbead tag sequence is sequentially composed of a first PCR linker, a first cell tag, and a first unique molecule in the 5' to 3' direction. sign and poly(dT), and correspondingly, the cDNA tag sequence sequentially comprises, from 3' to 5', a second PCR linker, a second cell tag, a second unique molecular label, and poly(A), where the second PCR linker is complementary to the first PCR linker, the second cell tag is complementary to the first cell tag, and the second unique molecular label is complementary to the first unique molecular label.

[0016] Furthermore, the single-stranded cDNA contains the sequence of the TSO primer at the 5' end.

[0017] Furthermore, a reverse transcriptase and a TSO linker are employed to reverse transcribe the mRNA to obtain first-strand cDNA, in which the transcriptase has terminal transferase activity and contains the complementary sequence of the TSO linker at the 3' end of the first-strand cDNA; the first-strand cDNA is amplified to obtain second-strand cDNA, which contains the sequence of the TSO primer at the 5' end of the second-strand cDNA.

[0018] Furthermore, the sequence of the TSO linker is SEQ ID NO:1.

[0019] Further, the reverse transcriptase is selected from MGI's Alpha Reverse Transcriptase, Invitrogen's SuperScript® II Reverse Transcriptase, Thermo's Superscript IV or Maxima H Minus.

[0020] Furthermore, the first strand cDNA is subjected to random amplification and / or full-length amplification to obtain double-stranded cDNA.

[0021] Further, a linker amplification primer and a TSO primer are employed to amplify the first strand cDNA to obtain double-stranded cDNA, or a linker amplification primer, a TSO-random primer and a TSO primer are employed to amplify the first strand cDNA to obtain double-stranded cDNA.

[0022] Furthermore, the sequence of the linker amplification primer is SEQ ID NO:2, the sequence of the TSO primer is SEQ ID NO:3, and the sequence of the TSO-random primer is SEQ ID NO:4.

[0023] Furthermore, the step of circularizing the single-stranded cDNA to obtain a single-stranded circularized cDNA includes the steps of ligating the single-stranded cDNA to form a loop under the action of a circularization assisting sequence and a ligase to obtain a ligated product, and enzymatically cleaving the ligated product to digest the unligated single-stranded cDNA to form a loop, thereby obtaining a single-stranded circularized cDNA, wherein the circularization assisting sequence is complementary to the sequences at both ends of the single-stranded cDNA.

[0024] Additionally, the cyclization assist sequence is selected from SEQ ID NO:5.

[0025] Furthermore, the gene-specific primers are TCR primers for TCR gene amplification and / or BCR primers for BCR gene amplification.

[0026] Furthermore, the cDNA tag primer is a poly(A) primer, more preferably SEQ ID NO:6.

[0027] Furthermore, the step of performing fragmentation library construction on the amplified fragments to obtain an RNA sequencing library includes the step of adding library linkers to the amplified fragments to obtain an RNA sequencing library.

[0028] Furthermore, the amplified fragments are subjected to enzymatic fragmentation to obtain enzymatic fragments, which are then sequentially subjected to end repair, A addition, and library linker ligation to obtain an RNA sequencing library.

[0029] Furthermore, after the library linker ligation, the ligation product of the library linker is amplified by PCR to obtain an RNA sequencing library.

[0030] Further, the library linker is a linker for the MGI sequencing platform or a linker for the Illumina sequencing platform.

[0031] According to a second aspect of the present application, there is provided an RNA library construction kit, the kit comprising a circularization auxiliary sequence, a DNA ligase, a cDNA tag primer, and at least one of (a) a random primer, (b) a TCR primer, and (c) a BCR primer.

[0032] Additionally, the kit further comprises an RNA reverse transcription reagent.

[0033] Additionally, the RNA reverse transcription reagent includes a reverse transcriptase, which is a reverse transcriptase enzyme with terminal transferase activity.

[0034] Further, the reverse transcriptase is selected from MGI's Alpha Reverse Transcriptase, Invitrogen's SuperScript® II Reverse Transcriptase, Thermo's Superscript IV or Maxima H Minus.

[0035] Additionally, the RNA reverse transcription reagent further comprises a TSO linker.

[0036] Furthermore, the sequence of the TSO linker is SEQ ID NO:1.

[0037] Additionally, the kit further includes a TSO primer and a linker amplification primer.

[0038] Furthermore, the sequence of the linker amplification primer is SEQ ID NO:2 and the sequence of the TSO primer is SEQ ID NO:3.

[0039] Additionally, the kit further comprises a TSO-random primer.

[0040] Furthermore, the sequence of the TSO-random primer is SEQ ID NO:4.

[0041] Additionally, the cyclization auxiliary sequence is SEQ ID NO:5.

[0042] Furthermore, the cDNA tag primer is a poly(A) primer.

[0043] Furthermore, the sequence of the cDNA tag primer is SEQ ID NO:6.

[0044] Additionally, the kit further comprises at least one of an exonuclease and a library linker.

[0045] Further, the exonuclease is selected from exonuclease I or exonuclease III.

[0046] Further, the library linker is a linker for the MGI sequencing platform or a linker for the Illumina sequencing platform.

[0047] Additionally, the MGI sequencing platform Linker is selected from bubble linkers, and the linkers for the Illumina sequencing platform are selected from P5 and P7 linkers.

[0048] Additionally, the DNA ligase is selected from T4 DNA ligase.

[0049] Furthermore, the kit further comprises a solid support, on which a support tag sequence is provided, wherein the cDNA tag primer is complementary to at least a portion of the support tag sequence, and preferably the solid support is a microbead and the support tag sequence is a microbead tag sequence.

[0050] Further, the support tag sequence is sequentially arranged in the 5' to 3' direction as follows: a first PCR linker, a first cell tag, a first unique molecule, and a sign and poly(dT).

[0051] According to a third aspect of the present application, there is provided a method for sequencing an RNA library, the sequencing method comprising the steps of constructing an RNA sequencing library by employing any of the above-mentioned RNA sequencing library construction methods, and sequencing the RNA sequencing library. [Effects of the Invention]

[0052] The technical solution of the present invention involves obtaining single-stranded cDNA, which is the product of reverse transcription of mRNA, and attaching a cDNA tag sequence to the 3' end of the single-stranded cDNA. The cDNA tagged single-stranded cDNA is then circularized so that the two ends of the single-stranded cDNA are linked (i.e., the 5' and 3' ends corresponding to the mRNA are linked). The 5' fragment of the mRNA is then labeled with the 3' cDNA tag sequence. The circularized single-stranded cDNA is then amplified using a cDNA tag primer identical to at least a portion of the cDNA tag sequence and a random primer or gene-specific primer, yielding amplified fragments starting from the 5' end of a specific gene or from any position on the 5' end. Finally, these amplified fragments are fragmented and screened, followed by library construction and sequencing, thereby achieving the goal of high-throughput sequencing. Therefore, depending on whether the length of the loop-forming single-stranded cDNA obtained above is full-length or random-length cDNA, a 5' RNA sequencing library or a full-length RNA sequencing library can be obtained, depending on the research objective. [Brief explanation of the drawings]

[0053] The accompanying drawings, which form a part of this application, are intended to provide a further understanding of the present invention, and the illustrative embodiments of the present invention and the description thereof are intended to provide an understanding of the present invention and are not intended to unduly limit the present invention. [Figure 1] 1 shows a schematic diagram of a chip configuration for preparing droplets in Example 1 of the present invention. [Figure 2] 1 shows a schematic diagram of the principle of RNA full-length library construction and the sequencing flow of the library construction of the present application. [Figure 3] 1 shows a schematic diagram of the 5′ RNA end library construction principle of the present application and the sequencing flow of the library construction. [Figure 4A] 1 shows the results of Agilent 2100 bioanalyzer detection of full-length cDNA amplification products of cell line samples and solid tissue samples in Example 1 of the present application. [Figure 4B] 1 shows the results of Agilent 2100 bioanalyzer detection of full-length cDNA amplification products of cell line samples and solid tissue samples in Example 1 of the present application. [Figure 5A] 1 shows the results of Agilent 2100 bioanalyzer detection of random primer amplified cDNA products of cell line samples and solid tissue samples in Example 2 of the present application. [Figure 5B] 1 shows the results of Agilent 2100 bioanalyzer detection of random primer amplified cDNA products of cell line samples and solid tissue samples in Example 2 of the present application. [Figure 6A] 1 shows the results of detection by Agilent 2100 bioanalyzer of random primer amplification products after single-stranded cDNA circularization of cell line samples and solid tissue samples in Example 1 of the present application. [Figure 6B] 1 shows the results of detection by Agilent 2100 bioanalyzer of random primer amplification products after single-stranded cDNA circularization of cell line samples and solid tissue samples in Example 1 of the present application. [Figure 7A] 1 shows the results of Agilent 2100 bioanalyzer detection of TCR / BCR primer amplification products after single-stranded cDNA circularization of cell line samples and solid tissue samples in Example 2 of the present application. [Figure 7B] 1 shows the results of Agilent 2100 bioanalyzer detection of TCR / BCR primer amplification products after single-stranded cDNA circularization of cell line samples and solid tissue samples in Example 2 of the present application. [Figure 8] 1 shows the results of analyzing the coverage status of transcripts by 5'-end and 3'-end sequencing fragments in offline data after sequencing analysis of a library constructed in a preferred embodiment of the present application. DETAILED DESCRIPTION OF THE INVENTION

[0054] It should be noted that, unless there is a contradiction, the embodiments and features in the embodiments in the present application can be combined with each other. The present invention will be described in detail below with reference to examples.

