Nucleic acid constructs for simultaneous gene activation

Abstract

This specification reports novel DNA constructs and methods for using the same. The invention employs the deliberate placement of non-productive / inactive promoters and genes on the coding and template strands of a DNA molecule, which are converted to active forms by interaction with a site-specific recombinase. More specifically, DNA elements of the invention are non-functional with respect to the expression of the first and second genes contained therein. By being non-functional with respect to the expression of the first and second genes, DNA elements of the invention can be integrated into the genome of a cell without the risk that the contained structural genes are already expressed immediately after integration. These genes are expressed only after a recombinase that recognizes and functions through the recombination recognition sequences of the DNA element is activated or introduced into the cell. This initiates recombinase-mediated cassette inversion (RMCI) between the first and second mutant recombinase recognition sequences in the DNA element of the invention integrated into the genome. RMCI results in the inversion of the portion of the DNA element of the invention located between the two mutant recombinase recognition sequences. This results in the first promoter being operably linked to a first gene and the second promoter being operably linked to a second gene. Only then are the first and second genes transcribed and their encoded proteins expressed. Thus, the DNA element according to the invention is particularly useful for the simultaneous activation of two genes in a cell. TIFF2023546113000015.tif79141

Description

Technical Field

[0001] This specification reports novel DNA constructs and methods of using them. In the novel DNA constructs according to the present invention, site-specific recombinase technology can be used to simultaneously activate the transcription of at least two genes. The present invention uses the intentional inactive arrangement of promoters and gene elements on the coding and template strands of DNA molecules, which are converted to their active forms by interaction with site-specific recombinases. Also reported herein are novel VA RNA elements in which the promoter is exchanged and LoxP sites are incorporated.

Background Art

[0002] Background of the Invention Gene therapy, in a broad sense, refers to the therapeutic administration of genetic material to modify gene expression in living cells and thereby change their biological properties. After decades of research, gene therapy has advanced into the market and is expected to become increasingly important. Generally, gene therapy can be divided into either in vivo or ex vivo approaches.

[0003] Today, most in vivo therapies rely on DNA delivery via recombinant adeno-associated virus (rAAV) vectors. AAV is a small, naturally occurring, non-pathogenic parvovirus, composed of a non-enveloped icosahedral capsid. It contains a linear single-stranded DNA genome of approximately 4.7 kb. The genome of the wild-type AAV vector contains two genes, rep and cap, flanked by a reverse-end repeat (ITR). The ITR is required in cis for viral replication and packaging. The rep gene encodes four distinct proteins, whose expression is driven by two alternative promoters, P5 and P19. Furthermore, alternative splicing generates different morphologies. The rep proteins have multiple functions, such as DNA binding, endonuclease, and helicase activity. They play roles in gene regulation, site-specific integration, excision, replication, and packaging. The cap gene encodes three capsid proteins and one aggregate activator protein. The differential expression of these proteins is achieved by alternative splicing and alternative start codon use, and is driven by a single promoter P40 located in the coding region of the rep gene.

[0004] In engineered therapeutic rAAV vectors, the viral genes remain adjacent to the viral ITR but are replaced by a transgene expression cassette encoding the target gene under the control of a selected promoter. Unlike wild-type viruses, engineered rAAV vectors do not undergo site-specific integration into the host genome and remain primarily in the episome within the nucleus of transduced cells.

[0005] AAV does not replicate itself, but requires the function of helper genes. These are naturally provided by co-infecting helper viruses, such as adenoviruses or herpes simplex viruses. For example, five adenovirus genes, namely E1A, E1B, E2A, E4, and VA, are known to be essential for AAV replication. In contrast to other protein-coding helper genes, VA is a small RNA gene.

[0006] To produce the rAAV vector, DNA containing the transgene adjacent to the ITR is introduced into a packaging host cell line that also contains the rep gene, the cap gene, and the necessary helper genes. There are many methods for introducing these three DNA elements into cells, and methods for combining them on different DNA plasmids (e.g., Robert, MA, et al. Biotechnol. J. 12 (2017) 1600193).

[0007] Two common manufacturing methods are widely used. In the triple transfection method, HEK293 cells already expressing adenoviruses E1A and E1B are transiently and simultaneously transfected with adenovirus helper plasmids (pHELPER) carrying E2A, E4, and VA, a plasmid containing rep / cap, and a plasmid containing the rAAV transgene. Alternatively, the rep / cap gene and the viral helper gene can be combined on a single large plasmid (double transfection method). The second method involves infection of insect cells (Sf9) with two baculoviruses, one carrying the rAAV genome and the other carrying rep and cap. In this system, the baculovirus plasmids themselves provide helper function. Similarly, herpes simplex virus is used in combination with HEK293 cells or BHK cells. More recently, Mietzsch et al. (Hum.Gene Ther. 25 (2014) 212-222; Hum.Gene Ther. Methods 28 (2017) 15-22) manipulated Sf9 cells in which rep and cap genes were stably integrated into the genome. In these cells, a single baculovirus carrying the rAAV transgene was sufficient to produce the rAAV vector. Clark et al. (Hum.Gene Ther. 6 (1995) 1329-1341) created a HeLa cell line in which the rep / cap gene and the rAAV transgene were integrated into its genome. Transfecting the cells with wild-type adenovirus induced rAAV vector production, resulting in the production of a mixed stock of rAAV vector and adenovirus.

[0008] No mammalian cell lines in which helper genes are stably integrated into their genome have been described to date. The expression of rep and viral helper genes is toxic to cells and needs to be strictly controlled (see, for example, Qiao, C., et al., J. Virol. 76 (2002) 1904-1913).

[0009] In the case of rep genes, such regulation is achieved by introducing an intron into the rep gene containing a polyadenylation site adjacent to the LoxP site. After introducing Cre recombinase using recombinant adenovirus, the polyadenylation site is removed, and the intron is removed by splicing (see, for example, Yuan, Z., et al., Hum. Gene Ther. 22 (2011) 613-624; Qiao, C., et al. (see above)).

[0010] Podhajska, AJ, et al. (Gene 40(1985) 163-168) reported a prototype gene expression plasmid with the following three novel characteristics: (i) its “off-phase” is absolute in all common hosts because the expression promoter faces away from the gene being tested and is blocked by a strong terminator; (ii) the “on-phase” is achieved by rapid and efficient inversion of the promoter; and (iii) only a short thermal pulse or exposure to other inducers is required to initiate this two-step process.

[0011] International Publication No. 97 / 9441 (EP 0 850 313 B1) describes a method for producing recombinant adeno-associated virus (AAV), comprising the steps of (1) culturing a composition comprising transiently transfected cells, the composition comprising: (a) an AAV helper plasmid comprising nucleic acids encoding AAV rep protein and cap protein; (b) an adenovirus helper plasmid comprising essential adenovirus helper genes, wherein the essential adenovirus helper genes present in the plasmid are selected from the group consisting of E1A, E1B, E2A, E4, E4ORF6, E4ORF6 / 7, VA RNA and combinations thereof; and (c) an AAV plasmid comprising first and second AAV reverse terminal repeat sequences (ITRs), wherein the first and second AAV ITR reported a method comprising (1) culturing a composition containing cells transiently transfected in the absence of adenovirus particles using an AAV plasmid in which DNA encoding a target polypeptide is adjacent to the DNA and the DNA is operably linked to promoter DNA; and (2) purifying recombinant AAV produced therefrom.

[0012] Japanese Patent Publication No. 10-33175 reports a gene sequence in which a stuffer sequence sandwiched between two recombinase recognition sequences is inserted into the genome sequence of an adeno-associated virus, characterized in that the insertion site of the recombinase recognition sequence is between promoter P5 and the translation start codon of the rep78 / 68 gene, and the stuffer sequence contains at least one detectable gene marker and a polyA signal in the same direction as promoter P5 and the rep78 / 68 gene.

[0013] International Publication No. 98 / 24918 (EP 0 942 999 B1; US ​​6,303,302 B1) reported a gene capture construct containing a first reporter gene that, after activation, can activate a second reporter gene, wherein the first reporter gene encodes a recombinase and the second reporter gene encodes a protein factor, and the second reporter gene is activated, thereby causing the recombinase to delete a DNA fragment located before the second reporter gene, thus positioning the second reporter gene downstream of its promoter under its control.

[0014] International Publication No. 98 / 27207 reported a polynucleotide comprising a recombinase-activatable adeno-associated virus (AAV) packaging cassette comprising the following components in relative order listed from upstream to downstream: (i) a first site-specific recombination (SSR) site; (ii) an SSR-intervening sequence; and (iii) a second site-specific recombination (SSR) site; wherein the cassette comprises a promoter and an AAV packaging gene selected from the group consisting of AAV rep genes and AAV cap genes, the promoter being located either within the SSR-intervening sequence or upstream of the first SSR site, the AAV packaging gene being located either downstream of the second SSR site or within the SSR-intervening sequence, and the promoter being activatably ligated to the AAV packaging gene.

[0015] International Publication No. 98 / 10086 (US 6,274,354 B1) reported a method for the efficient production of recombinant AAV. In one embodiment, three plasmids are introduced into a host cell. The first plasmid directs the expression of Cre-recombinase, the second plasmid contains a promoter, a LoxP site, and a spacer sequence adjacent to the rep / cap, and the third plasmid contains a minigene containing the transgene and a regulatory sequence adjacent to the AAV ITR. In another embodiment, the host cell stably or inductively expresses Cre-recombinase, and two plasmids carrying other elements of the system are introduced into the host cell.

[0016] International Publication No. 98 / 27217 (EP 0 953 647 B1) reported a DNA construction that controls the expression of a viral structural protein gene using a recombinase and its recognition sequence, which are sequenced in the following order: promoter, recombinase recognition sequence, drug resistance gene, poly(A) addition signal, recombinase recognition sequence, viral structural protein gene, and poly(A) addition signal.

[0017] International Publication No. 2001 / 36615 (EP 1 230 354 B1) reported a permanent amniotic fluid cell line containing at least one nucleic acid that results in the expression of gene products of the adenovirus E1A and E1B regions.

[0018] International Publication No. 2001 / 66774 reported a system for controlling the expression of a target gene comprising a first DNA sequence containing a target gene functionally linked to a promoter, a second DNA sequence containing a second gene encoding a polypeptide having recombination activity specific to a target DNA sequence, and two target DNA sequences adjacent to one of the two DNA sequences, characterized in that the second DNA sequence is located between the promoter and the target gene.

[0019] Silver, DP and Livingstone, DM reported that continuous expression of Cre recombinase in cultured cells lacking the exogenous LoxP site caused reduced growth, cytopathic effects, and chromosomal abnormalities. An autoexcisable retroviral vector incorporating a negative feedback loop to limit the duration and intensity of Cre recombinase expression avoided measurable toxicity while retaining the ability to excise target sequences adjacent to the LoxP site (Mol. Cell 8(2001)233-243).

