One-step RT-PCR reaction composition / kit

Abstract

To provide a two-enzyme one-step RT-PCR technique that is excellent in detection sensitivity and can employ reaction buffers with more diverse compositions.SOLUTION: Provided is a composition / kit comprising: a reverse transcriptase containing a mutant amino acid sequence A1 including mutations of E264X1, E280X2, L413X3, and D502A on a specific amino acid sequence A (X1, X2, and X3 each represent a basic amino acid); and a DNA-dependent DNA polymerase containing an amino acid sequence B represented in a specific amino acid sequence or an amino acid sequence B1 having 80% or more identity with the amino acid sequence B.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a composition / kit for one-step RT-PCR reaction. [Background technology]

[0002] SARS-CoV-2, the RNA virus that causes COVID-19, has spread globally, causing significant damage to healthcare and the economy. Nucleic acid detection and antigen detection are the primary methods for virus identification to confirm infection. Reverse transcription-PCR (RT-PCR) is a highly sensitive and widely used tool for detecting RNA viruses, including SARS-CoV-2 RNA. RT-PCR detection typically involves two steps: cDNA synthesis using reverse transcriptase and DNA amplification using DNA polymerase. One-step RT-PCR involves these two steps sequentially in the same tube. One-step RT-PCR involves reverse transcription and PCR sequentially in the same tube, simplifying the procedure and reducing the risk of contamination. One-step RT-PCR can be divided into two types: single-enzyme RT-PCR, which uses a DNA polymerase with reverse transcription activity, and two-enzyme RT-PCR, which uses both reverse transcriptase and DNA polymerase. Two-enzyme one-step RT-PCR is more sensitive than single-enzyme one-step RT-PCR because the reverse transcription efficiency of reverse transcriptase is higher than that of DNA polymerase. However, it has been reported that the reverse transcriptase and DNA polymerase interfere with each other, reducing detection sensitivity. Since two or more enzymes must work in the same buffer, adjusting the reaction buffer is essential.

[0003] Patent Document 1 discloses a technique for preventing a decrease in nucleic acid amplification efficiency by using a DNA polymerase belonging to family B. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] International Publication No. 2018 / 151246 [Patent Document 2] Japanese Patent Application Laid-Open No. 2016-136970 Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide a two-enzyme one-step RT-PCR technique that has excellent detection sensitivity and can employ reaction buffers with a wider variety of compositions. [Means for solving the problem]

[0006] In view of the above problems, the present inventors have conducted extensive research and have found that E264X is a nucleotide sequence corresponding to the amino acid sequence A shown in SEQ ID NO: 1. 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 The inventors have found that the above-mentioned problems can be solved by employing a combination of a reverse transcriptase containing a mutant amino acid sequence A1 including the amino acid sequence A1 and the amino acid sequence B shown in SEQ ID NO: 3, or a DNA-dependent DNA polymerase containing an amino acid sequence B1 having 80% or more identity to the amino acid sequence B. Based on this finding, the inventors have conducted further research and have completed the present invention. That is, the present invention encompasses the following aspects.

[0007] Item 1. E264X for the amino acid sequence A shown in SEQ ID NO: 1 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 and a DNA-dependent DNA polymerase having an amino acid sequence B having 80% or more identity to the amino acid sequence B shown in SEQ ID NO: 3.

[0008] Section 2. Said X 1 and X 3 is arginine and X 2 Item 1. The composition according to Item 1, wherein is lysine.

[0009] Item 3. The composition according to Item 1 or 2, wherein the mutant amino acid sequence A1 is the amino acid sequence A11 shown in SEQ ID NO: 2 or the amino acid sequence A12 having 80% or more identity to the amino acid sequence A11.

[0010] Item 4. The composition according to Item 3, wherein the identity of the mutant amino acid sequence A12 is 90% or more.

[0011] Item 5. The composition according to any one of Items 1 to 4, wherein the amino acid sequence B1 is the amino acid sequence of Thermus thermophilus DNA polymerase I.

[0012] Item 6. The composition according to any one of Items 1 to 5, wherein the identity of the amino acid sequence B1 is 90% or more.

[0013] Item 7. The composition according to any one of Items 1 to 6, which is a composition for PCR reaction.

[0014] Item 8. The composition according to any one of Items 1 to 7, which is a composition for one-step RT-PCR reaction.

[0015] Item 9. The composition according to any one of Items 1 to 8, which is used for detecting nucleic acids.

[0016] Item 10. The composition according to Item 9, wherein the nucleic acid is derived from a virus, bacteria, or fungus.

[0017] Item 11. The composition according to any one of Items 1 to 9, wherein the content of the manganese salt as the divalent cation source is 50 mol % or less relative to 100 mol % of the divalent cation source, and / or the composition contains a bicine buffer as a buffer.

[0018] Item 12. The composition according to item 11, wherein the content of the manganese salt as the divalent cation source is 10 mol % or less relative to 100 mol % of the divalent cation source, and the composition contains a Bicine buffer as a buffer.

[0019] Item 13. E264X for the amino acid sequence A shown in SEQ ID NO: 1 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 and a DNA-dependent DNA polymerase comprising an amino acid sequence B shown in SEQ ID NO: 3 or an amino acid sequence B1 having 80% or more identity to said amino acid sequence B. [Effects of the Invention]

[0020] According to the present invention, it is possible to provide a two-enzyme one-step RT-PCR technique that has excellent detection sensitivity and can employ reaction buffers with a wider variety of compositions. [Brief explanation of the drawings]

[0021] [Figure 1] This shows the results of the one-step RT-PCR test in Test Example 2-1 when Buffer 1 was used. The vertical axis indicates signal intensity, and the horizontal axis indicates the number of PCR cycles. [Figure 2] This shows the results of the one-step RT-PCR test in Test Example 2-1 when Buffer 2 was used. The vertical axis indicates signal intensity, and the horizontal axis indicates the number of PCR cycles. [Figure 3] This shows the results of the one-step RT-PCR test in Test Example 2-1 when Buffer 3 was used. The vertical axis indicates signal intensity, and the horizontal axis indicates the number of PCR cycles. [Figure 4] This shows the results of the one-step RT-PCR test in Test Example 2-1 when Buffer 4 was used. The vertical axis indicates signal intensity, and the horizontal axis indicates the number of PCR cycles. [Figure 5] This shows the results of the one-step RT-PCR test in Test Example 2-1 when Buffer 5 was used. The vertical axis indicates signal intensity, and the horizontal axis indicates the number of PCR cycles. [Figure 6] 1 shows the results of a one-step RT-PCR test in which the reverse transcription reaction time was examined in Test Example 2-2. The vertical axis represents fluorescence intensity, and the horizontal axis represents the number of PCR cycles. [Figure 7] 1 shows the bivariate correlation between the MoCO kit (using CDC N1 primer) and a commercially available kit (Takara Bio Inc.) in the one-step RT-PCR test of Test Example 2-3. [Figure 8] 1 shows the bivariate correlation between the MoCO kit (using CDC N2 primers) and a commercially available kit (Takara Bio Inc.) in the one-step RT-PCR test of Test Example 2-3. [Figure 9] 1 shows the bivariate correlation between the MoCO kit (using CDC N1 primer) and the MoCO kit (using CDC N2 primer) in the one-step RT-PCR test of Test Example 2-3. [Figure 10] 1 shows a growth curve in a one-step RT-PCR test in Test Example 6. [Figure 11] 1 shows the correlation between copy number and Ct value in the one-step RT-PCR test of Test Example 6. DETAILED DESCRIPTION OF THE INVENTION

