Transformants of Hydrogenophilus bacteria producing aspartic acid and methionine

Abstract

The present invention provides a transformant which is produced by introducing an aspartic acid dehydrogenase gene into a bacterium belonging to the genus Hydrogenophilus.

Description

[Technical Field]

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2020-104487 (filed June 17, 2020) and Japanese Patent Application No. 2020-169550 (filed October 7, 2020), the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a transformant of a bacterium of the genus Hydrogenophilus having the ability to produce aspartic acid and / or methionine, and a method for producing aspartic acid and / or methionine using the transformant. [Background technology]

[0003] The Paris Agreement, adopted in 2015, calls for rapid reductions in global greenhouse gas emissions. In line with this, Japan aims to reduce greenhouse gas emissions, including carbon dioxide and methane, by 26% by 2030 compared to 2013 levels. Currently, the majority of chemical production worldwide relies on petroleum as a raw material, resulting in rising greenhouse gas emissions. Therefore, there is a need to move away from petroleum-based chemical production, and research and development into biorefineries that produce green chemicals from biomass is being actively pursued around the world. However, the conversion of biomass into sugars for microbial fermentation requires complex processes and presents high costs. As part of research into petroleum-based decomposition, gases such as carbon dioxide, methane, and carbon monoxide have attracted attention as more sustainable carbon feedstocks. Technologies for producing valuable chemicals and biofuels using microorganisms that utilize these gases have attracted interest. In particular, there is great expectation for the effective use of carbon dioxide, which contributes significantly to global warming.

[0004] Aspartic acid is a useful amino acid used as a raw material for aspartame sweeteners and biodegradable polymers, while methionine is used as a raw material for various chemical products such as pharmaceuticals and feed additives. In the currently used industrial process using petroleum feedstocks, aspartic acid is mainly produced from fumaric acid using aspartase, which is produced by chemical synthesis as a petroleum fractional distillation product. Methionine is produced by generating carbon dioxide by improving liquefied petroleum gas (LPG) and other fuels.

[0005] Meanwhile, methods for producing aspartic acid and methionine using genetically modified microorganisms have been proposed. For example, a method for producing aspartic acid has been proposed that utilizes transformants of Enterobacteriaceae bacteria such as Escherichia coli or yeast, into which an exogenous aspartate dehydrogenase gene has been introduced (Patent Documents 1 and 2). However, unlike the present invention, which uses carbon dioxide for the growth and cultivation of microorganisms, these methods require costly sugars for the growth and cultivation of microorganisms. Furthermore, these methods do not contribute sufficiently to global warming countermeasures. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent No. 5846122 [Patent Document 2] WO 2017 / 083683 Summary of the Invention [Problem to be solved by the invention]

[0007] The problem to be solved by the present invention is to provide a transformant capable of producing aspartic acid and / or methionine using carbon dioxide as a sole carbon source, and to produce aspartic acid and methionine using this transformant. [Means for solving the problem]

[0008] To address the high cost of raw materials such as sugars and the need for global warming countermeasures, the present inventors focused on Hydrogenophilus bacteria as a microorganism capable of fixing carbon dioxide on an industrial scale. This bacterium possesses an enzyme that catalyzes the reaction of producing aspartic acid from oxaloacetate, but requires glutamate as a substrate. Therefore, to confer the ability to produce aspartic acid and its derived metabolite, methionine, on an industrial scale, it is necessary to introduce a gene for an enzyme that catalyzes the reaction of producing aspartic acid from an amino group derived from an inorganic salt, instead of glutamic acid. However, the present inventors have found that even when heterologous genes are introduced into Hydrogenophilus bacteria using vectors that function in Hydrogenophilus bacteria, functional proteins are often not expressed or are expressed only insufficiently. Furthermore, it has been found that genes that are expressed in bacteria other than Hydrogenophilus bacteria are often not expressed or are expressed only insufficiently in Hydrogenophilus bacteria.

[0009] Under these circumstances, the present inventors conducted extensive research into DNA encoding predicted aspartate dehydrogenase genes (hereinafter referred to as aspartate dehydrogenase genes) present in the genomes of various types of microorganisms, and into the construction of vectors for introducing these DNAs into bacteria of the genus Hydrogenophilus. As a result, they found that introducing DNA encoding an aspartate dehydrogenase gene derived from a specific microorganism (described below) into bacteria of the genus Hydrogenophilus enables efficient production of aspartate and / or methionine. Furthermore, they found that transformants obtained by introducing this DNA can efficiently produce aspartate and / or methionine using carbon dioxide as the sole carbon source.

[0010] The present invention has been completed based on the above findings and is as follows. [1] A transformant obtained by introducing an aspartate dehydrogenase gene into a bacterium of the genus Hydrogenophilus. [2] The transformant according to [1], wherein the aspartate dehydrogenase gene is a DNA selected from any one of the following (1) to (6): (1) DNA consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12; (2) DNA consisting of a base sequence having 90% or more identity to any one of SEQ ID NOs: 1 to 12, which encodes a polypeptide having aspartate dehydrogenase activity; (3) DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence complementary to any one of SEQ ID NOs: 1 to 12 and encodes a polypeptide having aspartate dehydrogenase activity; (4) DNA encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27; (5) DNA encoding a polypeptide having aspartate dehydrogenase activity, the polypeptide consisting of an amino acid sequence having 90% or more identity to any one of SEQ ID NOs: 16 to 27; and (6) A DNA encoding a polypeptide having aspartate dehydrogenase activity, which consists of an amino acid sequence in which one or more amino acids are deleted, substituted, or added in any one of the amino acid sequences of SEQ ID NOs: 16 to 27. [3] The transformant according to [1] or [2], wherein the aspartate dehydrogenase gene is a DNA selected from any one of the following (1) to (6): (1) DNA consisting of the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 11; (2) DNA consisting of a nucleotide sequence having 90% or more identity to SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 11, which encodes a polypeptide having aspartate dehydrogenase activity; (3) DNA that hybridizes under stringent conditions with DNA consisting of a nucleotide sequence complementary to SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 11 and encodes a polypeptide having aspartate dehydrogenase activity; (4) DNA encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 26; (5) DNA encoding a polypeptide having aspartate dehydrogenase activity, the polypeptide consisting of an amino acid sequence having 90% or more identity to SEQ ID NO: 18, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 26; and (6) A DNA encoding a polypeptide having aspartate dehydrogenase activity, which consists of an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 26. [4] The transformant according to any one of [1] to [3], wherein the bacterium of the genus Hydrogenophilus is Hydrogenophilus thermorteolus. [5] The transformant according to [4], wherein the Hydrogenophilus thermorteolus is a Hydrogenophilus thermorteolus TH-1C strain. [6] A method for producing aspartic acid, comprising a step of culturing the transformant according to any one of [1] to [5] above using carbon dioxide as substantially the only carbon source. [7] A method for producing methionine, comprising a step of culturing the transformant according to any one of [1] to [5] above using carbon dioxide as substantially the only carbon source. [Effects of the Invention]