[0055] Terminology: TSO: Template switch oligonucleotide (TSO), sometimes referred to as a "TSO linker" in this application, is used in combination with a reverse transcriptase with terminal transferase activity. When reverse transcribing mRNA, the reverse transcriptase adds CCC to the end of the first-strand cDNA (only to full-length transcripts). Meanwhile, the TSO linker contains rGrG+G (rG represents a ribose-guanine nucleotide, and +G represents an LNA-modified deoxyribose-guanine nucleotide) that pairs with CCC, thereby attaching the complementary sequence of the TSO linker, other than rGrG+G, to the 3'-end CCC of the first-strand cDNA during reverse transcription.

[0056] TSO primer: A primer capable of at least partially binding to the 3' end of first strand cDNA for cDNA second strand synthesis and cDNA amplification. In a specific embodiment, the TSO primer is a sequence in which rGrG+G is removed from the TSO linker.

[0057] Random primer and TSO-random primer: In the present application, a random primer refers to a sequence consisting only of the base N, for example, a random sequence consisting of 6 to 12 nt of N. On the other hand, a TSO-random primer refers to a sequence containing a TSO primer upstream of a random primer consisting of the base N.

[0058] Support tag sequence: In this application, this refers to a tag sequence attached to a solid support for capturing mRNA, and includes at least an oligo(dT) for capturing mRNA. In some embodiments, the support tag sequence includes, in 5' to 3' order, a cell tag and an oligo(dT), where the oligo(dT) is complementary to the poly(A) of the mRNA and is used to capture the mRNA, and the cell tag is used to label mRNA from the same cell. In some embodiments, a unique molecular identifier (i.e., UMI) can be placed between the cell tag and the oligo(dT) to further label different mRNA molecules within the same cell. In some preferred embodiments, a PCR linker can be placed 5' from the cell tag for subsequent PCR amplification to further facilitate subsequent library construction. In some preferred embodiments, the solid support is a microbead, and the tag sequence attached to the microbead is referred to as a microbead tag sequence, and includes, in order from closest to the microbead (i.e., from 5' to 3'), a PCR linker, a cell tag, a unique molecular identifier (i.e., UMI), and an oligo(dT).

[0059] cDNA tag sequence: A tag sequence on a single-stranded cDNA with circularized poly(A), where the poly(A) is complementary to the oligo(dT) on the solid support, thereby enabling amplification of mRNA captured on the solid support. In some preferred embodiments, the cDNA tag sequence includes a cell tag for tagging the cell origin in addition to poly(A). In one preferred embodiment, a unique molecular tag (i.e., UMI) is further placed between the cell tag and the oligo(dT) to label different mRNA molecules within the same cell. In another preferred embodiment, a PCR linker is further placed in the 3' direction of the cell tag to be used as a primer for PCR amplification in the subsequent library construction step. In a more preferred embodiment, the cDNA tag sequence includes, in 3' to 5' order, a PCR linker, a cell tag, a unique molecular tag, and poly(A). In this application, to more accurately distinguish the sequences, the PCR linker, cell tag, and unique molecular label (i.e., UMI) on the support tag sequence (or microbead tag sequence) will be referred to as the first PCR linker, first cell tag, and first unique molecular label, respectively, and correspondingly, the PCR linker, cell tag, and unique molecular label (i.e., UMI) on the cDNA tag sequence will be referred to as the second PCR linker, second cell tag, and second unique molecular label, respectively.

[0060] Linker amplification primer: In this application, a linker amplification primer is a PCR linker, and is described in terms of cDNA amplification, where the amplification is carried out using a primer combination of a linker amplification primer and a TSO primer.

[0061] cDNA tag primer: refers to a primer used in amplifying circularized single-stranded cDNA, and is at least a portion of the tag sequence linked to the poly(A) of the circularized single-stranded cDNA (for example, it may be poly(A) or a cDNA tag sequence). It is used to amplify the poly(T)-attached sequence after amplification of the circularized single-stranded cDNA with a random primer or a gene-specific primer, thereby obtaining the amplified fragments necessary to construct a 5' RNA library or a full-length RNA library.

[0062] TCR / BCR primers: TCR / BCR refers to primers encoding the T cell receptor / B cell receptor genes, i.e., T cell receptor or B cell receptor genes. They are a type of gene-specific primer and are used to sequence single-cell T / B cell receptors and further study immune mechanisms.

[0063] Circularization auxiliary sequence: In this application, this refers to an auxiliary sequence that draws the 5' and 3' ends of a single-stranded cDNA together to bring the ends closer together when circularizing the single-stranded cDNA. This refers to a sequence that draws the 5' and 3' ends of a single-stranded cDNA together by a segment of sequence that is complementary to the 5' and 3' ends of the single-stranded cDNA, respectively. A defect may exist between the adjacent 5' and 3' ends, and the defect is complemented by the action of DNA ligase, thereby achieving circularization of the single-stranded cDNA.

[0064] Poly(A): It is well known to those skilled in the art that mRNA has a poly(A) tail (polyadenylation), and correspondingly, the poly(A) tail corresponding to the DNA described in this application refers to polydeoxyadenylation complementary to poly(dT).

[0065] As mentioned in the background art, among existing RNA sequencing methods, methods capable of sequencing full-length mRNA have difficulty achieving high throughput. Most of the methods that can achieve high throughput sequencing are aimed at 3'-end mRNA sequencing, while 5'-end single-cell sequencing is currently mainly based on 10x genomics, and single-cell full-length mRNA sequencing has not yet been reported. To improve this situation, the inventors, taking into account the shortcomings of existing single-cell sequencing technologies, made improvements to existing single-cell RNA library construction methods, and discovered that after capturing cDNA based on single-cell high-throughput 3' RNA sequencing, the tag sequence at the 3' end of the mRNA is transferred to the 5' end of the mRNA by circularization and ligation, or shares a tag with the 3' end, while simultaneously achieving single-cell high-throughput sequencing of the 3' and / or 5' ends of the RNA. Specifically, the inventors conducted detailed studies on the construction of a full-length cDNA single-cell high-throughput sequencing library and the construction of a 5'-end RNA single-cell high-throughput sequencing library, and further refined the experimental design to confirm the feasibility of this method. The specific principles and steps are as follows:

[0066] (1) RNA full-length single-cell sequencing strategy Based on the 3'-end RNA_seq droplet strategy, mRNA is captured and reverse-transcribed to generate full-length cDNA. The cDNA is then amplified using a linker amplification primer, a TSO primer, and a TSO-random primer. The 3'-end microbead tag sequence, derived from a solid support, such as microbeads, is converted into a cDNA tag sequence during amplification, while the 5'-end DNA fragments are formed by varying the binding position of the TSO-random primer. The fragments of varying lengths are then circularized, forming loops where the 3'-end cDNA tag sequence and the 5'-end TSO primer are ligated. The loops are then further amplified using a random primer and poly(A) primer complementary to the cDNA loop as a template. These amplified products are then fragment screened and sequenced for library construction, achieving the goals of not only amplifying full-length cDNA but also enabling high-throughput sequencing (Figure 2).

[0067] The specific steps are as follows: (1) A PCR linker sequence is designed to capture the 3' end poly(A) of mRNA, and the PCR linker sequence can be attached to a solid support (e.g., microbeads). The PCR linker can be used as a linker amplification primer during cDNA amplification. A TSO primer and a TSO-random primer complementary to the 3' end of the first-strand cDNA are designed, and after synthesizing the first-strand cDNA, the primers are used to amplify it, yielding cDNA fragments of different sizes.

[0068] (2) Using the circularization ligation technique, the 3'-end cDNA tag sequence of the single-stranded poly(A)-attached cDNA fragment and the 5'-end sequence are successfully ligated to obtain circular DNA molecules of non-uniform sizes.

[0069] (3) The sequence is designed as an upstream primer, and the upstream primer is the same as the cDNA 3'-end poly(A) sequence. Random primers are used to amplify the circular DNA molecule to obtain an amplified sequence with poly(T). The binding between the poly(A) primer and poly(T) is utilized to amplify and obtain DNA fragments of different lengths. These fragments are then subjected to truncation, library construction, and sequencing to obtain full-length RNA sequences. See the Examples for details.

[0070] In a specific embodiment, the overall technical process for full-length RNA sequencing is as follows: droplet preparation (microbeads containing the lysate) → mRNA capture → demixing → reverse transcription → random primer amplification → circularization of the amplified product → PCR amplification of the circularized product → fragmentation library construction → sequencing. See the Examples for details.