[0020] Siegel, RW et al. outlined that, given the increasing importance of the Cre / LoxP system for elucidating gene function, more sophisticated schemes for activating or inactivating genes, as well as the ability to reuse selection markers for subsequent reuse, require the availability of a set of incompatible LoxP sites. By incorporating multiple incompatible LoxP sites into the genome at defined locations, subsequent introduction of the transgene construct to different chromosomal locations mediated by Cre recombinase becomes possible simply by specifying the corresponding LoxP sites on the targeting vector (FEBS Lett. 499 (2001) 147-153).

[0021] International Publication No. 2002 / 8409 (EP 1 309 709 A2, US 7,972,857) provides a method for obtaining site-specific substitution of a target DNA in mammalian cells, comprising: a) providing mammalian cells comprising a receptor construct comprising a receptor polynucleotide to be substituted, wherein the receptor polynucleotide is adjacent to two or more copies of an irreversible recombination site (IRS); b) introducing a donor construct comprising a donor polynucleotide for substitution of the receptor polynucleotide into cells, wherein the donor polynucleotide is adjacent to two or more complementary irreversible recombination sites (CIRS); and c) contacting the receptor construct and the donor construct with an irreversible recombinase polypeptide, wherein the irreversible recombinase catalyzes recombination between the IRS and CIRS and substitution of the receptor polynucleotide with the donor polynucleotide, thereby forming a substitution construct.

[0022] International Publication No. 2002 / 40685 (US 7,449,179 B2) reported a method for preparing a gene capture library and gene target cells for conditional gene inactivation. Plasmids were prepared containing mutant element cassettes and gene trap cassettes with site-specific recombination sequences. The mutant element cassette contained DNA containing a mutant sequence including a first site-specific recombination sequence, a splice acceptor sequence linked to a first marker gene linked to a polyadenylated sequence, and a second site-specific recombination sequence. The gene trap cassette contained DNA containing a first gene trap element including a first site-specific recombination sequence and a promoter operably linked to a second marker gene operably linked to a splice donor sequence, and a second gene trap cassette containing a promoter linked to a unique sequence not present in the genome of selected host cells.

[0023] International Publication No. 2002 / 88353 (EP 1 383 891 B1) reported an isolated DNA molecule comprising at least sequence A adjacent to at least site-directed recombinase-targeting sequence (SSRTS) L1 and at least sequence B adjacent to at least site-directed recombinase-targeting sequence (SSRTS) L2, wherein sequences A and B are transcribed and translated in opposite directions, SSRTS L1 and SSRTS L2 cannot recombine with each other, sequence L1 is in the opposite direction, sequence L2 is in the opposite direction, the order of the SSRTS sequences in the DNA molecule is 5'-L1-L2-L1-L2-3', and the recombinase specificity of SSRTS L1 and SSRTS L2 are the same.

[0024] Mlynarova, L. et al. reported that in Escherichia coli, in the presence of Cre recombinase, both Lox511 and Lox2272 sites become highly disordered relative to LoxP when one of the recombination partners is located in a larger stretch of the reverse repeat of non-lox DNA (Gene 296(2002)129-137).

[0025] Langer, S. J. et al. reported that the use of LoxP sites with complementary mutant arms (Lox66 and Lox71) enables efficient recombination in trans and generates defective sites with wild-type LoxP sites and double mutant arms (Nucl. Acids Res. 30 (2002) 3067-3077). Since the double mutant LoxP site is no longer an efficient substrate for recombinase, insertion is favored and the reaction is driven in one direction.

[0026] Tronche, F. et al. reported the use of site-directed recombinase in mice (FEBS Lett 529(2002)116-121). They outlined the first use of the Cre-LoxP system in mice to switch on gene expression in a given cell population. Two different transgenic mouse lines were created. The first carries a silent transgene positioned spaced away from the promoter by a “stop cassette.” The stop cassette prevents transcription of the transgene by containing either a strong polyadenylation signal and / or a splice donor sequence, or by disrupting the ORF of the silent gene. The second carries a transgene that drives Cre recombinase expression in a cell-type-specific, i.e., tissue-specific manner. In all Cre recombinase-expressing cells, the stop cassette is excised to allow expression of the desired transgene only in those cells. According to Tronche et al., it is essential that the insertion of the LoxP site does not interfere with the normal expression of the gene. Ideally, these should be located in introns or non-transcribed regions to avoid disruption of regulatory regions. However, in some cases, LoxP sites were inserted into non-translated regions but were transcribed without negative effects. Tronche et al. further outlined the observation of decreased cell proliferation and increased apoptosis in cells expressing high levels of Cre recombinase. This is associated with the accumulation of Cre recombinase-expressing cells, chromosomal rearrangement, and micronucleus formation during the G2 / M phase of the cell cycle. These abnormalities may be due to the action of Cre recombinase on potential target sites present in the genome.

[0027] International Publication No. 2003 / 84977 reported a method for regulating gene expression using transcription termination sequences located within introns. Transcription termination sequences can be disrupted by the addition of trans-activators. For example, in a "dual splicing switch," the transcription termination sequence is adjacent to the recombination site and can be excised by a recombinase. The Cre / LoxP recombination system can be used for this purpose.

[0028] Thomson, J.G. et al. reported that the insertion reaction in the Cre / LoxP system is more difficult to control because the excision event is kinetically favored. Comparing combinations of 50 mutant LoxP sites to the native LoxP site, mutations to 6 bp inside the Cre recombinase binding domain significantly inhibited recombination, while mutations to 8 bp outside were found to be more tolerated (Genesis 36 (2003) 162 - 167).

[0029] WO 2004 / 29219 reported vectors and methods for controlling the temporal and spatial expression of shRNA constructs in cells and organisms. Such vectors can be retroviral vectors such as lentiviral vectors. In a preferred embodiment, the expression of shRNA is regulated by an RNA polymerase III promoter. Such promoters are known to result in efficient silencing. Essentially any polIII promoter can be used, and desirable examples include the human U6 snRNA promoter, the mouse U6 snRNA promoter, the human and mouse Hl RNA promoters, and the human tRNA - val promoter.

[0030] Mizukami, H. et al. reported separate control of rep and cap expression using mutant and wild-type LoxP sequences, as well as an improved packaging system for adeno-associated virus vector production. They developed an inducible expression system for both the Rep and Cap proteins by using two separate plasmids, one containing a mutant sequence and the other a wild-type LoxP sequence, and the expression of the two different proteins can be simultaneously induced by Cre recombinase (Mol. Biotechnol. 27(2004) 1-14). To perform recombination, Cre recombinase-expressing adenovirus plasmids were applied to cultures. To control rep and cap expression, a stuffer sequence was placed adjacent to two LoxP (wild-type or mutant) sequences. In the presence of Cre recombinase, the stuffer sequence was removed, and the cap and rep genes were expressed.

[0031] Chatterjee, PK et al. reported that the difference between in vivo results and previously reported results may be related to transient versus constitutively expressed Cre recombinase proteins available for recombination. LoxP site indiscriminateness appears to increase with the level and persistence of Cre recombinase protein (Nucl. Acids Res. 32(2004) 5668-5676).

[0032] Ventura, A. et al. reported conditional Cre-lox regulatory RNA interference from a transgene (Proc. Natl. Acad. Sci. USA 101(2004)10380-10385). The authors constructed two lentiviral vectors for conditional Cre-lox regulatory RNA interference. One vector allows conditional activation, while the other allows conditional inactivation of short hairpin RNA (shRNA) expression. The former is based on a strategy of modifying the mouse U6 promoter by including a hybrid between the LoxP site and the TATA box.

[0033] U.S. Patent Application Publication 2006 / 110390 reports adenovirus expression vectors AdCMV-Ku70 and AdCMV-Ku80 based on the Cre recombinase-dependent luciferase expression plasmid AdCUL, which consists of oppositely oriented mutant LoxP sites Lox71 and Lox66 adjacent to the antisense firefly luciferase reporter gene downstream of the cytomegalovirus immediate-type early promoter (CMV). Cre recombinase-mediated recombination between Lox71 and Lox66 inverts the floxed cassette in the sense direction, resulting in luciferase gene expression.

[0034] U.S. Patent Application Publication No. 2006 / 143737 (U.S. Patent No. 7,267,979) reported a construct for recombinase inversion or excision that generates double-stranded target sequence RNA and thereby functions to trigger an endogenous gene silencing mechanism.

[0035] International Publication No. 2006 / 99615 reported the application of a Cre recombinase with an incompatible spacer and a half-mutant LoxP site for unidirectional exchange of a modified target gene in the fiber region of an adenovirus vector.

[0036] Missirlis, PI, et al. (BMC Genomics 7(2006)A13) reported a high-throughput screening to identify the sequence and indiscriminate properties of LoxP spacer regions in Cre-recombinase-mediated recombination. They outlined that, given the successful use of both spacers and reverse repeat variants, identifying a sufficient number of indiscriminate LE / RE spacer variants could potentially allow for the introduction of numerous DNA segments into a given target molecule, chromosome, or genome. However, serialization RMCE or insertion recombination via reverse repeats has been limited to the few stable indiscriminate LoxP sites identified to date.

[0037] International Publication No. 2015 / 068411 reported an AAV-LoxP plasmid containing a nucleotide sequence encoding a target protein located between Lox71 and LoxJTZ17 in the opposite direction to the promoter orientation, which normally does not express the target protein.

[0038] International Publication No. 2011 / 100250 reported a targeted plasmid for in vivo gene regulation in eukaryotic cells, which introduces the LoxP-FRT-Neo STOP-FRT-tetO-LoxP cassette to a specific locus in the genome.

[0039] Kawabe, Y. et al. reported a gene integration system for antibody production using recombinant Chinese hamster ovary (CHO) cells (Cytotechnol. 64 (2012) 267-279). Replacement cassettes adjacent to wild-type and mutant LoxP sites were integrated into the chromosomes of CHO cells to establish recipient founder cells. A donor plasmid was then prepared containing a marker antibody expression cassette adjacent to the matching pair of LoxP sites, including an internal non-paired LoxP site between the expression cassette for the selected marker and the antibody expression cassette. The donor plasmid and Cre recombinase expression plasmid were co-transfected into founder CHO cells to induce RMCE in the CHO genome, resulting in site-specific integration of the antibody gene restoring the original wild-type LoxP site and generating an inactive double mutant LoxP site that no longer participates in RMCE. The RMCE procedure was repeated to increase the copy number of the integrated gene, thereby excising and removing the selected marker expression cassette present in the cells at each step.

