Methods for generating novel mutations in organisms and their applications

The method of sequential DNA breaks in the genome using nucleases like ZFN, TALEN, or CRISPR/Cas systems addresses the inefficiency of site-specific base substitution, enabling diverse mutations and improved editing efficiency for plant breeding and cell therapy.

JP7822931B2Active Publication Date: 2026-03-03QINGDAO KINGAGROOT SEED SCI CO LTD
View PDF 11 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2020-10-13
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Existing gene editing technologies face challenges in efficiently achieving site-specific base substitution mutations without introducing exogenous DNA templates, leading to biosafety concerns and low editing efficiency, particularly in long-term plant breeding and cell therapy applications.

Method used

A method involving sequential DNA breaks at specific sites in the genome without an artificial DNA template, using nucleases like ZFN, TALEN, or CRISPR/Cas systems, where subsequent breaks are generated based on the repair of previous breaks, allowing for multiple mutations and diverse repair events.

Benefits of technology

This approach enhances the efficiency of site-specific base substitution and introduces a variety of mutations, including deletions and insertions, suitable for generating novel mutations and providing tools for editing and therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007822931000035
    Figure 0007822931000035
  • Figure 0007822931000036
    Figure 0007822931000036
  • Figure 0007822931000037
    Figure 0007822931000037
Patent Text Reader

Abstract

The present invention relates to the technical field of genetic engineering, and in particular to a method for creating site-specific mutations in organisms without the use of artificial DNA templates, and its use. This method comprises the following steps: consecutively creating two or more DNA breaks at specific sites in the genome of an organism, and then spontaneously repairing each of them, and the subsequent DNA breaks are generated based on the new sequence generated from the previous DNA break repair. In the present invention, new targets are designed based on the sequence generated by the new repair events caused by consecutive editing, and thus mutations can be created multiple times consecutively at specific sites in the genome, thereby greatly increasing the types of repair events after DNA breaks, and realizing new base substitutions, deletions and insertion mutations that cannot be seen by single gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

REFERENCE TO RELATED APPLICATIONS

[0001] Priority information This application claims the benefit of Chinese Patent Application No. 201911081617.X, filed November 7, 2019, Chinese Patent Application No. 202010821877.2, filed August 15, 2020, and Chinese Patent Application No. 202010974151.2, filed September 16, 2020, the entire contents of which are incorporated herein by reference. [Technical Field]

[0002] The present invention relates to the technical field of genetic engineering, and in particular to a method and its use for creating site-specific mutations in organisms in the absence of an artificial DNA template. [Background technology]

[0003] Genetic engineering techniques for modifying the genome of organisms are widely used in industrial and agricultural production, such as genetically modified microorganisms commonly used in pharmaceutical and chemical fields, and genetically modified crops with insect and herbicide resistance in agriculture. The emergence of site-specific nucleases has made it possible to achieve site-specific editing of genomes and more precise genome modification by introducing targeted fragmentation into the genome of recipient organisms and causing spontaneous repair.

[0004] Gene editing tools mainly include three types of sequence-specific nucleases (SSNs): zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas systems (CRISPR / Cas systems). Sequence-specific nucleases are programmable nucleases that can create DNA double-strand breaks (DSBs) at specific sites in the genome. DNA double-strand breaks activate endogenous DNA repair pathways to repair DNA damage in cells, and the repair process easily results in changes to the DNA sequence at the target site, thereby achieving the introduction of mutations at the site of interest. This technology allows biologists to precisely target and edit target genes. Notably, both ZFNs and TALENs require the design of specific recognition protein modules for the target sequence, resulting in low throughput and complex operations. However, Cas proteins are versatile in the CRISPR / Cas system, in which guide RNAs (gRNAs) can be formed by specific CRISPR-RNAs (crRNAs) designed for the target site alone or in combination with transactivating RNAs (tracrRNAs), or a single guide RNA (sgRNA) alone is sufficient, and the crRNA and tracrRNA together or the sgRNA alone assemble with the Cas protein to form a ribonucleoprotein complex (RNP), and the target sequence is identified based on the protospacer adjacent motif (PAM) in the genome, thereby achieving site-specific editing, which has therefore become a mainstream gene editing method due to its simple operation, wide applicability and high throughput.

[0005] Sequence-specific nucleases create DNA double-strand breaks at specific sites in the genome. These DNA double-strand breaks can be repaired into a variety of different repair types, primarily base insertions or deletions. For example, the two most common types of CRISPR / Cas9 editing events are base insertions at the break or base deletions at the break (Shen et al. 2018. Predictable and precise template-free CRISPR editing of pathogenic variants. Nature. DOI: 10.1038 / s41586-018-0686-x). Base insertions or deletions in coding regions cause frameshift mutations, resulting in loss of gene function. Therefore, the primary purpose of the above gene editing tools remains gene knockout.

[0006] It has long been believed that base substitution mutations cannot be achieved solely through the use of sequence-specific nucleases. To address this issue, three solutions have been proposed in the prior art: 1) adding exogenous DNA fragments as repair templates to induce the homologous recombination repair pathway; 2) fusing deaminase with Cas9 to sequentially develop single base editing tools for C to T and A to G; and 3) fusing reverse transcriptase with Cas9 using pegRNA to guide the synthesis and replacement of small DNA strands. However, the editing efficiency of these three solutions is significantly lower than that of gene knockout, and the simultaneous introduction of exogenous DNA fragments and reverse transcriptase can easily lead to biosafety concerns. Off-target effects of single base editing also limit its potential application in cell therapy. Especially in long-term plant breeding projects, how to improve the efficiency of base substitution at target sites while mitigating regulatory concerns regarding biosafety is a key issue that needs to be addressed in the application of gene editing technology.

[0007] In summary, there is a pressing need in the fields of cell therapy and organism breeding for site-specific base substitution without the introduction of exogenous DNA fragments, particularly by using only targeted knockout of sequence-specific nucleases via non-transgenic transient editing systems to efficiently perform site-specific base substitution editing. Summary of the Invention

[0008] Summary of the Invention The present invention provides a method and use of that method for creating site-specific mutations in an organism simply by creating a double-strand break in the genome without providing an artificial DNA template.

[0009] The technical solutions adopted by the present invention are as follows: A method for generating novel mutations in an organism, comprising the steps of: sequentially generating two or more DNA breaks at specific sites in the genome of the organism, and spontaneously repairing each of the breaks, wherein the subsequent DNA breaks are generated based on the novel sequences generated from the repair of the previous DNA breaks.

[0010] In certain embodiments, "DNA cleavage" is achieved by delivering a nuclease with targeting properties into the cells of an organism so that it contacts a specific site in the genomic DNA.

[0011] In certain embodiments, the "nuclease with targeting properties" is a ZFN, TALEN or CRISPR / Cas system.

[0012] In certain embodiments, "sequentially creating two or more DNA breaks at a particular site" refers to a new ZFN or TALEN protein designed to re-cut the site based on a new sequence generated from a previous DNA break repair event caused by ZFN or TALEN editing.

[0013] In another specific embodiment, "sequentially creating two or more DNA breaks at a specific site" refers to designing a new target RNA to cut the site again based on a new sequence generated from a previous DNA break repair event caused by the CRISPR / Cas system. For example, a second cut is performed again at the site by designing a new target RNA based on a new sequence generated from the first cut repair event of Cas9 editing. Similarly, a third cut is performed at the site by designing a new target RNA based on a new sequence generated from the second cut repair event, as shown in Figure 1.

[0014] In certain embodiments, "two or more DNA breaks" are created by sequentially delivering different targeting nucleases to different generations of recipient cells, and mutant cells that have completed previous editing are used as recipients to require delivery of subsequent targeting nucleases for editing, thereby performing a second editing to generate site-specific mutations. This method is preferably used in ZFN and TALEN editing systems.

[0015] In another specific embodiment, the "two or more DNA breaks" are created by delivering different targeting nucleases for different targets into the same recipient cell. This method is preferably used in CRISPR / Cas editing systems.

[0016] In certain embodiments, "two or more DNA breaks" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each with a different gRNA or sgRNA, sequentially cleave corresponding target sequences.

[0017] In another specific embodiment, "two or more DNA breaks" are created when RNP complexes formed individually by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA sequentially cleave the corresponding target sequences. For example, the PAM sequence recognized by Streptococcus pyogenes Cas9 is "NGG" or "NAG" (Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", Science 2012, 337:816-821), the PAM sequence recognized by Staphylococcus aureus Cas9 is "NNGRRT" or "NNGRR(N)", the PAM sequence recognized by Neisseria meningitidis Cas9 is NNNNGATT, and the PAM sequence recognized by Streptococcus thermophilus Cas9 is NNAGAAW. Thus, the editable window of DNA molecules is larger.

[0018] In certain embodiments, the targeted nuclease is any CRISPR / Cas nuclease capable of achieving genome editing.

[0019] In certain embodiments, the targeted nuclease is in the form of DNA.

[0020] In another specific embodiment, the targeted nuclease is in the form of mRNA or protein rather than DNA, with the protein form being preferred.

[0021] In certain embodiments, the method for delivering the targeted nuclease to cells is selected from, but not limited to, 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; and 6) Agrobacterium-mediated transformation.

[0022] In this method, new targets are designed based on the new sequence generated from previous DNA break repair, and thus mutations can be continuously generated at specific sites in genome multiple times, thereby exponentially increasing the types of repair events after DNA break, and generating new types of base substitution, deletion and insertion mutations that cannot be seen by single gene editing, and therefore this method is suitable for use as a tool for generating new mutations.This method can be simply referred to as programmed sequential cutting / editing or sequential cutting / editing method.

[0023] In certain embodiments, novel targets are designed based on specific novel sequences predicted to be generated from previous excision repair at a particular site in the organism's genome, and then sequential edits are performed such that the possible final mutations at that site can be pre-designed to achieve the predicted edit.

[0024] In another specific embodiment, novel targets are designed based on novel sequences predicted to be generated from previous excision repair at a particular site in the genome of an organism, and then sequential editing is performed, ultimately generating a variety of different mutations at that site in addition to the predicted editing event; thus, this method can be used as a tool to generate a variety of different mutations.

[0025] In another aspect, the present invention further provides a method for generating a novel mutation in an organism, comprising the steps of: sequentially generating two or more DNA breaks at specific sites in a gene at the genome or chromosomal level of the organism, thereby achieving a precise base substitution, deletion, or insertion.

[0026] In certain embodiments, "sequentially creating two or more DNA breaks at a specific site" refers to a new target RNA being designed based on the new sequence generated from the previous break repair event, and cutting again at that same site.

[0027] In certain embodiments, "DNA cleavage" is achieved by nucleases with targeting properties.

[0028] The present invention further provides novel mutations obtained by the above-described methods.

[0029] The present invention further provides proteins or biologically active fragments thereof having the aforementioned novel mutations.

[0030] The present invention further provides a nucleic acid comprising a nucleic acid sequence encoding a protein or a biologically active fragment thereof, or its complementary sequence.

[0031] The present invention further comprises: (a) a nucleotide sequence encoding a target RNA; wherein the target RNA comprises at least two target RNAs, a first target RNA that targets a DNA and causes a cleavage in that DNA, and a second target RNA that targets a sequence generated from a previous cleavage repair event and provides nucleic acid that creates another cleavage.

[0032] In certain embodiments, the nucleic acid further comprises (b) a nucleotide sequence encoding a Cas polypeptide.

[0033] In certain embodiments, the target RNA is an sgRNA or a gRNA.

[0034] In certain embodiments, the Cas polypeptide and target RNA are present in an in vitro or ex vivo cell.

[0035] The present invention further provides a recombinant expression vector comprising the aforementioned nucleic acid and a promoter operably linked thereto.

[0036] The present invention further provides an expression cassette comprising the aforementioned nucleic acid.

[0037] The present invention further provides a host cell comprising the above-described expression cassette.

[0038] The present invention further provides organisms reproduced by using the aforementioned host cells.

[0039] The present invention further provides a method for lysing target DNA, comprising contacting the target DNA with a complex, the complex comprising: (a) a Cas polypeptide; and (b) at least two target RNAs, where a first target RNA targets the DNA and causes a cleavage in the DNA, and a second target RNA targets a sequence generated from a previous cleavage repair event and again creates a cleavage; The method comprises:

[0040] In certain embodiments, the target RNA is an sgRNA or a gRNA.

[0041] In certain embodiments, the target DNA is present in a bacterial cell, a eukaryotic cell, a plant cell, or an animal cell.

[0042] In certain embodiments, the target DNA is chromosomal DNA.

[0043] In certain embodiments, the Cas polypeptide and target RNA are present in an in vitro or ex vivo cell.

[0044] In certain embodiments, the contacting comprises introducing into the cell: (a) a Cas polypeptide or a polynucleotide encoding the Cas polypeptide, and (b) a target RNA or a DNA polynucleotide encoding the target RNA.

[0045] The present invention further comprises: (a) a Cas polypeptide, or a polynucleotide encoding the Cas polypeptide; and (b) at least two target RNAs, or DNA polynucleotides encoding those target RNAs, where a first RNA targets a DNA and causes a cleavage in that DNA, and a second target RNA targets a sequence generated from a previous cleavage repair event and again creates a cleavage; A composition comprising:

[0046] In certain embodiments, the target RNA is an sgRNA or a gRNA.

[0047] In certain embodiments, the Cas polypeptide and target RNA are present in an in vitro or ex vivo cell.

[0048] The invention further provides the use of the composition in the manufacture of a medicament for the treatment of a disease.

[0049] Diseases treatable with the compositions of the present invention include, but are not limited to, diseases caused by single gene mutations, such as type 1 tyrosinemia, phenylketonuria, progeria, sickle cell disease, etc. Spontaneous cellular repair is induced by delivering Cas proteins and crRNA or sgRNA compositions predicted to repair the pathogenic mutation site to cells to produce normal functional protein, thus providing a therapeutic effect.

[0050] The present invention further comprises: (a) a Cas polypeptide, or a nucleic acid comprising a nucleotide sequence encoding a Cas polypeptide; and (b) at least two target RNAs, or nucleic acids comprising nucleotide sequences encoding those target RNAs, where a first target RNA targets a DNA and causes a cleavage in that DNA, and a second target RNA targets a sequence generated from a previous cleavage repair event and again creates a cleavage. wherein (a) and (b) are in the same or separate containers.

[0051] In certain embodiments, the target RNA is an sgRNA or a gRNA.

[0052] In certain embodiments, the target RNA in (b) is in the same container or a separate container.

[0053] The present invention further provides a method for screening for editing events independent of exogenous transgenic markers, comprising the steps of: 1) two or more DNA breaks are successively created at specific sites in the sequence of a first target gene in a recipient cell, and each is spontaneously repaired, with subsequent DNA breaks being generated based on new sequences generated from the repair of the previous DNA break; 2) a specific editing event occurs after a specific site in the first target gene is sequentially cut and repaired, which confers resistance to a specific selective pressure in the mutant cell to produce a phenotypically selectable trait, and a corresponding selective pressure is applied to select for the trait, and cells, tissues, organs or whole organisms containing such editing events are isolated; 3) Optionally, a targeted nuclease for at least one second target gene is used in addition to the first target gene to simultaneously edit another target site, and the editing events for the second target gene are enriched and simultaneously screened via screening for a selectable trait generated by mutation of the first target gene, thereby isolating cells, tissues, organs, or whole organisms that simultaneously contain editing events for the first target gene and at least one editing event for the second target gene. The method comprises:

[0054] In certain embodiments, a "first target gene" is a genetic locus that encodes at least one phenotypic selectable trait, wherein said at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage.

[0055] In certain embodiments, a "specific site in a first target gene" refers to a site where, after sequential excision and repair, a specific type of mutation is generated that can confer resistance to a particular selective pressure on the recipient cell, resulting in at least one phenotypically selectable resistance / tolerance trait or growth advantage.

[0056] In certain embodiments, a "certain type of mutation" comprises a single base substitution, a multiple base substitution, or an insertion or deletion of an unspecified number of bases.

[0057] In certain embodiments, "certain selective pressure" may be environmental pressure or pressure resulting from an added compound; for example, environmental pressure may be high temperature, low temperature, or low oxygen; pressure resulting from an added compound may be pressure resulting from salt ion concentration, antibiotics, cytotoxins, herbicides, etc.

[0058] In certain embodiments, "DNA cleavage" is achieved by delivering a nuclease with targeting properties into the cells of an organism so that it contacts a specific site in the genomic DNA.

[0059] In certain embodiments, a "nuclease with targeting properties" is any CRISPR / Cas nuclease capable of performing genome editing.

[0060] In certain embodiments, the feature "two or more consecutive DNA breaks are created at a particular site in the sequence" refers to the fact that a new target RNA is designed to cut that site again based on the new sequence generated by the previous DNA break repair event generated by the CRISPR / Cas system.

[0061] In certain embodiments, the "two or more DNA breaks" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each carrying a different gRNA or sgRNA, sequentially cleave corresponding target sequences.

[0062] In another specific embodiment, "two or more DNA cleavages" are generated when two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA form RNP complexes that sequentially cleave the corresponding target sequences. Thus, the editable window of the DNA molecule is larger.