[0071] (2) 5'-end RNA single-cell sequencing strategy The strategy for 5'-end RNA sequencing involves using droplet technology for 3'-end RNA sequencing to obtain mRNA. The mRNA is then reverse-transcribed and amplified to obtain full-length cDNA. The resulting double-stranded full-length cDNA is then circularized to form a single-stranded cDNA with a poly(A) tail, successfully linking the 3' end of the mRNA to the 5' end of the sequence. The circularized cDNA is then further amplified using a gene-specific primer (e.g., TCR / BCR primer) or a random primer and a poly(A) primer complementary to the circularized cDNA as a template. The amplified products are then fragmented and screened for library construction and sequencing, thereby capturing the 5' end of the TCR / BCR sequence or the 5' sequence of other genes of interest (Figure 3).

[0072] The specific steps are as follows: (1): A PCR linker sequence is designed to capture the 3' end poly(A) of mRNA. This PCR linker sequence can be attached to a solid support (e.g., magnetic beads) and used as a linker amplification primer during cDNA amplification. A TSO primer complementary to the 3' end of the first-strand cDNA is designed. After synthesizing the first-strand cDNA, it is amplified using a primer combination consisting of the PCR linker sequence and the TSO primer to obtain a full-length cDNA fragment.

[0073] (2) Using circularization ligation technology, the poly(A)-tagged single strand of the full-length cDNA fragment is circularized to obtain a circular DNA molecule in which the cDNA tag sequence at the 3' end and the TSO primer at the 5' end are successfully linked.

[0074] (3) A poly(A) primer is designed as an upstream primer, and this primer is the same as the cDNA 3'-end poly(A) sequence. A TCR / BCR primer or random primer complementary to the cDNA loop is designed to amplify the circular DNA molecule and obtain a 5'-end TCR / BCR fragment or a 5'-end random-start amplified fragment.

[0075] (4) Library construction sequencing is performed on the fragments obtained by TCR / BCR primer amplification or the amplified fragments with random 5'-end initiation, and the TCR / BCR sequence at the mRNA 5'-end or the sequence with random 5'-end initiation is further obtained.

[0076] In a specific embodiment, the overall technical pathway for 5'-end RNA sequencing is as follows: droplet preparation (containing cell lysate in the liquid phase of microbeads) → demixing → mRNA capture → reverse transcription reaction → full-length cDNA amplification → circularization of the amplified product → PCR amplification of the circularized product using ployA primer + TCR / BCR primer or random primer → fragmentation library construction → sequencing.

[0077] As can be seen from the above, this application employs a 3' droplet-based strategy to capture mRNA, i.e., carry PCR linkers, cell tags, and UMI (unique molecular identifier) ​​sequences on a solid support (e.g., microbeads), and simultaneously add poly(dT) to the end, which is complementary to the poly(A) tail at the 3' end of mature mRNA, thereby capturing the mRNA, which is then reverse transcribed to synthesize full-length first-strand cDNA. Then, random primers are used to amplify and connect the cDNA fragments in a looped fashion, thereby obtaining different sizes of cDNA fragments or full-length cDNA, thereby achieving single-cell RNA 5'-end and full-length RNA sequencing.

[0078] Based on the above-mentioned improved ideas and research results, the applicant presents the technical solution of the present application. In a typical embodiment, the present application provides a method for constructing an RNA sequencing library, the method comprising: obtaining single-stranded cDNA, which is a reverse transcription product of single-cell mRNA, the single-stranded cDNA containing a cDNA tag sequence at the 3' end; circularizing the single-stranded cDNA to obtain single-stranded circularized cDNA; amplifying the fragment using a primer combination consisting of a random primer or a gene-specific primer and a cDNA tag primer, wherein the cDNA tag primer is at least a part of the cDNA tag sequence; and performing fragmentation library construction on the amplified fragments to obtain an RNA sequencing library.

[0079] The construction method involves obtaining single-stranded cDNA, a product of reverse transcription of mRNA, and carrying a cDNA tag sequence at its 3' end. The single-stranded cDNA carrying the cDNA tag sequence is then circularized so that the two ends of the single-stranded cDNA are linked (i.e., the 5' and 3' ends corresponding to the mRNA), and labeling the 5' fragment of the mRNA with the 3' cDNA tag sequence. The circularized single-stranded cDNA is then amplified using a cDNA tag primer identical to at least a portion of the cDNA tag sequence and a random or gene-specific primer, yielding amplified fragments beginning at the 5' end of a specific gene or at any position in the 5' end. Finally, these amplified fragments are fragmentation screened and then sequenced for library construction, achieving the goal of high-throughput sequencing. Therefore, depending on whether the length of the loop-forming single-stranded cDNA obtained above is full-length or random-length cDNA, a full-length RNA sequencing library or a 5' RNA sequencing library can be obtained.

[0080] The above construction method can be applied to constructing an RNA library from any sample as long as reverse-transcribed single-stranded cDNA can be obtained from the mRNA of that sample. It is particularly applicable to constructing a single-cell RNA library. In a preferred embodiment, the mRNA is derived from a single-cell sample and is single-cell mRNA.

[0081] The single-cell mRNA can be obtained by any known method in the prior art. In a preferred embodiment of the present application, the single-cell mRNA is prepared using a droplet method so that the single-cell mRNA is attached to a solid support, preferably a microbead.

[0082] In a preferred embodiment of the present application, the steps of preparing single-cell mRNA using the droplet method so that single-cell mRNA is attached to microbeads include providing a single-cell suspension and microbeads, attaching a microbead tag sequence to the microbead, and including poly(dT) at the end of the microbead tag sequence; encapsulating the single-cell suspension and microbeads in droplets, each containing one single cell and one microbead; the microbeads binding to the poly(A) of the mRNA in the single-cell suspension via the poly(dT), thereby attaching the mRNA in the single-cell suspension to the microbead, thereby obtaining single-cell mRNA. Since the single-cell suspension contains cell lysate, it can also be considered a cell nucleus suspension. The droplet method achieves mRNA capture by binding the poly(dT) on the microbeads to the poly(A) of the mRNA, resulting in high capture efficiency. Since a single oil droplet corresponds to a single microbead and a single cell, the microbead tag sequence on the microbead can also specifically label single cells.

[0083] In the above construction method, the specific method for obtaining single-stranded cDNA, which is a reverse transcription product of mRNA, is not limited as long as the cDNA tag sequence can be attached to the 3' end corresponding to the mRNA. As described above, the length of the obtained single-stranded cDNA is also not particularly limited; it may be full-length cDNA or cDNA of random length, and both may be present. To enable sufficient mining and utilization of transcriptome information, in a preferred embodiment of the present application, the step of obtaining single-stranded cDNA, which is a reverse transcription product of mRNA, and attaching a cDNA tag sequence to the 3' end of the single-stranded cDNA includes the steps of reverse transcribing mRNA to obtain first-strand cDNA, amplifying the first-strand cDNA to obtain double-stranded cDNA, where the second-strand cDNA, complementary to the first-strand cDNA, contains the cDNA tag sequence at its 3' end and the cDNA tag sequence contains poly(A), and melting the double-stranded cDNA to obtain single-stranded cDNA containing the cDNA tag sequence. The double-stranded cDNA is melted for subsequent circularization, and in the case of double-stranded cDNA, it is difficult for the circularization-assisting sequence to effectively bind to the strand to be circularized. The method for subsequent circularization is not limited as long as it can successfully ligate the cDNA.

[0084] In the preferred embodiment, the microbead tag sequence on the microbead for capturing a single cell preferably comprises, in the 5' to 3' direction, a first PCR linker, a first cell tag, a first unique molecule, and sign and poly(dT), and correspondingly, the cDNA tag sequence sequentially comprises, from 3' to 5', a second PCR linker, a second cell tag, a second unique molecular label, and poly(A), where the second PCR linker is complementary to the first PCR linker, the second cell tag is complementary to the first cell tag, and the second unique molecular label is complementary to the first unique molecular label. That is, a microbead tag sequence is attached to the 5' end of the first-strand cDNA, and a cDNA tag sequence complementary to the microbead tag sequence is attached to the 3' end of the amplified second-strand cDNA.

[0085] To facilitate amplification of the first-stranded cDNA, a sequence containing a TSO primer at its 5' end is preferred. Specifically, the method for attaching the TSO primer sequence to the 5' end is not limited. In a preferred embodiment of the present application, mRNA is reverse transcribed using a reverse transcriptase with terminal transferase activity and a TSO linker to obtain first-strand cDNA, which contains a complementary sequence of the TSO linker at its 3' end. The first-strand cDNA is then amplified to obtain second-strand cDNA, which contains the TSO primer sequence at its 5' end.

[0086] Specifically, when amplifying first-strand cDNA, if a TSO primer is used, a full-length second-strand cDNA can be obtained, and if a TSO-random primer is used, a second-strand cDNA of any length can be obtained. Depending on the type of amplification primer, a full-length or any length double-stranded cDNA can be obtained, and after melting, a full-length or any length single-stranded cDNA with the above-mentioned cDNA tag sequence can be obtained.

[0087] The sequence of the TSO linker can be a known sequence or can be designed independently as needed. In some preferred embodiments of the present application, the sequence of the TSO linker is SEQ ID NO: 1. The reverse transcriptase includes, but is not limited to, MGI Alpha reverse transcriptase, Invitrogen SuperScript® II reverse transcriptase, Thermo Superscript IV, or Maxima H Minus.