[0040] Niesner, B. and Maheshri, N. reported that gene expression could be randomly altered by Cre recombinase-mediated promoter inversion by inserting a promoter adjacent to the inverted LoxP site before the gene of interest. This resembles a merry-go-round process of constantly inverting promoter orientation. Termination of this process is achieved by terminating Cre recombinase expression. However, although Cre recombinase is highly efficient, multiple inversion events can lead to irreversible loss of the floxed promoter or recombination with other genomic regions, resulting in large-scale rearrangement (Biotechnol.Bioeng.110(2013)2677-2686).

[0041] International Publication No. 2013 / 014294 reports the substitution of a first gene using a homologous recombination-mediated selection marker, e.g., the chloramphenicol acetyltransferase antibiotic marker, thereby allowing the marker to be removed due to the presence of LoxP sites at both ends of the marker. In the configuration used, two modified LoxP sites (Lox66 and Lox71) are used, each with a different mutation. After recombination with Cre recombinase, the Lox72 site remains (Lambert, JM, et al., Appl. Environ. Microbiol. 73 (2007) 1126-1135), which has two mutations instead of one and can no longer be recognized by Cre recombinase.

[0042] U.S. Patent Application Publication 2013 / 58871 reports the generation of a Cre-recombinase-mediated switchable inverted plasmid by using two head-to-head oriented mutant LoxP sites (Lox66 and Lox71). In the presence of Cre recombinase, the genes adjacent to the two mutant LoxP sites are inverted, forming one LoxP and one double mutant LoxP site. Since the double mutant LoxP site exhibits very low affinity for Cre recombinase, the preferred one-step inversion is nearly irreversible, allowing the gene to be stably switched "on" and "off" as desired. Leakage of expression in the absence of Cre recombinase was minimized by eliminating sequences containing a pseudo-TATA box and start codon on the side of the floxed gene.

[0043] International Publication No. 2015 / 38958 reports a cap-in-cis rAAV genome in which a ubiquitin C promoter fragment is used to drive the expression of an mCherry reporter, followed by a synthetic polyA sequence; after the AAV capsid gene controlled by a rep regulatory sequence, a late SV40 polyA signal is followed by Lox71 and Lox66; the Lox66 site is inverted relative to the Lox71 site; in this configuration, Cre recombinase mediates the inversion of the sequence adjacent to the mutant LoxP site; after the inversion, incompatible double mutant Lox72 and LoxP sites are generated, and the efficiency of the inversion is reduced to the original state.

[0044] International Publication No. 2015 / 68411 reported the viral AAV-LoxP-WGA, a nucleotide sequence encoding a target protein that is oriented opposite to the promoter orientation. This construct normally does not express the target protein. When the orientation of the nucleotide sequence encoding the target protein between the site-specific recombinase recognition sequences is reversed, the target protein is expressed.

[0045] Arguello, T. and Moraes, CT reported that Cre recombinase activity is inhibited in vivo by mutations in the asymmetric spacer region of the distal LoxP site, but not ex vivo.

[0046] International Publication No. 2016 / 57800 reported a TGG or DRG promoter operably linked to Cre recombinase and a LOX-stop-LOX-inducible RNA polymerase III promoter operably linked to inhibitory RNA. In vivo, the authors found that a single T-to-C mutation at position 4 of the central spacer region in the distal (3')LoxP site completely inhibited recombination in two conditional mouse models.

[0047] International Publication No. 2017 / 100671 reported the Cre recombinase-dependent recovery of AAV capsid sequences from transduced target cells. In the rAAV-Cap-in-cis-lox rAAV genome, polyadenylated (pA) sequences adjacent to the Lox71 and Lox66 sites are inverted by Cre recombinase.

[0048] International Publication No. 2017 / 189683 reported a gene construct containing a gene perturbation cassette and a method for evaluating the timing and sequence of gene expression using it.

[0049] International Publication No. 2018 / 96356 reported a method for producing an allele for conditional gene knockout in cells containing a target gene, comprising introducing an artificial intron sequence into the exons of the target gene, wherein the artificial intron sequence comprises a splice donor sequence; a first nuclease or recombinase site; a branching point sequence; a second nuclease or recombinase site; a splice acceptor sequence; and a stop codon located 5' or inside the first nuclease or recombinase site, and further comprising introducing or activating a recombinase or nuclease into the cell to inactivate the introduced intron, thereby excising or disrupting the branching point and inhibiting splicing of the artificial intron sequence.

[0050] International Publication No. 2018 / 229276 reports a conditional knock-in cassette which is a double-stranded DNA molecule containing sequence A, sequence B, a first pair of recombinase target sites (RTS) RTS1 and RTS1', and a second pair of RTS2 and RTS2', wherein (i) the first pair of RTS and the second pair of RTS cannot be recombined together, (ii) RTS1 and RTS1' are oriented in opposite directions, (iii) RTS2 and RTS2' are oriented in opposite directions, and (iv) sequences A and B and (v) The RTS are arranged in the following order from 5' to 3': RTS1, sequence A, RTS2, sequence B, RTS1', and RTS2', (v) sequences A and B each contain at least one coding sequence, the coding sequences are on different DNA strands, (vi) the amino acid sequence coded by sequence A has at least 90% sequence identity with the amino acid sequence coded by sequence B, and (vii) the coding strand of sequence A and the non-coding strand of sequence B cannot hybridize.

[0051] International Publication No. 2019 / 46069 reported the selective retrieval of the AAV cap gene and the development of cell type specificity in Cre recombinase expression by aligning the cap gene with a pair of LoxP sites. AAV infection of Cre recombinase-expressing cells and subsequent synthesis of the second-strand AAV genome resulted in the inversion of the floxed cap. We utilized mutant LoxP sites Lox66 and Lox71 to drive the equilibrium of Cre recombinase-mediated recombination toward unidirectional inversion. The LoxP sites were first inserted into the 3'UTR of the cap and align with a short stuffer sequence containing the target sequence for Cre recombinase-dependent retrieval.

[0052] Fischer, KB et al. reported mitigation of off-target expression sources from recombinase-dependent AAV vectors and crossover insensitive ATG-out vectors (Proc. Natl. Acad. Sci. USA 116(2019)27001-27010). Recombinase-dependent adeno-associated viruses (AAVs) allow for targeting of specific regions and expression of different transgenes without the relatively cumbersome process of transgenic mouse line production. Recombinase-dependent AAV designs using lox-STOP-lox and FRT-STOP-FRT systems have been used, but the double-inverted open reading frame (ORF) (DIO) and flip / excision (FLEX) constructs, which are effectively identical in these designs, are the most widely used due to their limited size and are said to have low leakability when using strong promoters. In short, DIO and FLEX designs utilize two pairs of orthogonal recognition sites that are overlapping and antiparallel in orientation around the desired transgene, i.e., inverted relative to the rest of the expression cassette and therefore transcriptionally repressed. Upon exposure to the appropriate recombinase, the transgene ORF inverts and locks with the promoter and 3' untranslated region (UTR) with incense, driving expression. In inverted ORFs, sometimes called "ATG-out" or "split-transgene," the transgene's Kozak sequence and start codon are positioned outside the first set of recombinase recognition sites, and the transgene ORF is reconfigured only after recombination. By independently disrupting spontaneous inversions and transgene ORFs, the authors have shown that both must be disrupted to completely suppress leakage. Furthermore, while leakage expression from intact ORFs is only detectable in highly sensitive systems, spontaneous inversions can result in low but detectable levels of fluorescent protein expression. Finally, the authors demonstrate that using a mutant recombinase recognition site with reduced homology in an ATG-out transgene design, which they call CIAO (cross-insensitive ATG-out), significantly reduces leaked expression in the mouse brain of recombinase reporter mice.

[0053] Transient transfection methods require large quantities of plasmid DNA, which must be produced by large-scale fermentation and DNA purification. More importantly, the scalability of DNA complexing with transfection reagents is limited. The scalability of electroporation is also limited. Furthermore, transient transfection of cells is largely unreproducible.

[0054] Systems that rely on herpes simplex or adenovirus transduction have an inherent risk of rAAV preparations being contaminated with replicable helper viruses.

[0055] Baculovirus-based systems have three major drawbacks: firstly, the large size of the baculovirus genome, ranging from 100kb, necessitates the application of cumbersome techniques to generate and prepare recombinant viral DNA; secondly, high-concentration recombinant virus stocks must be prepared before actual production campaigns; and finally, rAAVs derived from baculovirus-based systems are susceptible to changes in capsid composition and decreased potency. Therefore, further efforts are needed to adjust the expression ratios of different capsid proteins (Kondratov, O., et al., Mol. Ther. 25(2017) 2661-2675).

[0056] Ojala, DS et al. reported that in vivo selection of a computationally designed SCHEMA AAV library yielded novel variants for infection of adult neural stem cells in SVZ (Mol. Thera. 26(2018) 304-319).

[0057] International Publication No. 2020 / 78953 reported adeno-associated virus (AAV) vector-producing cells containing the AAV rep gene and cap gene, helper virus gene, and nucleic acid sequences encoding the DNA genome of the AAV vector; the AAV rep gene contained an intron, the intron contained a transcription termination sequence, with a first recombination site located upstream of the transcription termination sequence and a second recombination site located downstream of the transcription termination sequence; all nucleic acid sequences were integrated into a single locus within the genome of the AAV vector-producing cell. The present invention also relates to a method for producing an AAV vector-producing cell line.

[0058] International Publication No. 2018 / 150271 reported mammalian cells comprising at least four different recombinant target sites (RTS), an adenovirus (Ad) gene containing E1A, E1B or a combination thereof, and a promoter operably linked to the Ad gene, wherein the RTS, Ad gene, and promoter are integrated into the chromosome; a method for using the cells to produce recombinant adeno-associated virus (rAAV) producing host cells; and a method for producing, packaging, and purifying rAAV using AAV-producing host cells.

[0059] Mingqi, X. et al. reported on mammalian designer cells—engineering principles and biomedical applications (Biotechnol.J.10(2015)1005-1018).

[0060] Therefore, there is a need for functional genomics tools that increase the number of transgenic DNA segments that can be selectively addressed within the genome sequence. [Overview of the Initiative]

[0061] This specification reports novel deoxyribonucleic acids and methods for using them. The novel deoxyribonucleic acids according to the present invention are useful for the simultaneous activation of the expression of at least two open reading frame / genes by site-directed recombinase technology. The present invention utilizes the intentional inactivation of promoters and open reading frame / gene elements on the coding strand ((+) strand, positively oriented strand) and template strand ((-) strand, negatively oriented strand) of a deoxyribonuclear (DNA) molecule, which requires transcriptional activation, i.e., manipulable linkage between the promoter and the coding sequence that enables transcription of the coding sequence, and inversion by interaction with site-directed recombinase.