[0063] In certain embodiments, a "second target gene" refers to another gene whose coding differs from that of the first target gene.

[0064] In certain embodiments, the "targeted nuclease for at least one second target gene" and the CRISPR / Cas nuclease used to create a DNA break at a specific site in the first target gene are the same.

[0065] In another specific embodiment, the "targeting nuclease for at least one second target gene" and the CRISPR / Cas nuclease used to create DNA breaks at specific sites in the first target gene are different.In this way, there are more selectable editing sites in the second target gene.

[0066] In certain embodiments, the targeted nuclease is in the form of DNA.

[0067] In another specific embodiment, the targeted nuclease is in the form of mRNA or protein rather than DNA, with the protein form being preferred.

[0068] In certain embodiments, the method for delivering the targeted nuclease to cells is selected from, but not limited to, 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; or 6) Agrobacterium-mediated transformation.

[0069] The present invention further provides a method for non-transgenic transient editing of the genome of an organism, comprising the steps of: 1) designing and synthesizing a combination of at least two crRNA fragments or a combination of at least two sgRNA fragments for a specific site in a first target gene of a recipient cell, wherein the crRNA combination in combination with a tracrRNA or the sgRNA combination alone can guide a corresponding Cas protein to sequentially create two or more DNA breaks at the specific site in the first target gene of the recipient cell and spontaneously repair them, respectively, and the subsequent DNA breaks are generated based on the new sequences generated from the previous DNA break repair; 2) mixing an appropriate amount of CRISPR / Cas proteins or their corresponding mRNAs with the previously designed and synthesized combination of crRNA and tracrRNA fragments or a single sgRNA fragment combination capable of guiding site-specific editing of a first target gene to generate an endogenous selection marker, optionally further adding at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third, or subsequent target gene, and incubating in vitro to form an RNP complex; 3) delivering the RNP complex to a recipient cell and contacting it with a specific site in the genomic DNA to achieve gene editing; 4) Following the phenotypic selectable trait generated by site-specific editing of the first target gene by the RNP complex, a corresponding selective pressure is applied to select for that trait. a step of isolating a cell, tissue, organ or whole organism containing the editing event, optionally simultaneously isolating a cell, tissue, organ or whole organism containing an editing event in the first target gene and at least one editing event in a second, third or subsequent target gene; The method comprises:

[0070] In certain embodiments, a "first target gene" is a genetic locus that encodes at least one phenotypically selectable trait, wherein said at least one phenotypically selectable trait is , resistance / tolerance traits or growth advantage traits.

[0071] In certain embodiments, a "specific site in a first target gene" refers to a site where, after sequential excision and repair, a specific type of mutation is generated that can confer resistance to a particular selective pressure on the recipient cell, resulting in at least one phenotypically selectable resistance / tolerance trait or growth advantage.

[0072] In certain embodiments, a "certain type of mutation" comprises a single base substitution, a multiple base substitution, or an insertion or deletion of an unspecified number of bases.

[0073] In certain embodiments, the "certain selective pressure" may be environmental pressure or pressure resulting from an added compound, for example, the environmental pressure may be high temperature, low temperature, or low oxygen, and the pressure resulting from an added compound may be pressure resulting from salt ion concentration, an antibiotic, a cytotoxin, or a herbicide.

[0074] In certain embodiments, the CRISPR / Cas protein is a human CRISPR / Cas nuclease capable of performing genome editing.

[0075] In certain embodiments, the feature of "sequentially creating two or more DNA breaks at a specific site" refers to the fact that a new target RNA is designed to cut that site again based on the new sequence generated by the previous DNA break repair event generated by the CRISPR / Cas system.

[0076] In certain embodiments, "two or more DNA breaks" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each with a different gRNA or sgRNA, sequentially cleave corresponding target sequences.

[0077] In another specific embodiment, "two or more DNA cleavages" are generated when two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA form RNP complexes that sequentially cleave the corresponding target sequences. Thus, the editable window of the DNA molecule is larger.

[0078] In certain embodiments, a "second, third or subsequent target gene" refers to another gene whose code differs from the first target gene.

[0079] In certain embodiments, "at least one of the artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting the second, third, or subsequent target genes" has the same Cas protein as the crRNA or sgRNA targeting the first target gene.

[0080] In another specific embodiment, "at least one of the artificially synthesized crRNA and tracrRNA fragments or the artificially synthesized sgRNA fragments targeting the second, third, or subsequent target genes" and the crRNA or sgRNA targeting the first target gene use Cas proteins that recognize different PAM sequences. In this way, there are more selectable editing sites in the second target gene.

[0081] In certain embodiments, the method for delivering the RNP complex to cells is selected from, but not limited to, 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; or 5) gene gun bombardment.

[0082] The present invention further provides a method for non-transgenic transient editing of a plant genome, comprising the steps of: 1) a combination of at least two crRNA fragments or a combination of at least two sgRNA fragments is designed and synthesized for a specific site of a first target gene in a recipient plant cell or tissue, and the crRNA combination in combination with a tracrRNA or the sgRNA combination alone can guide a corresponding Cas protein to sequentially create two or more DNA breaks at the specific site of the first target gene in the recipient cell and spontaneously repair each of them, with the subsequent DNA breaks being generated based on the new sequence generated from the previous DNA break repair; 2) mixing an appropriate amount of CRISPR / Cas proteins or their corresponding mRNAs with the previously designed and synthesized combination of crRNA and tracrRNA fragments or a single sgRNA fragment combination capable of guiding site-specific editing of a first target gene to generate an endogenous selection marker, optionally further adding at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third, or subsequent target gene, and incubating in vitro to form an RNP complex; 3) delivering the RNP complex to a recipient plant cell or tissue and contacting it with a specific site in the genomic DNA to achieve gene editing; 4) according to the phenotypic selectable trait produced by site-specific editing of a first target gene by an RNP complex, applying a corresponding selection pressure to select for that trait, isolating cells, tissues, organs, or whole plants containing that editing event, and optionally isolating cells, tissues, organs, or whole plants containing simultaneously an editing event of the first target gene and at least one editing event of a second, third, or subsequent target gene.

[0083] In certain embodiments, a "first target gene" is a genetic locus that encodes at least one phenotypic selectable trait, wherein said at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage.

[0084] In certain embodiments, a "particular site in a first target gene" refers to a site at which, after sequential excision and repair, a particular type of mutation is generated that can confer resistance to a particular selective pressure on the recipient cell, resulting in at least one phenotypically selectable resistance / tolerance trait or growth advantage.

[0085] In certain embodiments, a "certain type of mutation" comprises a single base substitution, a multiple base substitution, or an insertion or deletion of an unspecified number of bases.

[0086] In certain embodiments, the "certain selective pressure" may be environmental pressure or pressure resulting from an added compound, for example, environmental pressure is preferably high temperature, low temperature, or low oxygen, and pressure resulting from an added compound may be pressure resulting from salt ion concentration, antibiotics, cytotoxins, or herbicides.

[0087] In a particular embodiment, a "recipient plant cell or tissue" is any cell or tissue that can serve as a recipient for transient expression and that can be regenerated into a whole plant by tissue culture. In particular, the cell is a protoplast or a suspension cell, and the tissue is preferably a callus, immature embryo, mature embryo, leaf, shoot tip, young panicle, hypocotyl, etc.

[0088] In certain embodiments, the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of performing genome editing.

[0089] In certain embodiments, the feature of "sequentially generating two or more DNA breaks at a specific site" refers to the fact that a new target RNA is designed to re-cut that site based on the new sequence generated by the previous DNA break repair event generated by the CRISPR / Cas system.

[0090] In certain embodiments, "two or more DNA breaks" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each with a different gRNA or sgRNA, sequentially cleave corresponding target sequences.

[0091] In another specific embodiment, "two or more DNA cleavages" are generated when two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA form RNP complexes that sequentially cleave the corresponding target sequences. Thus, the editable window of the DNA molecule is larger.

[0092] In certain embodiments, a "second, third or subsequent target gene" refers to another gene whose code differs from the first target gene.

[0093] In certain embodiments, "at least one of the artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting the second, third, or subsequent target genes" has the same Cas protein as the crRNA or sgRNA targeting the first target gene.

[0094] In another specific embodiment, "at least one of the artificially synthesized crRNA and tracrRNA fragments or the artificially synthesized sgRNA fragments targeting the second, third, or subsequent target genes" and the crRNA or sgRNA targeting the first target gene use Cas proteins that recognize different PAM sequences. In this way, there are more selectable editing sites in the second target gene.

[0095] In certain embodiments, the method for delivering RNP complex to plant cells is selected from, but not limited to: 1) PEG-mediated cell protoplast transformation method; 2) microinjection; 3) biolistic bombardment; 4) silicon carbide fiber-mediated method; or 5) vacuum infiltration method or any other transient introduction method.Biolistic bombardment is preferred.

[0096] In certain embodiments, the "first target gene" is at least one endogenous gene encoding at least one phenotypically selectable trait selected from herbicide resistance / tolerance, wherein the herbicide resistance / tolerance is resistance / tolerance to EPSPS inhibitors (including glyphosate), resistance / tolerance to glutamine synthase inhibitors (including glufosinate), resistance / tolerance to ALS or AHAS inhibitors (including imidazolines or sulfonylureas), resistance / tolerance to ACCase inhibitors (including aryloxyphenoxypropionic acid (FOP)), resistance / tolerance to carotenoid biosynthesis inhibitors (carotenoid biosynthesis inhibitors at the phytoene desaturase (PDS) step), 4 - resistance / tolerance to hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors or other carotenoid biosynthesis targeted inhibitors), resistance / tolerance to cellulose inhibitors, resistance / tolerance to lipid synthesis inhibitors, resistance / tolerance to long-chain fatty acid inhibitors, resistance / tolerance to microtubule polymerization inhibitors, resistance / tolerance to photosystem I electron shunt agents, resistance / tolerance to photosystem II inhibitors (including carbamates, triazines and triazones), resistance / tolerance to PPO inhibitors, and resistance / tolerance to synthetic growth hormones (including dicamba, 2,4-D (i.e., 2,4-dichlorophenoxyacetic acid)). Here, the first target gene is selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, TIR1, and AFB5, and several types of mutations generated after successive excision and repair at specific sites of these herbicide target genes can confer resistance / tolerance to the corresponding herbicide to recipient plant cells.

[0097] In certain embodiments, the "first target gene" is ALS, and the "specific site of the gene" refers to sites A122, P197, R198, D204, A205, D376, R377, W574, S653, or G654 in the amino acid sequence of the Arabidopsis AtALS protein (e.g., as set forth in SEQ ID NO: 1), and amino acid sites in ALS proteins of other plants that correspond to the above amino acid sites by using the AtALS amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an amino acid sequence site of the AtALS protein selected from the group consisting of A122, P197, R198, D204, A205, D376, R377, W574, S653, G654, or any combination thereof, as well as a target sequence comprising a sequence encoding an amino acid site in another plant ALS protein corresponding to the above amino acid site or any combination thereof by using the AtALS amino acid sequence as a reference standard. The ALS W574 site is preferred. The selective pressure is preferably pyroxsulam or nicosulfuron treatment.

[0098] In a specific embodiment, the "first target gene" is ACCase, and the "specific site of the gene" refers to sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, or G2096 in the amino acid sequence of the Alopecurus myosuroides AmACCase protein (e.g., as set forth in SEQ ID NO: 3, the gene sequence as set forth in SEQ ID NO: 4), and the amino acid sites in the ACCase protein of another monocotyledonous plant that correspond to the above amino acid sites by using the AmACCase amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an AmACCase amino acid sequence site selected from the group consisting of I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, G2096, or any combination thereof, as well as a target sequence comprising a sequence encoding an amino acid site corresponding to the above amino acid site or any combination thereof in an ACCase protein of another monocotyledonous plant by using the AmACCase amino acid sequence as a reference standard. The ACCase W2027 site is preferred. The selective pressure is preferably quizalofop-p-ethyl treatment.

[0099] In a specific embodiment, the "first target gene" is HPPD, and the "specific site of the gene" refers to sites H141, L276, P277, N338, G342, R346, D370, P386, K418, or G419 in the amino acid sequence of rice (Oryza sativa) OsHPPD protein (as shown in SEQ ID NO: 5, the genomic sequence as shown in SEQ ID NO: 6), and amino acid sites corresponding to the above amino acid sites in HPPD proteins of other plants using the OsHPPD amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an OsHPPD amino acid sequence site selected from the group consisting of H141, L276, P277, N338, G342, R346, D370, P386, K418, G419, or any combination thereof, as well as a target sequence comprising a sequence encoding an amino acid site in another plant's HPPD protein that corresponds to the above amino acid site or any combination thereof by using the OsHPPD amino acid sequence as a reference standard. The selective pressure is preferably biscarfentrazone treatment.

[0100] In a specific embodiment, the "first target gene" is a PPO, and the "specific site of the gene" refers to sites S128, V217, S223, V364, K373, L423, Y425, or W470 in the amino acid sequence of rice OsPPO1 protein (as set forth in SEQ ID NO:7; the genomic sequence is as set forth in SEQ ID NO:8), and amino acid sites in another plant's PPO protein that correspond to the above amino acid sites using the OsPPO1 amino acid sequence as a reference standard. The crRNA or sgRNA targets target sequences comprising a sequence encoding an OsPPO1 amino acid sequence site selected from the group consisting of S128, V217, S223, V364, K373, L423, Y425, W470, or any combination thereof, and target sequences comprising the above amino acid sites corresponding to another plant's PPO protein and combinations thereof using the OsPPO1 amino acid sequence as a reference standard. The selective pressure is preferably saflufenacil treatment.

[0101] In a specific embodiment, the "first target gene" is TIR1, and the "specific site of the gene" refers to sites F93, F357, C413, or S448 in the amino acid sequence of rice OsTIR1 protein (as set forth in SEQ ID NO:9; the genomic sequence is as set forth in SEQ ID NO:10), and amino acid sites corresponding to the above amino acid sites in a TIR1 protein of another plant using the OsTIR1 amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an OsTIR1 amino acid sequence site selected from the group consisting of F93, F357, C413, S448, or any combination thereof, and a target sequence comprising a sequence encoding an amino acid site corresponding to the above amino acid site in a TIR1 protein of another plant using the OsTIR1 amino acid sequence as a reference standard, and any combination thereof. The selection pressure is preferably 2,4-D treatment.

[0102] The present invention further provides a non-transgenic transient editing system using the aforementioned methods.

[0103] The present invention further provides the use of the aforementioned non-transgenic transient editing systems as selectable markers.

[0104] The present invention further provides the use of the aforementioned non-transgenic transient editing system in the treatment of disease.

[0105] The present invention further provides the use of the aforementioned non-transgenic transient editing system in organism breeding.

[0106] The present invention further provides a genetically modified plant comprising an editing event in a first target gene in its genome, obtained by the method described above, wherein the genetically modified plant is obtained in a non-transgenic manner.

[0107] The present invention further provides a genetically modified plant comprising a first target gene editing event and further comprising at least one second target gene editing event in its genome, obtained by the aforementioned method, wherein the genetically modified plant is obtained in a non-transgenic manner.

[0108] The present invention further provides a genetically modified plant comprising at least one second targeted gene editing event in its genome, obtained by the aforementioned method, wherein the genetically modified plant is obtained in a non-transgenic manner and the first targeted gene editing event has been removed by genetic segregation.

[0109] The present invention further provides the genome of a genetically modified plant obtained by the aforementioned method, wherein the genome comprises: 1) a first target gene editing event; 2) a first target gene editing event and at least one second target gene editing event; or 3) at least one second target gene editing event, where the first target gene editing event has been removed by genetic segregation, and the genome is obtained in a non-transgenic manner.

[0110] Another aspect of the present invention provides novel plant genetic mutations obtainable by the aforementioned methods.

[0111] The present invention also relates to a method for producing a pharmaceutical composition of the following type: The present invention provides novel mutations engineered into plants, comprising one or more combinations of: a substitution of aspartic acid at a site corresponding to Arabidopsis ALS376 with any other amino acid; a substitution of tryptophan at a site corresponding to Arabidopsis ALS574 with any other amino acid; a substitution of serine at a site corresponding to Arabidopsis ALS653 with any other amino acid; or a substitution of serine at a site corresponding to Arabidopsis ALS654 with any other amino acid; or a substitution of tryptophan at a site corresponding to black-glove ACCase2027 with any other amino acid.

[0112] In certain embodiments, an aspartic acid at a site corresponding to Arabidopsis ALS376 is substituted with a glutamic acid (D376E), a tryptophan at a site corresponding to Arabidopsis ALS574 is substituted with a leucine or methionine (W574L or W574M), a serine at a site corresponding to Arabidopsis ALS653 is substituted with an asparagine or arginine (S653N or S653R), or a site corresponding to Arabidopsis ALS654 is substituted with a nucleotide sequence corresponding to Arabidopsis ALS653. or a tryptophan at a site corresponding to Big-Grain-Arrowroot ACCase2027 is substituted with a leucine or cysteine ​​(W2027L or W2027C), where these amino acid sites are described using the corresponding amino acid sites in Big-Grain-Arrowroot as a reference.