[0088] Droplet-based single-cell mRNA capture is currently a low-cost, high-throughput method for transcriptome sequencing. The core of this method is the use of droplets as microreactors, each containing a single cell and a single tag sequence (usually pre-containing a first cell tag sequence (i.e., cell barcode) and a unique molecular identifier (i.e., unique molecular identifier, UMI)). The carrier / support is preferably a microbead. After droplet formation, the cells in the droplets lyse, releasing the mRNA, which then binds to the capture sequence on the microbead, thereby achieving mRNA capture. After mRNA enrichment in the droplets is typically completed, the mRNA enriched on all microbeads (which are already tagged with a complementary microbead tag sequence, allowing thousands of cells to be processed in the same batch) is combined for subsequent library construction. The mRNA library construction of 10xgenomics employs exactly the above principle, but its drawback is that the library construction mainly involves sequencing the 3' end of the mRNA, making it difficult to achieve library construction sequencing of the full length of the mRNA.

[0089] In the preferred embodiment of the present application, the step of capturing mRNA from a single cell using the droplet method is the same as in the above-described method. The process of reverse transcribing mRNA to obtain first-strand cDNA is also the same as in conventional methods, using a reverse transcriptase with terminal transferase activity to obtain first-strand full-length cDNA. The terminal transferase activity of the reverse transcriptase can add three Cs to the end of the first-strand full-length cDNA, and the terminal three rGrG+G residues of the TSO linker (see SEQ ID NO: 1 in Example 1 for an example) free in the droplet can be bound to the three Cs. A sequence complementary to the TSO linker is then synthesized downstream of the CCC end of the first-strand full-length cDNA (see the underlined sequence in SEQ ID NO: 1 in Example 1 for an example). Then, synthesis of the second-strand cDNA is completed using a TSO primer or TSO-random primer. The double-stranded cDNA thus obtained contains full-length cDNA as well as cDNA fragments of any length, and has a cDNA tag sequence attached to one end corresponding to the 3' end of the mRNA. As described above, the present application achieves the transfer of the cDNA tag sequence by circularizing one strand of such double-stranded cDNA (i.e., single-stranded cDNA with poly(A)), thereby obtaining non-full-length amplified fragments that label the 5' end of mRNA, and eventually full-length amplified fragments, and by constructing a library of these amplified fragments, it is possible to achieve 5'-end and / or full-length sequencing of mRNA.

[0090] Therefore, the first-strand cDNA can be randomly amplified or full-length amplified according to actual needs. To further improve the coverage of the 5'-end fragment and thus the full length of the mRNA in the amplified fragment, in a preferred embodiment of the present application, the first-strand cDNA is subjected to random amplification and / or full-length amplification to obtain double-stranded cDNA. In another preferred embodiment, the first-strand cDNA is amplified using at least one of a linker amplification primer (see, for example, SEQ ID NO: 2 in Example 1), a TSO primer (see, for example, SEQ ID NO: 3 in Example 1), and a TSO-random primer (see, for example, SEQ ID NO: 4 in Example 1) to obtain double-stranded cDNA.

[0091] Amplification using TSO-random primers can generate double-stranded cDNA fragments starting from any position on the 5' end, thereby encompassing as completely as possible all fragments of the mRNA sequence from the 5' to the 3' end. TSO primers can reliably generate full-length double-stranded cDNA fragments. Circularization of these unequal-length fragments results in single-stranded circular DNA molecules of uneven sizes. Amplification of all circular fragments yields amplified fragments that can label different positions on the 5' end of the mRNA. Constructing a library of these amplified fragments yields a sequencing library of fragments encompassing different positions on the 5' end and / or the full length of the mRNA.

[0092] The above step of circularizing single-stranded cDNA can be achieved by using existing circularization methods, such as the circularization method used in Hua Da Zhi circularization sequencing technology. In a preferred embodiment of the present application, the above step of circularizing single-stranded cDNA to obtain single-stranded circularized cDNA includes the steps of: ligating the single-stranded cDNA to form a loop under the action of a circularization auxiliary sequence and a ligase to obtain a ligated product; and enzymatically cleaving the ligated product to digest the unligated single-stranded DNA to form a loop (if the double-stranded DNA is directly circularized without being separated after melting, there may be uncircularized double-stranded DNA), thereby obtaining single-stranded circularized cDNA, where the circularization auxiliary sequence (see SEQ ID NO: 5 in Example 1 for an example) is complementary to the sequences at both ends of the single-stranded cDNA that form the loop (e.g., complementary to the second PCR linker in the cDNA tag sequence and complementary to the TSO primer, respectively).

[0093] In a more preferred embodiment, the double-stranded cDNA is first heat-denatured to melt the double-stranded cDNA into two single-stranded strands, and then, in the single-stranded state, a cyclization assisting sequence (rationally designed based on the terminal sequences of the single-stranded cDNA to be cyclized) is incubated with the single-stranded cDNA. The cyclization assisting sequence complements the terminal sequences of the single-stranded cDNA, thereby drawing the ends together, and then single-stranded cDNA is cyclized under the action of a ligase.

[0094] After obtaining single-stranded circularized cDNA, it can be amplified using a poly(A) primer and a random primer or a specific type of gene-specific primer (e.g., TCR / BCR primer) depending on the actual research purpose, thereby obtaining different amplified fragments labeled at the 5' end. This method converts the existing method of labeling the 3' end of mRNA into a method of labeling target fragments at the 5' end of mRNA through post-circularization amplification, thereby achieving 5' end sequencing and / or full-length sequencing of mRNA. This method is simple and compatible with the library construction steps of various existing sequencing platforms, helping to achieve high-throughput sequencing of the 5' end and / or full-length of mRNA from single cells.

[0095] In a preferred embodiment, a combination of at least one of (a) random primers, (b) TCR gene primers, and (c) BCR gene primers and a cDNA tag primer is used to amplify single-stranded circularized cDNA to obtain amplified fragments that meet different needs, and preferably, the cDNA tag primer is a poly(A) primer, more preferably SEQ ID NO: 6. As mentioned above, when studying the immune repertoire, primers for TCR and / or BCR genes are used to obtain the expression status of immune-related genes.

[0096] The above step of constructing a fragmentation library from the amplified fragments to obtain a single-cell RNA sequencing library can be performed using a conventional fragmentation library construction process. In a preferred embodiment of the present application, this step includes a step of adding a library linker to the amplified fragments to obtain an RNA sequencing library. The specific linker addition method can be selected based on the differences in different sequencing platforms, and an appropriate library linker and operation method can be selected to add the linker. In a preferred embodiment of the present application, this step includes a step of enzymatically fragmenting the amplified fragments to obtain the enzymatically cleaved fragments, and a step of sequentially performing end repair A addition and linker ligation on the enzymatically cleaved fragments to obtain a single-cell RNA sequencing library. More preferably, after end repair A addition and linker ligation, the method further includes amplifying the resulting linked fragments to obtain an RNA sequencing library that meets sequencing needs.

[0097] In the linker connection step, depending on the sequencing platform, a linker suitable for a specific sequencing platform can be rationally selected. For example, it may be a linker for the MGI sequencing platform or a linker for the Illumina sequencing platform. Correspondingly, the amplification primers used to amplify the linked fragments connected to the linker are also paired with the linker sequence of the corresponding platform. For example, when a linker for the MGI sequencing platform is used, the primers used to amplify the linked fragments are also amplification primers for the MGI sequencing platform.

[0098] A second exemplary embodiment of the present application further provides a single-cell RNA library construction kit, the kit including a circularization auxiliary sequence, a DNA ligase, a cDNA tag primer, and at least one of (a) a random primer, (b) a TCR gene primer, and (c) a BCR gene primer.

[0099] This kit is designed based on the reagents used in the circularization step and the amplification step of a specific fragment at the 5' end of a target gene on single-stranded circularized DNA or a random fragment starting at any position at the 5' end in the library construction method described above, and by including the reagents, library construction can be completed conveniently and quickly. Here, the circularization assist sequence binds complementarily to the TSO linker added corresponding to the 5' end of the mRNA and the tag sequence corresponding to the 3' end of the mRNA, respectively, and the specific sequence configuration will vary depending on the specific sequences on the tag sequence and TSO linker.

[0100] The DNA ligase in the kit primarily joins one phosphorylated base and one hydroxyl-containing base in a DNA strand, and any DNA ligase capable of achieving DNA joining is applicable to the present application. Specifically, it may be a thermolabile DNA ligase such as T4 DNA ligase, or a thermostable DNA ligase such as thermostable DNA ligase.

[0101] To facilitate library construction, in a preferred embodiment, the kit further includes a solid support, to which a support tag sequence is attached, wherein the cDNA tag primer is complementary to at least a portion of the support tag sequence, and preferably, the solid support is a microbead, and the support tag sequence is a microbead tag sequence. The solid support with the support tag sequence facilitates the capture of single-cell mRNA, while simultaneously allowing the mRNA to be tagged with a tag sequence complementary to the support tag sequence.