[0022] 1.Definitions etc. In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0023] As used herein, the "identity" of an amino acid sequence refers to the degree of correspondence between two or more comparable amino acid sequences. Therefore, the greater the identity between two amino acid sequences, the greater the identity or similarity between those sequences. The level of identity between amino acid sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul S F. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc. Natl. Acad. Sci. USA. 87:2264-2268 (1990); Karlin S, Altschul S F. "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc. Natl. Acad. Sci. USA. 90:5873-7 (1993)). A program called BLASTX, based on the BLAST algorithm, has been developed. Specific techniques for these analysis methods are known, and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of a nucleotide sequence is also defined in accordance with the above. In this specification, an amino acid mutation specifically refers to an amino acid deletion, substitution, insertion, or addition. In one aspect, the amino acid mutation is preferably a substitution, and more preferably a conservative substitution.

[0024] In this specification, "conservative substitution" means that an amino acid residue is substituted with an amino acid residue having a similar side chain.For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine is considered to be conservative substitution.Other than this, substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine are also considered to be conservative substitutions.

[0025] As used herein, nucleotides such as DNA and RNA may be chemically modified as described below. To prevent degradation by hydrolases such as nucleases, the phosphate residue of each nucleotide may be substituted with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. The hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, for example by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, etc. Also preferably used are BNA (LNA), in which the conformation of the sugar moiety is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety of the nucleotide.

[0026] Herein, the position of an amino acid in an amino acid sequence may be indicated by the single-letter amino acid code plus the amino acid number counted from the N-terminal amino acid. For example, "E264" indicates glutamic acid, the 264th amino acid from the N-terminus. Furthermore, when the number is followed by a single-letter amino acid code, it indicates a mutation of the amino acid represented by the single-letter code before the number to the amino acid represented by the single-letter code after the number. For example, "E264R" indicates a mutation of glutamic acid, the 264th amino acid from the N-terminus, to arginine.

[0027] 2. Composition In one aspect, the present invention provides a method for the preparation of a nucleic acid sequence comprising the amino acid sequence A shown in SEQ ID NO: 1, the amino acid sequence E264X 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 The present invention relates to a composition (sometimes referred to herein as the "composition of the present invention") comprising a reverse transcriptase (sometimes referred to herein as the "reverse transcriptase of the present invention") comprising a mutant amino acid sequence A1 containing the amino acid sequence A1 as set forth in SEQ ID NO: 3, and a DNA-dependent DNA polymerase (sometimes referred to herein as the "DNA-dependent DNA polymerase of the present invention") comprising the amino acid sequence B set forth in SEQ ID NO: 3 or an amino acid sequence B1 having 80% or more identity to said amino acid sequence B. This will be explained below.

[0028] The reverse transcriptase of the present invention has the amino acid sequence E264X with respect to the amino acid sequence A shown in SEQ ID NO: 1. 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 Each represents a basic amino acid.

[0029] Amino acid sequence A (SEQ ID NO: 1) is the amino acid sequence of the reverse transcriptase endogenously expressed (intrinsically possessed) by Moloney murine leukemia virus (MMLV).

[0030] The mutant amino acid sequence A1 is E264X relative to the amino acid sequence A. 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 Each of the symbols represents a basic amino acid.) is an amino acid sequence containing the amino acid sequence, and is not particularly limited as long as it contains the amino acid sequence. These mutations improve the thermostability of reverse transcriptase (Patent Document 2).

[0031] X 1 , X 2 , or X 3 Examples of basic amino acids represented by the formula (I) include arginine, lysine, histidine, etc. Among these, arginine, lysine, etc. are preferred. In one embodiment of the present invention, X 1 and X 3 is particularly preferably arginine, and X 2 It is particularly preferred that is lysine.

[0032] The mutant amino acid sequence A1 may contain other mutations than those described above, as long as the reverse transcriptase activity and thermostability are not significantly impaired. For example, the mutant amino acid sequence A1 may contain a mutation other than those described above, such that the reverse transcriptase activity and / or thermostability of the protein (protein A1) consisting of the sequence is significantly impaired by E264X relative to the amino acid sequence A shown in SEQ ID NO: 1. 1 , E280X 2 , L413X 3 and D502A (SEQ ID NO: 2), which has, for example, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the reverse transcriptase activity and / or thermostability of a protein (protein 2) consisting of a mutant amino acid sequence (SEQ ID NO: 2) in which only D502A is mutated.

[0033] The reverse transcriptase activity is measured by carrying out the following steps (1) to (6). (1) Reaction solution [composition: 25 mM Tris-HCl buffer (pH 8.3), 50 mM potassium chloride, 2 mM dithiothreitol, 5 mM magnesium chloride, 12.5 μM poly(rA)·p(dT)] 15 (PDT) 15 Concentration), and 0.2 mM [methyl- 3 incubating reverse transcriptase in [H]dTTP at 37°C; (2) taking 20 μL of the product obtained in step (1) and spotting it on a glass filter; (3) After step (2), the glass filter was washed with a cooled 5% by mass aqueous trichloroacetic acid solution for 10 minutes, and then with a cooled 95% by volume aqueous ethanol solution. This procedure was repeated three times to separate poly(rA)·p(dT) from the product on the glass filter. 15 Not included in 3 removing [H]dTTP; (4) drying the glass filter after step (3), and then placing the glass filter in 2.5 mL of liquid scintillation reagent to count the radioactivity; (5) determining the amount of poly(rA)·p(dT) based on the radioactivity obtained in step (4). 15 was incorporated into 3 (6) calculating the amount of poly(rA)·p(dT) in 10 minutes based on the amount of dTTP incorporated calculated in step (5). 15 Step 1: Determine the amount of reverse transcriptase required to incorporate 1 nmol of dTTP.

[0034] Thermal stability was measured by mixing a 100 nM protein with 28 μM poly(rA)·p(dT). 15 The reverse transcriptase activity is measured after incubation at 52°C for 5 minutes in the presence of .

[0035] Examples of other mutations in the mutant amino acid sequence A1 include, but are not limited to, mutations that further improve thermostability (Patent Document 2) and mutations in the amino acid sequence of an orthologue of the MMLV reverse transcriptase (SEQ ID NO: 1) (e.g., avian myeloblastosis virus reverse transcriptase, human immunodeficiency virus reverse transcriptase, etc.). The number of other amino acid mutations is, for example, 0 to 50, 0 to 20, 0 to 10, or 0 to 5.

[0036] The mutant amino acid sequence A1 is preferably the amino acid sequence A11 shown in SEQ ID NO: 2 or an amino acid sequence A12 having 80% or more identity to the amino acid sequence A11. The identity of the mutant amino acid sequence A12 is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, still more preferably 97% or more, and particularly preferably 99% or more, and less than 100%.