[0062] One embodiment of the present invention is also a recombinase-activatable packaging cell line for rAAV particle production, wherein the rep / cap genes and adenovirus helper genes are (stably) integrated into the genome, and at least one, or at least two, of them are contained in the deoxyribonucleic acid according to the present invention, thereby being transcriptionally activated by interaction with site-directed recombinase. In certain embodiments, transcriptional activation of one or more adenovirus helper genes is achieved by recombinase-mediated open reading frame / gene inversion (RMCI). For example, after such activation, the adenovirus helper protein E1A activates the transcription of the rep gene from its own P5 promoter, which then activates the transcription of the cap gene. In certain embodiments, in cells constitutively expressing the adenovirus E1A protein, such as HEK cells, rep / cap gene transcription is activated using the recombinase-mediated open reading frame / gene inversion in the deoxyribonucleic acid according to the present invention, or rep and / or cap gene transcription is driven using a heterologous promoter. In certain embodiments, the recombinase is Cre-recombinase type bacteriophage P1.

[0063] In certain embodiments, Cre recombinase expression is induced by transient transfection of a small amount of nucleic acid encoding Cre recombinase. It has been found that efficient recombination can be achieved with as little as 10% of the amount of plasmid DNA typically used for transient virus production. When using Cre recombinase encoding mRNA, even smaller amounts of nucleic acid are sufficient. In certain embodiments, the nucleic acid encoding Cre recombinase is incorporated into the genome of a packaging cell line and operably linked to an inductive promoter, such as a Tet-inducible promoter. In a preferred embodiment, the rAAV genome, including the ITR and transgene, is also incorporated into the genome of the packaging cell line. This makes the packaging cell line an rAAV vector and particle-producing cell line. Similarly, in certain embodiments, the rAAV genome is transiently introduced.

[0064] After recombination, the cells of the producing cell line are genetically homogeneous and express all the genes necessary for rAAV replication and packaging in the correct stoichiometric amounts (in contrast, in triple or double transfection methods, some cells may receive suboptimal doses of one or other plasmids / genes). Therefore, without being bound by this theory, stable rAAV vector / particle packaging or producing cell lines can result in higher product quality compared to transient packaging or producing cells. Furthermore, inducing rAAV vector or particle production by transfection with nucleic acids encoding Cre recombinase instead of helper viruses improves the safety of the produced rAAV vector / particles.

[0065] A further aspect of the present invention is a novel adenovirus VA RNA gene. The adenovirus VA RNA gene according to the present invention enables Cre recombinase-mediated gene activation by inversion. In the adenovirus VA RNA according to the present invention, the adenovirus VA RNA gene can be driven by any promoter having a precise transcription start site together with a LoxP site introduced into the non-coding element of the adenovirus VA RNA, i.e., the regulatory element.

[0066] A further aspect of the present invention is a novel LoxP site (spacer sequence) AGTTTATA (sequence number 01 (forward); sequence number 02 (reverse)). This spacer sequence is referred to herein as Lx. It can be combined with any known left and right repeat sequences.

[0067] In certain embodiments, the Lx spacer sequence is combined with a mutated left reverse repeat sequence and a wild-type right reverse repeat sequence. This Cre recombinase recognition sequence is denoted as Lx-LE and has the sequence of sequence number 03 in the forward direction and the sequence of sequence number 04 in the reverse direction.

[0068] In certain embodiments, the Lx spacer sequence is combined with a mutated right-reverse repeat sequence and a wild-type left-reverse repeat sequence. This Cre recombinase recognition sequence is denoted as Lx-RE and has the sequence of SEQ ID NO: 05 in the forward direction and the sequence of SEQ ID NO: 06 in the reverse direction.

[0069] The fundamental technical principle of this invention is the activation of transcription of an open reading frame or gene by combining DNA inversion with an associated, manipulable ligation to a regulatory element, such as a promoter.

[0070] One independent aspect of the present invention is a double-stranded DNA element comprising a (positively oriented) coding strand and a (negatively oriented) template strand, The code chain is in the 5' to 3' direction, that is, in the following order: - The first promoter, -A first recombinase recognition sequence containing a mutation in one of the reverse repeats, i.e., either the left reverse repeat or the right reverse repeat, while the other reverse repeat is unmuted / wild-type reverse repeat. - A second promoter whose (arrangement) is reversed with respect to the code chain (direction), - A first polyadenylation signal and / or transcription termination element whose (sequence) is inverted with respect to the coding chain (direction), -A first open reading frame that is inverted (in sequence) with respect to the code chain (direction) and operably linked to a first polyadenylation signal and / or transcription termination element, - The first recombinase recognition sequence contains mutations in each of the other reverse repeats, and the second recombinase recognition sequence is in the opposite direction to the first recombinase recognition sequence. - The second open reading frame, - Characterized by including a second polyadenylation signal and / or transcription termination element operably connected to a second open reading frame.

[0071] One independent aspect of the present invention is a double-stranded DNA element comprising the following in the 5' to 3' direction, i.e., in the following order: The first promoter is in the -5' to 3' direction / positive direction. - A first recombinase recognition sequence containing a mutation in one of the reverse repeats, i.e., either a left reverse repeat or a right reverse repeat. The second promoter is in the -3' to 5' direction / negative direction. A first polyadenylation signal and / or transcription termination element in the -3' to 5' direction / negative direction, A first open reading frame in the -3' to 5' direction / negative direction, optionally a first open reading frame operably connected to a first polyadenylation signal and / or transcription termination element, - The first recombinase recognition sequence contains mutations in each of the other reverse repeats, and the second recombinase recognition sequence is inverse / reverse to the first recombinase recognition sequence. The second open reading frame is in the -5' to 3' direction / positive direction. - A second polyadenylation signal and / or transcription termination element operably linked to a second open reading frame.

[0072] In certain dependent embodiments, incubation of a double-stranded DNA element with the first and second recombinase recognition sequences and functional recombinases is performed. - This causes an inversion of the sequence located between the first recombinase recognition sequence and the second recombinase recognition sequence (thereby operably linking the first promoter to the first open reading frame and the second promoter to the second open reading frame), and - After recombinase-mediated inversion of the DNA sequence between the first recombinase-recognition sequence and the second recombinase-recognition sequence, the generation of a (third) recombinase-recognition sequence occurs between the first promoter and the first open reading frame or between the second promoter and the second open reading frame, and the (third) recombinase-recognition sequence no longer functions with the recombinase.

[0073] One independent aspect of the present invention is a double-stranded adenovirus VA RNA element comprising the following in the 5' to 3' direction, i.e., in the following order: Promoter in the -5' to 3' direction / positive direction, - A first recombinase recognition sequence containing a mutation in one of the reverse repeats, i.e., either a left reverse repeat or a right reverse repeat. Adenovirus VA RNA gene in the -3' to 5' direction / negative orientation. - The second recombinase recognition sequence contains mutations in each of the other reverse repeats of the first recombinase recognition sequence and is inverse / reverse direction to the first recombinase recognition sequence. In certain dependent embodiments, incubation of a double-stranded VA RNA element with the first and second recombinase recognition sequences and functional recombinases is performed. - This causes a sequence inversion between the first recombinase recognition sequence and the second recombinase recognition sequence (the promoter is then operably linked to the VA RNA gene), and - After recombinase-mediated inversion of the DNA sequence between the first recombinase recognition sequence and the second recombinase recognition sequence, the generation of a (third) recombinase recognition sequence occurs between the promoter and the VA RNA gene or downstream of the VA RNA gene, and the (third) recombinase recognition sequence no longer functions with the recombinase.

[0074] One independent aspect of the present invention is a (double-stranded) DNA (molecule) comprising the following: - The first double-stranded DNA element according to the present invention, - The second double-stranded DNA element according to the present invention, -Optionally, a third double-stranded DNA element according to the present invention or an adenovirus VA RNA element according to the present invention, and -rep or / and cap open reading frame (element).

[0075] In certain dependent embodiments, 1) -In the first double-stranded DNA element, the first open reading frame is an E1A open reading frame, the second open reading frame is an E1B open reading frame, or vice versa; and -In the second double-stranded DNA element, the first open reading frame is an E2A open reading frame, and the second open reading frame is an E4 open reading frame or an E4 or E4 (open reading frame), or vice versa. or 2) -In the first double-stranded DNA element, the first open reading frame is an E2A open reading frame, and the second open reading frame is an E4 open reading frame or an E4 or E4 (open reading frame), or vice versa; and - In the second double-stranded DNA element, the first open reading frame is an E1A open reading frame, and the second open reading frame is an E1B open reading frame, or vice versa.

[0076] One independent aspect of the present invention is a mammalian or insect cell comprising at least one double-stranded DNA element or molecule or an inverted (sequence) form thereof according to the present invention.

[0077] One independent aspect of the present invention is a method for producing recombinant adeno-associated virus (rAAV) vectors or particles, comprising the following steps: - A step of culturing / proliferating cells according to the present invention (under conditions suitable for cell division), - The process of activating rAAV vector or particle production by recombinase-mediated open reading frame inversion according to the present invention (by introducing recombinase as a protein, or as mRNA, or as DNA, the recombinase is functional with the recombinase recognition sequence in the DNA element or molecule according to the present invention), -Optionally, a step of culturing the rAAV vector or particle-producing activated cells obtained in the previous step (under conditions suitable for rAAV vector or particle production), - A step of recovering rAAV vectors or particles from cells and / or culture media.

[0078] Therefore, one independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles), a) E1A open reading frame and E1B open reading frame; and b) Including E2A open reading frames and E4 or E4 or E4 or E6 open reading frames, The first and second open reading frames of a) or b) are characterized in that they are contained within / encompassed by a double-stranded DNA element comprising a (positively oriented) code strand and a (negatively oriented) template strand. The code chain, running from 5' to 3', that is, in the following order, includes the following: - First promoter (positive orientation), - The first recombinase recognition sequence contains a mutation in one of the reverse repeats. - A second promoter whose sequence is inverted (i.e., in an inverted / negative orientation) with respect to the code chain (direction), -Optionally, a first polyadenylation signal and / or transcription termination element, which is inverted (i.e., in an inverted / negative orientation) with respect to the code chain (direction) and operably linked to a first open reading frame, - The first open reading frame (a) or b) is inverted (i.e., in an inverted / negative orientation) with respect to the code chain direction. - Each other reverse repeat contains a mutation in the second recombinase recognition sequence, which is reciprocal / reverse to the first recombinase recognition sequence. -If the first open reading frame is of type a), then the second open reading frame of type a), or if the first open reading frame is of type b), then the second open reading frame of type b) (positive orientation), - A second polyadenylation signal and / or transcription termination element (positively oriented and optionally operably linked to a second open reading frame).