[0011] According to the present invention, by introducing the above-mentioned aspartate dehydrogenase gene into a Hydrogenophilus bacterium, it is possible to make it function within the Hydrogenophilus bacterium and produce aspartic acid and / or methionine, a metabolic product derived from aspartic acid. DETAILED DESCRIPTION OF THE INVENTION

[0012] (1) A transformant capable of producing aspartic acid and / or methionine First, the present invention provides a transformant obtained by introducing an aspartate dehydrogenase gene into a bacterium of the genus Hydrogenophilus. The transformant of the present invention has aspartate dehydrogenase activity, which enables it to efficiently produce aspartic acid and / or its derived metabolite, methionine, using carbon dioxide as a sole carbon source. That is, the transformant of the present invention is characterized by its ability to directly fix carbon dioxide and produce aspartic acid and / or methionine, which are the basis for various chemical products, on an industrial scale.

[0013] The aspartate dehydrogenase (hereinafter also referred to as "AspDH") gene introduced in the present invention may be derived from any source, as long as it can exhibit aspartate dehydrogenase activity in the Hydrogenophilus bacterium into which it is introduced. The aspartate dehydrogenase gene used in the present invention may be DNA of an aspartate dehydrogenase gene isolated from a naturally occurring bacterium, or may be DNA artificially synthesized using techniques known to those skilled in the art. Furthermore, the aspartate dehydrogenase gene used in the present invention may be DNA of an aspartate dehydrogenase gene derived from various known organisms, or may be DNA obtained by genetically modifying such genes. The aspartate dehydrogenase gene used in the present invention does not necessarily have to be identified as an aspartate dehydrogenase gene and may be DNA encoding the amino acid sequence of a polypeptide having aspartate dehydrogenase activity. Here, aspartate dehydrogenase activity refers to the enzymatic activity of synthesizing aspartic acid from oxaloacetate and ammonia (NH).

[0014] Examples of the aspartate dehydrogenase gene to be introduced in the present invention include the nucleotide sequence of the aspartate dehydrogenase gene derived from Candidatus Hydrothermae bacterium (SEQ ID NO: 1), the nucleotide sequence of the aspartate dehydrogenase gene derived from Glaciecola sp. 33A (SEQ ID NO: 2), the nucleotide sequence of the aspartate dehydrogenase gene derived from Mesorhizobium sp. M7D.F.Ca.US.005.01.1.1 (SEQ ID NO: 3), the nucleotide sequence of the aspartate dehydrogenase gene derived from Rhodospirillaceae bacterium (SEQ ID NO: 4), the nucleotide sequence of the aspartate dehydrogenase gene derived from Bacillus kochii (SEQ ID NO: 5), the nucleotide sequence of the aspartate dehydrogenase gene derived from Novosphingobium rosa (SEQ ID NO: 6), the nucleotide sequence of the aspartate dehydrogenase gene derived from Archaeoglobus fulgidus (SEQ ID NO: 7), and the nucleotide sequence of the aspartate dehydrogenase gene derived from Arthrobacter sp. The DNA may be a DNA consisting of the nucleotide sequence of the aspartate dehydrogenase gene derived from 161MFSha2.1 (SEQ ID NO: 8), the nucleotide sequence of the aspartate dehydrogenase gene derived from Oceanotoga teriensis (SEQ ID NO: 9), the nucleotide sequence of the aspartate dehydrogenase gene derived from Marinitoga sp. 1155 (SEQ ID NO: 10), the nucleotide sequence of the aspartate dehydrogenase gene derived from Thermotogales bacterium 46_20 (SEQ ID NO: 11), or the nucleotide sequence of the aspartate dehydrogenase gene derived from Thermotoga maritima (SEQ ID NO: 12).

[0015] The aspartate dehydrogenase gene used in the present invention may be DNA consisting of a nucleotide sequence having 20% ​​or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity to any of SEQ ID NOS: 1 to 12, and may be DNA encoding a polypeptide having aspartate dehydrogenase activity. The aspartate dehydrogenase gene used in the present invention is preferably DNA consisting of a nucleotide sequence having 90% or more identity to SEQ ID NOS: 3, 8, 9, or 11, and is DNA encoding a polypeptide having aspartate dehydrogenase activity. In the present invention, nucleotide sequence identity can be determined using techniques known to those skilled in the art, for example, it can be calculated using GENETYX ver. 17 (Genetyx Corporation).

[0016] The aspartate dehydrogenase gene used in the present invention may also be a DNA that hybridizes under stringent conditions with a DNA consisting of a nucleotide sequence complementary to any one of SEQ ID NOS: 1 to 12 and encodes a polypeptide having aspartate dehydrogenase activity. Here, "stringent conditions" refers to, for example, hybridization in a hybridization solution having a salt concentration of 6xSSC at a temperature of 50-60°C for 16 hours, followed by washing in a solution having a salt concentration of 0.1xSSC. "Hybridizing under stringent conditions" in the present invention refers to the formation of specific hybrids, for example, hybrids having a homology of 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more, and also includes nonspecific hybrids, for example, hybrids not having the homology described above or less.