[0037] The DNA-dependent DNA polymerase of the present invention comprises the amino acid sequence B shown in SEQ ID NO: 3 or an amino acid sequence B1 having 80% or more identity to the amino acid sequence B.

[0038] Amino acid sequence B (SEQ ID NO: 3) is the amino acid sequence of DNA polymerase I (NCBI Accession No.: AB744210) endogenously expressed (intrinsically possessed) by Thermus thermophilus.

[0039] The identity of the amino acid sequence B1 is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more, and less than 100%.

[0040] The number of mutations in amino acid sequence B1 relative to amino acid sequence B is, for example, 1 to 50, 1 to 20, 1 to 10, or 1 to 5.

[0041] In one embodiment of the present invention, amino acid sequence B1 is preferably the amino acid sequence of Thermus thermophilus DNA polymerase I (for example, an amino acid sequence obtained by introducing an inter-strain mutation of Thermus thermophilus into amino acid sequence B).

[0042] Amino acid sequence B1 can be an amino acid sequence such that the DNA polymerase activity of a protein consisting of said sequence (protein B1) is, for example, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the DNA polymerase activity of a protein consisting of amino acid sequence B (protein B).

[0043] DNA polymerase activity was assessed by detecting the PCR reaction product as follows. A 16S rDNA fragment amplified by PCR from T. kodakarensis genomic DNA was used as the substrate. The total reaction volume was 20 μL. DNA-dependent DNA polymerase was added to the reaction mixture to a final concentration of 4 μM. PCR was performed using 20 μL of PCR reaction mixture (composition: 0.2 mM dNTPs, 1 mM MgSO, 0.75 μM Fw primer, 0.75 μM Rv primer, 0.875 ng / μL 16S rDNA (T. kodakarensis), water) under the following cycling conditions: 94°C for 2 min, followed by 35–45 cycles of (94°C for 15 sec, 55°C for 30 sec, 68°C for 1 min), followed by 68°C for 5 min. The reaction mixture was subjected to agarose gel electrophoresis, and a PCR product (128 bp) was confirmed in the PCR reaction mixture.

[0044] The reverse transcriptase and DNA-dependent DNA polymerase of the present invention may have an amino acid sequence other than those described above, such as a protein or peptide tag, a fluorescent protein, a luminescent protein, a signal sequence, etc., added thereto, as long as their activity is not significantly impaired. Examples of protein tags include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, and PA tag.

[0045] The reverse transcriptase of the present invention and the DNA-dependent DNA polymerase of the present invention may be chemically modified as long as their activity is not significantly impaired.

[0046] The reverse transcriptase of the present invention and the DNA-dependent DNA polymerase of the present invention have a C-terminus containing a carboxyl group (-COOH), a carboxylate group (-COO - ), amide (-CONH2) or ester (-COOR).

[0047] Here, R in the ester is, for example, C such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1-6 Alkyl groups; for example, C groups such as cyclopentyl and cyclohexyl 3-8 Cycloalkyl groups such as phenyl and α-naphthyl 6-12 Aryl groups; for example, phenyl-C such as benzyl and phenethyl 1-2 Alkyl groups; α-naphthyl-C such as α-naphthylmethyl 1-2 C such as alkyl group 7-14 Aralkyl groups, pivaloyloxymethyl groups, etc. are used.

[0048] In the reverse transcriptase and DNA-dependent DNA polymerase of the present invention, a carboxyl group (or carboxylate) other than that at the C-terminus may be amidated or esterified. In this case, the above-mentioned C-terminal esters, for example, are used as the esters.

[0049] Furthermore, in the reverse transcriptase of the present invention and the DNA-dependent DNA polymerase of the present invention, the amino group of the N-terminal amino acid residue is protected by a protecting group (e.g., a C group such as a formyl group or an acetyl group). 1-6 C such as alkanoyl 1-6 those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutamated; those in which the substituents on the side chains of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) are protected by an appropriate protecting group (e.g., C group such as formyl group, acetyl group, etc.);1-6 C such as alkanoyl group 1-6 Also included are those protected with an alkyl group (such as an acyl group).

[0050] The reverse transcriptase and DNA-dependent DNA polymerase of the present invention may be in the form of a salt with an acid or a base. The salt is not particularly limited, and both acidic and basic salts can be used. Examples of acidic salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, and paratoluenesulfonate; and amino acid salts such as aspartate and glutamate. Examples of basic salts include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

[0051] The reverse transcriptase of the present invention and the DNA-dependent DNA polymerase of the present invention may be in the form of a solvate. The solvent is not particularly limited, and examples thereof include water, ethanol, glycerol, and acetic acid.

[0052] The reverse transcriptase and DNA-dependent DNA polymerase of the present invention can be easily produced by known genetic engineering techniques, such as PCR, restriction enzyme cleavage, DNA ligation, in vitro transcription / translation, and recombinant protein production techniques.

[0053] In the composition of the present invention, the content of the reverse transcriptase of the present invention is, for example, 50% by mass or more, 60% by mass or more, 70% by mass or more, 80% by mass or more, 90% by mass or more, 95% by mass or more, 99% by mass or more, or 100% by mass, relative to 100% by mass of the reverse transcriptase.

[0054] In the composition of the present invention, the content of the reverse transcriptase of the present invention is preferably such that the concentration in the PCR reaction solution or one-step RT-PCR reaction solution is, for example, 0.03 to 0.8 μM, preferably 0.03 to 0.4 μM, more preferably 0.05 to 0.3 μM, and even more preferably 0.05 to 0.2 μM.

[0055] In the composition of the present invention, the content of the DNA-dependent DNA polymerase of the present invention is, for example, 50% by mass or more, 60% by mass or more, 70% by mass or more, 80% by mass or more, 90% by mass or more, 95% by mass or more, 99% by mass or more, or 100% by mass, relative to 100% by mass of the DNA-dependent DNA polymerase.

[0056] In the composition of the present invention, the content of the DNA-dependent DNA polymerase of the present invention is preferably such that the concentration in the PCR reaction solution or one-step RT-PCR reaction solution is, for example, 0.5 to 12 μM, preferably 0.75 to 6 μM, more preferably 0.75 to 4.5 μM, and even more preferably 0.75 to 3 μM.

[0057] In the composition of the present invention, the content ratio of the reverse transcriptase of the present invention to the DNA-dependent DNA polymerase of the present invention is, for example, 5 to 30 moles, preferably 10 to 25 moles, and more preferably 12 to 18 moles of the DNA-dependent DNA polymerase of the present invention per 1 mole of the reverse transcriptase of the present invention.

[0058] In one embodiment of the present invention, the composition of the present invention is preferably a composition for PCR reactions, and more preferably a composition for one-step RT-PCR reactions. In this case, the composition of the present invention desirably contains other components necessary or preferred for reverse transcription reactions and / or PCR reactions. Such components include a buffer, a divalent cation source, a monovalent cation source, tRNA, dNTPs, an RNase inhibitor, polynucleotides to serve as primers / probes, uracil-DNA glycosylase, a solvent (e.g., water), etc.

[0059] In a preferred embodiment of the present invention, the composition of the present invention contains, as buffer components, a buffering agent, a source of divalent cations, and a source of monovalent cations.