[0079] Therefore, one independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles), a) E1A open reading frame and E1B open reading frame; and b) Including E2A open reading frames and E4 or E4 or E4 or E6 open reading frames, The first and second open reading frames of a) and the first and second open reading frames of b) are characterized in that they are contained within a double-stranded DNA element comprising a (positively oriented) coding strand and a (negatively oriented) template strand, respectively (i.e., the DNA molecule contains two of the DNA elements), The code chain, running from 5' to 3', that is, in the following order, includes the following: - First promoter (positive orientation), - The first recombinase recognition sequence contains a mutation in one of the reverse repeats. - A second promoter whose sequence is inverted (i.e., in an inverted / negative orientation) with respect to the code chain (direction), -Optionally, a first polyadenylation signal and / or transcription termination element, which is inverted (i.e., in an inverted / negative orientation) with respect to the code chain (direction) and operably linked to a first open reading frame, - The first open reading frame (a) or b) is inverted (i.e., in an inverted / negative orientation) with respect to the code chain direction. - Each other reverse repeat contains a mutation in the second recombinase recognition sequence, which is reciprocal / reverse to the first recombinase recognition sequence. -If the first open reading frame is of type a), then the second open reading frame of type a), or if the first open reading frame is of type b), then the second open reading frame of type b) (positive orientation), - A second polyadenylation signal and / or transcription termination element (positively oriented and optionally operably linked to a second open reading frame).

[0080] Therefore, one aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles) comprising (at least one) double-stranded DNA element including a (positively oriented) coding strand and a (negatively oriented) template strand, The code chain, running from 5' to 3', that is, in the following order, includes the following: - A first promoter, in one preferred embodiment, adeno-associated virus promoter P5 or a functional fragment thereof or a variant thereof, - The first recombinase recognition sequence contains a mutation in one of the reverse repeats. - A rep and cap open reading frame comprising further promoters for the expression of Rep and Cap proteins, wherein the sequence is inverted (i.e., reversed) with respect to the coding strand (direction), - Each other reverse repeat contains a mutation in the second recombinase recognition sequence, which is inverse / reverse to the first recombinase recognition sequence. -Polyadenylation signal, in one preferred embodiment, the self-polyadenylation signal of the open reading frame of rep and cap.

[0081] In certain dependent embodiments, incubation of (double-stranded) DNA (molecule) and the first and second recombinase recognition sequences and functional recombinases is performed. - This causes a sequence inversion between the first recombinase recognition sequence and the second recombinase recognition sequence (the first promoter is then operably linked to the rep and cap open reading frames), and - After recombinase-mediated inversion of the DNA sequence between the first recombinase-recognition sequence and the second recombinase-recognition sequence, the generation of a (third) recombinase-recognition sequence occurs between the first promoter and the rep and cap open reading frames, or between the rep and cap open reading frames and the polyadenylation signal (the first and second open reading frames no longer function with the recombinase).

[0082] Another independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles) comprising a double-stranded DNA element including a (positively oriented) coding strand and a (negatively oriented) template strand. The code chain, running from 5' to 3', that is, in the following order, includes the following: - A first promoter, in one preferred embodiment, adeno-associated virus promoter P5 or a functional fragment thereof or a variant thereof, - The first recombinase recognition sequence contains a mutation in one of the reverse repeats. - A second promoter inverted (reverse-oriented) with respect to the code chain, in one preferred embodiment, adeno-associated virus promoter P19 or a functional fragment thereof or a variant thereof, -Optionally, a first polyadenylation signal and / or transcription termination element that is inverted (i.e., in an inverted / negative orientation) with respect to the coding chain (direction) and operably linked to the Rep78 or Rep68 coding sequence, -A coding sequence that codes for either the Rep78 protein or the Rep68 protein, but not both. (i) optionally, the internal P40 promoter is inactivated, and / or (ii) The start codon of Rep52 / 40 has been mutated to a non-start codon, and / or (iii) The splice donor site and acceptor site have been removed. And, it is reversed (in the opposite direction) with respect to the code chain. - The first recombinase recognition sequence contains mutations in each of the other reverse repeats, and the second recombinase recognition sequence is inverse / reverse to the first recombinase recognition sequence. - Rep52 / Rep40 open reading frames and Cap open reading frames containing a common polyadenylation signal sequence (i.e., the polyadenylation signal is operably linked to the open reading frame).

[0083] Another independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles) comprising a double-stranded DNA element including a (positively oriented) coding strand and a (negatively oriented) template strand. The code chain, running from 5' to 3', that is, in the following order, includes the following: - A first promoter, in one preferred embodiment, adeno-associated virus promoter P5 or a functional fragment thereof or a variant thereof, - The first recombinase recognition sequence contains a mutation in one of the reverse repeats. - A second promoter inverted (reverse-oriented) with respect to the code chain, in one preferred embodiment, adeno-associated virus promoter P19 or a functional fragment thereof or a variant thereof, -Optionally, a first polyadenylation signal and / or transcription termination element that is inverted (i.e., in an inverted / negative orientation) with respect to the coding chain (direction) and operably linked to the Rep78 or Rep68 coding sequence, -A coding sequence that codes for either the Rep78 protein or the Rep68 protein, but not both. (i) optionally, the internal P40 promoter is inactivated, and / or (ii) The start codon of the Rep52 / 40 open reading frame has been mutated to a non-start codon, and (iii) The splice donor site and acceptor site have been removed. And, it is reversed (in the opposite direction) with respect to the code chain. - The first recombinase recognition sequence contains mutations in each of the other reverse repeats, and the second recombinase recognition sequence is inverse / reverse to the first recombinase recognition sequence. -Optionally, a Rep52 open reading frame from which the splice donor and acceptor regions have been removed, or a Rep40 open reading frame containing a polyadenylation signal sequence (i.e., the polyadenylation signal is operably linked to the open reading frame), -Optionally, a third promoter, a cap-open reading frame, and polyadenylated and / or terminator sequences (all operably linked).

[0084] One independent aspect of the present invention is an adenovirus VA RNA gene operably linked to a functional promoter, having a precise transcription start site added, and a Cre recombinase recognition sequence manipulated within / in the adenovirus VA RNA gene.

[0085] One aspect of the present invention is an isolated (mammalian or insect) cell comprising at least one of the DNA element or DNA (molecule) or adenovirus VA RNA of the present invention in its original form or (recombinase) inverted form.

[0086] One aspect of the present invention is a method for generating / producing recombinant adeno-associated virus (rAAV) vectors or particles, the method comprising: - To provide mammalian suspension growth cells containing the following, - A transgene expression cassette placed between two AAV ITRs; - Open reading frames encoding adenovirus E1A, E1B, E2A, E4 or E4 or f6 proteins and adenovirus VA RNA; - Open reading frame encoding adeno-associated Rep / Cap protein; - One or more different pairs of incompatible recombinase recognition sequences; Individually or in combination, one or more of the group consisting of E1A open reading frames, E1B open reading frames, E2A open reading frames, E4 open reading frames, E4 open reading frames 6, Rep78 open reading frames, Rep68 open reading frames, Rep52 open reading frames, Rep40 open reading frames, Rep / Cap open reading frames, and adenovirus VA RNA genes are arranged without operably linked promoters, but include operably linked polyadenylation and / or transcription termination signals between the pair of incompatible recombinase recognition sequences, one recombinase recognition sequence containing a mutation in a left reverse repeat, one recombinase recognition sequence containing a mutation in a right reverse repeat, and having a promoter located upstream of the first recombinase recognition sequence, with the open reading frames being reversed with respect to the promoter located upstream of it; The recombinase recognition sequences are organized to enable the generation of detectable recombinase-dependent changes (e.g., by rAAV vector or particle production), and in certain embodiments, one or more recombinase recognition sequences are Cre recombinase recognition sites (i.e., the recombinase recognition sequences are reciprocal / opposite directional, and the action of the recombinase results in sequence inversion between the recombinase recognition sequences and associated manipulable linkage to an upstream promoter located to the inverted sequences); and in certain embodiments, one or more recombinase recognition sequences are Flp recognition sites (i.e., the recombinase recognition sequences are reciprocal / opposite directional, and the action of the recombinase results in sequence inversion between the recombinase recognition sequences and associated manipulable linkage to an upstream promoter located to the inverted sequences); - Inducing recombinase expression in mammalian cells by transfecting the cells with a recombinase expression plasmid or recombinase mRNA, or by activating conditional recombinase expression within the mammalian cells (wherein recombinase expression results in recombinase-mediated cassette inversion, leading to rAAV vector or particle production, and recombinase-mediated cassette inversion is the inversion of the sequence adjacent to the recombinase recognition sequence); - Isolating rAAV vectors or particles from cells and / or culture media, and thereby preparing rAAV vectors or particles.

[0087] One aspect of the present invention is a method for obtaining site-specific substitution of a target DNA in mammalian cells, a) To provide mammalian cells containing DNA elements according to the present invention, b) a) includes introducing a recombinase recognition sequence of the DNA element and a functional recombinase into a cell, or activating them in the cell. Recombinases catalyze the inversion of sequences between recombinase-recognized sequences, thereby achieving site-specific substitution of the target DNA in mammalian cells.

[0088] In all aspects and in specific embodiments of the embodiments, the first recombinase recognition sequence contains a mutation in the left reverse repeat, and the second recombinase recognition sequence contains a mutation in the right reverse repeat. This arrangement results in the upstream, i.e., 5'-located recombinase recognition sequence containing mutations in both reverse repeats after recombinase-mediated inversion being non-functional, i.e., not recognizable by each recombinase. The downstream, i.e., 3'-located recombinase recognition sequence is wild-type with respect to both reverse repeats, and is therefore functional, i.e., recognizable by each recombinase.

[0089] In all aspects and in specific embodiments of the embodiments, the first recombinase recognition sequence contains a mutation in the right reverse repeat, and the second recombinase recognition sequence contains a mutation in the left reverse repeat. This arrangement results in the downstream, i.e., 3'-located recombinase recognition sequence containing mutations in both reverse repeats after recombinase-mediated inversion being non-functional, i.e., not recognizable by each recombinase. The upstream, i.e., 5'-located recombinase recognition sequence is wild-type with respect to both reverse repeats, and is therefore functional, i.e., recognizable by each recombinase.