[0113] In another specific embodiment, the mutation type is S653R / G654D, and these amino acid positions are stated by using the corresponding amino acid positions in Arabidopsis as a reference.

[0114] In certain embodiments, the aspartic acid at position 350 of rice ALS is substituted with any other amino acid, the tryptophan at position 548 of rice ALS is substituted with any other amino acid, or the tryptophan at position 561 of potato (Solanum tuberosum L.) ALS2 is substituted with any other amino acid; or the tryptophan at position 2038 of rice ACCase2 is substituted with any other amino acid.

[0115] In another specific embodiment, the aspartic acid at site 350 of rice ALS is substituted with glutamic acid (D350E), the tryptophan at site 548 of rice ALS is substituted with leucine or methionine (W548L or W548M), or the tryptophan at site 561 of potato ALS2 is substituted with leucine or methionine (W561L or W561M); or the tryptophan at site 2038 of rice ACCase2 is substituted with leucine or cysteine ​​(W2038L or W2038C), wherein the amino acid sequence of the rice ALS protein is set forth in SEQ ID NO: 11, the amino acid sequence of the potato StALS2 protein is set forth in SEQ ID NO: 19, and the amino acid sequence of the rice ACCase2 protein is set forth in SEQ ID NO: 13.

[0116] The present invention further provides proteins or biologically active fragments thereof having the aforementioned novel mutations.

[0117] The present invention also provides a nucleic acid comprising a nucleic acid sequence encoding said protein or a biologically active fragment thereof, or a complementary sequence.

[0118] The present invention further provides a recombinant expression vector comprising the nucleic acid and a promoter operably linked thereto.

[0119] The present invention further provides an expression cassette comprising the nucleic acid.

[0120] The present invention further provides a plant cell comprising the expression cassette.

[0121] The present invention further provides a plant regenerated by using the plant cell.

[0122] Another aspect of the present invention is a method for producing a plant having improved resistance or tolerance to a herbicide, the method comprising regenerating said plant cell into a plant.

[0123] Another aspect of the invention provides a method for controlling weeds in a locus of plants, the plants including those described above or plants produced by the methods described above, comprising applying to the locus one or more herbicides in an amount effective to control weeds.

[0124] Another aspect of the present invention also provides the use of the novel mutations, proteins or biologically active fragments thereof, nucleic acids, recombinant expression vectors or expression cassettes in improving the resistance or tolerance of plant cells, plant tissues, plant parts or plants to herbicides.

[0125] The present invention has the following excellent technical effects: New targets can be designed based on the sequences generated from new repair events caused by sequential editing, which can generate multiple consecutive mutations at specific sites in the genome, thereby exponentially increasing the types of repair events after DNA cleavage and realizing new types of base substitution, deletion, and insertion mutations that cannot be seen with a single gene edit. That is, the programmed sequential cleavage / editing method employed by the present invention, which uses the sequences generated from previous gene editing repairs as subsequent gene editing targets, provides CRISPR / Cas with novel functions of single-base editing via simple knockout and precise site deletion and insertion.

[0126] The present invention allows for screening of gene editing events in the absence of exogenous markers and further allows for non-transgenic gene editing, greatly reducing biosafety concerns for cell therapy and organism breeding methods.

[0127] In particular, the plant non-transgenic transient editing method provided by the present invention involves only a Cas protein and a small fragment of an artificially synthesized gRNA or sgRNA, and no exogenous DNA is involved in any of the steps. An endogenous resistance selection marker is created by editing the first target gene through sequential cutting / editing. Therefore, editing events can be effectively screened without involving any genetic modification manipulation. Therefore, this method is equivalent to chemical mutagenesis or radiation-induced breeding, and does not require the continuous isolation and detection of exogenous transgenic components over multiple generations. This shortens the breeding cycle, ensures biological safety, saves management and approval costs, and offers great application prospects for rigorous plant breeding. DETAILED DESCRIPTION OF THE INVENTION

[0128] Detailed Description of the Invention In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art.In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology-related terms and research procedures used herein are all terms and common methods widely used in the corresponding fields.At the same time, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

[0129] The term "genome," as used herein, refers to the full complement of genetic material (genes and non-coding sequences) present in each cell or virus or organelle of an organism, and / or the complete genome inherited from the parents as a single unit (haploid).

[0130] The term "gene editing" refers to strategies and techniques for making targeted, specific modifications to the genetic information or genome of a living organism. Thus, it includes not only the editing of gene-coding regions, but also the editing of non-gene-coding regions of the genome. The term also includes the editing or modification of the nucleus (if present) and other genetic information of the cell.

[0131] The term "CRISPR / Cas nuclease" may refer to a CRISPR nuclease or a nucleic acid sequence encoding the same, including, but not limited to: 1) Cas9, including SpCas9, ScCas9, SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9, NGA-Cas9 (VQR), etc.; 2) Cas12, including LbCpf1, FnCpf1, AsCpf1, MAD7, etc., or any mutant or derivative of the above-mentioned CRISPR nucleases, preferably wherein at least one CRISPR nuclease comprises a mutation such that the resulting CRISPR nuclease recognizes a different PAM sequence compared to the corresponding wild-type sequence. As used herein, "CRISPR-based nuclease" refers to any nuclease that has been identified in a natural CRISPR system, and then isolated from its natural background, and preferably modified or combined into a recombinant construct of interest that is suitable as a tool for targeted genome engineering.As long as the original wild-type CRISPR-based nuclease provides DNA recognition, i.e., binding properties, any CRISPR-based nuclease can be used, and may optionally be reprogrammed or otherwise mutated to suit various embodiments of the present invention.

[0132] The term "CRISPR" refers to a sequence-specific genetic engineering technique that relies on clustered regularly interspaced short palindromic repeats, which is distinct from RNA interference in regulating gene expression at the transcriptional level.

[0133] "Cas9 nuclease" and "Cas9" are used interchangeably herein and refer to an RNA-guided nuclease comprising a Cas9 protein or a fragment thereof (e.g., a protein comprising an active Cas9 DNA cleavage domain and / or a Cas9 gRNA-binding domain). Cas9 is a component of the CRISPR / Cas (clustered regularly interspaced short palindromic repeats and associated systems) genome editing system. Under the guidance of a guide RNA, it can target and cleave a DNA target sequence to form a DNA double-strand break (DSB).

[0134] "Cas protein" or "Cas polypeptide" refers to a polypeptide encoded by a Cas (CRISPR-associated) gene. Cas proteins include Cas endonucleases. Cas proteins can be bacterial or archaeal proteins. For example, Type I-III CRISPR Cas proteins herein are generally of prokaryotic origin, Type I and Type III Cas proteins are derived from bacterial or archaeal species, and Type II Cas proteins (i.e., Cas9) can be derived from bacterial species. "Cas protein" includes Cas9 protein, Cpf1 protein, C2c1 protein, C2c2 protein, C2c3 protein, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas12a, Cas12b, or combinations or complexes thereof.

[0135] "Cas9 mutant" or "Cas9 endonuclease mutant" refers to a mutant of the parent Cas9 endonuclease that, when associated with a crRNA and a tracRNA, or with an sgRNA, retains the ability to recognize and bind to, and optionally unwind, nick, or cleave all or part of a DNA target sequence. Cas9 endonuclease variants include those described herein, where the Cas9 endonuclease variant differs from the parent Cas9 endonuclease in that the Cas9 endonuclease variant (when complexed with a gRNA to form a polynucleotide-specific endonuclease complex capable of modifying a target site) has at least one improved property compared to the parent Cas9 endonuclease (when complexed with the same gRNA to form a polynucleotide-guided endonuclease complex capable of modifying the same target site), such as, but not limited to, increased transformation efficiency, increased DNA editing efficiency, reduced off-target cleavage, or any combination thereof.

[0136] The Cas9 endonuclease mutants described herein include mutants that can bind to and nick double-stranded DNA target sites when associated with the crRNA and tracrRNA or with the sgRNA, while the parent Cas endonuclease can bind to the target site and generate a double-stranded break (cleavage) when associated with the crRNA and tracrRNA or with the sgRNA.

[0137] "Guide RNA" and "gRNA" are used interchangeably herein and generally refer to a guide RNA sequence used to target a specific gene for correction using CRISPR technology, consisting of a partially complementary crRNA and tracrRNA molecule that form a complex, where the crRNA contains a sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and direct the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is also known in the art that a single guide RNA (sgRNA) can be designed that contains properties of both crRNA and tracrRNA.

[0138] The terms "single guide RNA" and "sgRNA" are used interchangeably herein and refer to a synthetic fusion of two RNA molecules comprising a fusion of a variable targeting domain (linked to a tracer pairing sequence hybridized to the tracrRNA) of a crRNA (CRISPR RNA) and a tracrRNA (trans-activating CRISPR RNA). The sgRNA may comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of a Type II CRISPR / Cas system that can form a complex with a Type II Cas endonuclease, and the guide RNA / Cas endonuclease complex can guide the Cas endonuclease to the DNA target site such that the Cas endonuclease can recognize, optionally bind to, or optionally nick or cleave (introduce a single- or double-strand break) the DNA target site.

[0139] In certain embodiments, the guide RNA and Cas9 can be delivered to cells as a ribonucleoprotein (RNP) complex. RNPs consist of purified Cas9 protein complexed with a gRNA, and it is well known in the art that RNPs can be efficiently delivered to many types of cells, including, but not limited to, stem cells and immune cells (Addgene, Cambridge, MA; Mirus Bio LLC, Madison, WI).

[0140] As used herein, a protospacer adjacent motif (PAM) refers to a short nucleotide sequence adjacent to the target sequence (prespacer) recognized (targeted) by the gRNA / Cas endonuclease system. If this target DNA sequence is not adjacent to an appropriate PAM sequence, the Cas endonuclease may not be able to successfully recognize the target DNA sequence. The sequence and length of the PAM herein may vary depending on the Cas protein or Cas protein complex used. The PAM sequence can be any length, but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0141] As used herein, the term "organism" or "living organism" includes animals, plants, fungi, bacteria, and the like.

[0142] As used herein, the term "host cell" includes plant cells, animal cells, fungal cells, bacterial cells, and the like.

[0143] In the present invention, "animals" include, but are not limited to, vertebrates such as humans, non-human mammals, birds, fish, reptiles, amphibians, etc., as well as invertebrates such as insects.

[0144] In the present invention, "plant" should be understood to mean any differentiated multicellular organism capable of photosynthesis, in particular monocotyledonous or dicotyledonous plants, such as: (1) food crops: Oryza spp., for example, rice (Oryza sativa), wild rice (Oryza latifolia), rice (Oryza sativa), African rice (Oryza glaberrima); Triticum spp., for example, wheat (Triticum aestivum), durum wheat (T. Turgidum spp. Durum); Hordeum spp., for example, barley (Hordeum vulgare), Hordeum arizonicum; rye (Secale cereale); Avena spp., for example, oats (Avena sativa, oat (Avena fatua), Avena byzantine, Avena fatua var. sativa, Avena hybrida; Echinochloa spp., e.g., pearl millet (Pennisetum glaucum), sorghum (Sorghum bicolor), Sorghum vulgare, triticale, Zea mays or maize, millet, rice, foxtail millet, millet, sorghum (Sorghum bicolor), Panicum, buckwheat spp., millet (Panicum miliaceum), foxtail millet (Setaria italica), wild rice (Zizania palustris), teff (Eragrostis tef), millet (Panicum miliaceum), finger millet (Eleusine coracana); (2) Leguminosae: Glycine spp.), such as soybean (Glycine max), Soja hispida, Soja max, Vicia spp., Vigna spp., Pisum spp., broad bean, Lupinus spp., Vicia spp., Vicia spp., Vicia faba, Tamarind (Tamarindus indica), Lens (Lens culinaris), Lathyrus spp., Lablab bean, broad bean, mung bean, adzuki bean, chickpea; (3) oil crops: peanut (Arachis hypogaea), Arachis spp., Sesamum spp., Helianthus spp. spp.), e.g., sunflower (Helianthus annuus), Elaeis spp., e.g., oil palm (Eiaeis guineensis), oil palm (Elaeis oleifera), soybean, rapeseed (Brassicanapus), Brassica oleracea, sesame (Sesamum orientale), mustard (Brassica juncea), rapeseed, camellia oleifera, oil palm, olive, castor oil plant, rapeseed (Brassica napus L.), canola; (4) fiber crops: sisal (Agave sisalana), cotton spp., e.g., Gossypium spp., Gossypium barbadense barbadense), Gossypium hirsutum, kenaf (Hibiscus cannabinus), sisal (Agave sisalana), Manila hemp (Musa textilis Nee), flax (Linum usitatissimum), jute (Corchorus capsularis L.), ramie (Boehmeria nivea L.), hemp (Cannabis sativa); (5) Fruit crops: Ziziphus spp.), cucumber (Cucumis spp.), passion fruit (Passiflora edulis), grape (Vitis spp.), vaccinium (Vaccinium spp.), pear (Pyrus communis), cherry (Prunus spp.), jasmine (Psidium spp.), pomegranate (Punica granatum), apple (Malus spp.), watermelon (Citrullus lanatus), citrus (Citrus spp.), fig (Ficus carica), kumquat (Fortunella spp.), strawberry (Fragaria spp.), hawthorn (Crataegus spp.), persimmon (Diospyros spp.), pitanga (Eugenia unifora, loquat (Eriobotrya japonica), longan (Dimocarpus longan), papaya (Carica papaya), palms (Cocos spp.), star fruit (Averrhoa carambola), actinidia spp., almonds (Prunus amygdalus), musa spp. (Musa spp.) (Musa acuminate), Persea spp. (avocado (Persea Americana)), guava (Psidium guajava), mame apple (Mammea Americana), mango (Mangifera indica), canarium album (Oleaeuropaea), papaya (Caricapapaya), coconut palm (Cocos nucifera), acerola (Malpighia emarginata), sapodilla (Manilkara zapota), pineapple (Ananas comosus), bromeliads (Annona spp.), ponkan (Citrus reticulate), breadfruit (Artocarpus spp.), litchi (Litchi chinensis), gooseberry (Ribes spp.), rubus spp., pear, peach, etc.(6) Root crops: cassava (Manihot spp.), sweet potato (Ipomoea batatas), taro (Colocasia esculenta), tuberous mustard, Allium cepa (onion), Eleocharis tuberose (Water chestnut), Cyperus rotundus, and Rhizoma dioscoreae; (7) Vegetable crops: spinach (Spinacia spp.), Phaseolus spp., lettuce (Lactuca sativa), and momordica spp.), parsley (Petroselinum crispum), Capsicum spp., Solanum spp. (e.g., potato (Solanum tuberosum), Solanum integrifolium, tomato (Solanum lycopersicum)), Lycopersicon spp. (e.g., tomato (Lycopersicon esculentum), tomato (Lycopersicon lycopersicum), Lycopersicon pyriforme), Macrotyloma spp., kale, Luffa acutangularis, lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts sprouts), cabbage, carrots, cauliflower, celery, collard greens, pumpkin, wax gourd (Benincasa hispida), asparagus (Asparagus officinalis), celery (Apium graveolens), Amaranthus spp., Leek spp., Abelmoschus spp., endive (Cichorium endivia), Cucurbita spp.), coriander (Coriandrum sativum), apicessinian mustard (B. carinata), radish (Rapbanus sativus), Brassica species (Brassica spp.) (e.g., rapeseed (Brassica napus), turnip species (Brassica rapa ssp.), canola, rapeseed, oilseed rape, mustard greens, cabbage, black mustard, canola (rapeseed), etc. Brussels sprouts, Solanaceae (eggplant), sweet pepper (Capsicum annuum), cucumber, loofah, Chinese cabbage, rapeseed, cabbage, bottle gourd, chives, lotus, lotus root, lettuce; (8) flower crops: trumpet jasmine (Tropaeolum minus), nasturtium (Tropaeolum majus), dandelion (Canna indica), prickly pear (Opuntia spp.), tagetes spp., Cymbidium (orchids), Crinum asiaticum L., clivia, amaryllis (Hippeastrum rutilum), rose rosa rugosa, Chinese rose (Rosa chinensis), Jasminum sambac sambac), tulip (Tulipa gesneriana L.), cherry blossom (Cerasus sp.), Pharbitis nil (L.), morning glory, calendula (Calendula officinalis L.), lotus (Nelumbo sp.), daisy (Bellis perennis L.), carnation (Dianthus caryophyllus), petunia (Petunia hybrida), tulip (Tulipa gesneriana L.), Lilium brownie, plum (Prunus mume), daffodil (Narcissus tazetta L.), winter jasminum (Jasminum nudiflorum Lindl.), Maiden cherry (Primula malacoides), Daphne odora, Camellia japonica, Silver laurel (Michelia alba), Magnolia (Magnolia liliiflora), Japanese laurel (Viburnum macrocephalum), Clivia miniate, Begonia spectabilis, Peony (Paeonia suffruticosa), Peony (Paeonia lactiflora), Clove (Syzygium aromaticum), Azalea (Rhododendron simsii), Rhododendron hybridum, Japanese laurel (Michelia figo (Lour.) Spreng.), Redbud (Cercis chinensis), Kerria japonica, Weigela florida), Forsythia (Fructus forsythyae), Winter Fritillary (Jasminum mesnyi), Blue Clover (Parochetus communis), Cyclamen (Cyclamen persicum Mill.), Phalaenophsis hybrid, Dendrobium nobile, Hyacinth (Hyacinthus orientalis), Iris tectorum Maxim, Calla lily (Zantedeschia aethiopica), Calendula (Calendula officinalis), and Hippeastrum rutilum. Begonia semperflorens (Begonia semperflorenshybr), fuchsia (Fuchsia hybrida), white spotted begonia (Begonia maculataRaddi), (geranium), pothos (Epipremnum aureum); (9) medicinal crops: safflower (Carthamus tinctorius), mint (Mentha spp.), rhubarb (Rheum rhabarbarum), saffron (Crocus sativus), wolfberry (Lycium chinense), Polygonatum odoratum, Polygonatum kingianum, flower sedge (Anemarrhena asphodeloides Bunge), jack-o'-lantern (Radix ophiopogonis), Fritillaria cirrhosa, and day laurel (Curcuma aromatica), Chinese weed (Amomum villosum Lour.), Polygonum multiflorum, Rheum officinale, Licorice (Glycyrrhiza uralensis Fisch), Astragalus membranaceus, Ginseng (Panax ginseng), Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Cnidium root (Ligusticum wallichii), Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L.), Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L.), Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild species), Medicago sativa Linn, Pepper (Piper nigrum L.), Radix Isatidis, Atractylodes macrocephala Koidz; (10) Raw material crops: Hevea brasiliensis, Ricinus communis, Vernicia fordii, Mulberry (Morus alba L.), Hops (Humulus lupulus), Birch (Betula), Alnus cremastogyne Burk., Sumac (Rhus verniciflua stokes; (11) Pasture crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum spp., Phalaris arundinacea, Panicum virgatum, prairie grass, Indian grass, big bluestem grass, Phleum pratense, lawn grass, cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis), alfalfa (Medicago sativa) Linn), Timothy grass (Phleum pratense L.), alfalfa (Medicago sativa), Chinese bush clover (Melilotus suavcolen), astragalus sinicus, sunn hemp (Crotalaria juncea), hornwort (Sesbania cannabina), duckweed (Azolla imbircata), water hyacinth (Eichhornia crassipes), black sorrel (Amorpha fruticose), lupine (Lupinus micranthus), clover (Trifolium), purple vine (Astragalus adsugens pall), waterweed (Pistia stratiotes linn), day weed (Alternanthera philoxeroides), and ryegrass (Lolium); (12) sugar crops: sugarcane species (Saccharum spp.) spp.), sugar beet (Beta vulgaris); (13) Beverage crops: tea plant (Camellia sinensis), tea plant (Camellia sinensis), tea, coffee (Coffea spp.), cocoa (Theobroma cacao),. Hops (Humulus lupulus Linn.); (14) Turfgrass: Beachgrass (Ammophila arenaria), Poa spp. (Poa pratensis (Bluegrass)), Agrostis spp. (Agrostis matsumurae, Agrostis palustris), Lolium spp. (Lolium multiflorum), Festuca spp. (Festuca ovina L.), Zoysia spp. (Zoysia japonica), Cynodon spp. (Cynodon dactylon) dactylon / Bermudagrass), St. Augustinegrass (Stenotaphrum secundatum), Paspalum spp., Centipedegrass (Eremochloa ophiuroides) (Centipedegrass), Axonopus spp. (Carpetgrass), Bouteloua dactyloides (Buffalograss), Bouteloua var. spp. (Blue Grama (Bouteloua gracilis)), Crabgrass (Digitaria sanguinalis), Cyperus rotundus, Common ragwort (Kyllingabrevifolia), Cyperus amuricus, Common mugwort (Erigeron canadensis, Hydrocotyles ibthorpioides, Kummerowia striata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex hetelostachya, and lawn grass; (15) Tree crops: Pinus spp., Salix spp., Acer spp., Hibiscus spp.), Eucalyptus spp., Ginkgo biloba, Bambusa spp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Beech spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp., Poplar, Hedera helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo biloba L., Quercus spp., Ailanthus altissima, Camellia (Schima superba), Ilex purpurea, Platanus acerifolia, Ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Black wattle (Acacia mearnsii), Pinus massoniana, Pinus khasys, Pinus yunnanensis, and Pinus unnanensis. finlaysoniana), Japanese pine (Pinus tabuliformis), Korean pine (Pinus koraiensis), black walnut (Juglans nigra), lemon (Citrus limon), Japanese maple (Platanus acerifolia), myrtle (Syzygium jambos), handkerchief tree (Davidia involucrate), yellow cotton (Bombax malabarica L.), and breadfruit (Ceiba pentandra L.), Bauhinia blakeana, American silk tree (Albizia saman), silk tree (Albizzia julibrissin), coral tree (Erythrina corallodendron), Deiko (Erythrina indica), Magnolia grandiflora, Cycad (Cycas revolute), Crape myrtle (Lagerstroemia indica), conifers, trees, and shrubs; (16) Nut crops: Brazil nut (Bertholletia excelsea), chestnut (Castanea spp.), hazel (Corylus spp.), pecan (Carya spp.), walnut (Juglans spp.), pistachio (Pistacia vera), cashew (Anacardium occidentale, macadamia (Macadamia integrifolia), pecan (Carya illinoensis Koch), macadamia, pistachio, almond, and other nut-producing plants; (17) Other: Arabidopsis (Arabidopsis thaliana), small grain grass (Brachiaria eruciformis), burdock moth (Cenchrus echinatus), green foxtail (Setaria faberi), goosegrass (Eleusine indica), Cadaba farinosa, algae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp. Carrot (Daucus carota), Dioscorea spp., Erianthus spp., Tall fescue (Festuca arundinacea), Daylily (Hemerocallis fulva), Lotus spp., Common laurel (Luzula sylvatica), Medicago sativa, Melilotus spp., Black mulberry (Morus nigra), Tobacco spp., Olive spp., Ornithopus spp., American ash (Pastinaca sativa), Sambucus spp., White mustard spp. sp.), Syzygium spp., gamagrass (Tripsacum dactyloides), Triticosecale rimpaui, sweet violet (Viola odorata), etc.