[0060] Examples of buffers include Bicine buffer (such as Bicine-KOH) and Tris buffer (such as Tris-HCl). Among these, Bicine buffer and Tris buffer are preferred, and it is particularly preferred to use them in combination. In one aspect of the present invention, the composition of the present invention preferably contains Bicine buffer as a buffer from the viewpoint of detection sensitivity.

[0061] In the composition of the present invention in the above aspect, the content of the buffer is preferably such that the concentration in the PCR reaction solution or one-step RT-PCR reaction solution is, for example, 5 to 400 mM, preferably 10 to 200 mM, more preferably 10 to 150 mM, and even more preferably 50 to 120 mM.

[0062] When the composition of the present invention contains a Bicine buffer, the content thereof is preferably such that the concentration in the PCR reaction solution or one-step RT-PCR reaction solution is, for example, 0 to 250 mM, preferably 0 to 120 mM, more preferably 0 to 100 mM, and even more preferably 30 to 80 mM.

[0063] When the composition of the present invention contains a Bicine buffer, the content thereof is, for example, 0 to 100% by mass, preferably 0 to 90% by mass, more preferably 25 to 85% by mass, and even more preferably 50 to 80% by mass, relative to 100% by mass of the buffer.

[0064] Examples of divalent cation sources include magnesium salts (magnesium chloride, etc.) and manganese salts (manganese acetate, etc.), with magnesium salts being preferred.

[0065] In the composition of the present invention in the above aspect, the content of the divalent cation source is preferably such that the concentration in the PCR reaction solution or one-step RT-PCR reaction solution is, for example, 0.3 to 5 mM, preferably 0.6 to 4 mM, more preferably 1 to 4 mM, and even more preferably 1.2 to 3 mM.

[0066] From the viewpoint of detection sensitivity, the composition of the present invention preferably has a manganese salt content equal to or lower than that of other divalent cation sources (particularly preferably, the manganese salt content is lower than that of other divalent cation sources). From this viewpoint, in the composition of the present invention, the content of the manganese salt as a divalent cation source is, for example, 80 mol% or less, preferably 70 mol% or less, more preferably 50 mol% or less, even more preferably 30 mol% or less, still more preferably 10 mol% or less, and particularly preferably 0 mol%, relative to 100 mol% of the divalent cation source. Examples of monovalent cation sources include potassium salts (potassium chloride, potassium acetate, etc.).

[0067] In the composition of the present invention in the above aspect, the content of the monovalent cation source is preferably such that the concentration in the PCR reaction solution or one-step RT-PCR reaction solution is, for example, 10 to 200 mM, preferably 20 to 150 mM, and more preferably 40 to 120 mM.

[0068] The contents of other components than those described above are not particularly limited, and any contents that can be used in PCR or one-step RT-PCR can be appropriately adopted.

[0069] The composition of the present invention may be in a concentrated form. For example, the composition of the present invention may be in a dry form or in a concentrated form in which the concentration of the components contained therein is, for example, 1.2 to 50 times (e.g., 1.2 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 12 times, 15 times, 20 times, 25 times, 30 times, 40 times, or 50 times) the concentration in a PCR or one-step RT-PCR reaction solution.

[0070] The composition of the present invention can be suitably used for RNA detection, particularly for RNA virus detection and RNA detection derived from bacteria and fungi. Examples of RNA viruses, bacteria, and fungi include, but are not limited to, the following viruses, bacteria, and fungi. Furthermore, the composition of the present invention can be suitably used for DNA detection, even in the presence of reverse transcriptase. Therefore, in addition to RNA detection, the composition can also be used for DNA virus detection and DNA detection derived from bacteria and fungi. Examples of DNA viruses, bacteria, and fungi include, but are not limited to, the following viruses, bacteria, and fungi. Furthermore, the composition can be suitably used for simultaneous detection of RNA and DNA viruses, and RNA and DNA viruses derived from bacteria and fungi. Furthermore, the composition can be suitably used for SNP detection and detection of mutant strains of a target virus, bacteria, or fungus. For example, it can also be used to detect mutant viruses of SARS-CoV-2. Herein, SARS-CoV-2 may be referred to as SARS-CoV-2, 2019 novel coronavirus, 2019-Novel Coronavirus, or 2019-nCoV. double-stranded RNA viruses (dsRNA) Reoviridae: Rotavirus, Bluetongue virus, Cytoplasmic polyhedrosis virus (Cypovirus, CPV) Single-stranded negative-strand RNA viruses Orthomyxoviridae: influenza viruses Paramyxoviridae: mumps virus, measles virus, respiratory syncytial virus, Sendai virus, Nipah virus, Hendra virus, Newcastle disease virus Rhabdoviridae: rabies virus, lyssavirus, vesicular stomatitis virus Family Bornaviridae, Genus Bornavirus: Borna disease virus, avian bornavirus, reptilian bornavirus Filoviridae: Marburg virus, Ebola virus Bunyaviridae: Crimean-Congo hemorrhagic fever virus, SFTS virus, Hantavirus Arenaviridae (enveloped viruses with a genome of two segments (S-RNA and L-RNA) of single-stranded (negative) RNA): Lassa virus, Machupo virus, Junin virus Single-stranded RNA positive-strand reverse transcription Retroviridae: Human immunodeficiency virus (HIV), human T-lymphotropic virus, simian immunodeficiency virus, simian T-cell leukemia virus (STLV) Single-stranded positive-strand RNA viruses Picornaviridae: Enteroviruses (poliovirus, coxsackievirus, etc.), Hepatitis A virus Echovirus Coronaviridae: SARS-CoV, MERS-CoV, SARS-CoV-2 (2019 novel coronavirus) Caliciviridae: Norovirus, Norwalk virus, Sapovirus Togaviridae: rubella virus, chikungunya virus Nodaviridae: Viral nervous necrosis virus Flaviviridae: Yellow fever virus, Dengue virus, Zika virus, Japanese encephalitis virus, West Nile virus, Hepatitis C virus, Hepatitis G virus. bacteria Bordetella pertussis, Clostridium tetani, Corynebacterium diphtheriae, Ureaplasma bacteria fungi Mold, Candida DNA viruses Poxviridae: smallpox virus, vaccinia virus Herpesviridae: Herpes simplex virus type 1, type 2, varicella-zoster virus Adenoviridae Papoviridae: papillomaviruses, polyomaviruses, papillomaviruses Parvoviridae: Parvovirus Hepadnaviridae: Hepatitis B virus

[0071] Furthermore, the composition of the present invention can be used for genetic testing of pathogenic viruses or bacteria. By detecting SNPs in human genes using any primers and probes known to those skilled in the art, genetic testing related to diseases such as cancer and dementia can be suitably used.

[0072] The composition of the present invention can be used as a PCR reaction solution or a one-step RT-PCR reaction solution as it is, or after adding other components / to other compositions as needed.

[0073] 3. Kit In one aspect, the present invention provides a method for the preparation of a nucleic acid sequence comprising the amino acid sequence A shown in SEQ ID NO: 1, the amino acid sequence E264X 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 The present invention relates to a kit (sometimes referred to herein as the "kit of the present invention") comprising a reverse transcriptase comprising a mutant amino acid sequence A1 containing a mutated amino acid sequence A1 (including a basic amino acid), and a DNA-dependent DNA polymerase comprising an amino acid sequence B set forth in SEQ ID NO: 3 or an amino acid sequence B1 having 80% or more identity to said amino acid sequence B. This will be described below.