[0090] In all aspects and in specific embodiments of the embodiments, the first promoter is positively oriented, and / or the second open reading frame is positively oriented. [Invention 1001] A double-stranded DNA element comprising a coding strand and a template strand, The aforementioned code chain, in the direction from 5' to 3', is arranged in the following order: - The first promoter, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - A first polyadenylation signal sequence and / or transcription termination element inverted relative to the code strand, - A first open reading frame, which is inverted with respect to the code strand and operably linked to the first polyadenylation signal sequence and / or transcription termination element, - A second recombinase recognition sequence containing a mutation in a right-reverse repeat, which is oriented in the opposite direction to the first recombinase recognition sequence. - The second open reading frame, and - A second polyadenylation signal sequence and / or transcription termination element operably connected to the second open reading frame. Features including, Double-stranded DNA element. [Invention 1002] A double-stranded DNA element comprising a coding strand and a template strand, The aforementioned code chain, in the direction from 5' to 3', is arranged in the following order: - The first promoter, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A Rep / Cap open reading frame comprising further promoters for the expression of Rep protein and Cap protein, wherein the Rep / Cap open reading frame is inverted relative to the coding strand. - A second recombinase recognition sequence containing a mutation in a right-reverse repeat and oriented in the opposite direction to the first recombinase recognition sequence, and -Polyadenylated signal sequence including, Double-stranded DNA element. [Invention 1003] A double-stranded DNA element comprising a coding strand and a template strand, (a) The code chain is arranged in the following order from 5' to 3': - The first promoter, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - A first polyadenylation signal sequence and / or transcription termination element inverted relative to the code strand, -It is a code array, It encodes either the Rep78 protein only or the Rep68 protein only, but not both. (i) optionally, the internal P40 promoter is inactivated, and / or (ii) The start codon of Rep52 / 40 has been mutated to a non-start codon, and / or (iii) The splice donor site and acceptor site have been removed. It is inverted with respect to the aforementioned code chain, and The first polyadenylation signal sequence and / or transcription termination element is operably linked, Code array, - A second recombinase recognition sequence containing a mutation in a right-reverse repeat and oriented in the opposite direction to the first recombinase recognition sequence, and - Rep52 / Rep40 open reading frame and Cap open reading frame, which include a polyadenylation signal operably coupled to these open reading frames. including, or (b) The code chain is arranged in the following order from 5' to 3': - The first promoter, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - A first polyadenylation signal sequence and / or transcription termination element inverted relative to the code strand, -It is a code array, It encodes either the Rep78 protein only or the Rep68 protein only, but not both. (i) optionally, the internal promoter is deactivated, and / or (ii) The start codon of the Rep52 / 40 open reading frame has been mutated into a non-start codon, and (iii) The splice donor site and acceptor site have been removed, It is inverted with respect to the aforementioned code chain, and The first polyadenylation signal sequence and / or transcription termination element is operably linked, Code array, - A second recombinase recognition sequence containing a mutation in a right-reverse repeat and oriented in the opposite direction to the first recombinase recognition sequence, and - The Rep52 open reading frame, or the Rep40 open reading frame, wherein the splice donor site and acceptor site are optionally removed, and the Rep40 open reading frame includes a polyadenylation signal operably connected to the open reading frame. including, Double-stranded DNA element. [Invention 1004] A double-stranded DNA element according to the present invention 1002 or 1003, wherein the first promoter is a P5 promoter. [Invention 1005] A double-stranded DNA element according to the present invention 1003 or 1004, wherein the second promoter is a P19 promoter. [Invention 1006] (c) In the above code chain, at its 3' end, - All are operably linked: a third promoter, a cap-open reading frame, and a polyadenylated signal sequence and / or terminator sequence. Further including, A double-stranded DNA element according to any of invention 1003 to 1005. [Invention 1007] (a) E1A open reading frame and E1B open reading frame; and / or (b) E2A open reading frame and E4 or E6 open reading frame A double-stranded DNA molecule containing, (a) or / and (b) is characterized in that the first open reading frame and the second open reading frame are contained within a double-stranded DNA element including a coding strand and a template strand. The aforementioned code chain, in the direction from 5' to 3', is arranged in the following order: - The first promoter, - The first recombinase recognition sequence containing a mutation in the right reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - The first open reading frame (a) or (b) which is inverted with respect to the code chain, - A second recombinase recognition sequence containing a mutation in a left reverse repeat and oriented in the opposite direction to the first recombinase recognition sequence, and - The second open reading frame of (a) or (b) including, double stranded DNA molecule. [Invention 1008] A double-stranded DNA molecule comprising two or more double-stranded DNA elements or molecules selected from invention 1001 to 1007. [Invention 1009] Incubation of the double-stranded DNA element or molecule with a recombinase functional to the first recombinase recognition sequence and the second recombinase recognition sequence is -A sequence inversion occurs between the first recombinase recognition sequence and the second recombinase recognition sequence, and thereafter the first promoter is operably linked to the first open reading frame, - To cause the generation of a recombinase recognition sequence between the recombinated first promoter and the first gene in which the recombinase no longer functions, The double-stranded DNA element or double-stranded DNA according to the present invention 1002. [Invention 1010] Incubation of the double-stranded DNA element or molecule with a recombinase functional to the first recombinase recognition sequence and the second recombinase recognition sequence is -A sequence inversion occurs between the first recombinase recognition sequence and the second recombinase recognition sequence, thereafter the first promoter is operably linked to the first open reading frame, and the second promoter is operably linked to the second open reading frame, and - To cause the generation of a recombinase recognition sequence between the recombinated first promoter and the first gene in which the recombinase no longer functions, A double-stranded DNA element or double-stranded DNA according to any of the present invention 1001 and 1003-1008. [Invention 1011] -One or more double-stranded DNA elements of the present invention 1001, or - At least one double-stranded DNA element according to any of invention 1002 to 1006, or - One double-stranded DNA molecule from any of Invention 1002 to 1006 and one double-stranded DNA molecule from Invention 1007, or - At least one double-stranded DNA molecule of the present invention 1007, or - One or more double-stranded DNAs of Invention 1008 Mammalian cells, including those mentioned above. [Modes for carrying out the invention]

[0091] Detailed description of the embodiments of the invention This specification reports novel DNA constructs and methods for using them. The novel DNA constructs according to the present invention are useful for the simultaneous transcriptional activation of at least two open reading frames or genes using site-directed recombinase-mediated cassette inversion (RMCI). The present invention utilizes the intentional unproductive arrangement of promoters and open reading frames on the coding and template strands of a double-stranded DNA molecule, which are converted into their productive, i.e., operably linked forms through interaction with site-directed recombinase (i.e., inversion).

[0092] definition Useful methods and techniques for carrying out the present invention are described, for example, in Ausubel, FM (ed.), Current Protocols in Molecular Biology, Vols. I-III (1997); Glover, ND, and Hames, BD, ed., DNA Cloning: A Practical Approach, Vols. I and II (1985), Oxford University Press; Freshney, RI (ed.), Animal Cell Culture - a practical approach, IRL Press Limited (1986); Watson, JD, et al., Recombinant DNA, Second Edition, CHSL Press (1992); Winnacker, EL, From Genes to Clones; NY, VCH Publishers (1987); Celis, J., ed., Cell Biology, Second Edition, Academic Press (1998); and Freshney, RI, Culture of Animal Cells: A Manual of Basic Technique, second edition, Alan R. Liss, Inc., NY (1987).

[0093] Recombinant DNA technology enables the creation of nucleic acid derivatives. Such derivatives can be modified at individual or several nucleotide positions, for example, by substitution, alteration, exchange, deletion, or insertion. Modification or derivatization can be carried out, for example, by site-directed mutagenesis. Such modifications can be easily performed by those skilled in the art (see, for example, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual (1999), Cold Spring Harbor Laboratory Press, New York, USA; Hames, BD, and Higgins, SG, Nucleic Acid Hybridization: A Practical Approach (1985), IRL Press, Oxford, England).

[0094] Deoxyribonucleic acid comprises a coding strand and a non-coding strand. The terms "5'" and "3'" refer to positions on the coding strand, as used herein.

[0095] The term "3' adjacent sequence" refers to the sequence located at the 3' end (downstream, below) of a base sequence.

[0096] The term "5' adjacent sequence" refers to the sequence located at the 5' end (downstream, below) of a base sequence.

[0097] When used herein and in the appended claims, the singular forms “a,” “an,” and “the” include multiple referents unless the context makes otherwise obvious. Thus, for example, a reference to “a cell” includes multiple such cells and their equivalents known to those skilled in the art, and so on. Similarly, the terms “a” (or “an”), “one or more,” and “at least one” may also be used synonymously herein. It should also be noted that the terms “comprising,” “including,” and “having” may also be used synonymously.

[0098] The term "AAV helper function" refers to AAV-derived coding sequences (proteins) that can be expressed to provide trans-functioning AAV gene products and AAV particles for AAV replication and packaging. Therefore, AAV helper functions include rep and cap, as well as AAV open reading frames (ORFs), including others such as AAP for specific AAV serotypes. Rep gene expression products have been shown to have many functions, including, among others, recognition, binding, and nicking of AAV origins in DNA replication; DNA helicase activity; and regulation of transcription from AAV (or other xenogeneic) promoters. Cap gene expression products (capsids) provide the necessary packaging functions. AAV helper functions are used to complement trans-AAV functions that are missing from the AAV vector genome.

[0099] The term "approximately" means a range of ±20% of the following number. In certain embodiments, the term "approximately" means a range of ±10% of the following number. In certain embodiments, the term "approximately" means a range of ±5% of the following number.

[0100] The term "comprising" also includes the term "consisting of".

[0101] The term "CAS protein" refers to CRISPR-related proteins that possess ribonuclease activity and can bind to specific RNA sequences.

[0102] The term "CAS9" refers to the endonuclease Cas9. This enzyme binds to the RNA sequence GUUUUAGAGCU(A / G)UG(C / U)UGUUUUG (crRNA repeat) (SEQ ID NO: 26) and cleaves the associated DNA at that point.