[0017] The aspartate dehydrogenase gene to be introduced in the present invention is preferably an aspartate dehydrogenase gene derived from Candidatus Hydrothermae bacterium, Glaciecola sp. 33A, Mesorhizobium sp. M7D.F.Ca.US.005.01.1.1, Rhodospirillaceae bacterium, Bacillus kochii, Novosphingobium rosa, Archaeoglobus fulgidus, Arthrobacter sp. 161MFSha2.1, Oceanotoga teriensis, Marinintoga sp. 1155, Thermotogales bacterium 46_20, or Thermotoga maritima, because of its high efficiency in producing aspartate and / or methionine. More preferred is an aspartate dehydrogenase gene derived from 161MFSha2.1, Oceanotoga teriensis, or Thermotogales bacterium 46_20. The nucleotide sequences of the aspartate dehydrogenase genes derived from the various bacteria listed above, excluding Thermotoga maritima and Archaeoglobus fulgidus (SEQ ID NOS: 1-6, 8-11), were predicted to correspond to DNA encoding aspartate dehydrogenase from the genome sequences of the various bacteria listed above. However, the amino acid sequences encoded by these sequences (SEQ ID NOS: 16-21, 23-26) have a maximum homology of approximately 50% to the amino acid sequences of aspartate dehydrogenases whose activity has been confirmed in other microorganisms. Therefore, it was not easily predicted that the transformant of the present invention would actually have aspartate dehydrogenase activity.

[0018] The aspartate dehydrogenase gene used in the present invention may also be selected from the group consisting of the amino acid sequence of aspartate dehydrogenase derived from Candidatus Hydrothermae bacterium (SEQ ID NO: 16), the amino acid sequence of aspartate dehydrogenase derived from Glaciecola sp. 33A (SEQ ID NO: 17), the amino acid sequence of aspartate dehydrogenase derived from Mesorhizobium sp. M7D.F.Ca.US.005.01.1.1 (SEQ ID NO: 18), the amino acid sequence of aspartate dehydrogenase derived from Rhodospirillaceae bacterium (SEQ ID NO: 19), the amino acid sequence of aspartate dehydrogenase derived from Bacillus kochii (SEQ ID NO: 20), the amino acid sequence of aspartate dehydrogenase derived from Novosphingobium rosa (SEQ ID NO: 21), the amino acid sequence of aspartate dehydrogenase derived from Archaeoglobus fulgidus (SEQ ID NO: 22), and the amino acid sequence of aspartate dehydrogenase derived from Arthrobacter sp. The DNA may also be a DNA encoding a polypeptide consisting of the amino acid sequence of aspartate dehydrogenase derived from 161MFSha2.1 (SEQ ID NO: 23), the amino acid sequence of aspartate dehydrogenase derived from Oceanotoga teriensis (SEQ ID NO: 24), the amino acid sequence of aspartate dehydrogenase derived from Marinitoga sp. 1155 (SEQ ID NO: 25), the amino acid sequence of aspartate dehydrogenase derived from Thermotogales bacterium 46_20 (SEQ ID NO: 26), or the amino acid sequence of aspartate dehydrogenase derived from Thermotoga maritima (SEQ ID NO: 27).

[0019] Furthermore, the aspartate dehydrogenase gene used in the present invention may be DNA encoding a polypeptide having aspartate dehydrogenase activity, which is comprised of an amino acid sequence that shares 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity with any of SEQ ID NOS: 16 to 27. The aspartate dehydrogenase gene used in the present invention is preferably DNA encoding a polypeptide having aspartate dehydrogenase activity, which is comprised of an amino acid sequence that shares 90% or more identity with SEQ ID NOS: 18, 23, 24, or 26. In the present invention, amino acid sequence identity can be determined using techniques known to those skilled in the art, and can be calculated, for example, using GENETYX ver. 17 (Genetyx Corporation).

[0020] The aspartate dehydrogenase gene used in the present invention may be a DNA encoding a polypeptide having aspartate dehydrogenase activity, which comprises an amino acid sequence in which one or more amino acids have been deleted, substituted, or added in any of the amino acid sequences of SEQ ID NOs: 16 to 27. In the present invention, "multiple" refers to, for example, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1.

[0021] The aspartate dehydrogenase gene to be introduced in the present invention is preferably a DNA encoding a polypeptide consisting of the amino acid sequence (SEQ ID NOS: 16 to 27) of aspartate dehydrogenase derived from Candidatus Hydrothermae bacterium, Glaciecola sp. 33A, Mesorhizobium sp. M7D.F.Ca.US.005.01.1.1, Rhodospirillaceae bacterium, Bacillus kochii, Novosphingobium rosa, Archaeoglobus fulgidus, Arthrobacter sp. 161MFSha2.1, Oceanotoga teriensis, Marinintoga sp. 1155, Thermotogales bacterium 46_20, or Thermotoga maritima, in terms of high aspartate and / or methionine production efficiency, and more preferably a DNA encoding a polypeptide consisting of the amino acid sequence of aspartate dehydrogenase derived from Mesorhizobium sp. More preferred is a DNA encoding a polypeptide consisting of the amino acid sequence of aspartate dehydrogenase derived from M7D.F.Ca.US.005.01.1.1, Arthrobacter sp. 161MFSha2.1, Oceanotoga teriensis, or Thermotogales bacterium 46_20 (SEQ ID NO: 18, 23, 24, or 26).