[0145] In certain embodiments, the plant is selected from rice, corn, wheat, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, potato, sweet potato, Chinese cabbage, cabbage, cucumber, rose hip, pothos (Scindapsus aureus), watermelon, melon, strawberry, blueberry, grape, apple, mandarin orange, peach, pear, banana, etc.

[0146] As used herein, the term "plant" includes the whole plant and any progeny, cell, tissue, or part of the plant. The term "plant part" includes, for example, but is not limited to, any part of a plant, including seeds (including mature seeds, immature embryos without seed coats, and immature seeds); cuttings; plant cells; plant cell cultures; plant organs (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, and related explants). Plant tissue or plant organs can be seeds, callus tissue, or any other group of plant cells organized into a structural or functional unit. Plant cell or tissue culture can regenerate plants with physiological and morphological characteristics of the plant from which the cell or tissue is derived, and can regenerate plants with substantially the same genotype as the plant. In contrast, some plant cells cannot regenerate plants. The regenerable cells in plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk threads, flowers, kernels, panicles, cobs, pods, or stems.

[0147] Plant parts include harvestable parts and parts that can be used to propagate progeny plants. Plant parts that can be used for propagation include, but are not limited to, seeds, fruits, scions, seedlings, tubers, and rhizomes. Harvestable plant parts can be any useful plant part, including, but not limited to, flowers, pollen, seedlings, tubers, leaves, stems, fruits, seeds, and roots.

[0148] A plant cell is the structural and physiological unit of a plant. As used herein, plant cells include protoplasts and protoplasts with partial cell walls. Plant cells may be in the form of isolated single cells or cell aggregates (e.g., loose callus and cultured cells), or may be part of higher-order tissue units (e.g., plant tissue, plant organs, and whole plants). Thus, plant cells may be protoplasts, gamete-producing cells, or cells or cell aggregates that can regenerate into complete plants. Thus, in the embodiments herein, seeds that contain multiple plant cells and can regenerate into complete plants are considered "plant parts."

[0149] As used herein, the term "protoplast" refers to a plant cell whose cell wall has been completely or partially removed, exposing the lipid bilayer membrane. Generally, a protoplast is an isolated plant cell without a cell wall that has the ability to regenerate a cell culture or a whole plant.

[0150] Plant "progeny" includes any subsequent generation of the plant.

[0151] The term "bacteria" refers to all prokaryotes, including all organisms in the kingdom Prokaryote. The term "bacteria" includes all microorganisms considered to be bacteria, including Mycoplasma, Chlamydia, Actinomyces, Streptomyces, and Rickettsia. This definition includes all forms of bacteria, including cocci, bacilli, spirals, spheroplasts, protoplasts, etc. The term also includes prokaryotes that are gram-negative or gram-positive. "Gram-negative" and "gram-positive" refer to the staining pattern using the gram staining method well known in the art (see, e.g., Finegold and Martin, Diagnostic Microbiology, 6th Ed., CV Mosby St. Louis, pp. 13-15

[1982] ). "Gram-positive bacteria" are bacteria that can retain the dye used in the gram stain; the stained cells appear dark blue to purple under the microscope. "Gram-negative bacteria" do not retain the original dye used in Gram staining, but are stained with the counter dye, and therefore appear red after the Gram stain reaction.

[0152] As used herein, the term "fungi" refers to eukaryotic organisms such as molds and yeasts, including dimorphic fungi.

[0153] The terms "herbicide tolerance" and "herbicide resistance" can be used interchangeably and both refer to herbicide tolerance and herbicide resistance. "Improved herbicide tolerance" and "improved herbicide resistance" mean improved tolerance or resistance to a herbicide compared to a plant containing a wild-type gene.

[0154] The term "wild-type" refers to a nucleic acid molecule or protein that can be found in nature.

[0155] In the present invention, the term "cultivation site" includes the location, such as soil, where the plant of the present invention is cultivated, and also includes, for example, plant seeds, plant seedlings, and growing plants. The term "weed-controlling effective amount" refers to an amount of herbicide sufficient to affect the growth or development of target weeds, for example, to prevent or inhibit the growth or development of target weeds, or to kill weeds. Advantageously, the weed-controlling effective amount does not significantly affect the growth and / or development of the plant seeds, plant seedlings, or plants of the present invention. Those skilled in the art can determine such weed-controlling effective amounts through routine experimentation.

[0156] The term "target DNA," as used herein, refers to a DNA polynucleotide comprising a "target site" or "target sequence."

[0157] The term "lysis" refers to the cleavage of the covalent backbone of a DNA molecule. Lysis can be induced by various methods, including, but not limited to, enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-stranded and double-stranded lysis are possible, and double-stranded lysis can occur through two different single-stranded lysis events. DNA lysis can produce blunt or overhanging ends. In certain embodiments, a complex comprising a DNA-targeting RNA and a site-specific modifying polypeptide is used for targeted double-stranded DNA lysis.

[0158] The term "gene" comprises a nucleic acid fragment that expresses a functional molecule (such as, but not limited to, a particular protein) including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.

[0159] A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that can be transcribed into RNA. A DNA polynucleotide can encode an RNA that can be translated into protein (mRNA), or it can encode an RNA that cannot be translated into protein (e.g., tRNA, rRNA, or DNA-targeting RNA; these are also known as "non-coding" RNA or "ncRNA").

[0160] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" can also include modified forms thereof, including, but not limited to, glycosylation, lipid linkage, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0161] The term "biologically active fragment" refers to a fragment that is missing one or more amino acid residues from the N-terminus and / or C-terminus of a protein but retains its functional activity.

[0162] For the terminology used herein regarding amino acid substitutions, the first letter represents the native amino acid at a particular position in a particular sequence, the number following represents the position in the corresponding sequence, and the second letter represents a different amino acid to substitute for the native amino acid. For example, W574L means that the tryptophan at position 574 has been replaced with leucine. For double or multiple mutations, each mutation is separated by a " / ".

[0163] The terms "polynucleotide" and "nucleic acid" are used interchangeably and comprise DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0164] The terms "nucleotide sequence" and "nucleic acid sequence" both refer to the sequence of bases in DNA or RNA.

[0165] As used herein, "expression cassette," "expression vector," and "expression construct" refer to a vector, such as a recombinant vector, suitable for expressing a nucleotide sequence of interest in a plant. The term "expression" refers to the production of a functional product. For example, expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (e.g., transcription to produce mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein.

[0166] An "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or in some embodiments, an RNA (eg, mRNA) that can be translated.

[0167] An "expression construct" of the present invention may comprise regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source, but arranged in a manner different from that which normally occurs in nature.

[0168] The terms "recombinant expression vector" or "DNA construct" are used interchangeably herein to refer to a DNA molecule comprising a vector and at least one insert sequence. Recombinant expression vectors are typically created for the purpose of expressing and / or amplifying an insert sequence or for the construction of other recombinant nucleotide sequences. The insert sequence may be operably or inoperably linked to a promoter sequence, or may be operably or inoperably linked to a DNA regulatory sequence.

[0169] The terms "regulatory sequence" and "regulatory element" are used interchangeably and refer to nucleotide sequences located upstream (5' non-coding sequences), midstream, or downstream (3' non-coding sequences) of a coding sequence that influence the transcription, RNA processing, stability, or translation of the associated coding sequence. Plant expression regulatory elements refer to nucleotide sequences that can control the transcription, RNA processing, stability, or translation of a nucleotide sequence of interest in plants.

[0170] Regulatory sequences include, but are not limited to, promoters, translation leader sequences, introns, and poly A recognition sequences.

[0171] The term "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter capable of controlling the transcription of a gene in a plant cell, regardless of whether it is derived from a plant cell. The promoter may be a constitutive promoter, a tissue-specific promoter, a developmentally regulated promoter, or an inducible promoter.

[0172] The term "constitutive promoter" generally refers to a promoter that causes gene expression in most cell types at most times. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to a promoter that is expressed primarily, but not exclusively, in a certain tissue or organ and also in a particular cell or cell type. "Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoters" selectively express operably linked DNA sequences in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

[0173] As used herein, the term "operably linked" refers to the linkage of a regulatory element (such as, but not limited to, a promoter sequence, a transcription termination sequence, etc.) with a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operably linking a regulatory element region with a nucleic acid molecule are known in the art.

[0174] "Introducing" a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or a protein into a plant refers to transforming a plant cell with the nucleic acid or protein so that the nucleic acid or protein can function in the plant cell. As used herein, the term "transformation" includes stable transformation and transient transformation.

[0175] The term "stable transformation" refers to the introduction of an exogenous nucleotide sequence into a plant genome, resulting in stable inheritance of the exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the plant genome and any progeny thereof.

[0176] The term "transient transformation" refers to the introduction of a nucleic acid molecule or protein into a plant cell to perform a function that does not result in stable inheritance of the foreign gene. In transient transformation, the exogenous nucleic acid sequence is not integrated into the plant genome.

[0177] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0178] All publications and patents cited herein are incorporated by reference to the same extent as if each individual publication or patent was accurately and individually indicated to be incorporated by reference and to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication up to the filing date should not be construed as an admission that the present invention is not entitled to antedate the disclosure of a prior invention. Further, the publication dates provided may be different from the actual publication dates, which may require independent verification.