[0103] The term "Cre recombinase" refers to a tyrosine recombinase that catalyzes site-directed recombination between LoxP sites using a topoisomerase I-like mechanism. The enzyme has a molecular weight of approximately 38 kDa and consists of 343 amino acid residues. It is a member of the integrase family. An exemplary Cre recombinase has the following amino acid sequence: MSNLLTVHQN LPALPVDATS DEVRKNLDMDM FRDRQAFSEH TWKMLLSVCR SWAAWCKLNN RKWFPAEPED VRDYLLYLQA RGLAVKTIQQ HLGQLNMLHR RSGLPRPSDS NAVSLVMRRI RKENVDAGER AKQALAFERT DFDQVRSLME NSDRCQDIRN LAFLGIAYNT LLRIAEIARI RVKDISRTDG GRMLIHIGRT KTLVSTAGVE KALSLGVTKL VERWISVSGV ADDPNNYLFC RVRKNGVAAP SATSQLSTRA LEGIFEATHR LIYGAKDDSG QRYLAWSGHS ARVGAARDMA RAGVSIPEIIM QAGGWTNVNI VMNYIRNLDS ETGAMVRLLE DGD (Sequence code 07); One corresponding Cre mRNA has the following sequence: AUGAGCAACC UGCUGACCGU GCACCAGAAC CUGCCCGCCCC UGCCCGUGGA CGCCACCAGC GACGAGGUGA GGAAGAACCU GAUGGACAUG UUCAGGGACA GGCAGGCCUU CAGCGAGCAC ACCUGGAAGA UGCUGCUGAG CGUGUGCAGG AGCUGGGCCG CCUGGUGCAA GCUGAACAAC AGGAAGUGGU UCCCCGCCGA GCCCGAGGAC GUGAGGGACU ACCUGCUGUA CCUGCAGGCC AGGGGCCUGG CCGUGAAGAC CAUCCAGCAG CACCUGGGCC AGCUGAACAU GCUGCACAGG AGGAGCGGCC UGCCCAGGCC CAGCGACAGC AACGCCGUGA GCCUGGUGAU GAGGAGGAUC AGGAAGGAGA ACGUGGACGC CGGCGAGAGG GCCAAGCAGG CCCUGGCCUU CGAGAGACC GACUUCGACC AGGUGAGGAG CCUGAUGGAG AACAGCGACA GGUGCCAGGA CAUCAGGAAC CUGGCCUUCC UGGGCAUCGC CUACAACACC CUGCUGGAGGA UCGCCGAGAU CGCCAGGAUC AGGGUGAAGG ACAUCAGCAG GACCGACGGC GGCAGGAUGC UGAUCCACAU CGGCAGGACC AAGACCCUGG UGAGCACCGC CGGCGUGGAG AAGGCCCUGA GCCUGGGCGU GACCAAGCUG GUGGAGAGGU GGAUCAGCGU GAGCGGCGUG GCCGACGACC CCAACAACUA CCUGUUCUGC AGGGUGAGGA AGAACGGCGU GGCCGCCCCC AGCGCCACCA GCCAGCUGAG CACCAGGGCC CUGGAGGGCA UCUUCGAGGC CACCCACAGG CUGAUCUACG GCGCCAAGGA CGACAGCGGC CAGAGGUACC UGGCCUGGAG CGGCCACAGC GCCAGGGUGG GCGCCGCCAG GGACAUGGCC AGGGCCGGCG UGAGCAUCCC CGAGAUCAUG CAGGCCGGCG GCUGGACCAA CGUGAACAUC GUGAUGAACU ACAUCAGGAA CCUGGACAGC GAGACCGGCG CCAUGGUGAG GCUGCUGGAG GACGGCGAC (Sequence ID 08) or its variant having similarly different codon usage frequencies.

[0104] The term "CRISPR" is an abbreviation for Clustered Regularly Interspaced Short Palindromic Repeats; these are short palindromic repetitions grouped at regular intervals.

[0105] The term "CRISPR / CAS" refers to the CRISPR-related system. Clustered regulatory interspaced short palindromic repeats are loci containing multiple short direct repeats that provide adaptive immunity against bacteria and archaea. The CRISPR system relies on crRNA and tracrRNA for sequence-specific silencing of invading foreign DNA. Three types of CRISPR / CAS systems exist: In the type II system, Cas9 acts as an RNA-guided DNA endonuclease that cleaves DNA upon recognition of crRNA-tracrRNA targets.

[0106] The term "crRNA" refers to RNA consisting of a crRNA repeat sequence and a crRNA spacer sequence; it has a specific secondary structure; crRNA binds to Cas9, inducing a structural change in Cas9, thereby allowing target DNA to be bound by the crRNA spacer (complementary to the target DNA); by exchanging the crRNA spacer sequence, the target DNA can be modified (to the complementary RNA sequence of the target DNA); the crRNA repeat consists of 20 nucleotides; the 12 nucleotides adjacent to the PAM motif are extremely important for binding specificity.

[0107] The term "donor plasmid" refers to a plasmid containing a donor sequence.

[0108] The term "donor sequence" refers to a sequence containing a 5' flanking sequence, a target sequence, and a 3' flanking sequence.

[0109] The term "DSB" stands for double-strand break. A product of ZFN, TALEN, and CRISPR / Cas9 action, a double-strand break is a form of DNA damage that occurs when both strands of DNA are broken.

[0110] The terms "empty capsid" and "empty particle" refer to AAV particles that possess an AAV protein shell but lack all or part of the nucleic acid that encodes a protein or is transcribed into the target transcript adjacent to the vector, i.e., AAV ITR. Therefore, empty capsids do not function to transfer the nucleic acid that encodes a protein or is transcribed into the target transcript into a host cell.

[0111] The term "endogenous" refers to something that arises naturally within a cell; something that is naturally produced by the cell. Similarly, an "endogenous locus / intracellular locus" is a gene locus that arises naturally within a cell.

[0112] As used herein, the term “exogenous” means that a nucleotide sequence does not originate from a particular cell and is introduced into such cell by DNA delivery methods, such as transfection, electroporation, or transformation by a viral vector. Therefore, an exogenous nucleotide sequence is an artificial sequence, which may arise, for example, from a combination of subsequences of different origins (e.g., a combination of a recombinase recognition sequence with an SV40 promoter and a green fluorescent protein coding sequence is an artificial nucleic acid), or from a partial deletion or mutation of nucleic acid bases in a sequence (e.g., a sequence or cDNA that codes only for the extracellular domain of a membrane-bound receptor). The term “endogenous” means a nucleotide sequence that originates from a cell. An “exogenous” nucleotide sequence may have an “endogenous” counterpart that has the same base composition but is becoming an “exogenous” sequence through introduction into a cell, for example, via recombinant DNA technology.

[0113] As used herein, the term “adjacent” means that the first nucleotide sequence is located at either the 5' or 3' end, or both ends, of the second nucleotide sequence. The adjacent nucleotide sequence may be adjacent to the second nucleotide sequence or at a predetermined distance therefrom. There are no specific restrictions on the length of the adjacent nucleotide sequence other than the practical requirements. For example, the adjacent sequence may be a few base pairs or several thousand base pairs. The term “adjacent nucleotide sequence” means the sequence segments of nucleic acid before and after the sequence to be inserted (=target sequence).

[0114] The term "gene locus" refers to the location of a gene on a chromosome, that is, the location of a gene within the genome, i.e., the gene location.

[0115] The term "HR" stands for homologous recombination. Homologous recombination repair is a template-dependent pathway for DSB repair. By supplying homology-containing donor templates along with site-specific nucleases, HDR faithfully inserts donor molecules into target loci. This approach allows for the insertion of single or multiple transgenes, as well as single nucleotide substitutions.

[0116] An "isolated" composition is one that has been separated from one or more components of its natural environment. In some embodiments, the composition is purified to a purity of 95% or more than 99% as measured, for example, by electrophoresis (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis, CE-SDS) or chromatography (e.g., size exclusion chromatography or ion exchange or reversed-phase HPLC). For an overview of methods for evaluating antibody purity, see, for example, Flatman, S. et al., J. Chrom. B 848 (2007) 79-87.

[0117] "Isolated" nucleic acids refer to nucleic acid molecules that have been separated from one or more components of their natural environment. Isolated nucleic acids include nucleic acid molecules that are normally found inside cells containing nucleic acid molecules, but the nucleic acid molecules are located outside of chromosomes or at chromosomal locations different from their natural chromosomal locations.

[0118] An "isolated" polypeptide or antibody means a polypeptide molecule or antibody molecule that has been isolated from one or more components of its natural environment.

[0119] The term "integration site" refers to a nucleic acid sequence within the cellular genome where an exogenous nucleotide sequence is inserted. In certain embodiments, an integration site is located between two adjacent nucleotides in the cellular genome. In certain embodiments, an integration site includes a stretch of nucleotides. In certain embodiments, an integration site is located within a specific gene locus in the genome of a mammalian cell. In certain embodiments, an integration site is located within an endogenous gene in a mammalian cell.

[0120] The term "LoxP site" refers to a 34 bp nucleotide sequence consisting of two terminal 13 bp palindromic sequences (reverse repeats) (ATAACTTCGTATA (SEQ ID NO: 14) and TATACGAAGTTAT (SEQ ID NO: 15), respectively) and a central 8 bp core (asymmetric) spacer sequence. The spacer sequence determines the orientation of the LoxP site. Depending on the relative orientation and position of the two LoxP sites, the intervening DNA is either cut (LoxP sites oriented in the same direction) or inverted (LoxP sites oriented in opposite directions). The term "floxed" refers to a DNA sequence located between two LoxP sites. When two floxed sequences exist, i.e., a target floxed sequence in the genome and a floxed sequence in the donor nucleic acid, both sequences can be exchanged with each other. This is called "recombinase-mediated cassette exchange."

[0121] Exemplary LoxP sites are shown in the table below: TIFF0007830449000001.tif58128

[0122] The term “mammalian cell containing an exogenous nucleotide sequence” encompasses cells into which one or more exogenous nucleic acids have been introduced, including offspring of such cells. These can serve as a starting point for further genetic modification. Therefore, the term “mammalian cell containing an exogenous nucleotide sequence” encompasses cells containing an exogenous nucleotide sequence integrated into a single site within a locus of the genome of the mammalian cell, the exogenous nucleotide sequence comprising at least one first and at least one second recombination recognition site (these recombination recognition sites are distinct) adjacent to at least one first choice marker. In certain embodiments, a mammalian cell containing an exogenous nucleotide sequence is a cell containing an exogenous nucleotide sequence integrated into a single site within a locus of the genome of the cell, the exogenous nucleotide sequence comprising a first recombination recognition site and a second recombination recognition site adjacent to at least one first choice marker, and a third recombination recognition site located between the first and second recombination recognition sites, and all recombination recognition sites are distinct.

[0123] Both "mammalian cells containing exogenous nucleotide sequences" and "recombinant cells" are "transfected cells." This term includes both primary transfected cells and their offspring, regardless of the number of passages. Offspring may contain mutations, for example, even if their nucleic acid content is not exactly identical to that of the parent cell. Mutant offspring that have the same function or biological activity as the initially transfected cells are included.

[0124] The term "NHEJ" stands for Non-Homologous End Joining. This is a DSB repair pathway that ligates or joins two cleaved ends together. NHEJ does not use homologous templates for repair and therefore typically results in the introduction of small insertions and deletions at the cleavage site, often inducing a frameshift that knocks out gene function.

[0125] As used herein, the term “incompatible” refers to a recombinase recognition site, e.g., a first LoxP site, that does not recombine with another recombinase recognition site, e.g., a second LoxP site that does not share spacer region homology. In certain embodiments, an incompatible LoxP site recombines with another LoxP site that does not share spacer region homology by less than 1%, or 0.5% or less in one preferred embodiment. This means that two cis-linked incompatible LoxP sites are stable in the presence of Cre recombinase, i.e., site exchange of up to 1%, or 0.5% or less in a preferred embodiment.