[0022] The aspartate dehydrogenase activity of the present invention can be determined by those skilled in the art using common techniques. For example, the aspartate dehydrogenase activity can be confirmed by reacting the obtained polypeptide with oxaloacetate in the presence of NADH and detecting the absorbance at 340 nm. Aspartate dehydrogenase produces aspartic acid from oxaloacetate. Since aspartate dehydrogenase consumes NADH when producing aspartic acid from oxaloacetate, a decrease in the amount of NADH can be detected using a decrease in absorbance at 340 nm as an indicator. If the test polypeptide reduces the absorbance at 340 nm even slightly, it can be determined that the test polypeptide has aspartate dehydrogenase activity.

[0023] (2) Method for producing transformants Next, a method for obtaining a transformant by introducing an aspartate dehydrogenase gene into a bacterium of the genus Hydrogenophilus will be described. In the present invention, the bacterium of the genus Hydrogenophilus into which the aspartate dehydrogenase gene is introduced is not particularly limited. It may be a bacterium isolated from nature, or a bacterium isolated from nature that has been genetically modified to enable high expression of the introduced aspartate dehydrogenase gene. This modification can be achieved by, for example, removing the endogenous plasmid in the bacterium of the genus Hydrogenophilus. Techniques for removing (curing) the endogenous plasmid that can be used in the present invention may be methods known in the art, such as, but not limited to, methods using chemicals (e.g., methods using novobiocin, SDS, acriflavine, ethidium bromide, etc.) or methods using plasmid incompatibility (e.g., methods of destabilizing the endogenous plasmid by introducing a plasmid with the same replication origin as the endogenous plasmid, or methods of destabilizing the endogenous plasmid by disrupting factors involved in the plasmid partition system).

[0024] Examples of Hydrogenophilus bacteria that can be used in the present invention include Hydrogenophilus thermoluteolus, Hydrogenophilus halorhabdus, Hydrogenophilus denitrificans, Hydrogenophilus hirschii, Hydrogenophilus islandicus, and the Hydrogenophilus bacterium Mar3 strain (Hydrogenophilus sp. Mar3). Of these, Hydrogenophilus thermoluteolus is preferred due to its high growth rate and carbon dioxide fixation ability as a carbon dioxide fixation microorganism, and the Hydrogenophilus thermoluteolus TH-1 (NBRC 14978) strain is particularly preferred. The Hydrogenophilus thermorteolus TH-1 strain exhibits the highest growth rate among carbon dioxide-fixing microorganisms (doubling in one hour) (Agricultural and Biological Chemistry, 41, 685-690 (1977)). The Hydrogenophilus thermorteolus TH-1 (NBRC 14978) strain has been internationally deposited under the Budapest Treaty. Furthermore, the most preferred strain for use in the present invention is the Hydrogenophilus thermorteolus TH-1C strain, which can be prepared based on the examples described herein.

[0025] Introduction of the aspartate dehydrogenase gene into a bacterium belonging to the genus Hydrogenophilus to produce the transformant of the present invention can be carried out using methods commonly used in the art for introducing foreign genes into bacteria. Introduction of the aspartate dehydrogenase gene into a bacterium belonging to the genus Hydrogenophilus in the present invention can be carried out by directly introducing the aspartate dehydrogenase gene into the bacterium, or by incorporating the gene into a vector for transformation (e.g., a plasmid vector, a viral vector, a cosmid, a fosmid, a BAC, a YAC, etc.) and then introducing the incorporated vector into the bacterium belonging to the genus Hydrogenophilus. The vector used for the introduction in the present invention may be any commonly used vector, as long as it contains DNA capable of autonomously replicating in Hydrogenophilus bacteria. For example, broad-host-range vectors such as pRK415 (GenBank: EF437940.1), pBHR1 (GenBank: Y14439.1), pMMB67EH (ATCC 37622), pCAR1 (NCBI Reference Sequence: NC_004444.1), pC194 (NCBI Reference Sequence: NC_002013.1), pK18mobsacB (GenBank: FJ437239.1), and pUB110 (NCBI Reference Sequence: NC_001384.1), or genetically modified versions of these vectors (e.g., pCAMO-4). The vector that can be used for the introduction in the present invention is preferably pCAMO-4, which can be prepared by those skilled in the art according to the examples below. In addition, examples of promoters contained in the vectors used in the present invention include the tac promoter, lac promoter, trc promoter, and the OXB1, OXB11 to OXB20 promoters from Oxford Genetics. Preferred terminators include the rrnB T1T2 terminator of the Escherichia coli rRNA operon, the bacteriophage λt0 transcription terminator, and the T7 terminator.The aspartate dehydrogenase gene used in the present invention can be introduced (transformed) into a bacterium belonging to the genus Hydrogenophilus by any general method that allows the vector to be introduced so that it can autonomously replicate within the bacterium, such as the calcium chloride method, the calcium phosphate method, the DEAE-dextran-mediated transfection method, and the electric pulse method (electroporation method).

[0026] (3) Method for producing aspartic acid and / or methionine In a further aspect, the present invention provides a method for producing aspartic acid and / or methionine using the transformant described herein. The method of the present invention includes a step of culturing the transformant described herein using carbon dioxide as substantially the sole carbon source. The culturing step in the method of the present invention may include culturing the transformant in an inorganic or organic medium while supplying a mixed gas containing hydrogen, oxygen, and carbon dioxide. The supplied gas is preferably a mixed gas consisting of hydrogen, oxygen, and carbon dioxide, but other gases may be mixed in as long as aspartic acid and / or methionine can be efficiently produced.