[0179] Unless otherwise stated or implied, as used herein, "a," "a / an," and "the" mean "at least one." All patents, patent applications, and publications described or cited herein are incorporated by reference in their entirety to the same extent as if they were individually cited. [Brief explanation of the drawings]

[0180] [Figure 1] Figure 1 shows a schematic diagram of a method for generating novel mutations in an organism according to the present invention. While only Cas9 with NGG as the PAM is shown as an example in this diagram, other Cas9 variants with different PAMs (e.g., NG) can be used in a similar manner. [Figure 2] Figure 2 shows a schematic diagram of gRNA design at Arabidopsis ALS gene sites W574 and S653. [Figure 3] Figure 3 shows T2 generation herbicide-resistant Arabidopsis lines transformed with two different programmed sequential excision / editing vectors. pQY743 and pQY745 are vector numbers. The resistant lines were able to root normally, whereas wild-type Col-0 and non-resistant lines were not. [Figure 4]FIG. 4 shows a diagram of the sequencing peaks of the ALS gene in an imazapic-resistant T2 generation Arabidopsis line, where the T indicated by the arrow has mutated from G, resulting in the W574L mutation. [Figure 5] Figure 5 shows the design of the programmed sequential cleavage / editing scheme at the W574 site of the ALS gene in Arabidopsis. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Among them, sgRNA1 and Cas9 formed a complex, which cleaved the W574 codon of ALS in the genome and was expected to form a -G genotype through spontaneous cell repair. This novel sequence was recognized and cleaved by the complex formed by sgRNA2 and Cas9, which formed a +T genotype through spontaneous cell repair, resulting in W574L. [Figure 6] FIG. 6 shows the resistant seedlings of Arabidopsis thaliana screened by imazapic and the sequencing results of the ALS W574 site. [Figure 7] Figure 7 shows the design of a programmed sequential cleavage / editing scheme at the S653 site of the ALS gene in Arabidopsis. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Among them, sgRNA1 and Cas9 formed a complex, which cleaved the S653 codon of ALS in the genome. After spontaneous repair of the cells, a -G genotype was formed. This sequence could be recognized and cleaved by the complex formed by sgRNA2 and Cas9. After spontaneous repair of the cells, a +A genotype was formed, resulting in S653N. [Figure 8] Figure 8 shows the results of sequencing Arabidopsis resistant seedlings screened by imazapic and the ALS S653 site. The left panel shows the screening results and the proportion of resistant seedlings, and the right panel shows a diagram of the sequencing peaks and the type of mutation at the S653 site. [Figure 9]Figure 9 shows the design of a programmed sequential cleavage / editing scheme at the W574 site of the ALS gene in Arabidopsis. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Among them, sgRNA1 and Cas9 formed a complex, which cleaved the W574 codon of ALS in the genome. After spontaneous repair of the cells, a +A genotype was formed. This sequence could be recognized and cleaved by the complex formed by sgRNA2 and Cas9. After spontaneous repair of the cells, a -G genotype was formed, resulting in W574M. These two cleavages used different PAM sites. [Figure 10] Figure 10 shows the design of the programmed sequential cleavage / editing scheme at the W2038 site of the ACCase2 gene in rice. This site corresponds to the W2027 site of the ACCase2 gene in black-grass amplex. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Among them, sgRNA1 and Cas9 formed a complex, which cleaved the W2038 codon of ACCase in the genome. After spontaneous repair of the cells, the -G genotype was formed. This sequence could be recognized and cleaved by the complex formed by sgRNA2 and Cas9. After spontaneous repair of the cells, the +T genotype was formed, resulting in W2038L. [Figure 11] FIG. 11 shows the resistant calli of rice simultaneously screened with hygromycin (50 μg / L) and quizalofop-p (50 μg / L) and the sequencing results of the W2038 site. [Figure 12] Figure 12 shows a polyacrylamide gel electrophoresis of purified SpCas9 and NGA-Cas9 proteins produced by prokaryotic expression. The band indicated by the arrow is the Cas9 protein band. [Figure 13]Figure 13 shows the in vitro cleavage activity of purified Cas9 protein against DNA fragments containing the OsALS W548 target site and the OsACCase2 W2038 target site, as detected by agarose gel electrophoresis. It can be seen that the DNA fragments could be cleaved to the predicted size only when the Cas9 protein and sgRNA fragments were added simultaneously. [Figure 14] Figure 14 shows a diagram of the sequencing peaks of the OsALS W548 target site in RNP-transformed rice protoplasts, which corresponds to the ALS W574 site in Arabidopsis. In addition to the original G signal peak, there was a T signal peak at the position indicated by the arrow, resulting in the W548L mutation. [Figure 15] 15 shows resistant rice calli edited by RNP at the OsACCase2 W2038 site and screened with 50 μg / L quizalofop-p. Arrows indicate resistant calli. [Figure 16] 16 shows a diagram of the sequencing peak of the OsACCase2 W2038 target site in rice seedlings differentiated from resistant calli. The T indicated by the arrow was mutated from G, resulting in the W2038L mutation. [Figure 17] Figure 17 shows a resistance test of T1 generation OsACCase2 W2038L-edited seedlings to haloxyfop-p. From left to right, seedling 1 shows the results for the water-treated control wild-type Huaidao No. 5 (rice cultivar), while seedlings 2 to 4 show the results for wild-type Huaidao No. 5 and the T1 generation W2038L-edited lines QY367-7-12 and QY367-7-18 transformed by biolistic manipulation with two RNPs. All of these lines were treated with 5 g / mu (mu, unit of area; 1 mu = 1 / 15 hectare) of haloxyfop-p active ingredient. It is clear that the edited lines developed resistance to haloxyfop-p. [Figure 18]Figure 18 shows the resistance test of T1 generation OsACCase2 W2038L-edited seedlings to quizalofop-p. From left to right, seedling 1 shows the results of the water-treated control wild-type Huaidao No. 5, while seedlings 2-4 show the results of wild-type Huaidao No. 5 and the T1 generation W2038L-edited lines QY367-5-10 and QY367-5-21 biolistically transformed with two RNPs, all of which were treated with 5 g / mu of haloxyfop-p active ingredient. It is clear that the edited lines have developed resistance to haloxyfop-p. [Figure 19] 19 shows resistant rice calli simultaneously edited by RNP at the OsACCase2 W2038 site and the OsBADH2 gene and screened with 50 μg / L quizalofop-p. Arrows indicate resistant calli. [Figure 20] Figure 20 shows a diagram of the sequencing peak of the OsACCase2 W2038 target site in a TO generation two-site-edited seedling. The T indicated by the arrow was mutated from G, resulting in the W2038L mutation. [Figure 21] Figure 21 shows a diagram of the sequencing peaks of the OsBADH2 target site in the TO generation two-site-edited seedlings. A +A homozygous mutation occurred at the position indicated by the arrow. [Figure 22] Figure 22 shows resistant rice calli simultaneously edited by RNP at the OsALS W548 site and the OsSWEET14 gene and screened for resistance with 5 mg / L pyroxsulam. Arrows indicate resistant calli. [Figure 23] Figure 23 shows a diagram of the sequencing peaks of the OsALS W548 target site in the TO generation two-site-edited seedlings. Both G and T base signal peaks were present at the positions indicated by the arrows, resulting in the W548L mutation. [Figure 24] Figure 24 shows a diagram of the sequencing peaks of the OsSWEET14 target site in the TO generation two-site-edited seedlings. A -C homozygous mutation occurred at the site indicated by the arrow. [Figure 25]Figure 25 shows the resistance test of T1 generation OsALS W548 site- and OsSWEET142 site-edited seedlings to nicosulfuron. From left to right, seedling 1 shows the results of the water-treated control wild-type Huaidao No. 5, while seedlings 2-3 show the results of wild-type Huaidao No. 5 and the T1 generation W548L-edited line QY360-7-11 transformed by biolistic transformation with RNP, both of which were treated with 4 g / mu of nicosulfuron active ingredient. It is clear that the edited lines have developed resistance to nicosulfuron. [Figure 26] Figure 26 shows the resistance test of T1 generation OsALS W548 site and OsSWEET142 site-edited seedlings to flucarbazone-Na. From left to right, seedling 1 shows the results of the water-treated control wild-type Huaidao No. 5, while seedlings 2 and 3 show the results of wild-type Huaidao No. 5 and the T1 generation W548L-edited line QY360-7-9 transformed by biolistic transformation with RNP, both of which were treated with 2 g / mu of flucarbazone-Na active ingredient. It is clear that these edited lines developed resistance to flucarbazone-Na. [Figure 27] Figure 27 shows the resistance test of T1 generation OsALS W548 site- and OsSWEET142 site-edited seedlings to imazapic. From left to right, seedling 1 shows the results of the water-treated control wild-type Huaidao No. 5, while seedlings 2 and 3 show the results of wild-type Huaidao No. 5 and the T1 generation W548L-edited line QY360-7-11 transformed with RNP via biolistic transformation, both of which were treated with 7 g / mu imazapic active ingredient. It is clear that these edited lines developed resistance to imazapic. [Figure 28]Figure 28 shows the resistance test of T1 generation OsALS W548 site and OsSWEET142 site-edited seedlings to pyroxsulam. From left to right, seedling 1 shows the results of the water-treated control wild-type Huaidao No. 5, while seedling 243 shows the results of wild-type Huaidao No. 5 and the T1 generation W548L-edited lines QY360-7-2 and QY360-7-11 transformed with RNP RNP biolistically, all of which were treated with 2 g / mu pyroxsulam active ingredient. It is clear that these edited lines have developed resistance to pyroxsulam. [Figure 29] Figure 29 shows the scheme for programmed sequential cleavage / editing of the HBB gene in 293T cells. A. Design of HBB gene sites for programmed sequential cleavage / editing in 293T cells; B. Conversion efficiency of programmed sequential cleavage / editing of the HBB gene in 293T cells after 48 hours of transformation with each editing vector; C. The ratio of gene edited types generated from programmed sequential cleavage / editing of the HBB gene in 293T cells and single-site cleavage / editing of the HBB gene; WT: wild type; indel: deletion or insertion genotype; C→T SNP: genotype with C to T base substitution at the cleavage site.

[0181] Sequence Listing Description The major sequences encompassed by the present invention are summarized below, with related sequences shown in the sequence listing.

[0182] [Table 1] [Example]

[0183] EMBODIMENTS FOR CARRYING OUT THE INVENTION The present invention will be further described below in conjunction with examples. The following examples are provided for illustrative purposes only, and the scope of protection of the present invention is not limited to these examples. The experimental methods used in the following examples were those described in commonly used molecular biology, tissue culture technology, and agronomy manuals, unless otherwise specified. For example, specific steps can be found in "Molecular Cloning: A Laboratory Manual (3rd Edition)" (Sambrook, J., Russell, David W., 2001, Cold Spring Harbor) and "Plant Propagation by Tissue Culture" (Edwin F. George, Michael A. Hall, Geert-Jan De Klerk, 2008, Springer). Materials, reagents, equipment, etc. used in the following examples are commercially available unless otherwise specified.

[0184] Example 1: Design of predictable base substitutions introduced by programmed sequential excision / editing at the W574 and S653 sites of the Arabidopsis ALS gene A. Experimental Materials 1. Arabidopsis Materials Wild-type Arabidopsis thaliana Col-0 is a model variety of dicotyledonous plants, and its original seeds were provided by the Department of Weeds, College of Plant Protection, China Agricultural University, and its propagation and preservation were carried out in our laboratory according to standard methods in the field.

[0185] 2. Vector The vector plasmids pCBC-dT1T2 (Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ 2014. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. Nov 29;14(1):327; for details, see https: / / www.addgene.org / 50590 / ), pHEE401E (Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ Genome Biol. 2015 Jul 21;16:144. doi: 10.1186 / s13059-015-0715-0. For specific information, see https: / / www.addgene.org / 71287 / for specific information), and pHEE401E-NG (Nishimasu et al. The vector pHEE401E-NG, which can recognize the NG PAM, was constructed by introducing mutations into pHEE401E as reported in 2018 Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361(6408):1259-1262. doi: 10.1126 / science.aas9129. The vector pHEE401E-NG was either purchased from the Addgene website or constructed in our laboratory according to conventional molecular biology methods and maintained in our laboratory.

[0186] 3. Major Equipment Pipette gun, water bath, PCR machine (Bio-rad T100), electrophoresis machine (WIX-EP600), gel imager, electric blast dryer, centrifuge (Eppendorf 5424R), high-throughput tissue layer, shaker, electronic balance, pH meter, etc.

[0187] 4. Key Reagents High-fidelity DNA polymerase (purchased from Tsingke Bio), agarose gel recovery kit and plasmid extraction kit (purchased from Sparkjade), BsaI and T4 DNA ligase (purchased from NEB), Trans5α competent cells and EHA105 competent cells (purchased from TransGen Biotech, Beijing, China), GV3101 Agrobacterium competent cells (purchased from Shanghai AngyuBio), Tris, EDTA, kanamycin, cephalosporin, hygromycin, agarose, yeast powder, tryptone, NaCl (purchased from Sangon Biotech), MS powder, sucrose, Silwet-77, hygromycin (purchased from Solarbio), nucleic acid dye (Dured), absolute ethanol (purchased from Sinopharm), etc.

[0188] 5. Preparation of Primary Solutions 1) Seed fungicide: 4 mL of 10% SDS, 20 mL of NaClO, add water to make 200 mL. 2) SDS extraction buffer: 40 mL of 1 M Tris HCl (pH 8.0), 50 mL of 0.1 M EDTA, 10 mL of 5 M NaCl, 10 mL of 10% SDS, and add water to make 200 mL. 3) Infection solution: Add 1.5 g of sucrose, 9 μL of Silwet-77, and 30 mL of ultrapure water. 4) LB solid medium: 5g yeast powder, 10g tryptone, 10g NaCl, 15g agar, add water to make 1L, sterilize at 121°C for 15 minutes, and pour into plates for later use. 5) 50x TAE stock solution: Add 242 g of Tris, 37.2 g of Na2EDTA·2H2O, and 800 mL of ultrapure water, stir well to dissolve, add 57.1 mL of acetic acid, stir well, and finally dilute to 1 L with deionized water and store at room temperature. 6) MS solid medium: Weigh 4.42 g of MS powder and 10 g of sucrose, add 800 mL of ultrapure water, adjust the pH to 5.8, add water to make 1 L, add 10 g of phytagel, sterilize at 121 °C for 15 minutes, and pour into plates for later use.

[0189] B. Experimental Methods 1. Design and Construction of CRISPR / Cas9 Dual-targeting Vector 1.1 Target design The Arabidopsis ALS gene is shown in SEQ ID NO: 2. A 19-base target sequence, gRNA1 (5'-GCATGGTTATGCAATGGGA-3'), was designed using AGA near the Arabidopsis ALS574 site as the PAM. After editing, a single G base was predicted to be deleted between the first 3 and 4 positions of the PAM. A second target sequence, gRNA2 (5'-GGCATGGTTATGCAATGGA-3'), was then designed based on the sequence generated from the deletion. As shown in Figure 2, the second editing inserted a single T base, resulting in a TGG-TTG conversion.

[0190] Similarly, a 19-nt target sequence, gRNA3 (5'-TGCCGATGATCCCGAGTGG-3'), was designed using a TGG near the Arabidopsis ALS653 site as a PAM. After editing, a single G base was predicted to be deleted between the first 3-4 positions of the PAM. A second target sequence, gRNA4 (5'-TTGCCGATGATCCCGATGG-3'), was then designed based on the sequence generated from the deletion. As shown in Figure 2, a single A base was predicted to be inserted after the second editing, resulting in an AGT-AAT conversion.

[0191] 1.2 Vector construction Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ 2014. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. Nov 29;14(1):327. Specifically, sgRNA expression cassettes were constructed using dT1T2 plasmid as a template to amplify double-targeting fragments at the ALS574 and ALS653 sites, respectively. The vector backbones of pHEE401E and pHEE401E-NG were digested with BsaI, and these bands were excised and recovered from the gel. The target fragments were directly used in the ligation reaction after digestion. The vector backbones and targeting fragments were ligated using T4 DNA ligase. The ligation products were transformed into Trans5α-competent cells, and distinct monoclones were selected for sequencing. After confirmation by sequencing, the recombinant plasmids were obtained using Sparkjade High Purity Plasmid Mini Extraction Kit to extract the plasmids, which were designated pQY743 and pQY745, respectively.

[0192] 2. Designing Primers for Target Detection The primers for target detection were centered around the ALS574 and ALS653 target sites. The upstream primer was approximately 100 bp from the ALS574 target site, and the downstream primer was approximately 280 bp from the ALS653 target site. The primer sequences were as follows: 574 / 653checking-F: 5'ATTGACGGAGATGGAAGCTT3', and 574 / 653checking-R: 5'CCAAACTGAGCCAGTCACAA3'.

[0193] 3. Establishment of Arabidopsis genetic transformation system 3.1 Agrobacterium transformation The constructed recombinant plasmid was transformed into Agrobacterium GV3101 competent cells to obtain recombinant Agrobacterium cells.

[0194] 3.2 Preparation of Agrobacterium infection solution 1) The activated Agrobacterium was collected and inoculated into 30 ml of YEP liquid medium (containing 25 mg / L Rif and 50 mg / L Kan), and cultured at 200 rpm at 28°C overnight until the OD600 value reached approximately 1.0 to 1.5. 2) After centrifugation at 6000 rpm for 10 minutes, the Agrobacterium was collected and the supernatant was discarded. 3) The Agrobacterium was resuspended in infection solution (no need to adjust H) to OD600=0.8 for later use.

[0195] 3.3 Arabidopsis transformation 1) Before transforming plants, careful attention was paid to ensure that the plants were well grown, had abundant inflorescences, and showed no stress response. The first transformation was performed when the plants were approximately 20 cm tall. Watering could be performed as needed when the soil was dry. The day before transformation, the developed siliques were cut off with scissors. 2) Immerse the inflorescence of the plant to be transformed in the above solution for 30 seconds to 1 minute with gentle agitation. There should be a layer of liquid film on the infiltrated plant. 3) After transformation was completed, the plants were cultured in the dark for 24 hours, and then removed and placed in a normal light environment for growth. 4) After one week, a second transformation can be carried out in the same manner.

[0196] 3.4 Seed collection After the seeds reached maturity, they were harvested and then dried in an oven at 37°C for approximately one week.

[0197] 4. Selection of Transgenic Plants The seeds were treated with a fungicide for 5 minutes, washed five times with deionized water, and then spread evenly on MS selective medium (containing 30 μg / mL hygromycin and 100 μg / mL cephalosporin). The medium was then placed in a light incubator (temperature 22°C, 16-hour light, 8-hour dark cycle, light intensity 100–150 μmol / m 2 / s, 75% humidity), and after one week, positive seedlings were selected and transplanted into soil.