[0074] In the kit of the present invention, the reverse transcriptase of the present invention and the DNA-dependent DNA polymerase of the present invention may be contained in the same container or in separate containers.

[0075] In one embodiment of the kit of the present invention, each component of the composition of the present invention is contained in the same container or in multiple containers. For example, the kit of the present invention may contain a buffer containing a buffering agent, a divalent cation source, and a monovalent cation source. Each component in each container of the kit of the present invention may be in a concentrated form. The components, their concentrations, concentrated forms, etc. are the same as those of the composition of the present invention.

[0076] The kit of the present invention may contain instruments and reagents that can be used to carry out PCR or one-step RT-PCR reactions, if necessary.

[0077] 4. Nucleic Acid Detection Methods In one aspect, the present invention provides a method for the preparation of a nucleic acid sequence comprising the amino acid sequence A shown in SEQ ID NO: 1, the amino acid sequence E264X 1 , E280X 2 , L413X 3 , and D502A mutation (X 1 , X 2 , and X 3 The present invention relates to a method for detecting nucleic acids (RNA and / or DNA) (sometimes referred to herein as the "detection method of the present invention"), which comprises amplifying nucleic acids (RNA and / or DNA) as templates in a reaction solution containing a reverse transcriptase comprising a mutant amino acid sequence A1 containing a mutated amino acid sequence A1, the mutated amino acid sequence A1 including a mutated amino acid sequence B1 as set forth in SEQ ID NO: 3, or an amino acid sequence B1 having 80% or more identity to said amino acid sequence B. This method will be described below.

[0078] The reaction solution contains other components necessary for the reverse transcription reaction and / or PCR reaction, which are the same as the other components in the composition of the present invention, and their concentrations are also the same as those in the composition of the present invention.

[0079] Nucleic acid amplification using RNA as a template is carried out by one-step RT-PCR, i.e., a reverse transcription reaction using RNA as a template with the reverse transcriptase of the present invention, and an amplification reaction of the DNA obtained thereby with the DNA-dependent DNA polymerase of the present invention. Nucleic acid amplification using DNA as a template is carried out by a DNA amplification reaction using the DNA-dependent DNA polymerase of the present invention. The temperature and time of the reverse transcription reaction and the temperature and time of the PCR reaction cycle are not particularly limited and can be set appropriately depending on the Tm values ​​of primers, probes, etc., the length of the target to be amplified, the GC ratio of the target to be amplified, etc.

[0080] The temperature for the reverse transcription reaction is preferably 45 to 55°C, more preferably 48 to 52°C, and the reaction time is preferably 3 seconds to 20 minutes, more preferably 1 to 10 minutes.

[0081] The PCR reaction cycle preferably consists of a cycle at a denaturation temperature (preferably 92 to 98°C, more preferably 93 to 97°C) for, for example, 5 to 15 seconds, followed by a cycle at an enzyme reaction temperature (preferably 55 to 65°C, more preferably 58 to 62°C) for, for example, 15 seconds to 2 minutes (preferably 20 to 40 seconds), and is performed for, for example, 25 or more, 30 or more, 35 or more, or 40 or more cycles.

[0082] After nucleic acid amplification, the presence or absence of nucleic acid can be detected by detecting a signal based on the amplified nucleic acid, and the nucleic acid can be further quantified. Signal detection can be performed based on labeling / staining of primers / probes or amplified nucleic acid. Substances used for labeling / staining are not particularly limited, and examples include nucleic acid labeling substances such as Cy3, Cy5, FITC, TRITC, rhodamine, TAMRA, Alexa Fluor, Texas Red, FAM, APC, PE, ATTO, and DyLight, and nucleic acid staining substances such as EtBr and various fluorescent dyes. The detection method of the present invention can be preferably performed by real-time PCR. [Example]

[0083] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0084] Test Example 1. Preparation of enzyme Test Example 1-1. Preparation of reverse transcriptase (MM4) A reverse transcriptase (MM4) consisting of a mutant amino acid sequence (SEQ ID NO: 2) was prepared by introducing the mutations E264R, E280K, L413R, and D502A into the amino acid sequence A shown in SEQ ID NO: 1. Specifically, the procedure was as follows.

[0085] The MM4 expression vector used contained a base sequence consisting of the MM4 coding sequence (SEQ ID NO: 4) and a Hisx6 tag coding sequence ligated downstream of it, integrated into the MCS of the E. coli expression vector (pET22b(+)). E. coli (BL21(DE3)) containing the MM4 expression vector was cultured in 400 mL of ampicillin-containing medium. When the culture reached an OD of 0.6, IPTG was added and the culture was further cultured at 37°C for 3 hours. The culture was centrifuged (7,000 x g, 30 min, 4°C), the supernatant was removed, and the precipitate was temporarily stored at -80°C. 30 mL of Buffer A (composition: 20 mM potassium phosphate buffer (pH 7.2), 2 mM DTT, 10% v / v glycerol, 5 mM PMSF) was added to the thawed precipitate, and the cells were sonicated (5 min x 3 times). The lysate was centrifuged (34,000 x g, 60 min, 4°C), and the supernatant was subjected to ResQ anion exchange chromatography (AKTA). Elution buffers were eluted using Buffer B (20 mM potassium phosphate buffer (pH 7.2), 2 mM DTT, 10% v / v glycerol, 120 mM NaCl) and Buffer C (20 mM potassium phosphate buffer (pH 7.2), 2 mM DTT, 10% v / v glycerol, 1000 mM NaCl) with a linear gradient elution (120 to 1000 mM NaCl). Each elution fraction was analyzed by SDS-PAGE, and fractions containing the MM4 band were pooled and subjected to ammonium sulfate precipitation (7.29 g / 30 mL). The mixture was centrifuged (4,860 x g, 60 min, 4°C), the supernatant was removed, and the resulting precipitate was dissolved in 10 mL of buffer D (composition: 50 mM Tris-HCl buffer (pH 8.3), 200 mM KCl, 2 mM DTT, 10% v / v glycerol, 50 mM imidazole). The resulting solution was subjected to His column purification (AKTA) (Ni-NTA Cartridge (5 mL x 5) FUJIFILM 142-09733).Buffer D and buffer E (composition: 50 mM Tris-HCl buffer (pH 8.3), 200 mM KCl, 2 mM DTT, 10% v / v glycerol, 500 mM imidazole) were used as elution buffers, and linear gradient elution (50 to 500 mM imidazole) was performed. Each elution fraction was analyzed by SDS-PAGE, and fractions in which the MM4 band was confirmed were pooled and desalted on a PD-10 column to obtain MM4 (concentration: approximately 150 μg / mL).

[0086] Test Example 1-2. DNA-dependent DNA polymerase (M1pol Tth Preparation of A DNA-dependent DNA polymerase (Thermus thermophilus DNA polymerase I) consisting of the amino acid sequence shown in SEQ ID NO: 3 was prepared. Specifically, the procedure was as follows.