[0027] The transformant Hydrogenophilus bacteria used in the method of the present invention can grow using hydrogen as an energy source and carbon dioxide as the sole carbon source. Therefore, by producing the above-mentioned compounds using substantially only carbon dioxide as a carbon source (especially using only carbon dioxide), carbon dioxide can be efficiently fixed. Therefore, in the method of the present invention, it is preferable to use an inorganic medium that does not contain carbon sources such as organic substances or carbonates, i.e., to culture using substantially only carbon dioxide as a carbon source (especially carbon dioxide as the sole carbon source). In the present invention, "using carbon dioxide as substantially the sole carbon source" also encompasses the case where unavoidable amounts of other carbon sources are mixed in. The method of the present invention can also use a medium that does not supply carbon dioxide and contains organic substances such as sugars, organic acids, and amino acids, or carbonates. The pH of the medium used in the method of the present invention is preferably 6.2 to 8, more preferably 6.4 to 7.4, and even more preferably 6.6 to 7. Within this range, bacterial growth and mixed gas solubility in the medium are high, allowing for highly efficient production of aspartic acid and / or methionine. In the method of the present invention, when batch culture is used, the mixed gas can be sealed in a sealed culture vessel and cultured statically or with shaking. When continuous culture is used, the mixed gas can be continuously supplied to a sealed culture vessel while cultured with shaking, or the mixed gas can be introduced into the medium by bubbling in a sealed culture vessel while culturing the transformant. In the method of the present invention, shaking culture is preferred because it improves the dissolution of the mixed gas into the medium. The volume ratio of hydrogen, oxygen, and carbon dioxide (hydrogen:oxygen:carbon dioxide) in the feed gas used in the method of the present invention is preferably 1.75 to 7.5:1:0.25 to 3, more preferably 5 to 7.5:1:1 to 2, and even more preferably 6.25 to 7.5:1:1.5. Within this range, bacterial growth is favorable and the target compound can be efficiently produced. The supply rate of the mixed gas or raw material gas used in the method of the present invention is 10.5 to 60 L / hour, preferably 10.5 to 40 L / hour, and more preferably 10.5 to 21 L / hour per L of medium. Within this range, the growth of the transformant is favorable, the target compound can be produced efficiently, and waste of the mixed gas can be reduced.The culture temperature used in the method of the present invention is preferably 35 to 55° C., more preferably 37 to 52° C., and even more preferably 50 to 52° C. Within this range, the transformant grows well and aspartic acid and / or methionine can be produced efficiently.

[0028] In the method of the present invention, aspartic acid and / or methionine are produced in the culture medium by culturing as described above. The aspartic acid and / or methionine can be recovered by recovering the culture medium. Furthermore, aspartic acid and / or methionine can also be separated from the culture medium by known methods, such as precipitation, distillation, chromatography, and electrodialysis. [Example]

[0029] The present invention will now be described with reference to examples, but the technical scope of the present invention is not limited to the following examples.

[0030] Construction of plasmid vector (pCAMO-4) The method for constructing the plasmid vector (pCAMO-4) used to introduce the AspDH gene is described below. (1) Preparation of tac promoter DNA fragment The following pair of primers was synthesized and used to amplify the tac promoter DNA fragment using the plasmid pMAL-c5X (New England Biolabs) as a template. PCR was performed using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as a reaction reagent, according to standard procedures. Primers for amplifying the tac promoter (a-1) 5'- TTTTATAA CCCGGG CCATCGACTGCACGGTGCACC-3' (SEQ ID NO: 31) (b-1) 5'- TGCTAGCACTGTTTCCTGTGTGAAATTGTTATCCG -3' (SEQ ID NO: 32) The primer (a-1) has an SmaI restriction enzyme site added thereto as shown by the underline. 2 μL of the reaction mixture prepared above was subjected to electrophoresis on a 1% agarose gel, and a DNA fragment of approximately 0.3 kbp corresponding to the tac promoter was detected.

[0031] (2) Preparation of DNA fragments from the multicloning region To prepare a DNA fragment of the multicloning region, the following pairs of primers were synthesized and used in PCR to generate the first and second halves. PCR was performed using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as reaction reagents in a standard manner. In practice, no template DNA is involved; the 3' ends of each pair of primers anneal and extend to form double-stranded DNA. Primer for preparing the first half of the multicloning region (a-2) 5'-GGAAACAGTGCTAGCAGATCTGGAGGAGAAACGCATAT-3' (SEQ ID NO: 33) (b-2) 5'- CAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGAATTCGGATCCGATATCAGCATATGCGTTTCTCCTCCAGA -3' (SEQ ID NO: 34) The 3'-terminal base sequences of primers (a-2) and (b-2) are complementary to each other. Primer for preparing the latter half of the multicloning region (a-3) 5'- ACAAGCTTGCGGCCGCACTGCAGCACCATCACCACCATCATTGATAAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCT -3' (SEQ ID NO: 35) (b-3) 5'- TATTTGAATCGAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTGT -3' (SEQ ID NO: 36) The 3'-terminal base sequences of primers (a-3) and (b-3) are complementary to each other. 20 μL of the reaction mixture was electrophoresed on a 1% agarose gel, and DNA fragments of approximately 0.1 kbp each, corresponding to the first and second halves of the multicloning region, were detected. Each DNA fragment was excised from the agarose gel, and the DNA was recovered from the gel by freezing and thawing. Overlap extension PCR was performed using the recovered DNA fragments corresponding to the first and second halves of the multicloning region as templates. The 5'-terminal base sequences of primers (b-2) and (a-3), used to amplify the template DNA fragments, are complementary to each other. For overlap extension PCR, a combination of primers (a-2) and (b-3) was used to generate DNA from the multicloning region. PCR was performed using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as reaction reagents, according to standard procedures. 2 μL of the reaction mixture prepared above was subjected to electrophoresis on a 1% agarose gel, and a DNA fragment of approximately 0.2 kbp corresponding to the multicloning region was detected.