[0198] 5. Detection of T1 mutant plants 5.1 Genomic DNA extraction 1) Arabidopsis leaves were excised and placed in a 2 mL centrifuge tube, steel balls were added, and the leaves were ground in a high-throughput tissue homogenizer. 2) After the grinding was completed, 400 μL of SDS extraction buffer was added, mixed by inversion, and incubated in a 65° C. water bath for 15 minutes, with mixing by inversion every 5 minutes. 3) Centrifugation was carried out at 13,000 rpm for 5 minutes. 4) 300 μL of the supernatant was pipetted and transferred to a new 1.5 mL centrifuge tube, and an equal volume of isopropanol pre-cooled to -20°C was added to the centrifuge tube, which was then placed at -20°C for 1 hour or overnight. 5) The mixture was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was discarded. 6) 500 μL of 70% ethanol was added to the centrifuge tube to wash the pellet, the washing solution was discarded after centrifugation (be careful not to discard the pellet), the tube was dried at room temperature, 30 μL of ultrapure water was added to dissolve the DNA, and the DNA was stored at -20°C.

[0199] 5.2 PCR amplification The extracted T1 plant genome was used as a template to amplify the target fragment with detection primers. Five microliters of the amplified product was pipetted and detected by 1% agarose gel electrophoresis. The resulting product was then imaged using a gel imager. The remaining product was then sent to a sequencing company for direct sequencing.

[0200] 6. Detection of T2 mutant plants After collecting seeds of the T1 lineage from a single plant, seeds of different lineages of the two vectors were selected and spread on imazapic selection medium (MS medium + 0.24 μg / mL imazapic) for selection. After one week, positive seedlings were transplanted into soil for molecular detection. This method was the same as in step 5.

[0201] Primers used and their sequences:

[0202] [Table 2]

[0203] C. Experimental Results 1. Genotype detection of T1 plants T1 seeds were selected on MS hygromycin resistance medium, and a total of 32 positive seedlings were obtained for the pQY743 vector and 18 positive seedlings for the pQY745 vector. Ten seedlings were selected for each vector, and genomic DNA was extracted from their leaves to detect the target site. In the T1 generation, no editing occurred at the ALS574 site, but an editing event was found at the ALS653 site, consistent with the design predictions. The detection results are shown in Table 1.

[0204] [Table 3]

[0205] 2. Selection results of T2 generation seeds After collecting T2 generation seeds from single plants, they were spread on imazapic-resistant medium for selection. As shown in Figure 3, wild-type Col-0 could not grow on this resistant medium, but the positive plants of the mutant lines could grow normally on this resistant medium.

[0206] Ten seedlings were selected for each vector, and genomic DNA was extracted from the leaves for molecular detection. As shown in Figure 4, six lines with the pQY743 vector were found to have homozygous mutations, i.e., TGG to TTG mutations, as expected. In addition, one line had a heterozygous mutation, and three lines had chimeric mutations. The detection results are shown in Table 2.

[0207] [Table 4]

[0208] The above results demonstrated that by using the technical solution of programmed sequential cleavage / editing of the present invention, it is possible to design and realize predicted mutations at target sites, and base substitution mutations can only be achieved when sequential sgRNA combinations are designed using the Cas9 protein.

[0209] Example 2: Achieving multiple mutation types by programmed sequential excision / editing at the W574 and S653 sites of the Arabidopsis ALS gene The design, construction, and operation steps for Arabidopsis transformation and selection were performed as described in Example 1. For the AtALS W574 site, the vector design was the same as in Example 1. A schematic diagram of the vector is shown in Figure 5 , and it was predicted that the W574L mutation should be realized by first -G and then +T at a specific site. No editing events were detected in the T1 generation of Arabidopsis transformed with the vector. The T2 generation of transgenic Arabidopsis was selected with 0.24 mg / L imazapic, resulting in a large number of herbicide-resistant plants, as shown in the left panel of Figure 6 . Molecular detection of these resistant plants was performed, and the PCR product sequencing results showed that not only the predicted W574L mutation was found at the W574 site, but also another resistance mutation, W574M, was found, as shown in the right panel of Figure 6 .

[0210] The vector design for the AtALS S653 site was the same as in Example 1. The vector diagram is shown in Figure 7 , and the S653N mutation was predicted to be realized by first -G and then +A at a specific site. The predicted S653N editing event was not detected in the T1 generation of Arabidopsis plants transformed with the vector. The T2 generation of transgenic Arabidopsis plants was continuously selected with 0.24 mg / L imazapic, resulting in a large number of herbicide-resistant plants, as shown in the left panel of Figure 8 . These resistant plants were subjected to molecular detection. PCR product sequencing results showed that not only the predicted S653N mutation at the S653 site had occurred, but also two other resistance mutations, S653R and S653R / G654D, had occurred, as shown in the right panel of Figure 8 .

[0211] The above results also demonstrated that by using the technical solution of programmed sequential cleavage / editing of the present invention, in addition to the predicted mutations designed for the target site, multiple functional mutation types can be generated only when sequential sgRNA combinations are designed with the corresponding Cas9 proteins.

[0212] Example 3: Generation of W574M resistant mutations by using different PAMs to perform programmed sequential excision / editing around the W574 site in the Arabidopsis ALS gene Sequence around the AtALS W574 site [ka] For sgRNA1, the design, construction, and manipulation steps for Arabidopsis transformation and selection were performed as in Example 1, except that GG, which is closer to the W574 site, was first used as the PAM to design sgRNA1:5'CTTGGCATGGTTATGCAATG3' (where the W574 site is underlined and the NG PAM is italicized). After cutting and repair, +A was used to create the new sequence [ka] The predicted W574M editing event was predicted. sgRNA2: 5'CTTGGCATGGTTATGCAAATGGGA3' was designed using AG as a novel PAM site, and after spontaneous repair in cells, a -G genotype was generated, resulting in W574M. In other words, in this scheme, different PAM sites were used for the two cuts. A diagram of the vector is shown in Figure 9. Arabidopsis thaliana was transformed with the vector, and genotype detection was performed on T1 transgenic lines. The predicted W574M editing event was detected, and the plants were resistant to imazapic treatment.

[0213] These results demonstrate that using the technical solution of the present invention to perform programmed sequential cleavage / editing and using different PAMs allows editing over a wider sequence range to obtain amino acid substitutions.

[0214] Example 4: Design of predictable base substitutions for the D350 and W548 sites of the ALS gene We constructed the NG PAM-recognizing vector pHUE411-NG by introducing mutations described in Nishimasu et al. 2018 Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361(6408):1259-1262. doi: 10.1126 / science.aas9129 into pHUE411 (A CRISPR / Cas9 toolkit for multiplex genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327. 10.1186 / s12870-014-0327-y, see details in https: / / www.addgene.org / 71287 / ).

[0215] The rice ALS gene sequence is shown in SEQ ID NO: 12. 5'GGCGTGCGGTTTGAT GATA double-targeting vector was constructed according to the method described in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014, by using the OsALS-D350 site CG3' (the underlined part was the OsALS-D350 site corresponding to Arabidopsis ALS-D376) and the novel sequence 5'GGCGTGCGGTTTGATGACG3' predicted to be generated by editing, resulting in the OsALS D350E mutation by acquiring the GAT-GAA conversion.

[0216] 5'GGTATGGTTGTGCAA TGG A double-targeting vector was constructed by using as targets GA3′ (the underlined part was the OsALS-W548 site, corresponding to Arabidopsis ALS-W574) and the novel sequence 5′GGTATGGTTGTGCAATGGA3′ predicted to be generated from editing and to acquire a TGG-TTG conversion, resulting in the OsALS W548L mutation.

[0217] These two vectors were then introduced into rice to obtain and identify transgenic plants, which showed that the plants possessed the predicted substitutions D350E and W548L. Field herbicide resistance bioassays showed that the D350E and W548L mutants acquired resistance to ALS inhibitor herbicides.

[0218] Example 5: Design of predictable base substitutions and selection of multiple mutation types for the W2038 site of the rice ACCase2 gene The rice ACCase2 gene sequence is shown in SEQ ID NO: 14, where the OsACCase2 W2038 site corresponds to the ACCase W2027 site in black fringe amaryllis. The AGG site adjacent to this site was used as a PAM to design sgRNA1: 5'TTCATCCTCGCTAAC-TGAG3', which was predicted to form a new sequence with a -G after cleavage and repair. This AGG was then used as a PAM to design sgRNA2: 5'CTTC-ATCCTCGCTAACTGAG3', which again formed a +T genotype after cleavage and repair, resulting in the W2038L mutation. sgRNA1 and sgRNA2 were assembled on the pHUE411 vector to form the editing vector, a diagram of which is shown in Figure 10.

[0219] This editing vector was used to transform calli of Huaidao No. 5 (rice cultivar), and after three weeks of simultaneous selection with 50 μg / L hygromycin and 50 μg / L quizalop-p, numerous resistant calli were obtained, as shown in the left panel of Figure 11. The resistant calli were harvested for genotyping and were found to have not only the expected W2038L mutation but also the W2038C mutation, as shown in the right panel of Figure 11.

[0220] The above results of programmed sequential cutting / editing of rice genes demonstrated that the technical solution of the present invention is applicable to both monocotyledonous and dicotyledonous plants.

[0221] Example 6: Expression and purification of SpCas9 and NGA-Cas9 proteins 1. Laboratory equipment and reagents

[0222] [Table 5]

[0223] [Table 6]

[0224] 2. Experimental Method 2.1 Construction of pET15b-Cas9 expression vector The DNA sequences of the SpCas9 and NGA-Cas9 proteins obtained after plant codon optimization are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively, and these sequences were synthesized using GenScript as template DNA.

[0225] After amplifying the NG-Cas9 and NGA-Cas9 sequences, respectively, the two fragments were ligated into the pET15b expression vector by infusion, transformed into DH5a, and then sequenced after confirmation.

[0226] [Table 7]

[0227] 2.2 Protein expression and purification The constructed expression vector was transformed into Escherichia coli Rosetta (DE3), expression was induced with IPTG, and the bacteria were harvested, lysed, and purified using a Ni-NTA column. a) The recombinant expression vector was transformed into Rosetta (DE3) strain, and a single colony was picked into 10 ml of LB medium, CmR+Amp (pET15b) or CmR+Kana (pET28a) resistant, and cultured overnight at 37°C at 200 rpm. The colony was then transferred to a 2 L shake flask containing 1 L of LB medium, cultured at 37°C at 200 rpm until the OD600 reached 0.6-0.8, cooled to 18°C, and induced with 0.5 mM IPTG overnight. The bacteria were then harvested by centrifugation at 4000 g. b) The collected bacteria were resuspended in Ni-buffer A: 50 mM HEPES, pH 7.4, 500 mM NaCl, 20 mM imidazole, 5 mM β-mercaptoethanol, and PMSF (final concentration: 1 mM) and 250 μl of cocktail inhibitors were added, followed by thorough mixing. c) After the resuspended cells were disrupted with an ultrasonic disrupter, they were centrifuged at 40,000 g for 30 minutes at 4° C., and the supernatant was collected and passed through a Ni-NTA column. d) Purification by Ni-NTA column: The lysate supernatant was combined with the resin for 20 minutes, eluted with buffer A containing 50 mM imidazole to remove impurities, and finally eluted with elution buffer containing 400 mM imidazole. e) The purification effect of the protein was detected using SDS-PAGE gel electrophoresis system. f) Dialysis was performed by changing the buffer to 50 mM HEPES pH 7.5, 150 mM KCl, 1 mM DTT, 3% glycerol. h) The final sample was subjected to SDS-PAGE gel electrophoresis to detect the purification effect of the protein. After concentration by ultrafiltration, the protein was frozen at -80°C for later use.

[0228] 2.3 Expression and purification of Cas9 fusion proteins The purification results of SpCas9 and NGA-Cas9 proteins are shown in Figure 12. The arrow indicates the Cas9 protein band, indicating that higher purity was achieved.

[0229] Example 7: In vitro enzymatic cleavage activity of SpCas9 and NGA Cas9 proteins detected against the OsACCase2 W2038 target site and the OsALS W548 target site, respectively 1. The DNA sequences of the OsALS gene and OsACCase2 gene were entered into the CRISPOR online tool (http: / / crispor.tefor.net / ). The following sgRNAs were designed for W548 of OsALS (548th amino acid of OsALS; the amino acid sequence of the rice ALS protein is shown in SEQ ID NO: 11), which corresponds to amino acid position 574 of the Arabidopsis thaliana ALS protein, and W2038 of OsACCase2 (2038th amino acid of OsACCase2; the amino acid sequence of the rice ACCase2 protein is shown in SEQ ID NO: 13), which corresponds to amino acid position 2027 of Black Alopecurus. These sgRNAs were synthesized using GenScript.

[0230] [ka]

[0231] 2. Specific detection primers, OsALS265AA-F: 5'ggtcttgcgtctggttggc3' and OsALS-end-R: 5'ccatgccaagcacatcaaacaag3', were used to amplify a fragment containing the OsALS W548 target site, and the PCR product was 1200 bp in length.

[0232] Specific detection primers, OsACC1750AA-F: 5'gcgaagaagactatgctcgtattgg3' and OsACC2196AA-R: 5'cttaatcacacctttcgcagcc3', were used to amplify a fragment containing the OsACCase W2038 target site, and the PCR product was 1500 bp in length.

[0233] The PCR system is shown in the table below.

[0234] [Table 8]

[0235] 3. PCR reaction was established and the reaction conditions are shown in the table below.

[0236] [Table 9]

[0237] 4. The PCR product was detected by agarose gel electrophoresis and sequenced for further confirmation. After proper confirmation, the gel was excised and the DNA fragment was recovered. The recovered DNA fragment was dissolved by adding 30 μl of RNase-free ultrapure water, and its concentration was measured.

[0238] 5. The following detection system was used to detect Cas9 protein activity, and after the system was prepared, it was incubated at 37°C for 1 hour.

[0239] [Table 10]

[0240] 6. After the reaction was completed, the system was treated at 65°C for 10 minutes, 4ul of 6x DNA loading buffer was added, and the gel was run on a 2% agarose gel to detect the band size.

[0241] The results are shown in Figure 13, which shows that the purified Cas9 protein was able to cleave the DNA duplex at the designed target site only in the presence of sgRNA.

[0242] Example 8: Achieving the W548L mutation at the OsALS548 locus by transforming rice protoplasts with two different targeting RNP complexes 1. Preparation of rice protoplasts and PEG-mediated transformation were carried out according to a published method (Bart et al., 2006) with some modifications. The specific preparation steps were as follows: (1) Rice seedlings for protoplasts were prepared first. The rice cultivar was Nipponbare. Rice seeds were threshed, rinsed with 75% ethanol for 1 minute, treated with 5% (v / v) sodium hypochlorite for 20 minutes, washed five times with sterile water, placed on an ultraclean table, blow-dried, and then placed into tissue culture flasks containing 1 / 2 MS medium, 20 seeds per flask. Protoplasts were prepared by incubating the seeds at 26°C under a 12-hour photoperiod for approximately 10 days. (2) Seedling leaf sheaths were selected and chopped into approximately 1 mm pieces with a sharp Gillette razor blade and placed in 0.6 M mannitol and MES culture medium (formulation: 0.6 M mannitol, 0.4 M MES, pH 5.7) for later use. After chopping all the materials, they were transferred to 20 mL of enzyme lysis solution (formulation: 1.5% Cellulase R10 / RS (YaKult Honsha), 0.5% Macerozyme R10 (YaKult Honsha), 0.5 M mannitol, 20 mM KCl, 20 mM MES, pH 5.7, 10 mM CaCl2, 0.1% BSA, 5 mM β-mercaptoethanol), wrapped in aluminum foil, and placed on a shaker at 28°C. Enzyme lysis was carried out in the dark at 50 rpm for approximately 4 hours, with the speed increased to 100 rpm for the last 2 minutes. (3) After enzymatic lysis, an equal volume of W5 solution (154 mM NaCl, 125 mM CaCl, 5 mM KCl, 15 mM MES) was added and the mixture was shaken horizontally for 10 seconds to release the protoplasts. The cells obtained from enzymatic lysis were filtered through a 300-mesh sieve and centrifuged at 150 g for 5 minutes to recover the protoplasts. (4) The cells were rinsed twice with W5 solution, and protoplasts were collected by centrifugation at 150 g for 5 minutes. (5) The protoplasts were resuspended in an appropriate amount of MMG solution (composition: 3.05 g / L MgCl, 1 g / L MES, 91.2 g / L mannitol) to a protoplast concentration of approximately 2 × 10 6 Expressed as cells / mL.

[0243] 2. Preparation of RNP complexes: OsALS548 target site sequence [ka] Purified NGA-Cas9 protein was selected to prepare RNP complexes according to the following: (OsALS W548 site is underlined, corresponding to Arabidopsis ALS W574; PAM site recognized by Cas9 protein is indicated in italicized lowercase letters). GGA was used as PAM >CrRNA1-548-G:5'-GGGUAUGGUUGUGCAA UGG GAguuuuagagcuaugcu-3' was designed, which was predicted to result in the deletion of one G base between the first 3 and 4 positions of the PAM after editing. The sequence resulting from the above deletion was then used to design a second >CrRNA2-548+T:5'-UGGGUAUGGUUGUGCAAUGGAguuuuagagcuaugcu-3', which was predicted to result in the insertion of one T base after the second editing, resulting in a TGG-TTG conversion.