[0087] M1pol Tth M1pol is an M1 pol gene comprising a base sequence in which a Hisx6 tag coding sequence is linked downstream of a coding sequence (SEQ ID NO: 5) and which is incorporated into the MCS of an E. coli expression vector (pET28). Tth The expression vector used was M1pol TthE. coli (BL21(DE3)) containing the expression vector was cultured in 400 mL of kanamycin-containing medium. When the culture reached an OD of 0.5, IPTG was added and the culture was further cultured at 37°C for 4 hours. The culture was centrifuged (7,000 x g, 40 min, 4°C), the supernatant was removed, and the precipitate was temporarily stored at -80°C. 35 mL of Buffer F (20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 0.1% Triton X-100, 20 mM imidazole) was added to the thawed precipitate, and the cells were sonicated (5 min x 3 times). The lysate was centrifuged (34,000 x g, 60 min, 4°C), and the supernatant was subjected to His column purification (AKTA) (Ni-NTA Cartridge (5 mL x 5) FUJIFILM 142-09733). Buffer F and buffer G (composition: 20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 0.1% Triton X-100, 500 mM imidazole) were used as elution buffers, and linear gradient elution (20 → 500 mM imidazole) was performed. Each eluted fraction was analyzed by SDS-PAGE, and M1pol Tth The fractions in which the band was confirmed were collected and dialyzed using a Thermo Slide-A-Lyzer (MWCO 3,500). Tth (concentration: approximately 2800 μg / mL).

[0088] Test Example 1-3. DNA-dependent DNA polymerase (K4pol L329A Preparation of E. coli BL21 CodonPlus DE3 (RIL) was transformed with the pET21a vector (pET-21a-K4polI-L329A) containing the coding sequence (nucleotide sequence: SEQ ID NO: 7) of DNA polymerase I derived from the K4 strain (amino acid sequence: SEQ ID NO: 6), and cultured overnight at 37°C in LB medium (+Amp, +Cm). Ampicillin was added at 50 μg / mL, and chloramphenicol was added at 25 μg / mL. A colony was picked and precultured overnight at 37°C in LB (+Amp, +Cm) liquid medium (30 mL). 1% of the colony was then inoculated into 3 L of fresh LB (+Amp, +Cm) liquid medium. The OD 660 The cells were cultured with shaking at 37°C until the pH reached 0.5, and then 0.1 mM IPTG was added and cultured with shaking for 4 hours. The cells were then harvested and sonicated three times for 5 minutes in 15 mL of Buffer H (10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM DTT, and 10% glycerol) per 1 L of cells. The lysate was centrifuged, and the supernatant was collected and heat-treated at 85°C for 30 minutes. The supernatant was then centrifuged again and loaded onto a heparin column (Hi Prep Heparin FF16 / 10) and eluted with a linear gradient of Buffer H and Buffer I (10 mM Tris-HCl (pH 8.0), 1000 mM NaCl, 1 mM DTT, and 10% glycerol). The eluted fraction was dialyzed against Buffer H. Because contaminating proteins were found, the heat treatment was repeated by dispensing 1 mL of the mixture into 1.5 mL tubes, and the mixture was heat treated and purified at 85°C for 30 minutes in a heat block. L329A obtained.

[0089] Test Example 1-4. Preparation of DNA-dependent DNA polymerase (RTX) E. coli BL21 CodonPlus DE3 (RIL) was transformed with pET21a-RTX (amino acid sequence: SEQ ID NO: 8, nucleotide sequence: SEQ ID NO: 9), pre-cultured overnight at 37°C in LB medium (10 mL), and inoculated into fresh LB medium (2 L) at 1% OD. 660The cells were cultured at 37°C aerobically until the RI = 0.5, then IPTG was added to a final concentration of 1 mM and cultured at 37°C for 4 hours. Ampicillin (50 μg / mL) was added to the LB medium. The culture was harvested and washed with 0.8% NaCl. 15 mL of buffer J (composition: 10 mM potassium phosphate buffer (pH 7.0), 1 mM dithiothreitol, 10% glycerol, 0.1 mM ethylenediaminetetraacetic acid, 100 mM NaCl) was added per 1 L of cells. The cells were sonicated three times for 5 minutes per 1 L (Output 4, Duty Cycle 40). The lysate was centrifuged at 14,000 rpm for 30 minutes, and the supernatant was collected. The supernatant was then heat-treated at 85°C for 25 minutes and centrifuged again at 14,000 rpm for 30 minutes. The supernatant was subjected to heparin affinity column chromatography. The supernatant was applied to a Hi-Trap Heparin column (5 mL) and the target protein was eluted with Buffer J containing 1 M NaCl at room temperature using a gradient elution (20 column volumes). The target protein fraction was identified by SDS-PAGE, and the resulting fraction was dialyzed against Buffer A. The supernatant was then subjected to cation exchange column chromatography. The supernatant was applied to a Hi-Trap SP column (5 mL) and the target protein was eluted with Buffer J containing 1 M NaCl at room temperature using a gradient elution (20 column volumes). The target protein fraction was identified by SDS-PAGE, and the fraction was centrifuged (3000 × g, 4°C) using an Amicon-Ultra 30 kDa-cut column. The concentrate was dialyzed against Buffer K (composition: 50 mM Tris-Cl (pH 8.0), 50% glycerol, 0.1% Tween-20, 50 mM KCl, 0.1 mM ethylenediaminetetraacetic acid, 1 mM dithiothreitol) and purified. Get RTX Ta.

[0090] Test example 2. One-step RT-PCR test Unless otherwise noted, RT-PCR was performed as follows. Clinical samples were obtained from medical institutions. RNA was extracted from a total of 127 cases, including at least 19 sputum samples, 59 nasopharyngeal swabs, and 6 saliva samples, using the QIAamp Viral RNA Mini Kit (QIAGEN). UNG (Uracil-DNA Glycosylase), RNase inhibitor, deoxyribonucleotide:dNTP mixture (A, C, G, T), and dNTP mixture (A, C, G, U) were purchased from Toyobo. One-step RT-PCR was performed using a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). RNA copy number was estimated from a simultaneously tested standard curve. Primers and probes for 2019-Novel Coronavirus (2019-nCoV) were synthesized according to a report from the Centers for Disease Control and Prevention (CDC). 2019-nCoV_N1 forward primer: GAC CCC AAA ATC AGC GAA AT (SEQ ID NO: 10), 2019-nCoV_N1 reverse primer: TCT GGT TAC TGC CAG TTG AAT CTG (SEQ ID NO: 11), 2019-nCoV_N1 probe: FAM- ACC CCG CAT TAC GTT TGG TGG ACC (SEQ ID NO: 12) TAMRA, 2019-nCoV_N2 forward primer: TTA CAA ACA TTG GCC GCA AA (SEQ ID NO: 13), 2019-nCoV_N2 reverse primer: GCG CGA CAT TCC GAA GAA (SEQ ID NO: 14), 2019-nCoV_N2 probe: FAM-ACA ATT TGC CCC CAG CGC TTC AG (SEQ ID NO: 15) -TAMRA, RNase P forward primer: AGA TTT GGA CCT GCG AGC G (SEQ ID NO: 16), RNase P reverse primer: GAG CGG CTG TCT CCA CAAGT (SEQ ID NO: 17). The RNase P probe was synthesized with an MGB quencher added according to the report from the CDC.RNase P probe: VIC-TTC TGA CCT GAA GGC T-MGB (Thermo Fisher Scientific). Synthetic standard RNA for COVID-19 CDC N1 and N2 primer set (US-CDC-N1N2-PC) was purchased from Nihon Gene Research Institute. 7 Next, the standard RNA was diluted with RNA-grade TE buffer (Nacalai Tesque) at a concentration of 10 copies / µL. 5 , 10 4 , 10 3 , 10 2 The one-step RT-PCR data of the present invention was serially diluted to 10, 10, and 5 copies / µL. When comparing the data from the one-step RT-PCR kit of the present invention with that from a commercially available one-step RT-PCR kit (SARS-CoV-2 Direct PCR Detection Kit, Takara Bio Inc.), sensitivity, specificity, positive predictive value (NPV), negative predictive value (NPV), and bivariate relationships were analyzed. Sensitivity, specificity, positive predictive value (NPV), negative predictive value (NPV), and bivariate relationships were analyzed using JMP 10 software (SAS).