[0032] (3) Preparation of a DNA fragment containing the rrnB terminator and the replication origin of pUC19 The following pair of primers was synthesized and used to amplify the DNA fragment of the rrnB terminator using the plasmid pMAL-c5X (New England Biolabs) as a template. Primers for amplifying the rrnB terminator (a-4) 5'-TAACTCGATTCAAATAAAACGAAAGGCTCAGTCGA-3' (SEQ ID NO: 37) (b-4) 5'-CCTAGATCCGCGGAGTTTGTAGAAACGCAAAAAGG-3' (SEQ ID NO: 38) The following pair of primers was synthesized and used to amplify a DNA fragment of the DNA replication origin using the plasmid pUC19 as a template. Primers for amplifying the DNA replication origin of pUC19 (a-5) 5'- ACAAACTCCGCGGATCTAGGTGAAGATCCTTTTTG-3' (SEQ ID NO: 39) (b-5) 5'- CGTCCGCGGCCAGCAAAAGGCCAGGAACCGTAAAA -3' (SEQ ID NO: 40) PCR was performed using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as reaction reagents according to standard procedures. 20 μL of each reaction mixture was electrophoresed on a 1% agarose gel, and DNA fragments of approximately 0.3 kbp were detected for the rrnB terminator and approximately 0.8 kbp for the pUC19 DNA replication origin. Each DNA fragment was excised from the agarose gel, and the gel was frozen and thawed to recover the DNA. Overlap extension PCR was performed using the recovered DNA fragments corresponding to the rrnB terminator and pUC19 DNA replication origin as templates. The 5'-terminal base sequences of primers (b-4) and (a-5) used to amplify this template DNA fragment are complementary to each other. For overlap extension PCR, the combination of primers (a-4) and (b-5) was used to generate a DNA fragment linking the rrnB terminator and the replication origin of pUC19. PCR was performed in a standard manner using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as a reaction reagent. 2 μL of the reaction mixture produced above was electrophoresed on a 1% agarose gel, and a DNA fragment of approximately 1.0 kbp corresponding to the DNA in which the rrnB terminator and the replication origin region of pUC19 were ligated was detected.

[0033] (4) Preparation of neomycin / kanamycin resistance gene DNA fragment The following pair of primers was synthesized and used to amplify a DNA fragment of the neomycin / kanamycin resistance gene (hereinafter sometimes referred to as the "nptII gene") using pK18mobsacB [GenBank: FJ437239.1; Gene, 145, 69-73 (1994)] as a template. PCR was performed by standard methods using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as a reaction reagent. Primers for amplifying the nptII gene (a-6) 5'-TTGCTGGCCGCGGACGTAGAAAGCCAGTCCGCAGA-3' (SEQ ID NO: 41) (b-6) 5'-GG CCCGGG TTATAAAAGCCAGTCATTAGGCCTATC-3' (SEQ ID NO: 42) The primer (b-6) has an SmaI restriction enzyme site added thereto as underlined. 2 μL of the reaction mixture prepared above was subjected to electrophoresis on a 1% agarose gel, and a DNA fragment of approximately 1.0 kbp corresponding to the nptII gene was detected.

[0034] (5) Construction of a circular plasmid by ligating the DNA fragments (1) to (4) The DNA fragments prepared in steps (1) through (4) share 16 bp of homology with each other: the end of DNA fragment (1) shares the ends of DNA fragments (4) and (2), the end of DNA fragment (2) shares the ends of DNA fragments (1) and (3), the end of DNA fragment (3) shares the ends of DNA fragments (2) and (4), and the end of DNA fragment (4) shares the ends of DNA fragments (3) and (1). Therefore, DNA fragments (1), (2), (3), and (4) can be ligated to form a circular DNA by Gibson assembly. To ligate the DNA fragments prepared in steps (1) through (4) to form a circular DNA, Gibson assembly was performed using the Gibson Assembly Master Mix (New England BioLabs). The resulting reaction mixture was used to transform Escherichia coli JM109 by the calcium chloride method and plated on LB agar medium containing 50 μg / mL kanamycin. The strain growing on the medium was cultured in liquid culture by the usual method, and the plasmid DNA was extracted from the culture medium and confirmed by cleaving the plasmid with the restriction enzyme SmaI. As a result, a DNA fragment of approximately 2.3 kbp was observed, which corresponds to the size of a single DNA fragment formed by ligating the DNA fragments prepared in (1) to (4). This circular plasmid DNA, which replicates in E. coli, was designated pCAMO-1.

[0035] (6) Construction of plasmid vector (pCAMO-4) Hydrogenophilus thermoluteolus TH-1 strain (NBRC 14978) was cultured in liquid medium A [(NH4)2SO4 3.0 g, KH2PO4 1.0 g, K2HPO4 2.0 g, NaCl 0.25 g, FeSO4 7H2O 0.014 g, MgSO4 7H2O 0.5 g, CaCl2 0.03 g, MoO3 4.0 mg, ZnSO4 7H2O 28 mg, CuSO4 5H2O 2.0 mg, H3BO3 4.0 mg, MnSO4 5H2O 4.0 mg, and CoCl2 6H2O 4.0 mg dissolved in 1 L of distilled water (pH 7.0)] for 5 min. The bacteria were inoculated into a test tube containing 1 mL of HO using a platinum loop, and the tube was filled with a gas mixture of H2:O2:CO2 = 7.5:1:1.5. The tube was then cultured with shaking at 50°C. The endogenous plasmid pTH1 [Microbiol Resour Announc. 2018 Aug 16;7(6)] was extracted from the culture medium using the standard alkaline SDS method. The prepared pTH1 of about 66 kbp was cleaved with restriction enzymes ScaI and PvuII, and the above-prepared plasmid pCAMO-1 was cleaved with restriction enzyme SmaI, and then ligated together using T4 DNA ligase (Takara Bio Inc.).