[0244] >CrRNA1-548-G and >CrRNA1-548+T were synthesized by GenScript Biotechnology Company, and sgRNA was also synthesized.

[0245] [ka]

[0246] Following the manufacturer's instructions, the synthesized crRNA and GenCRISPR tracrRNA (GenScript SC1933) were mixed in equal molar amounts, and the crRNA & tracrRNA annealing buffer (GenScript SC1957-B) was added. The gRNA sequence was 5'-agcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuu-3'.

[0247] The RNP reaction system was prepared according to the table below, and after the reaction system was prepared, it was incubated at 25°C for 10 minutes.

[0248] [Table 11]

[0249] 3. Protoplast Transformation (1) 200 μl of the protoplasts resuspended in MMG prepared above was taken, and the RNP complex (20 μg of Cas9 protein, 20 μg of sgRNA) generated after incubation was added, followed by gentle shaking to mix well. (2) An equal volume of 40% (w / v) PEG solution (composition: 40% (w / v) PEG, 0.5 M mannitol, 100 mM CaCl2) was added, the mixture was mixed well by gently shaking, and the mixture was allowed to stand at 28°C in a dark place for 15 minutes. (3) After induction and transformation, 1.5 mL of W5 solution was slowly added, the cells were mixed well by gently tapping, and the cells were collected by centrifugation at 150 g for 3 minutes. This process was repeated once. (4) These cells were resuspended by adding 1.5 mL of W5 solution and cultured in a dark incubator at 28°C for 12 to 16 hours. If these cells are to be used for the extraction of protoplast genomic DNA, they should be incubated for 48 to 60 hours.

[0250] 4. Detection of genome-targeted editing events (1) Protoplast DNA was extracted using a modified CTAB method, which is specifically described as follows: protoplasts were centrifuged, the supernatant was discarded, 500 μL of DNA extraction solution was added, shaken to mix well, and incubated in a water bath at 65°C for 1 hour; after incubation in the water bath, the sample was cooled, an equal volume of chloroform was added, mixed well by inverting several times, and centrifuged at 10,000 rpm for 10 minutes; 400 μL of the supernatant was removed and transferred to a new 1.5 mL centrifuge tube, and 1 mL of 70% (v / v) ethanol was added and allowed to stand at −20°C for 20 minutes to precipitate; DNA was precipitated by centrifugation at 12,000 rpm for 15 minutes, and the precipitate was air-dried and then dissolved by adding 50 μL of ultrapure water and stored at −20°C for later use.

[0251] (2) A fragment containing the W548 target site was amplified using gene-specific primers, and the following detection primers were designed for the target site: [ka]

[0252] The PCR reaction system is shown in the table below.

[0253] [Table 12]

[0254] (3) A PCR reaction was established, and the general reaction conditions are listed below.

[0255] [Table 13]

[0256] (4) Detection was performed by agarose gel electrophoresis, and the PCR fragments were recovered and sequenced.

[0257] 5. Experimental results: Active RNP complexes with purified NGA-Cas9 protein were formed using gRNAs prepared by annealing synthetic crRNA and tracrRNA, or directly using synthetic sgRNA. Sequencing of the OsALS548 targeting site detected a TGG to TTG mutation, demonstrating that site-specific mutation of the target site was achieved in cells by the programmed sequential cleavage / editing generated from the RNP complexes combined with crRNA or sgRNA in sequential order. In the protoplast OsALS548 target sequencing peak diagram (Figure 14), in addition to the initial G base signal peak, there was also a T base signal peak generated from this mutation, as indicated by the arrowhead, resulting in the W548L mutation at the OsALS548 site.

[0258] Example 9: Achieving the W2038L mutation at the OsACCase2 W2038 site by bombardment of rice callus with two different targeted RNP complexes 1. Preparation of RNP complexes: OsACCase2 W2038 target site sequence [ka] Purified SpCas9 protein was selected for RNP complex preparation according to the following: (Here, the OsACCase2 W2038 site, corresponding to the Big-Fringe ACCase W2027, is underlined, and the PAM site recognized by the Cas9 protein is indicated in italicized lowercase letters.) GGA was used as the PAM to design >CrRNA1-2038-G:5'-GUUCAUCCUCGCUAACUGGAGguuuuagagcuaugcu-3', which is expected to result in a deletion of one G base between the first 3 and 4 positions of the PAM after editing. The resulting sequence was then used to design the second >CrRNA2-2038+T:5'-UGUUCAUCCUCGCUAACUGAGguuuuagagcuaugcu-3', which is expected to result in a T base insertion after the second editing, resulting in a TGG-TTG conversion.

[0259] >CrRNA1-2038-G and >CrRNA2-2038+T were synthesized by GenScript Biotechnology Company, and sgRNA was also synthesized. [ka]

[0260] According to the manufacturer's instructions, the synthesized crRNA and GenCRISPR tracrRNA (GenScript SC1933) were mixed in equal molar amounts, and crRNA & tracrRNA annealing buffer (GenScript SC1957-B) was added. The mixture was annealed to prepare gRNA.

[0261] The RNP complex was prepared by incubating in the same reaction system as in Example 8. For example, the amount of 10 biolistic bombardments for transformation is: 20 μg of Cas9 protein, 20 μg of gRNA or sgRNA, 10 μl of 10×Cas9 reaction buffer, and RNase-free ultrapure water to a total volume of 100 μl, incubated at 25° C. for 10 minutes, and mixed gently.

[0262] 2. Rice callus induction Mature and full rice seeds were selected, threshed and disinfected according to the following process. (1) Rice seeds were threshed, and the rice variety was Huaidao No. 5, purchased from a seed market. (2) The seeds were washed with sterile water an unlimited number of times until the water became clear. (3) After sterilization with 70% alcohol for 1 minute, the seeds were placed in 10% sodium hypochlorite on a horizontal shaker and incubated under shaking for 25 minutes. (4) After disinfection with sodium hypochlorite, the seeds were washed five times with sterile water and then sown on callus induction medium (MS powder (4.42 g / L) + 2,4-D (2 mg / L) + sucrose (30 g / L) + phytagel (4 g / L)) and incubated in the dark at 28°C to induce callus.

[0263] 3. Gene gun RNP bombardment: (1) Hypertonic culture Calli with good embryogenic potential were transferred to hypertonic medium (composition: MS powder (4.42 g / L) + 2,4-D (2 mg / L) + sucrose (30 g / L) + D-mannitol (0.4 M)) + phytagel (4 g / L)). Aseptic procedures were performed in an ultraclean bench, and the calli were cultured in the dark at 25°C for 4 to 6 hours. (2) Preparation of gold powder suspension: 30 mg of gold powder (0.6 μm diameter) was weighed into a 1.5 mL imported EP tube; 1 mL of 70% ethanol was added, vortexed thoroughly, and the tube was left on ice for 10 minutes. After centrifugation for 1 minute, the supernatant was discarded; 1 mL of sterile water was added, vortexed thoroughly, centrifuged for 1 minute, and the supernatant was discarded. This procedure was repeated three times. 500 μL of sterile glycerol (50%) was added, vortexed thoroughly, and a gold powder suspension with a concentration of 60 μg / μl was prepared. This suspension was then stored at -20°C. (3) 50 μL of gold powder suspension (60 μg / mL) was taken, and 100 μL of the prepared RNP complex was added and mixed gently. (4) 15 μl of the RNP / gold powder mixture was taken and placed in the center of the cuttable membrane of a PDS-1000 benchtop gene gun (Bio-Rad), blown dry, and then bombarded according to the instrument's instructions. Impact parameters: vacuum level was 26-28, distance was 6 cm, and air pressure was 1100 psi or 1350 psi. (5) After bombardment was completed, the calli were incubated in hypertonic medium at 25°C overnight in the dark (16 hours).

[0264] 4. Selection, differentiation and rooting: (1) The bombarded calli were cultured overnight, then transferred to induction medium and cultured at 28°C for 1 week. (2) After 1 week of regeneration, the calli were transferred to selection medium (formulation: 4.1 g / L N6 powder + 0.3 g / L casein hydrolysate + 2.8 g / L proline + 2 mg / L 2,4-D + 3% sucrose + 50 μg / L quizalofop-p + 500 mg / L Cef (cephalosporin) + 0.1 g / L inositol + 0.35% phytagel, pH 5.8) for 3–4 weeks of selection; as shown in Figure 15, for the predicted editing of OsACCase2 W2038, 50 μg / L quizalofop-p was used for selection. (3) The selected resistant calli with good growth status were transferred to differentiation medium (formulation: MS powder (4.42 g / L) + KT (1 mg / L) + sucrose (30 g / L) + phytagel (4.5 g / L) + 50 μg / L quizalofop-p, pH 5.8) and cultured at 28°C under illumination for 2 to 4 weeks to induce differentiation. (4) The differentiated seedlings were transferred to rooting medium (formulation: 1 / 2 MS powder (2.3 g / L) + sucrose (30 g / L) + phytagel (4.5 g / L)) for rooting, and the seedlings were strengthened after rooting was completed, then transplanted into pots filled with soil and transferred to a greenhouse for cultivation.

[0265] 5. Detection of Targeted Editing Events in Resistant Calli and T0 Tissue Culture Seedlings: A total of 11 resistant calli were obtained from the selection, and their DNA was extracted by the CTAB method. The detection primers for the target site were designed as follows: OsACC2038test-F: 5'CTGTAGGCATTTGAAACTGCAGTG3', OsACC2038test-R: 5'GCAATCCTGGAGTTCCT-CTGACC3'. PCR fragments containing the OsACCase2 W2038 site were amplified, recovered, and sequenced. Sequencing detection showed that 10 of them had a TGG to TTG mutation at the OsACCase2 W2038 site, and three samples were homozygous mutants.

[0266] For the T0 generation tissue culture seedlings obtained by resistant callus differentiation, their DNA was extracted to detect the editing target site sequence, and as shown in Figure 16, a type-conjugated mutation from TGG to TTG was also present at the OsACCase2 W2038 site.

[0267] 6. Resistance test of T1 seedlings to ACCase inhibitor herbicides After breeding the TO lines containing the W2038L mutation, the T1 generation mutant seedlings were tested for herbicide resistance using field concentrations of quizalofop-p and haloxyfop-p. As shown in Figures 17-18, it was found that the OsACCase2 W2038L mutant lines were significantly resistant to these two ACCase inhibitor herbicides.

[0268] In summary, active RNP complexes with purified SpCas9 protein could be formed using gRNAs prepared by annealing synthetic crRNA and tracrRNA or directly using synthetic sgRNA; biolistically bombarded calli could be selected by using quizalofop-p in tissue culture; a homozygous TGG-to-TTG mutation was detected by sequencing the OsACCase2 W2038 target site in T0 generation tissue culture seedlings; this mutation was heritable to the T1 generation and conferred resistance to ACCase inhibitor herbicides. This further demonstrated that programmed sequential cleavage / editing generated from RNP complexes combined with sequentially targeting crRNAs or sgRNAs can achieve site-specific mutations at target sites in cells and induce the production of cell-intrinsic selectable markers for tissue culture selection, thereby generating herbicide-resistant crops.

[0269] Example 10: Different targeting RNP complexes simultaneously edit the OsACCase2 W2038 site and the OsBADH2 gene in rice callus The RNP complex was prepared by the method according to Example 8, and the biolistic bombardment and tissue culture procedures were the same as those in Example 9. In addition to the crRNA or sgRNA targeting the OsACCase2 W2038 site, the crRNA or sgRNA targeting the OsBADH2 gene was simultaneously added and incubated with SpCas9 protein to form a targeted RNP complex for the second target gene, OsBADH2. Biolistic bombardment was performed, and T0 generation tissue culture seedlings were obtained after regeneration, screening, differentiation, and rooting, and T1 generation was obtained after propagation.

[0270] The rice OsBADH2 genome sequence is shown in SEQ ID NO: 17. The target site sequence was determined according to the CRISPOR online tool (http: / / crispor.tefor.net / ). [ka] (Here, the PAM site recognized by the Cas9 protein is shown in lowercase italics.) The purified SpCas9 protein was used to prepare RNP complexes. Using CGG as the PAM, we designed the CrRNA1-OsBADH2: 5'-CCAAGUACCUCCGCGCAAUCGguuuuagagcuaugcu-3'. This predicted that the resistance mutation of OsACCase2 W2038L and the knockout mutation of OsBADH2 could be simultaneously detected in resistant calli obtained by quizalofop-p selection.

[0271] >CrRNA1-OsBADH2 was synthesized by GenScript Biotechnology Company, and sgRNA was also synthesized. [ka]

[0272] As shown in Figure 19, resistant calli were selected according to the transformation procedure of Example 9, and the sequences of the OsACCase2 and OsBADH2 target sites in the calli and T0 generation tissue culture seedlings were determined after differentiation and seedling emergence. The OsBADH2 target detection primers were as follows: [ka]

[0273] As a result, a total of 13 resistant calli were obtained through selection, of which the OsACCase2 W2038L mutation event was detected in 11. Detection of the OsBADH2 target sequence in these 11 calli samples indicated that 8 of them simultaneously contained editing events at the OsBADH2 target site. In the T0 generation tissue culture seedlings obtained by differentiation, the presence of the OsACCase2 W2038L mutation and the OsBADH2+A homozygous mutation was detected, as shown in Figures 20-21.

[0274] In brief, rice calli were bombarded with a series of targeted crRNA- or sgRNA-targeted RNP complexes to perform site-specific editing of OsACCase2 W2038. Simultaneously, a targeted RNP complex targeting a second target gene, OsBADH2, was added. Calli were selected using quizalofop-p during tissue culture. Sixty-one percent of resistant calli simultaneously harbored the OsACCase2 W2038 mutation and a targeted knockout of OsBADH2. Homozygous OsBADH2 mutant lines were detected in T0 tissue culture seedlings. These results demonstrate that sequential excision / editing, combined with RNP transformation for site-specific editing of resistance genes, can generate endogenous selectable markers and allow simultaneous screening for editing events of the second target gene under enrichment and corresponding selective pressure, thereby achieving site-specific genome editing by non-transgenic means.

[0275] Example 11: Different targeting RNP complexes simultaneously edit the OsALS548 site and the OsSWEET14 gene in rice callus The targeting RNP complex for the OsALS548 site was prepared by the method according to Example 8, and the crRNA and sgRNA sequences were the same as those in Example 8. [ka]

[0276] Referring to Example 8, gRNA or sgRNA was incubated with NGA-Cas9 to prepare an RNP complex targeting the OsALS548 site.

[0277] In addition to the OsALS548 targeting RNP complex, a crRNA or sgRNA targeting the OsSWEET14 gene was co-incubated with SpCas9 protein to form a targeting RNP complex for the second target gene, OsSWEET14. T0 generation tissue culture seedlings were obtained by biolistic bombardment, regeneration, selection, differentiation, and rooting, and then propagated to obtain the T1 generation. The selection pressure was 5 mg / L pyroxsulam.

[0278] The rice OsSWEET14 genome sequence is shown in SEQ ID NO: 18. The target site sequence was determined according to the CRISPOR online tool (http: / / crispor.tefor.net / ). [ka] (where the PAM site recognized by the SpCas9 protein is shown in lowercase italics) was selected, and purified SpCas9 protein was used for the preparation of RNP complexes. The following was designed using GGG as the PAM: [ka] It was predicted that the resistance mutation of OsALS W548L and the knockout mutation of OsSWEET14 would be detected simultaneously in the resistant calli obtained by pyroxsulam selection.

[0279] >CrRNA1-Os SWEET14 was synthesized by GenScript Biotechnology Company, and sgRNA was also synthesized. [ka]

[0280] Resistant calli were selected for differentiation and seedling emergence according to the gene gun bombardment and tissue culture procedures as described in Example 9, as shown in Figure 22, where the selective medium formulation was 4.1 g / L N6 powder + 0.3 g / L casein hydrolysate + 2.8 g / L proline + 2 mg / L 2,4-D + 3% sucrose + 5 mg / L pyroxsulam + 500 mg / L Cef (cephalosporin) + 0.1 g / L inositol + 0.35% phytagel, pH 5.8.

[0281] The sequences of the OsALS548 site and the OsSWEET14 target site in the callus and T0 generation tissue culture seedlings were determined. The primers for detecting the OsSWEET14 target site were as follows: [ka]

[0282] As a result, a total of nine resistant calli were obtained through selection, and the OsALS W548L mutation event was detected in eight of them. Detection of the OsSWEET14 target sequence in these eight calli samples indicated that five of them contained editing events at the OsSWEET14 target site. In the T0 generation tissue culture seedlings obtained by differentiation, both the OsALS W548L mutation and the OsSWEET14-C homozygous mutation were detectable, as shown in Figures 23 and 24.

[0283] After breeding the TO lines in which the OsALS W548L mutation was detected, the T1 generation mutant seedlings were tested for herbicide resistance using field concentrations of pyroxsulam, imazapic, nicosulfuron, and flucarbazone-Na. As shown in Figures 25-28, the OsALS W548L mutant lines exhibited significant resistance to all four ALS inhibitor herbicides.