[0102] In the above kit, the microbeads with tag sequences (e.g., gel microbeads) can be purchased from existing microbeads or can be prepared by hand. The tag sequence on each microbead contains the following DNA sequences: (1) a PCR linker used for PCR amplification; (2) a cell barcode, where one microbead corresponds to one type of cell tag; (3) a unique molecular identifier (UMI), used to label different template molecules in the same cell and quantify the abundance of transcripts; and (4) a capture sequence, usually poly(dT), which captures mRNA by binding to the poly(A) tail of mRNA.

[0103] To further improve the convenience of the library construction, the kit preferably further comprises an RNA extraction reagent and / or an RNA reverse transcription reagent, and the RNA reverse transcription reagent comprises a reverse transcriptase, which is a reverse transcriptase having terminal transferase activity (for example, MGI Alpha reverse transcriptase, Invitrogen SuperScript (registered trademark) II reverse transcriptase, Thermo Maxima H Minus, Superscript IV, etc.).

[0104] Reagents related to droplet-based mRNA capture and reverse transcription can be used as a set, After poly(dT) binds to the poly(A) tail of mRNA to capture it, first-strand cDNA is synthesized under the action of reverse transcriptase. To facilitate second-strand synthesis, typical reverse transcription reagents include a TSO linker (e.g., as shown in SEQ ID NO: 1) in addition to reverse transcriptase. For example, a reverse transcriptase with terminal transferase activity is used to add CCC to the end of the first cDNA strand, and the rGrG+G on the TSO linker is used to complement CCC. The TSO linker sequence is then used as a template to add the complementary sequence of the TSO linker after CCC (i.e., the complementary sequence of TSO is attached to the end of the first cDNA strand).

[0105] This kit allows obtaining a sequence fragment from any position at the 5' end of the mRNA to the 3' end, thereby obtaining all fragments covering the full length of the mRNA from multiple fragments of heterogeneous sizes, thereby realizing 5' end sequencing or full length sequencing. Therefore, in a preferred embodiment of the present application, the kit further comprises a TSO primer, a TSO-random primer, and a linker amplification primer. Preferably, the sequence of the linker amplification primer is SEQ ID NO: 2, and the sequence of the TSO primer is SEQ ID NO: 3, TSO The random primer is SEQ ID NO: 4. The linker amplification primer can bind to the cDNA tag sequence at the 3' end of the second cDNA strand (corresponding to the 3' end of the mRNA), while the TSO-random primer can bind to any position at the 3' end of the first strand cDNA (corresponding to the 5' end of the mRNA), thereby obtaining cDNA fragments of heterogeneous sizes.

[0106] Preferably, the circularization auxiliary sequence is SEQ ID NO:5, and preferably, the cDNA tag primer is a poly(A) primer, more preferably SEQ ID NO:6.

[0107] In some preferred embodiments, the kit further includes at least one of an exonuclease and a library linker. Here, the exonuclease is used to degrade unsuccessfully circularized single-stranded or double-stranded cDNA after melting and circularizing the double-stranded cDNA into single strands, and may be, for example, exonuclease I or exonuclease III. The library construction linker may be a linker of the MGI sequencing platform (e.g., a double-stranded linker, one of which is a linear linker and the other is a bubble linker, where the linear linker is A + 31 bp sequence + 10 bp index sequence + 17 bp, and the bubble linker includes a 17 bp bubble sequence, 13 bp before the 17 bp bubble sequence, and 7 bp after the 17 bp bubble sequence + T, with a total linker length of 97 bp). Linkers for other sequencing platforms, such as linkers for Illumina sequencing platforms (e.g., Y-shaped P5 and P7 linkers, where library tag sequences may be attached to one or both of the P5 and P7 linkers as needed to facilitate the division of library generation data for subsequent sample mixture sequencing) may also be used.

[0108] A third exemplary embodiment of the present application further provides an RNA sequencing method, which includes constructing an RNA sequencing library using any of the above-described RNA sequencing library construction methods and sequencing the RNA sequencing library. The RNA sequencing library constructed using the above-described RNA sequencing library construction method can be a fragment encompassing more of the mRNA 5'-end or a fragment encompassing the full length of the mRNA, depending on the research purpose, thereby meeting the current market demand for 5'-end sequencing, such as the demand for 5'-end sequencing in constructing immune peptide libraries. Sequencing a full-length RNA sequencing library can fulfill research into the structural variation of alternative splicing of a certain transcript.

[0109] The 5'-end RNA sequencing and full-length sequencing can be performed simultaneously or separately, depending on the specific application scenario.

[0110] The technical effects of the present application will be further illustrated below with reference to specific examples.

[0111] The following examples include cell suspension preparation, microbead preparation, droplet generation, demixing, reverse transcription RT reaction, cDNA amplification, circular ligation, circular product amplification, fragmentation enzyme library construction, and high-throughput sequencing.

[0112] Example 1: Full-length RNA sequencing This example was prepared according to the principle flow shown in FIG. 2, specifically as follows.

[0113] 1. Single Cell Suspension Preparation 1.1 For cell lines and solid tissues, prepare single cell / cell nuclei suspensions using appropriate digestion / polishing methods, wash them once or twice with PBS (containing 0.04% BSA), and filter them through a 40 μm cell sieve.

[0114] 1.2 The concentration of cells / cell nuclei was detected using a cell counting plate or counter.

[0115] 1.3 Depending on the cell concentration, 100,000 cells / cell nuclei were aspirated and centrifuged at 300-500 g, 4°C, for 5 minutes to collect the cell pellet. 100 μL of cell resuspension buffer (0.04% BSA + PBS) was added to resuspend the cells / cell nuclei.

[0116] 2. Microbead Preparation 2.1 200 μL (220,000 beads) of magnetic beads were aspirated into a 0.2 mL PCR tube, placed on a magnetic rack, and left to stand for 2 minutes. The supernatant was then removed.

[0117] 2.2 Remove the PCR tube from the magnetic rack and add 200 μL of 1x Buffer D (1 mM EDTA, 9 mg / mL 85% KOH) to suspend the magnetic beads. Incubate at room temperature for 5 minutes.

[0118] 2.3 Place on a magnetic rack and let stand for 2 minutes, then remove the supernatant.

[0119] 2.4 Place the PCR tube on a magnetic rack, add 200 μL of 1x Buffer D, let stand for 30 s, and remove the supernatant.

[0120] 2.5 200 μL LSWB (50 mM TrTSO-HCl, 150 mM NaCl, 0.05% Tween-20) was added, the mixture was allowed to stand for 30 s, and the supernatant was removed. The previous step was repeated.

[0121] 2.6 200 μL of lysis buffer (Lysis Buffer: 6% Ficoll PM-400, 0.2% salbutamol, 20 mM EDTA, 200 mM Tris pH 7.5, HO) was added, the tube was left to stand for 30 s, and the supernatant was removed. The PCR tube was removed from the magnetic rack, and 100 μL of lysis buffer and 5 μL of 1 M DTT were added.

[0122] 3 Droplet generation 3.1 Chip (see Figure 1) The surface protection film was peeled off and the chip was placed in the chip groove area of ​​a droplet generator (10x Genomics).

[0123] 3.2 The end A of the connecting tube on the collection lid (the connecting tube that contacts the bottom of the collection tube) was inserted into the outlet hole of the chip.

[0124] 3.3 Place a 50 mL syringe on the fixed rack and adjust the push rod to the initial position. Use a flat-nosed needle to connect the syringe to end B of the connecting tube on the lid of the collection tube (the connecting tube that does not touch the bottom of the collection tube).

[0125] 3.4 200 μL droplet generation oil was added to the collection tube, the collection lid was tightened, and the collection tube was placed vertically in a stationary rack.

[0126] 3.5 Gently mix the cells using a pipette and add 100 μL of the cell suspension prepared in step 1.3 to the cell hole of the chip, ensuring that the tip of the pipette touches the bottom of the hole.

[0127] 3.6 Gently mix the magnetic beads using a pipette and add 100 μL of magnetic beads to the microbead hole on the chip, ensuring that the tip of the pipette touches the bottom of the hole.

[0128] 3.7 Immediately, 350 μL of droplet-generating oil was added to the chip oil hole.

[0129] 3.8 Quickly pull the syringe push rod into the locking slot to engage the push rod with the locking slot.

[0130] 3.9 A timer was started to measure 20 minutes and droplets were collected.

[0131] 3.10 After 20 minutes, the collection lid on the collection tube was immediately loosened, the connecting tube of the chip outlet hole was pulled out, the connecting tube was extended vertically, and the droplets in the tube were allowed to flow into the collection tube, and the collection tube lid was then replaced with a normal one.

[0132] 3.11 The mixture was left to stand at room temperature for 20 minutes to allow the mRNA molecules to fully bind to the magnetic beads.

[0133] 4 Milking 4.1 Prepare the demulsifying reagent by adding 10 mL 6X SSC (20X SSC, Invitrogen, diluted to 6x with enzyme-free water) and 200 μL PFO (Perfluorooctanol, Sigma, 370533-25G) to a 15 mL centrifuge tube.

[0134] 4.2 Connect the filtration device to the vacuum pump, adjust the pressure parameter to 0.01 MPa or 100 mbar, and start the vacuum pump.

[0135] 4.3 20 mL of 6X SSC was added to pretreat the device.

[0136] 4.4 When no liquid remained on the filter membrane, pour all the liquid in the collection tube evenly onto the surface of the filter membrane, and wash the collection tube twice with 2 mL of 6X SSC, then pour the washings into the filter device all at once.