[0091] Test Example 2-1. Examination of enzyme combinations and reaction buffers Five different buffer solutions containing purified human total RNA and different concentrations of MgCl2, Mn(OCOCH3)2, Bicine-KOH (pH 8.2), Tris-HCl (pH 8.3), KCl, and CH3COOK were prepared (Tables 2 and 3). MM4 and each DNA polymerase (M1pol) were used. Tth , K4pol L329A , or RTX) and perform one-step RT-PCR to measure 10% of SARS-CoV-2 RNA. 4 The copy was confirmed. The specific conditions are as shown in Table 1 below.

[0092] [Table 1]

[0093] As a result, M1pol Tth was able to detect specific RNA in all buffers 1 to 5, whereas K4pol L329AThe amplification of RNA was possible only in buffers 1, 3, and 5 (Figs. 1-5). On the other hand, RTX did not show any amplification of RNA (Figs. 1-5). When MM4 was used as the reverse transcriptase and M1pol was used as the DNA polymerase, Tth It was found that by using M1pol, it is possible to adopt reaction buffers with a wider variety of compositions. Tth M1polTth, K4pol L329A is denoted as K4polL329A.

[0094] [Table 2]

[0095] [Table 3]

[0096] Test Example 2-2. Examination of detection limit and reverse transcription reaction time The RNA detection limit was investigated in each buffer. Tth Using 10% of SARS-CoV-2 RNA 5 , 10 4 , 10 3 , 10 2 The same procedure as in Test Example 2-1 was repeated, except that 10, 10, and 5 copies of RNA were confirmed. As a result, 100 copies of RNA were detected in Buffers 1, 3, and 5 (Table 4). On the other hand, 10 copies of RNA were detected in Buffer 2 and 5 copies in Buffer 4 after a maximum of 45 PCR cycles (Table 4).

[0097] [Table 4]

[0098] Next, we investigated the reverse transcription reaction time. MM4 was used as the reverse transcriptase. Using samples with 10,000 or 100 copies, reverse transcription was performed at 50°C for 30 seconds, 5 minutes, 10 minutes, or 15 minutes. The results confirmed that the reverse transcription reaction proceeded regardless of the reaction time (Figure 6). As a standard protocol, the reverse transcription reaction time for clinical use is 5 minutes.

[0099] Contamination of PCR due to carryover of amplified DNA has become a problem. Therefore, we investigated the applicability of UNG to the one-step RT-PCR method of the present invention. The RNase P gene has been used as an internal standard in coronavirus detection systems. Therefore, we investigated whether simultaneous detection of RNase P is possible using a CDC primer and probe set, and found that the method of the present invention can be used as an internal standard without any problems. The one-step RT-PCR conditions and reagents are shown in Tables 5 and 6. The one-step RT-PCR kit of the present invention is called the Mother's and Children's, Osaka (MoCO) kit (sometimes referred to as the MoCO kit in this specification).

[0100] [Table 5]

[0101] [Table 6]

[0102] Test Example 2-3. Examination of consistency with commercially available kits Clinical RNA samples were stored at -80°C before use. After thawing, one-step RT-PCR was performed using the MoCO kit and a commercially available kit (Takara Bio). A total of 127 RNA samples were tested using both kits. The MoCO kit detects the CDC probes N1 and N2 separately, whereas the Takara Bio kit combines both probes. To verify the accuracy of the MoCO kit, 1) the detection limits were set at 10, 5, and 1 copy. 2) If amplification by either the N1 or N2 probe exceeded the detection limit of the MoCO kit, the sample was considered positive. At a detection limit of 10 copies, the sensitivity was 97.7%, the specificity was 100%, the PPV was 100%, and the NPV was 95.2%. At a detection limit of 5 copies, the sensitivity was 97.8%, the specificity was 100%, the PPV was 100%, and the NPV was 94.6%. At a detection limit of 1 copy, the sensitivity was 100%, specificity 100%, PPV 100%, and NPV 100% (Table 7). Linear regression analysis also showed a good fit (Figures 7-9). These results demonstrate that the MoCO kit is a clinically useful method for quantitative detection of SARS-CoV-2 RNA.

[0103] [Table 7]

[0104] Test Example 3: SNP analysis using one-step RT-PCR test-1 Using the MoCO kit, we attempted to detect various mutant viruses of the 2019-Novel Coronavirus (2019-nCoV) (N501Y mutant strain, alpha strain, delta strain, and omicron strain).

[0105] (3-1) Detection of N501Y mutant strain Using the MoCO kit, we investigated whether the 2019-Novel Coronavirus (2019-nCoV) mutant virus (N501Y mutant strain) could be detected. Primers and probes for detecting the N501Y mutant strain were used. MM4 (reverse transcriptase) and M1pol Tth(DNA polymerase) and one-step RT-PCR was performed using Buffer 4 (5x RT PreMix 4) in Table 2. Specific conditions are shown in Tables 8 and 9 below.

[0106] [Table 8]

[0107] [Table 9]

[0108] As a result, the N501Y mutant strain was detected. The fluorescent dye FAM detects wild-type viruses, and the fluorescent dye VIC detects mutant viruses (N501Y mutant strains). If the FAM Ct value > VIC Ct value, it indicates the N501Y mutant strain, and if the FAM Ct value < VIC Ct value, it indicates the wild-type virus. The detection results are shown in Table 10. The results showed that the N501Y mutant strain was detected in more than half of all samples. These results demonstrate that the MoCO kit is a useful method for SNP analysis.

[0109] [Table 10]

[0110] (3-2) Detection of Alpha and Delta Strains Using the MoCO kit, we investigated the feasibility of detecting mutant viruses (alpha and delta strains) of the 2019-Novel Coronavirus (2019-nCoV). Detection of the 69-70 deletion mutation was performed using the composition shown in Table 8 and the conditions shown in Table 12. Primers and probes were synthesized according to a report from Yale University. SARS-CoV-2 69 / 70del-forward primer: TCAACTCAGGACTTGTTCTTACCT (SEQ ID NO: 18), SARS-CoV-2 69 / 70del-reverse primer: TGGTAGGACAGGGTTATCAAAC (SEQ ID NO: 19), SARS-CoV-2 69 / 70del FAM (WT) probe: TTCCATGCTATACATGTCTCTGGGA (SEQ ID NO: 20), SARS-CoV-2 69 / 70 VIC (del) probe: TGGTTCCATGCTATCTCTGGGACCA (SEQ ID NO: 21). In addition, L452R was detected using Primer / Probe L452R (SARS-CoV-2) ver.2 (Takara Bio Inc.). MM4 (reverse transcriptase) and M1pol Tth (DNA polymerase) and one-step RT-PCR was performed using Buffer 4 (5x RT PreMix 4) in Table 2. Specific conditions for detecting L452R are shown in Tables 11 and 12 below.