[0284] In brief, active RNP complexes with purified SpCas9 protein can be formed using gRNAs prepared by annealing synthetic crRNA and tracrRNA, or by directly using synthetic sgRNA; site-specific mutation of target sites in cells can be achieved by programmed sequential cleavage / editing generated from the RNP complexes combined with a series of targeting crRNAs or sgRNAs; selection of biolistically bombarded calli can be performed using pyroxsulam during tissue culture; sequencing of the OsALS548 target site in T0-generation tissue-cultured seedlings detected a TGG-to-TTG mutation, which was heritable to the T1 generation and conferred resistance to ALS inhibitor herbicides.

[0285] After biolistic bombardment of rice calli using a targeting RNP complex targeting a second target gene, OsSWEET14, and SpCas9 protein that recognizes the NGG PAM, calli were selected using pyroxsulam in the tissue culture stage. The OsALS W548L mutation and the targeted knockout of OsSWEET14 were simultaneously observed in 55% of resistant calli. The presence of a homozygous OsSWEET14 mutation was detectable in T0 tissue culture seedlings. This further demonstrated that an endogenous selectable marker can be generated by combining programmed sequential excision / editing with site-specific editing of the resistance gene generated from PNP transformation. The editing events of the second target gene can be simultaneously selected by simultaneously using Cas9 proteins that recognize different PAM sites and applying the corresponding selection pressure, thereby achieving site-specific genome editing by non-transgenic means.

[0286] Example 12: Creation of the W561L mutation at the StALS561 locus by bombarding potato (Solanum tuberosum L.) explants with two different targeted RNP complexes The amino acid sequence of the potato StALS2 protein is shown in SEQ ID NO: 19, and the sequence of the potato StALS2 gene is shown in SEQ ID NO: 20. The methods for preparing the RNP complex and for gene gun bombardment refer to Examples 8 and 9. The original sequence of the StALS2W561 site of potato StALS2, which corresponds to the Arabidopsis ALS574 site, and the sgRNA for the designed editing sequence were as follows: [ka]

[0287] The RNP complex was prepared according to the method described in Example 8.

[0288] The recipient potato cultivars were Atlantic or Favorita, and leaves, stems, and axillary buds were used as explants. The methods for gene gun bombardment and selection and differentiation were as follows. (1) Leaves: Whole leaves were excised and spread flat on hypertonic M6 medium (composition: 4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin riboside + 0.2 M mannitol + 250 mg / L Cef). Approximately 5 to 6 leaves were used per bombardment. After 24 hours of preincubation, bombardment with gold powder was performed. After bombardment, they were cultured in hypertonic M6 medium for 2 days in the dark, then transferred to M6 medium (4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin riboside + 250 mg / L Cef) and cultured for 1 week. After 1 week, they were transferred to M6 medium under selective pressure and supplemented with 20 μg / L chlorsulfuron (formulation: 4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin riboside + 250 mg / L Cef). Resistant calli were selected using a selective pressure of 4.42 g / L MS powder + 1 ml / L B5 vitamin (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L GA3 + 0.8 mg / L zeatin riboside + 250 mg / L Cef + 20 μg / L chlorsulfuron, and after 4 weeks they were transferred to the selective pressure of R4 (formulation: 4.42 g / L MS powder + 1 ml / L B5 vitamin (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L GA3 + 0.8 mg / L zeatin riboside + 250 mg / L Cef + 20 μg / L chlorsulfuron) until seedlings emerged.

[0289] (2) Stems: Potato stems (excluding axillary buds) were harvested, cut lengthwise with the cut end facing up, and placed on CIMI medium (4.42 g / L MS powder + 20 g / L sucrose + 8 g / L agar + 0.5 mg / L zeatin nucleoside + 2 mg / L 2,4-D + 250 mg / L Cef + 20 μg / L chlorsulfuron). After biolistic bombardment and incubation in the dark for 1 day, the stems were transferred to fresh CIMI medium and cultured for 1 week. Subsequently, the stems were transferred to SIMI medium (formulation: 4.42 g / L MS powder + 20 g / L sucrose + 8 g / L agar + 1 mg / L zeatin riboside + 0.1 mg / L GA3 + 250 mg / L Cef + 20 μg / L chlorsulfuron) containing selective pressure, and selection for resistant shoots was performed until seedlings emerged.

[0290] (3) Axillary buds: Axillary buds were collected from potato stems, cut vertically, and transferred to CIMI medium. , placed cut end up on CIMI medium, then bombarded with a biolistic gun, cultured in the dark for 1 day after bombardment, transferred to fresh CIMI medium, continued culture for 1 week, and then transferred to SIMI medium containing selective pressure to select for resistant shoots until seedlings emerged.

[0291] The detection primers for the StALS2 W561 site were as follows: [ka]

[0292] After detection, the W561L editing event was found at the StALS2 W561 site in the resistance-screened T0 generation potato tissue culture seedlings, demonstrating that the non-transgenic transient gene editing method provided by the present invention is suitable for crops such as potato, where it can be difficult to isolate and remove exogenous transgenic elements by selfing or crossing.

[0293] Example 13: Successful use of a programmed sequential cleavage / editing scheme for base substitution in human 293T cells The HBB (hemoglobin subunit β) gene of human embryonic kidney cell 293T (its DNA sequence is shown in SEQ ID NO: 21, its CDS sequence is shown in SEQ ID NO: 22, and its amino acid sequence is shown in SEQ ID NO: 23) was selected, and target sites for the sequential cleavage / editing of sgRNA were designed within the region of the first exon, and this first target was catggtgcaCctgactcctg AGG The sgRNA that recognized this target was designated sgHBB, and it was predicted that a deletion of one C base could be generated at the sgRNA cleavage site of this site. The second target recognized the sequence with a deletion of one C base generated by cleavage / editing of the first target, ccatggtgcatctgactctg. AGG The sgRNA for this target was designated sgHBB-c. An sgRNA without a target site in 293T cells was designed and designated sgNOTAR, which was used as the complementary plasmid for transfection in this experiment.

[0294] Complementary single-stranded DNA fragments were synthesized according to the above design. After annealing, they were ligated to the px458 (addgene:48138) plasmid digested with BbsI enzyme and transformed into competent E. coli DH5a. The resulting single colonies were confirmed by sequencing, and the plasmids were extracted and purified using an endotoxin-free plasmid extraction kit (Tiangen Bio).

[0295] Proliferating 293T cells were digested and isolated with 0.05% trypsin (Gibico), diluted in DMEM medium (10% fetal bovine serum; penicillin + streptomycin double resistance), seeded into 24-well culture plates, and placed in a carbon dioxide incubator overnight. The next day, they were mixed separately according to the following: sequential cleavage / editing: 0.5 μg each of sgHBB and sgHBB-c plasmids; single-target cleavage / editing: 0.5 μg each of sgHBB and sgNOTAR plasmids; and no-target control: 1 μg of pEGFP-c1 plasmid. Transformation was performed using Lipofectamine 3000 (Invitrogen). Each group had three replicates.

[0296] Forty-eight hours after transformation, photographs were taken under a fluorescent microscope to record the transformation efficiency, and total DNA from each well was extracted using a nucleic acid extraction kit (Omega).

[0297] The designed Hi-tom sequencing primers were as follows: [ka]

[0298] PCR was performed on each DNA sample using these primers, and high-throughput sequencing of the PCR products was performed using the Hi-tom method (Sci China Life Sci. 2019 Jan;62(1):1-7. doi: 10.1007 / s11427-018-9402-9).

[0299] The statistical data of the sequencing results are shown in Tables 6 and 7. These data showed that the sequential cleavage / editing method at the HBB site resulted in C to T editing (resulting in a P6S mutation) at a rate of approximately 1.67%, while the single-target cleavage / editing method was unable to produce such a base substitution.

[0300] [Table 14]

[0301] [Table 15]

[0302] Furthermore, sickle cell anemia and β-thalassemia are both hereditary anemias caused by mutations in the HBB gene, which encodes the adult hemoglobin β subunit. Patients with these diseases may require blood transfusions or other therapies throughout their lives. The results of the above experiments demonstrated that, with the technical solution of programmed sequential cleavage / editing provided by the present invention, a combination of crRNA or sgRNA can be designed to induce predicted repair at the mutation site of the HBB gene, resulting in cells producing active hemoglobin and restoring function, thereby achieving a therapeutic effect. In other words, the compositions provided by the present invention have applications in the treatment of diseases.

[0303] After various simultaneous tests, we found that this novel method is entirely based on the existing functions of Cas9, and therefore the method of the present invention is fully applicable to achieve new functions of base substitution, deletion, and insertion of specific fragments in other organisms (such as plants, animals, fungi, or bacteria) in which Cas9 can function well.

[0304] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0305] Although the invention has been described in more detail above by way of examples and embodiments for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims, and all such changes and modifications are within the scope of the invention.

Claims

1. A method for generating novel mutations in an organism, comprising the steps of: sequentially generating two or more DNA breaks at specific sites in the genome of the organism, and spontaneously repairing each of the DNA breaks, wherein the subsequent DNA breaks are generated based on novel sequences generated from the repair of the previous DNA break; and the organism is not a plant, When the organism is a human or non-human animal, the method is an in vitro method; The "DNA cleavage" is achieved by delivering a nuclease with targeting properties to a cell of the organism so that it contacts a specific site in the genomic DNA; the "nuclease with targeting properties" is a CRISPR / Cas system; The "sequential creation of two or more DNA breaks at specific sites" Based on the new sequence generated by the previous DNA break repair event generated by the CRISPR / Cas system, a new target RNA is designed to cut the site again; The "two or more DNA breaks" are created by sequentially delivering different targeted nucleases to recipient cells of different generations, and mutant cells that have completed a previous edit are used as recipients to receive the delivery of a targeted nuclease for a subsequent edit, thereby performing a second edit to generate a site-specific mutation; or The "two or more DNA breaks" are created by delivering different targeted nucleases for different targets to the same recipient cell, or The "two or more DNA cleavages" are generated when RNP complexes formed by the same CRISPR / Cas nuclease each carrying a different gRNA or sgRNA sequentially cleave corresponding target sequences; or The method wherein the "two or more DNA cleavages" are generated when RNP complexes formed individually by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA sequentially cleave the corresponding target sequences.

2. 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; or 6) Agrobacterium-mediated transformation.

3. 1. A method for lysing a target DNA, comprising contacting the target DNA with a complex, the complex comprising: (a) a Cas polypeptide; and (b) at least two target RNAs, where a first target RNA targets the DNA and causes a cleavage in the DNA, and a second target RNA targets a sequence generated from a previous cleavage repair event and again creates a cleavage; comprising the target DNA is not derived from a plant, When the target DNA is of human origin, the method is an in vitro method.

4. 4. The method of claim 3, wherein the contacting comprises introducing into the cell: (a) a Cas polypeptide or a polynucleotide encoding the Cas polypeptide, and (b) a target RNA or a DNA polynucleotide encoding the target RNA.

5. 1. A method for screening for editing events independent of exogenous transgenic markers, comprising the steps of: 1) two or more DNA breaks are successively created at specific sites in the sequence of a first target gene in a recipient cell, and each is spontaneously repaired, with subsequent DNA breaks being generated based on new sequences generated from the repair of the previous DNA break; 2) a specific editing event occurs after specific sites in the first target gene are sequentially cut and repaired, which confers resistance to a specific selective pressure on the mutant cell to produce a phenotypically selectable trait, and the corresponding selective pressure is applied to select for the trait, and cells, tissues, organs or whole organisms containing such editing events are isolated; 3) Optionally, a targeted nuclease is used to simultaneously edit at least one second target gene in addition to the first target gene, and the editing events of the second target gene are enriched and simultaneously screened via screening for a selectable trait generated by mutation of the first target gene, and cells, tissues, organs, or whole organisms that simultaneously contain an editing event of the first target gene and an editing event of at least one second target gene are isolated. comprising the organism is not a plant, When the organism is a human or non-human animal, the method is an in vitro method; The "DNA cleavage" is achieved by delivering a nuclease with targeting properties to a cell of the organism so that it contacts a specific site in the genomic DNA; The "nuclease with targeting properties" is any CRISPR / Cas nuclease capable of performing genome editing; The phrase "two or more DNA breaks are successively created at specific sites in the sequence" refers to a new target RNA being designed to cut the site again based on a new sequence generated by a previous DNA break repair event generated by the CRISPR / Cas system; The "two or more DNA cleavages" are generated when RNP complexes formed by the same CRISPR / Cas nuclease each carrying a different gRNA or sgRNA sequentially cleave corresponding target sequences; or The method wherein the "two or more DNA cleavages" are generated when RNP complexes formed individually by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA sequentially cleave the corresponding target sequences.

6. 6. The method of claim 5, wherein the "first target gene" is a genetic locus encoding at least one phenotypically selectable trait, and the at least one phenotypically selectable trait is a resistance / tolerance trait or a growth advantage trait.

7. "A specific site in a first target gene" refers to a site where, after sequential excision and repair, a specific type of mutation is generated that can confer resistance to a specific selective pressure on a recipient cell, resulting in at least one phenotypically selectable resistance / tolerance trait or growth advantage; The "certain type of mutation" comprises a single base substitution, a multiple base substitution, or an insertion or deletion of an unspecified number of bases; The method according to claim 5 or 6, wherein the "certain selective pressure" is environmental pressure or pressure resulting from an added compound.

8. 6. The method of claim 5, wherein the "targeted nuclease for at least one second target gene" and the CRISPR / Cas nuclease used to create a DNA break at a specific site in the first target gene are the same or different.

9. The method of claim 8, wherein the targeted nuclease is in the form of DNA, or the targeted nuclease is not DNA but is in the form of mRNA or protein.

10. 1. A method for non-transgenic transient editing of the genome of an organism, comprising the steps of: 1) a combination of at least two crRNA fragments or a combination of at least two sgRNA fragments is designed and synthesized for a specific site of a first target gene in a recipient cell, and the combination of crRNA in combination with a tracrRNA or the combination of sgRNA alone can guide a corresponding Cas protein to sequentially create two or more DNA breaks at the specific site of the first target gene in the recipient cell and spontaneously repair them, respectively, and the subsequent DNA breaks are generated based on the new sequence generated from the previous DNA break repair; 2) Mixing an appropriate amount of CRISPR / Cas protein or its corresponding mRNA with the combination of crRNA fragments and tracrRNA fragments or a combination of single sgRNA fragments, which are designed and synthesized in advance as described above and capable of guiding site-specific editing of the first target gene to generate an endogenous selection marker, and optionally further adding at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting the second, third, or subsequent target genes, and incubating in vitro to form an RNP complex; 3) delivering the RNP complex to a recipient cell and contacting it with a specific site in genomic DNA to achieve gene editing; 4) according to the phenotypic selectable trait produced by the site-specific editing of the first target gene by the RNP complex, applying a corresponding selection pressure to select for that trait, isolating cells, tissues, organs or whole organisms containing that editing event, and optionally isolating cells, tissues, organs or whole organisms containing simultaneously an editing event of the first target gene and at least one editing event of a second, third or subsequent target gene; and the organism is not a plant, When the organism is a human or non-human animal, the method is an in vitro method; the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of performing genome editing; The phrase "sequentially creating two or more DNA breaks at a specific site" refers to designing a new target RNA to cut the site again based on a new sequence generated by a previous DNA break repair event generated by the CRISPR / Cas system; The "two or more DNA cleavages" are generated when RNP complexes formed by the same CRISPR / Cas nuclease each carrying a different gRNA or sgRNA sequentially cleave corresponding target sequences; or The method wherein the "two or more DNA cleavages" are generated when RNP complexes formed individually by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA sequentially cleave the corresponding target sequences.

11. 11. The method of claim 10, wherein the "first target gene" is a genetic locus encoding at least one phenotypic selectable trait, and the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait.

12. the "specific site of the first target gene" refers to a site where, after successive excisions and repairs, a specific type of mutation is generated that can confer resistance to a specific selective pressure on a recipient cell, resulting in at least one phenotypically selectable resistance / tolerance trait or growth advantage trait; The "certain type of mutation" comprises a single base substitution, a multiple base substitution, or an insertion or deletion of an unspecified number of bases; The method according to claim 10 or 11, wherein the "certain selective pressure" is environmental pressure or pressure resulting from an added compound.

13. The "at least one of the artificially synthesized crRNA and tracrRNA fragments or the artificially synthesized sgRNA fragments targeting the second, third or subsequent target gene" has the same Cas protein with the crRNA or sgRNA targeting the first target gene, or The method of any one of claims 10 to 12, wherein the "at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third or subsequent target gene" and the crRNA or sgRNA targeting the first target gene use Cas proteins that recognize different PAM sequences.

Citation Information

Patent Citations

  • Herbicidal composition

    JP2019182876A

  • Transgenic plants with enhanced agronomic traits

    US20120005773A1

  • ALS inhibitor herbicide tolerant mutant plants

    US20160208277A1

  • ALS inhibitor herbicide tolerant mutant plants

    US20160298129A1

  • Herbicide-resistant taraxacum kok-saghyz and taraxacum brevicorniculatum

    US20170314033A1