[0137] 4.5 10 mL of demulsifying reagent was mixed uniformly by inverting it vigorously, and then poured slowly into the filter in portions.

[0138] 4.6 Once no liquid remained on the filter membrane, 30 mL of 6X SSC was added in succession to wash the magnetic beads in batches.

[0139] 4.7 Once no liquid remained on the filter membrane, the vacuum pump was closed and the connection between the vacuum pump and the filter was disconnected.

[0140] 4.8 The filtration port of the filtration device was blocked with a syringe or rubber stopper.

[0141] 4.9 1.0 mL of collection buffer was added using a pipette and gently blown over the entire surface of the filter membrane approximately 20 times to suspend the magnetic beads.

[0142] 4.10 The collection fluid containing the magnetic beads was transferred to a 1.5 mL low-binding centrifuge tube.

[0143] 4.11 The entire surface of the filtration membrane was gently sprayed approximately 10 times with an additional 1.0 mL of collection buffer to suspend the remaining magnetic beads.

[0144] 4.12 The collected solution containing the magnetic beads was transferred to a 1.5 mL low-adsorption centrifuge tube, placed on a magnetic rack, and left to stand for 2 minutes, after which the supernatant was slowly removed.

[0145] 4.13 Remove the centrifuge tubes from the magnetic rack and suspend the magnetic beads adsorbed to one side of each of the two centrifuge tubes in 100 μL of collection buffer, then transfer the liquid to a 0.2 mL low-adsorption PCR tube.

[0146] 4.14 Again, 100 μL of collection buffer was used to suspend the magnetic beads adsorbed to one side of the two centrifuge tubes in turn, and the liquid was transferred to the above 0.2 mL low-adsorption PCR tube.

[0147] 4.15 The PCR tube containing the magnetic beads was placed on a magnetic rack and left to stand for 2 minutes, after which the supernatant was removed.

[0148] 4.16 While maintaining the magnetic bead adsorption state, 200 μL of 6× SSC was added, left to stand for 30 s, and the supernatant was removed.

[0149] 4.17 200 μL of 5× FS Buffer (MGI, 01E022MS) was added, and the mixture was left to stand for 30 s. The supernatant was then slowly removed while avoiding aspirating the magnetic beads.

[0150] 5. Reverse transcription reaction 5.1 Prepare the reverse transcription reaction system on ice: 5 μL HO, 20 μL 5x FS Buffer (First-Strand Buffer), 20 μL 5 M Betaine, 10 μL 10 mM dNTPs, 7.5 μL 100 mM MgCl, 5 μL 50 μM Template Switch Oligo (TSO Linker), 5 μL 100 mM DTT, 5 μL 200 U / μL SuperScript® II Reverse Transcriptase (Invitrogen, 18064014), 2.5 μL 40 U / μL RNase inhibitor.

[0151] TSO linker sequence: SEQ ID NO: 1: 5'- AAGCAGTGGTATCAACGCAGAGTACAT The structure is rGrG+G-3′, where +G represents the strand nucleotide. The reason for adopting rGrG+G is that it provides better thermal stability for RNA-DNA hybridization.

[0152] 5.2 Aspirate 100 μL of the reverse transcription reaction mixture and add it to the PCR tube containing the magnetic beads from step 4.17, then mix by blowing.

[0153] 5.3 The reverse transcription reaction was carried out under the following conditions: 42°C, 90 min; 10 cycles (50°C, 2 min; 42°C, 2 min). The lid temperature was set to 75°C. Because the magnetic beads tended to settle, the beads were gently flicked and mixed every 20 min, and the reaction was continued after a short centrifugation.

[0154] 5.4 After the reaction was completed, the mixture was centrifuged briefly, placed on a magnetic rack, and left to stand for 2 minutes, after which the reaction mixture was removed.

[0155] 5.5 Remove the PCR tube from the magnetic rack, add 200 μL of TE-SDS (TE Buffer + 0.5% SDS), shake to mix evenly, and terminate the reaction.

[0156] 5.6 After a brief centrifugation, the tube was placed on a magnetic rack and allowed to stand for 2 minutes, after which the liquid was removed.

[0157] 5.7 While maintaining the magnetic bead adsorption state, 200 μL of TE-TW (TE Buffer + 0.01% Tween-20) was added, the mixture was left to stand for 30 seconds, and the supernatant was removed.

[0158] 5.8 The above steps were repeated.

[0159] 5.9 The magnetic beads were retained, and 200 μL of 10 mM NF-H2O was added. The mixture was left to stand for 30 seconds, and the supernatant was removed.

[0160] 6. First-strand cDNA Random Primer Amplification 6.1 Prepare PCR reaction system: 42 μL H2O, 4 μL 10 μM Tn primer (i.e., linker amplification primer), 2 μL 20 μM TSO-random primer, 2 μL 20 μM TSO primer, and 50 μL 2x KAPA HiFi Hotstart Ready mix (KAPA:KK2602).

[0161] Here, a Tn primer (i.e., a linker amplification primer) is used to initiate amplification from one end connected to the magnetic bead, and its specific sequence is: SEQ ID NO: 2: 5'-CGTAGCCATGTCGTTCTG-3', The TSO primer is used to initiate amplification from one end of the TSO linker, and its specific sequence is: SEQ ID NO: 3: 5'Phos-AAGCAGTGGTATCAACGCAGAGTACAT-3', The TSO-random primer is used to amplify cDNA from any position at the 5' end toward the 3' end, and its specific sequence is: SEQ ID NO: 4: 5'phos-AAGCAGTGGTATCAACGCAGAGTACATNNNNNN-3'.

[0162] 6.2 PCR reaction was carried out according to the following conditions: 95°C, 3 min; 10-15 cycles (98°C, 20 s; 58°C, 20 s; 72°C, 3 min); 72°C, 5 min; 4°C, hold.

[0163] 6.3 After PCR was completed, the PCR product was purified and recovered using 120 μL (1.2x) VAHTS™ DNA Clean Beads (VAZYME: N411-03) (pre-equilibrated at room temperature for 30 minutes).

[0164] The PCR purified products were quantified using a 6.4 Qubit fluorometer and the fragment distribution was detected using an Agilent 2100 bioanalyzer (see Figures 4A and 4B for cell line samples and solid tissue samples, respectively).

[0165] 7. DNA Circularization 7.1 Take 100-200 ng of the above cDNA product, fill the volume to 45 μL with NF-HO, add 5 μL of splint oligo 1 (20 μM), vortex briefly to mix evenly, centrifuge for 5 s, incubate at 95°C for 3 minutes (heat the oven to 105°C to melt the dsDNA into single strands for single-strand circularization), and immediately place on ice for 5-10 minutes.

[0166] Here, the specific sequence of splint oligo 1 (cyclization auxiliary sequence) is: SEQ ID NO: 5: 5'-TACCACTGCTTCGTAGCCATGT-3'.

[0167] 7.2 Connection: The PCR tube was placed in an ice bath and the reaction system was prepared according to the following table. [Table 1]

[0168] The prepared ligation product was added to the melted product, briefly vortexed to mix evenly, briefly centrifuged, and the PCR tube was placed in a PCR machine and incubated at 37°C for 45 min, with a hot lid temperature of 75°C.

[0169] 7.3 Enzyme cleavage digestion: When the single-stranded circularization reaction was about to be completed, an enzyme cleavage digestion reaction solution was prepared on ice in advance according to the following table. [Table 2]

[0170] Using a pipette, 4 μL of the prepared enzyme cleavage digestion reaction solution (used to digest uncyclized single strands and optionally unmelted double strands) was aspirated and added to the single-stranded circularized product, vortexed briefly to mix uniformly, centrifuged briefly, and the PCR tube was placed in a PCR machine and incubated at 37°C for 30 min with a hot lid temperature of 75°C.

[0171] 7.4 End of enzyme digestion: After the enzyme digestion reaction was completed, 3 μL of stop solution (0.1 M EDTA) was added to the PCR tube, mixed evenly, and centrifuged briefly to collect the liquid at the bottom of the tube.

[0172] 7.5 cDNA circularized library purification: Purify the circularized products obtained in step 7.4 using PEG32 magnetic beads and quantify the purified cDNA circularized products using a Qubit fluorometer in preparation for subsequent amplification.

[0173] 8. cDNA Random Primer PCR Amplification 8.1 Initially, 10-50 ng of circularized DNA product was taken, and the volume was supplemented with NF-HO to 42 μL. 4 μL of 20 μM poly(A) primer, 4 μL of random primer (SEQ ID NO: 12: 5'-NNNNNN-3'), and 50 μL of 2x KAPA HiFi Hotstart Ready mix were added. These primers allow amplification of fragments of different lengths from circularized products of different sizes, thereby covering the full-length sequence of the cDNA as much as possible.

[0174] The specific sequence of the poly(A) primer is: SEQ ID NO: 6: 5'phos-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3'.

[0175] 8.2 PCR reaction was carried out according to the following conditions: 95°C, 3 min; 10-15 cycles (98°C, 20 s; 60°C, 20 s; 72°C, 30 s); 72°C, 5 min; 4°C, hold.