[0036] The resulting ligation solution was used to transform the Hydrogenophilus thermorteolus strain TH-1 by electroporation. The transformants were grown on solid medium A containing 50 μg / mL kanamycin [(NH4)2SO4 3.0 g, KH2PO4 1.0 g, K2HPO4 2.0 g, NaCl 0.25 g, FeSO4 7H2O 0.014 g, MgSO4 7H2O 0.5 g, CaCl2 0.03 g, MoO3 4.0 mg, ZnSO4 7H2O 28 mg, CuSO4 5H2O 2.0 mg, H3BO3 4.0 mg, MnSO4 5H2O 4.0 mg, CoCl2 6H2O 4.0 mg, and 15 g of agar dissolved in 1 L of distilled water (pH 7.0). The seven strains were plated on a plate containing 100 ml of PBS and cultured at 50°C for 60 hours in a chamber filled with a 7.5:1:1.5 H2:O2:CO2 gas mixture. Seven strains grown on solid medium A were inoculated into test tubes containing 5 mL of liquid medium A containing 50 μg / mL kanamycin using a platinum loop. The test tubes were filled with a 7.5:1:1.5 H2:O2:CO2 gas mixture and cultured at 50°C with shaking. Plasmid DNA was extracted from the culture medium and electrophoresed on a 1% agarose gel. The results showed that all seven strains contained the same plasmid DNA of approximately 5.5 kbp.

[0037] Using the extracted plasmid as a template, the following pair of primers corresponding to both sides of the SmaI restriction enzyme site of pCAMO-1 were synthesized and used to amplify the DNA fragment of the endogenous plasmid pTH1 inserted into the SmaI restriction enzyme site of pCAMO-1. PCR was performed by standard methods using a Life Technologies DNA Thermal Cycler and KOD FX Neo (Toyobo Co., Ltd.) as a reaction reagent. Primers for amplifying the inserted pTH1 DNA fragment (a-7) 5'- AATTGTCAGATAGGCCTAATGACTGGCTTTTATAA -3' (SEQ ID NO: 43) (b-7) 5'-TGACGCCAGAAGCATTGGTGCACCGTGCAGTCGAT-3' (SEQ ID NO: 44) 2 μL of the reaction mixture was electrophoresed on a 1% agarose gel, and a DNA fragment of approximately 3.2 kbp was detected. In other words, the resulting plasmid contained a 3.2 kbp DNA fragment, a portion of pTH1, inserted into the SmaI restriction enzyme site of the pCAMO-1 plasmid. Because this 3.2 kbp DNA fragment contained a replication origin that functions in Hydrogenophilus thermorteolus cells, the resulting plasmid replicated in Hydrogenophilus thermorteolus cells. The constructed plasmid was named pCAMO-4 and used as a plasmid vector for introducing genes into Hydrogenophilus thermorteolus.

[0038] Transformants capable of producing aspartic acid and methionine Cloning of the aspartate dehydrogenase gene DNA consisting of the base sequences of the aspartate dehydrogenase genes from each of the bacteria selected as follows (Candidatus Hydrothermae bacterium (SEQ ID NO: 1), Glaciecola sp. 33A (SEQ ID NO: 2), Mesorhizobium sp. M7D.F.Ca.US.005.01.1.1 (SEQ ID NO: 3), Rhodospirillaceae bacterium (SEQ ID NO: 4), Candidatus Altiarchaeales archaeon IMC4 (SEQ ID NO: 13), Bacillus kochii (SEQ ID NO: 5), Novosphingobium rosa (SEQ ID NO: 6), Mumia flava (SEQ ID NO: 14), Archaeoglobus fulgidus (SEQ ID NO: 7), Arthrobacter sp. 161MFSha2.1 (SEQ ID NO: 8), Oceanotoga teriensis (SEQ ID NO: 9), Marinotoga sp. 1155 (SEQ ID NO: 10), Thermotogales bacterium (SEQ ID NO: 11), Thermotoga maritima (SEQ ID NO: 12), and Amycolatopsis thermoflava (SEQ ID NO: 15) were synthesized by Eurofins Genomics K.K.

[0039] A BLAST search (database: NCBI) was performed using the amino acid sequence of the AspDH gene from Thermotoga maritima (SEQ ID NO: 27) as a query, and sequences predicted to be AspDH genes from 14 types of fungi were selected. A BLAST search was performed against AspDH amino acid sequences previously reported in non-patent literature and amino acid sequences described in patent literature (database: dgene) to determine homology with the collected amino acid sequences. As a result, these amino acid sequences were found to have very low homology, approximately 50%, with the exception of Archaeoglobus fulgidus. Therefore, it was not clear that polypeptides having amino acid sequences derived from Candidatus Hydrothermae bacterium (SEQ ID NO: 16), Glaciecola sp. 33A (SEQ ID NO: 17), Mesorhizobium sp. M7D.F.Ca.US.005.01.1.1 (SEQ ID NO: 18), Rhodospirillaceae bacterium (SEQ ID NO: 19), Bacillus kochii (SEQ ID NO: 20), Novosphingobium rosa (SEQ ID NO: 21), Arthrobacter sp. 161MFSha2.1 (SEQ ID NO: 23), Oceanotoga teriensis (SEQ ID NO: 24), Marinitog a sp. 1155 (SEQ ID NO: 25), and Thermotogales bacterium (SEQ ID NO: 26) had AspDH activity.

[0040] Construction of an expression plasmid for the AspDH gene The plasmid into which the synthetic gene of AspDH was cloned was digested with the restriction enzymes NdeI and NotI, and then subjected to electrophoresis on a 1% agarose gel. The DNA fragment corresponding to the synthetic gene of AspDH was excised from the agarose gel, and the DNA fragment of the synthetic gene of AspDH was recovered from the gel by freezing and thawing.

[0041] The plasmid vector pCAMO-4 was digested with the restriction enzymes NdeI and NotI and ligated to the DNA fragment of the AspDH synthetic gene synthesized above using T4 DNA ligase (Takara Bio Inc.). The endogenous plasmid was removed from the Hydrogenophilus thermorteolus TH-1 strain by a standard method to obtain a cured strain (TH-1C strain).

[0042] The resulting ligation solution was used to transform the Hydrogenophilus thermorteolus TH-1C strain by electroporation, and the transformed cells were spread on solid medium A containing 50 μg / mL of kanamycin. The cells were then cultured at 50°C for 60 hours in a chamber filled with a gas mixture of H2:O2:CO2 = 7.5:1:1.5.