[0111] [Table 11]

[0112] [Table 12]

[0113] As a result, either the alpha strain or the delta strain could be detected. Strains in which the 69-70 amino acid deletion was detected indicate the alpha strain, while strains in which the L452R mutation was detected indicate the delta strain. The PCR results using the MoCO Kit and the next-generation sequencer are shown in Table 13. These results demonstrate that both methods produce identical results. These results demonstrate that the MoCO Kit is a useful method for SNP analysis.

[0114] [Table 13]

[0115] (3-3) Detection of Omicron strains The MoCO kit was used to examine whether it could detect the 2019-Novel Coronavirus (2019-nCoV) mutant virus (Omicron strain). Primer / Probe E484A (SARS-CoV-2) (Takara Bio Inc.) was used to detect E484A. MM4 (reverse transcriptase) and M1pol Tth (DNA polymerase) and one-step RT-PCR was performed using Buffer 4 (5x RT PreMix 4) in Table 2. Specific conditions are shown in Tables 11 and 12 (50 cycles under L452R detection conditions).

[0116] As a result, the Omicron strain was successfully detected. The strain in which the E484A mutation was detected but the L452R mutation was not (L452 WT) is an Omicron strain. The results of PCR determination using the MoCO Kit and the results of determination using a next-generation sequencer are shown in Table 14. These results demonstrate that both methods yield identical results. These results demonstrate that the MoCO Kit is a useful method for SNP analysis.

[0117] [Table 14]

[0118] Test Example 4 SNP analysis using one-step RT-PCR test-2 The MoCO kit was used to detect the 2019-Novel Coronavirus (2019-nCoV) mutant virus (N501Y mutant strain) and compared it with a commercially available kit (Takara Bio). Primers and probes for detecting the N501Y mutant strain were used. MM4 (reverse transcriptase) and M1pol Tth (DNA polymerase) and one-step RT-PCR was performed using Buffer 4 (5x RT PreMix 4) in Table 2. Specific conditions are shown in Tables 15 and 9 below.

[0119] [Table 15]

[0120] The results are shown in Table 16. Using the commercially available kit and the MoCO kit, samples BMSC1 to 17 were found to be the N501Y mutant strain, and samples BMSC18 to 36 were found to be wild-type virus. These results demonstrate that the MoCO kit exhibits detection sensitivity equivalent to that of the commercially available kit.

[0121] [Table 16]

[0122] Test Example 5: Detection of DNA virus genes using one-step RT-PCR test The MoCO kit was used to examine the feasibility of detecting various DNA virus genes and compared with commercially available kits. Artificial genes (DNA standards) of HSV1, HSV2, VZV, CMV, EBV, HHV6, and HHV7 were used as DNA virus detection targets. The DNA standards, primers, and probes used in the experiment are shown in Table 17. MM4 (reverse transcriptase) and M1pol Tth (DNA polymerase), and one-step RT-PCR was performed using Buffer 4 (5×RT PreMix 4) in Table 2 under the conditions in Tables 8 and 9.

[0123] [Table 17]

[0124] The results are shown in Tables 18 to 24. Five copies of HSV1, HSV2, VZV, CMV, HHV6, and HHV7 DNA could be detected, and 50 copies of EBV DNA could be detected. The detection sensitivity was equal to or greater than that of a commercially available kit (Takara Bio Inc.).

[0125] [Table 18]

[0126] [Table 19]

[0127] [Table 20]

[0128] [Table 21]

[0129] [Table 22]

[0130] [Table 23]

[0131] [Table 24]

[0132] Test Example 6: Detection of Ureaplasma DNA using a one-step RT-PCR test The MoCO kit was used to examine whether ureaplasma DNA can be detected. The following DNA standards, primers, and probes were used: DNA standard: 16S-urea / pT7 plasmid DNA, 16S-Urea common forward primer: AGGCATGCGTCTAGGGTAGGA (SEQ ID NO: 22), 16S-Urea common reverse primer: ACGTTCTCGTAGGGATACCTTGTTA (SEQ ID NO: 23), 16S-Urea common probe: FAM-CGGTGACTGGAGTTAA (SEQ ID NO: 24)-MGB. MM4 (reverse transcriptase) and M1pol Tth (DNA polymerase), and one-step RT-PCR was performed using Buffer 4 (5×RT PreMix 4) in Table 2 under the conditions in Tables 25 and 26.

[0133] [Table 25]

[0134] [Table 26]

[0135] The results are shown in Table 27, Figures 10 and 11. Five copies of ureaplasma DNA could be detected. The detection sensitivity was equal to or higher than that of Digital PCR (Thermo).

[0136] [Table 27]

Claims

1. A composition comprising a reverse transcriptase which contains the mutations E264R, E280K, L413R, and D502A with respect to the amino acid sequence A shown in SEQ ID NO: 1, and which comprises the amino acid sequence A11 shown in SEQ ID NO: 2 or a mutated amino acid sequence A12 having 90% or more identity to the amino acid sequence A11, and a DNA-dependent DNA polymerase which contains the amino acid sequence B shown in SEQ ID NO: 3 or an amino acid sequence B1 having 90% or more identity to the amino acid sequence B.

2. The composition of claim 1, wherein the amino acid sequence B1 is the amino acid sequence of Thermus thermophilus DNA polymerase I.

3. The composition according to claim 1 or 2, which is a composition for PCR reaction.

4. The composition according to any one of claims 1 to 3, which is a composition for one-step RT-PCR reaction.

5. The composition according to any one of claims 1 to 4, which is used for detecting nucleic acids.

6. The composition of claim 5 , wherein the nucleic acid is of viral, bacterial, or fungal origin.

7. A composition described in any of claims 1 to 6, wherein the concentration of the divalent cation source in the reaction solution is 3 mM or less, the content of manganese salt as a divalent cation source is lower than the content of other divalent cation sources, and the composition contains bicine buffer as a buffer.

8. 8. The composition according to claim 7, wherein the content of the manganese salt as the divalent cation source is 10 mol % or less relative to 100 mol % of the divalent cation source, and the composition contains a Bicine buffer as a buffer.

9. A kit comprising: a reverse transcriptase which contains the mutations E264R, E280K, L413R, and D502A with respect to the amino acid sequence A shown in SEQ ID NO: 1, and which contains the amino acid sequence A11 shown in SEQ ID NO: 2 or a mutant amino acid sequence A12 having 90% or more identity to the amino acid sequence A11; and a DNA-dependent DNA polymerase which contains the amino acid sequence B shown in SEQ ID NO: 3 or an amino acid sequence B1 having 90% or more identity to the amino acid sequence B.

Images