[0176] 8.3 PCR products were purified using 0.5x + 0.7x VAHTS™ DNA Clean Beads magnetic beads, and the screened fragments (150-800 bp in length) were quantified using Qubit and the fragment distribution was detected using an Agilent 2100 Bioanalyzer (see Figures 6A and 6B for cell line and solid tissue samples, respectively).

[0177] 9. cDNA Library Construction 9.1 DNA Fragmentation: Depending on the cDNA concentration obtained in step 8.3, take 100–200 ng (approximately 0.1–0.2 pmol) of the target cDNA for cleavage into a new 0.2 mL PCR tube so that the volume is ≤16 µL. Refill any portion less than 16 µL with HO. Prepare the fragmentation reaction solution on ice according to the table below. [Table 3]

[0178] The PCR tube was placed in a PCR device, the hot lid was heated to 75°C, and the mixture was incubated at 37°C for 10 minutes. After the reaction was completed, 30 μL of 0.1 M EDTA was added to the PCR tube and mixed uniformly by vortexing to terminate the reaction.

[0179] 9.2 Purification of fragmented products: The above-mentioned fragmented DNA products were purified and screened using 0.6x + 0.2x VAHTS™ DNA Clean Beads magnetic beads (retaining fragments of 300-500 bp), and the concentration was quantified using a Qubit fluorometer.

[0180] 9.3 Prepare the end-repair reaction on ice according to the following table: [Table 4]

[0181] Using a pipette, 10 μL of the prepared end-repair reaction solution was aspirated and added to the purified fragmentation product from step 9.2, vortexed briefly to mix uniformly, centrifuged briefly, and the PCR tube was placed in a PCR machine and incubated at 37°C for 30 min, 65°C for 15 min, and 4°C.

[0182] 9.4 Library Linker Connection Prepare the linker ligation reaction mixture on ice according to the following table: [Table 5]

[0183] The specific sequence of the library linker is: SEQ ID NO: 7: 5'-Phos-AGTCGGAGGCCAAGCGGTCTTAGGAAGACAA-3', Sequence number 8: 3'-TTCAGCCTCCGGT-5'.

[0184] Using a pipette, 30 μL of the prepared linker ligation reaction solution was slowly aspirated and added to the end-repaired product, mixed uniformly by vortexing, and then centrifuged briefly to collect the reaction solution at the bottom of the tube. The PCR tube was then placed in a PCR machine and maintained at 23°C for 30 min at 4°C.

[0185] 9.5 Purification of ligated products: Purification was performed using 1.0x VAHTS™ DNA Clean Beads magnetic beads, and concentration measurements were performed on the ligated products using a Qubit fluorometer.

[0186] 9.6 PCR amplification of linker ligation products Specific sequences of primers for amplifying linker ligation products are: FP: 5'-phos-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3' (SEQ ID NO: 9), RP: 5'-TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCT-3' (SEQ ID NO: 10), NNNNNNNNNN is the tag sequence, and N represents any of A, T, C, or G, which is used to distinguish different libraries. A PCR reaction mixture was prepared in a centrifuge tube according to the following table. [Table 6]

[0187] Using a pipette, aspirate 54 μL of the prepared PCR reaction mixture and add it to the purified ligated product. Mix thoroughly by vortexing, then centrifuge the tube to collect the reaction mixture at the bottom. Then perform PCR amplification: 95°C, 3 min; 10–15 cycles (98°C, 20 s; 60°C, 20 s; 72°C, 30 s); 72°C, 5 min; maintain at 4°C.

[0188] 9.7 PCR amplification product fragment screening: (0.6x + 0.6x) Purification was performed using VAHTS™ DNA Clean Beads magnetic beads, and product quantification was performed using Qubit.

[0189] 10 High-Throughput Sequencing 10.1 Denaturation: Take 200-400ng of the above cDNA product, add NF-H2O to the volume of 47µL, add 3µL of splint oligo 2 (20µM), vortex briefly to mix evenly, centrifuge for 5s, incubate at 95°C for 3 minutes (heat lid 105°C), and immediately place on ice for 5-10 minutes. (splint oligo 2:5'-TTTTTTTTTT TGTGAGCCAAG -3') (SEQ ID NO: 11, the underlined sequence is the same as the first 11 positions of the FP sequence in SEQ ID NO: 10).

[0190] 10.2 Connection: The PCR tube was placed in an ice bath and the reaction system was prepared according to the following table. [Table 7]

[0191] The prepared ligation product was added to the melted product, briefly vortexed to mix evenly, briefly centrifuged, and the PCR tube was placed in a PCR machine and incubated at 37°C for 30 min with a hot lid temperature of 75°C.

[0192] 10.3 Enzyme cleavage digestion: When the single-stranded circularization reaction was about to be completed, an enzyme cleavage digestion reaction solution was prepared on ice in advance according to the following table. [Table 8]

[0193] Using a pipette, 4 μL of the prepared enzyme digestion reaction solution was aspirated and added to the single-stranded circularized product, vortexed briefly to mix uniformly, and then centrifuged briefly. The PCR tube was placed in a PCR machine and incubated at 37°C for 30 min with the hot lid temperature set to 75°C.

[0194] 10.4 End of enzyme digestion: After the enzyme digestion reaction is complete, add 3 μL of stop solution (0.1 M EDTA) to the PCR tube, vortex to mix evenly, and briefly centrifuge to collect the liquid at the bottom of the tube. 10.5 Cyclization library purification: Cyclization products were purified using PEG32 magnetic beads, and the purified products were quantified using a Qubit fluorometer. A library mass of >0.5 ng / μL was required to pass library detection, and sequencing was performed using an MGISEQ2000 high-throughput sequencer.

[0195] (Example 2) 5'-end RNA single-cell sequencing This example was prepared according to the principle flow shown in FIG. 2, specifically as follows.

[0196] (1) Single-cell mRNA capture and first-strand cDNA synthesis The steps are identical to the previous full-length RNA sequencing steps.

[0197] (2) The steps of cDNA amplification are as follows: 1. Prepare a PCR reaction system: 42 μL H2O, 4 μL 10 μM Tn primer (i.e., the linker amplification primer SEQ ID NO: 2), 4 μL TSO primer (i.e., the linker amplification primer SEQ ID NO: 4), and 50 μL 2x KAPA HiFi Hotstart Ready mix.

[0198] 2 PCR reaction was carried out under the following conditions: 95°C, 3 min; 13 to 20 cycles (98°C, 20 s; 58°C, 20 s; 72°C, 3 min); 72°C, 5 min; 4°C, maintain.

[0199] 3 After PCR was completed, the PCR product was purified and recovered using 60 μl (0.6×) VAHTS™ DNA Clean Beads (pre-equilibrated at room temperature for 30 minutes).

[0200] The PCR purified products were quantified using a 4 Qubit fluorometer and the fragment distribution was detected using an Agilent 2100 bioanalyzer (see Figures 5A and 5B for cell line samples and solid tissue samples, respectively).

[0201] (3) cDNA circularization The circularization process is the same as the full-length RNA sequencing step described above.

[0202] (4) 5' RNA amplification 1. Initially, 10-50 ng of circularized DNA product was taken and the volume was supplemented with NF-H2O to 42 μl. 4 μL of 20 μM poly(A) primer (SEQ ID NO: 6: 5'-phos-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3'), 4 μL of 20 μM TCR / BCR primer (10x Genomics V(D)J sequences: PN-1000005, PN-1000016) or random primer (5'-NNNNNN-3'), and 50 μL of 2x KAPA HiFi Hotstart Ready mix were added.

[0203] 2 PCR reaction was carried out under the following conditions: 95°C, 3 min; 13 to 20 cycles (98°C, 20 s; 60°C, 20 s; 72°C, 30 s); 72°C, 5 min; 4°C, maintain.

[0204] PCR product purification was performed using 3 0.5x + 1.0x VAHTS™ DNA Clean Beads magnetic beads, and the screened fragments were quantified using Qubit and the distribution of the fragments was detected using an Agilent 2100 bioanalyzer (see Figures 7A and 7B for cell line samples and solid tissue samples, respectively, where Figure 7A shows the 2100 detection results for TCR-specific primer amplification and Figure 7B shows the 2100 detection results for BCR-specific primer amplification).

[0205] (5) cDNA 5' library construction (the subsequent steps are the same as in Example 1, and the explanation is omitted). Detection and Verification: The library constructed in Example 2 was sequenced using an MGI sequencing platform sequencing instrument, and the coverage of the transcripts based on the 5'-end and 3'-end sequencing fragments from the offline data was analyzed. The specific results are shown in Figure 8. Here, shallow gradation corresponds to the coverage of the 5'-end, and deep gradation corresponds to the coverage of the 3'-end. As can be seen from Figure 8, the method of the present invention can effectively capture information on the 5'-end and 3'-end of the transcript.

[0206] The above description is merely a preferred embodiment of the present invention, and is not intended to limit the present invention. Various modifications and variations are possible by those skilled in the art. Any modifications, equivalents, improvements, etc. made within the scope of the spirit and principles of the present invention are included in the protection scope of the present invention.