[0043] Each strain growing on solid medium A was inoculated into a test tube containing 5 mL of liquid medium A containing 50 μg / mL kanamycin using a platinum loop. The tube was filled with a gas mixture of H2:O2:CO2 (7.5:1:1.5), and the culture was incubated with shaking at 50°C. Plasmid DNA was extracted from the culture medium. Each plasmid was digested with restriction enzymes NdeI and NotI to confirm the inserted fragment. In addition to the approximately 5.5 kbp DNA fragment of plasmid pCAMO-4, an approximately 0.8 kbp inserted fragment corresponding to the AspDH gene was also identified. Plasmids containing the AspDH gene from various bacteria and the Hydrogenophilus thermorteolus TH-1C strain transformed with these plasmids were named as shown in Table 1 below.

[0044] Aspartate and methionine production The strain of Hydrogenophilus thermorteolus carrying the aspartate dehydrogenase gene was inoculated into liquid medium A containing 50 μg / mL kanamycin using a platinum loop. A gas mixture of H2:O2:CO2 (7.5:1:1.5) was supplied during the culture, and the culture was cultured at 50°C for 72 to 96 hours with shaking. After the culture, the culture supernatant was centrifuged (4°C, 15,000 rpm, 1 minute) and the aspartate and methionine contents were quantified. As shown in Table 1, aspartate and methionine were found to be produced in the culture supernatant.

[0045] [Table 1] As shown in Table 1, the strains into which the aspartate dehydrogenase gene of the present invention derived from various strains of Hydrogenophilus thermorteolus was introduced had aspartic acid concentrations of 0.9 to 137.8 μM and methionine concentrations of 0.9 to 10.3 μM as a result of cultivation, demonstrating that they have extremely high aspartic acid and methionine production abilities compared to control strains (bacteria other than those derived from the seed strain of the present invention (AspDH005, 008, 015) and a strain not containing the AspDH gene (pCAMO-4 / TH-1C)).

[0046] Furthermore, all strains described herein (including ATCC strains and NBRC strains) have been internationally deposited under the Budapest Treaty, are held by an institution from which they may be obtained without condition, are commercially available, or can be prepared by those skilled in the art based on the present specification and are publicly available. [Industrial Applicability]

[0047] The transformant of the present invention can produce aspartic acid and / or methionine with high efficiency using carbon dioxide as the sole carbon source, thereby enabling the industrial production of chemical products with high efficiency while solving global warming caused by increased carbon dioxide. Specifically, the Hydrogenophilus bacterium used in the present invention has particularly excellent carbon dioxide fixation ability among organisms capable of carbon dioxide fixation. Therefore, the transformant of the present invention can fix carbon dioxide and produce aspartic acid and / or methionine on an industrial scale. Furthermore, since aspartic acid and / or methionine are used as raw materials for various chemical products, such as aspartame sweeteners, biodegradable polymers, feed additives, and pharmaceuticals, the present invention enables the industrial production of products using carbon dioxide alone as a carbon source, without using expensive sugars or petroleum-based raw materials that pose a global warming problem.

Claims

1. A transformant obtained by introducing an aspartate dehydrogenase gene into a bacterium belonging to the genus Hydrogenophilus, wherein the bacterium is Hydrogenophilus thermorteolus.

2. The transformant according to claim 1, wherein the aspartate dehydrogenase gene is a DNA selected from any one of the following (1) to (6): (1) DNA consisting of the base sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11; (2) DNA consisting of a base sequence having 90% or more identity to any one of SEQ ID NOs: 1 to 11, which encodes a polypeptide having aspartate dehydrogenase activity; (3) A DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to any one of SEQ ID NOs: 1 to 11 and encodes a polypeptide having aspartate dehydrogenase activity; (4) DNA encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26; (5) A DNA encoding a polypeptide having aspartate dehydrogenase activity, the polypeptide consisting of an amino acid sequence having 90% or more identity to any one of SEQ ID NOs: 16 to 26; and (6) A DNA encoding a polypeptide having an amino acid sequence in which one or more amino acids are deleted, substituted, or added in any one of the amino acid sequences of SEQ ID NOs: 16 to 26 and having aspartate dehydrogenase activity.

3. The transformant according to claim 1 or 2, wherein the aspartate dehydrogenase gene is a DNA selected from any one of the following (1) to (6): (1) DNA consisting of the base sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11; (2) DNA consisting of a base sequence having 90% or more identity to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11, which encodes a polypeptide having aspartate dehydrogenase activity; (3) DNA that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11 and encodes a polypeptide having aspartate dehydrogenase activity; (4) DNA encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26; (5) DNA encoding a polypeptide having aspartate dehydrogenase activity, which is a polypeptide consisting of an amino acid sequence having 90% or more identity to SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26; and (6) A DNA encoding a polypeptide having aspartate dehydrogenase activity, which consists of an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO:

26.

4. The transformant according to any one of claims 1 to 3, wherein the aspartate dehydrogenase gene is a DNA selected from any one of the following (1) to (6): (1) DNA consisting of the base sequence of SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10; (2) DNA consisting of a base sequence having 90% or more identity with SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10, which encodes a polypeptide having aspartate dehydrogenase activity; (3) DNA that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10 and encodes a polypeptide having aspartate dehydrogenase activity; (4) DNA encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25; (5) DNA encoding a polypeptide having aspartate dehydrogenase activity, the polypeptide consisting of an amino acid sequence having 90% or more identity to SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25; and (6) A DNA encoding a polypeptide having aspartate dehydrogenase activity, which consists of an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO:

25.

5. The transformant according to any one of claims 1 to 4, wherein the Hydrogenophilus thermorteolus is a Hydrogenophilus thermorteolus TH-1C strain.

6. A method for producing aspartic acid, comprising a step of culturing the transformant according to any one of claims 1 to 5 using carbon dioxide as substantially the only carbon source.

7. A method for producing methionine, comprising a step of culturing the transformant according to any one of claims 1 to 5 using carbon dioxide as substantially the only carbon source.

Images