Claims

1. A method for constructing an RNA sequencing library, comprising: obtaining a single-stranded cDNA, which is a reverse transcription product of mRNA, the single-stranded cDNA containing a cDNA tag sequence at the 3' end; circularizing the single-stranded cDNA to obtain a single-stranded circularized cDNA; amplifying the single-stranded circularized cDNA using a primer combination to obtain an amplified fragment, the primer combination being selected from 1) a primer combination consisting of a random primer and a cDNA tag primer, or 2) a primer combination consisting of a gene-specific primer and a cDNA tag primer, and the cDNA tag primer is at least a part of the cDNA tag sequence; performing fragmentation library construction on the amplified fragments to obtain the RNA sequencing library; A method for constructing an RNA sequencing library, wherein the cDNA tag sequence contains poly(A).

2. The step of obtaining a single-stranded cDNA, which is a reverse transcription product of mRNA, and which contains a cDNA tag sequence at the 3' end of the single-stranded cDNA, comprises: reverse transcribing the mRNA to obtain first strand cDNA; a step of amplifying the first strand cDNA to obtain a double-stranded cDNA, wherein the second strand cDNA complementary to the first strand cDNA contains the cDNA tag sequence at its 3' end, and the cDNA tag sequence contains the poly(A); and a step of melting the double-stranded cDNA to obtain the single-stranded cDNA.

3. the mRNA is captured by a tag sequence attached to a solid support; the tag sequence attached to the solid support comprises, in the 5' to 3' direction, a first PCR linker, a first cell tag, a first unique molecular label, and an oligo(dT); The method of claim 2, wherein the cDNA tag sequence comprises, in the 3' to 5' direction, a second PCR linker, a second cell tag, a second unique molecular tag, and the poly(A).

4. 2. The method of claim 1, wherein the mRNA is derived from a single cell sample and the mRNA is single cell mRNA.

5. The method of claim 4, wherein the single-cell mRNA is prepared using a droplet method so that the single-cell mRNA is attached to a solid support.

6. the solid support is a microbead; preparing the single-cell mRNA using a droplet method so that the single-cell mRNA is attached to the microbeads, providing a single cell suspension and the microbeads, respectively, wherein the microbeads are tagged with a microbead tag sequence, the microbead tag sequence comprising poly(dT) at the end thereof; The method of claim 5, further comprising the steps of: encapsulating the single cell suspension and the microbeads into droplets, each droplet containing one single cell and one microbead; connecting the mRNA in the single cell suspension to the microbeads by binding the microbeads to poly(A) of the mRNA in the single cell suspension via poly(dT), thereby obtaining the single cell mRNA.

7. The construction method described in claim 6, characterized in that the microbead tag sequence sequentially comprises, from 5' to 3', a first PCR linker, a first cell tag, a first unique molecular label, and the poly(dT), and correspondingly, the cDNA tag sequence sequentially comprises, from 3' to 5', a second PCR linker, a second cell tag, a second unique molecular label, and poly(A), wherein the second PCR linker is complementary to the first PCR linker, the second cell tag is complementary to the first cell tag, and the second unique molecular label is complementary to the first unique molecular label.

8. The method for constructing a cDNA according to claim 2, wherein the cDNA contains a sequence of a TSO primer at the 5' end of the single-stranded cDNA.

9. obtaining the first strand cDNA by reverse transcribing the mRNA using a reverse transcriptase and a TSO linker, wherein the reverse transcriptase has terminal transferase activity and the first strand cDNA contains a complementary sequence of the TSO linker at the 3' end; 9. The method of claim 8, wherein the first strand cDNA is amplified to obtain the second strand cDNA, and the second strand cDNA contains the sequence of the TSO primer at its 5' end.

10. The method of claim 9, wherein the sequence of the TSO linker is SEQ ID NO:

1.

11. 10. The method of claim 9, wherein the reverse transcriptase is selected from MGI Alpha Reverse Transcriptase, Invitrogen SuperScript II Reverse Transcriptase, Thermo Superscript IV, or Maxima H Minus.

12. 3. The method according to claim 2, wherein the first strand cDNA is subjected to random amplification and / or full-length amplification to obtain the double-stranded cDNA.

13. amplifying the first strand cDNA using a linker amplification primer and a TSO primer to obtain the double stranded cDNA; or The method of claim 12, wherein the first strand cDNA is amplified using a linker amplification primer, a TSO-random primer and the TSO primer to obtain the double-stranded cDNA.

14. The method of claim 13, wherein the sequence of the linker amplification primer is SEQ ID NO: 2, the sequence of the TSO primer is SEQ ID NO: 3, and the sequence of the TSO-random primer is SEQ ID NO:

4.

15. The step of circularizing the single-stranded cDNA to obtain a single-stranded circularized cDNA comprises: ligating the single-stranded cDNA to form a loop under the action of a circularization auxiliary sequence and a ligase to obtain a ligation product; digesting the unligated single-stranded cDNA to enzymatically cleave the ligated product into a loop, thereby obtaining the single-stranded circularized cDNA; 15. The method of claim 1, wherein the cyclization auxiliary sequence is complementary to sequences at both ends of the single-stranded cDNA.

16. The method of claim 15, wherein the cyclization auxiliary sequence is selected from SEQ ID NO:

5.

17. The method of claim 1, wherein the gene-specific primers are TCR primers for TCR gene amplification and / or BCR primers for BCR gene amplification.

18. The method of claim 1, wherein the cDNA tag primer is a poly(A) primer.

19. The method of claim 18, wherein the cDNA tag primer is SEQ ID NO:

6.

20. The step of constructing a fragmentation library for the amplified fragments to obtain the RNA sequencing library includes: The method of claim 1, further comprising the step of adding a library linker to the amplified fragment to obtain the RNA sequencing library.

21. The amplified fragment is subjected to enzymatic cleavage fragmentation to obtain an enzymatic cleavage fragment; The construction method according to claim 20, wherein the enzyme-cleaved fragments are sequentially subjected to end repair, A addition, and library linker ligation to obtain the RNA sequencing library.

22. The construction method according to claim 20 or 21, further comprising, after linking the library linker, performing PCR amplification on the library linker linkage product to obtain the RNA sequencing library.

23. The construction method of claim 20, wherein the library linker is a linker for the MGI sequencing platform or a linker for the Illumina sequencing platform.

24. a circularization auxiliary sequence, a DNA ligase, a cDNA tag primer, and at least one of (a) a random primer, (b) a TCR primer, and (c) a BCR primer; A kit for constructing an RNA library using the method for constructing an RNA sequencing library described in any one of claims 1 to 23, further comprising a solid support, wherein a support tag sequence is provided on the solid support, and wherein the cDNA tag primer is complementary to at least a portion of the support tag sequence, and the support tag sequence includes poly(dT).

25. 25. The kit of claim 24, wherein the kit further comprises an RNA reverse transcription reagent.

26. 26. The kit of claim 25, wherein the RNA reverse transcription reagent comprises a reverse transcriptase that is a reverse transcriptase with terminal transferase activity.

27. 27. The kit of claim 26, wherein the reverse transcriptase is selected from MGI Alpha Reverse Transcriptase, Invitrogen SuperScript II Reverse Transcriptase, Thermo Superscript IV, or Maxima H Minus.

28. 27. The kit of claim 26, wherein the RNA reverse transcription reagent further comprises a TSO linker.

29. 29. The kit of claim 28, wherein the sequence of the TSO linker is SEQ ID NO:

1.

30. 25. The kit of claim 24, further comprising a TSO primer and a linker amplification primer.

31. 31. The kit of claim 30, wherein the sequence of the linker amplification primer is SEQ ID NO:2 and the sequence of the TSO primer is SEQ ID NO:

3.

32. The kit of claim 30, further comprising a TSO-random primer.

33. The kit of claim 32, wherein the sequence of the TSO-random primer is SEQ ID NO:

4.

34. 25. The kit of claim 24, wherein the cyclization auxiliary sequence is SEQ ID NO:

5.

35. 25. The kit of claim 24, wherein the cDNA tag primer is a poly(A) primer.

36. 36. The kit of claim 35, wherein the sequence of the cDNA tag primer is SEQ ID NO:

6.

37. 25. The kit of claim 24, wherein the kit further comprises at least one of an exonuclease and a library linker.

38. 38. The kit of claim 37, wherein the exonuclease is selected from exonuclease I or exonuclease III.

39. 38. The kit of claim 37, wherein the library linker is a linker for an MGI sequencing platform or a linker for an Illumina sequencing platform.

40. 40. The kit of claim 39, wherein the linker of the MGI sequencing platform is selected from bubble linkers and the linker of the Illumina sequencing platform is selected from P5 and P7 linkers.

41. 25. The kit of claim 24, wherein the DNA ligase is selected from T4 DNA ligase.

42. 25. The kit of claim 24, wherein the solid support is a microbead and the support tag sequence is a microbead tag sequence.

43. 43. The kit of claim 42, wherein the support tag sequence comprises, in the 5' to 3' direction, a first PCR linker, a first cell tag, a first unique molecular label, and poly(dT).

44. A method for sequencing an RNA library, comprising the steps of constructing an RNA sequencing library using the RNA sequencing library construction method described in any one of claims 1 to 23, and sequencing the RNA sequencing library.

Images