[0126] As used herein, the term “nuclear localization sequence” refers to an amino acid sequence containing multiple copies of a positively charged amino acid residue, namely arginine and / or lysine. Polypeptides containing such sequences are identified by cells for introduction into the cell nucleus. Exemplary nuclear localization sequences include PKKKRKV (SEQ ID NO: 09; SV40 large T antigen), KR[PAATKKAGQA]KKKK (SEQ ID NO: 10; SV40 nucleoplasmin), MSRRRKANPTKLSENAKKLAKEVEN (SEQ ID NO: 11; Caenorhabditis elegans EGL-13), PAAKRVKLD (SEQ ID NO: 12; human c-myc), and KLKIKRPVK (SEQ ID NO: 13; Escherichia coli terminal utilization protein). Other nuclear localization sequences can be readily identified by those skilled in the art.

[0127] The term "nucleic acid encoding AAV packaging proteins" generally refers to one or more nucleic acid molecules containing nucleotide sequences that provide the AAV functionality deleted from an AAV vector, used to produce transduction-eligible recombinant AAV particles. Nucleic acids encoding AAV packaging proteins are commonly used to provide expression of AAV rep and / or cap genes to complement the missing AAV functionality required for AAV replication. However, nucleic acid constructs lack AAV ITR and cannot replicate or package. Nucleic acids encoding AAV packaging proteins can be in the form of plasmids, phages, transposons, cosmids, viruses, or particles. Many nucleic acid constructs, such as the commonly used plasmids pAAV / Ad and pIM 29+45, which encode both rep and cap gene expression products, have been described. See, for example, Samulski et al. (1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol. 65:2936-2945. Several plasmids encoding rep and / or cap gene expression products have been described (e.g., U.S. Patent No. 5,139,941 and U.S. Patent No. 6,376,237). Any one of these nucleic acids encoding AAV packaging proteins may contain a DNA element or nucleic acid according to the present invention.

[0128] The term “nucleic acid encoding a helper protein” generally refers to one or more nucleic acid molecules containing nucleotide sequences that encode a protein and / or RNA molecule that provides adenovirus helper function. A plasmid having a nucleic acid encoding a helper protein can be transfected into a suitable cell, and as a result, the plasmid can support AAV particle production in said cell. Any one of these nucleic acids encoding a helper protein may contain a DNA element or nucleic acid according to the present invention. Infectious viral particles present in nature, such as adenovirus, herpesvirus, or vaccinia virus particles, are specifically excluded from this term.

[0129] As used herein, the term “operably linked” means the close arrangement of two or more components that are related in a way that enables them to function in the desired manner. For example, if a promoter and / or enhancer plays a role in regulating the transcription of a coding sequence / open reading frame / gene, then the promoter and / or enhancer is operably linked to the coding sequence / open reading frame / gene. In certain embodiments, “operably linked” DNA sequences are contiguous. In certain embodiments, for example, when it is necessary to link the coding regions of two proteins, such as one secretory leader and one polypeptide, these sequences are contiguous and reside in the same reading frame. In certain embodiments, an operably linked promoter may be located upstream of the coding sequence / open reading frame / gene and adjacent to the coding sequence. In certain embodiments, for example, with respect to an enhancer sequence that regulates the expression of a coding sequence / open reading frame / gene, the two components may not be adjacent but may be operably linked. If an enhancer increases the transcription of a coding sequence / open reading frame / gene, the enhancer is operably ligated to the coding sequence / open reading frame / gene. An operably ligated enhancer may be located upstream, within, or downstream of the coding sequence / open reading frame / gene, and may be located at a considerable distance from the promoter of the coding sequence / open reading frame / gene.

[0130] The term "packaging protein" refers to non-AAV-derived viral and / or cellular functions on which AAV replication depends. Therefore, this term encompasses the capture of proteins and RNA necessary for AAV replication, including regions involved in AAV gene transcription, step-specific AAV mRNA splicing, AAV DNA replication, Cap expression product synthesis, and activation of AAV capsid assembly. Virus-based accessory functions may originate from any known helper viruses, such as adenoviruses, herpesviruses (other than type I herpes simplex virus), and vaccinia viruses.

[0131] As used herein, “AAV packaging protein” refers to an AAV-derived sequence that functions in trans for the production of AAV replication. Thus, AAV packaging proteins are encoded by the major AAV open reading frame (ORF), rep, and cap. The rep protein has been shown to have many functions, including, among others, recognition, binding, and nicking of the AAV origin of DNA replication; DNA helicase activity; and regulation of transcription from AAV (or other heterologous) promoters. The cap (capsid) protein provides the necessary packaging function. AAV packaging proteins are used herein to complement the trans AAV function missing from the AAV vector.

[0132] The term "PAM motif" refers to a protospacer-adjacent motif; a motif adjacent to a protospacer. The sequence NGG is located within the target DNA; the cleavage of the target DNA occurs 3 nucleotides before the PAM.

[0133] A "plasmid" is typically a form of nucleic acid or polynucleotide having additional elements for plasmid expression (e.g., transcription, replication, etc.) or proliferation (replication). Plasmids as used herein can also be used to reference such nucleic acid or polynucleotide sequences. Accordingly, in all embodiments, the compositions and methods of the present invention are applicable to nucleic acids, polynucleotides, and plasmids, for example, to produce cells that produce viral (e.g., AAV) vectors, to produce viral (e.g., AAV) particles, to produce cell culture media containing viral (e.g., AAV) particles, etc.

[0134] As used herein, the term “proteinic compound” means a heteromultimeric molecule containing at least one polypeptide produced in a functional form in mammalian cells. An exemplary proteinic compound is an adeno-associated virus particle (AAV particle) containing a capsid formed from a capsid polypeptide and a single-stranded DNA molecule which is a non-polypeptide component.

[0135] As used herein, the term “recombinant cell” means a cell after final genetic modification, for example, a cell that expresses the polypeptide of interest or produces the rAAV particles of interest and can be used for the production of the polypeptide of interest or the rAAV particles of interest on any scale. For example, a “mammalian cell containing an exogenous nucleotide sequence” that has been subjected to recombinase-mediated cassette exchange (RMCE) by which the coding sequence of the polypeptide of interest has been introduced into the genome of the host cell is a “recombinant cell.” This cell can still undergo further RMCE reactions, but it is not intended to do so.

[0136] A "recombinant AAV vector" is obtained from the wild-type genome of a virus (e.g., AAV) by using molecular biological methods to remove the wild-type genome and replacing it with a non-natural nucleic acid, such as a nucleic acid transcribed into a transcript or a protein-coding nucleic acid. Typically, for AAV, one or both of the reverse-end repeat (ITR) sequences of the wild-type AAV genome are retained in the recombinant AAV vector. A "recombinant" AAV vector is distinguished from a wild-type viral AAV genome because all or part of the viral genome is replaced with a non-natural (i.e., heterologous) sequence with respect to the viral genome nucleic acid. Therefore, the incorporation of a non-natural sequence defines a viral vector (e.g., AAV) as a "recombinant" vector, which in the case of AAV can be called an "rAAV vector".

[0137] Recombinant vectors (e.g., AAVs) are packaged for subsequent infection (transduction) of cells ex vivo, in vitro, or in vivo, and may be referred to herein as “particles.” When a recombinant vector sequence is encapsulated or packaged within an AAV particle, the particle may also be referred to as “rAAV.” Such particles contain proteins that encapsulate or package the vector genome. Specific examples include viral envelope proteins, and in the case of AAV, capsid proteins, e.g., AAV VP1, VP2, and VP3.

[0138] A "recombination recognition site" (RRS) is a nucleotide sequence that is recognized by a recombinase and is necessary and sufficient for a recombinase-mediated recombination event. Using RRSs, the location within a nucleotide sequence where a recombination event is expected to occur can be determined.

[0139] As used herein, the term “selection marker” means a gene that enables cells possessing that gene to be positively or negatively specific selected in the presence of a corresponding selective agent. For example, but not limited to, a selection marker may enable host cells transformed with that selection marker gene to be positively selected in the presence of each selective agent (under selective culture conditions); untransformed host cells are considered unable to proliferate or survive under selective culture conditions. Selection markers may be positive, negative, or bifunctional. A positive selection marker may enable the selection of cells possessing the marker, while a negative selection marker may enable the selective exclusion of cells possessing the marker. Selection markers can confer drug resistance in host cells or compensate for metabolic or catabolic defects. In prokaryotic cells, in particular, genes conferring resistance to ampicillin, tetracycline, kanamycin, or chloramphenicol may be used. Useful resistance genes as selection markers in eukaryotic cells include, but are not limited to, those of aminoglycoside phosphotransferases (APHs) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthase (GS), asparagine synthase, tryptophan synthase (indole), and histidinol dehydrogenase (histidinol D)), as well as genes encoding resistance to puromycin, blasticidine, bleomycin, phleomycin, chloramphenicol, zeosin, and mycophenolic acid. Further marker genes are described in International Publication Nos. 92 / 08796 and 94 / 28143.

[0140] Beyond facilitating selection in the presence of a corresponding selector, the selection marker may, alternatively, be a molecule not normally present in cells, such as green fluorescent protein (GFP), high-sensitivity GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), high-sensitivity YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire. For example, cells expressing such molecules can be distinguished from cells that do not contain this gene based on the detection or absence of fluorescence emitted by the encoded polypeptide, respectively.

[0141] As used herein, the term “serotype” refers to a distinction based on serologically distinct AAV capsids. Serological specificity is determined based on the absence of cross-reactivity between antibodies against a given AAV compared to other AAVs. Such differences in cross-reactivity are typically due to differences in capsid protein sequences / antigenic determinants (e.g., differences in the VP1, VP2, and / or VP3 sequences of AAV serotypes). An AAV variant containing a capsid variant differs from the reference or other AAV serotype by at least one nucleotide or amino acid residue, even though it may not be serologically distinguishable from the reference or other AAV serotypes.

[0142] Under the conventional definition, a serotype means that the virus of interest has been tested against serums specific to all existing and characterized serotypes for neutralizing activity, and no antibody neutralizing the virus of interest has been found. As more naturally occurring virus isolates are discovered and / or capsid variants are generated, they may or may not be serologically distinct from any of the currently existing serotypes. Therefore, if a new virus (e.g., AAV) has no serological differences, this new virus (e.g., AAV) is a subgroup or variant of the corresponding serotype. Often, serological testing for neutralizing activity has not yet been performed on mutant viruses with capsid sequence alterations to determine whether they are other serotypes according to the conventional definition of serotypes. Therefore, for convenience and to avoid repetition, the term “serotype” in a broad sense refers to both serologically distinct viruses (e.g., AAV) and serologically distinct viruses (e.g., AAV) that may be within a subgroup or variant of a given serotype.

[0143] The term "sgRNA" refers to a single guide RNA; a single RNA strand containing both crRNA and tracerRNA.

[0144] The term "TALEN" refers to transcription activator-like effector nucleases. These are fusions of a FokI cleavage domain and a DNA-binding domain derived from a TALE protein. TALEs contain multiple 33-35 amino acid repeat domains, each recognizing a single base pair. Similar to ZFNs, TALENs activate DNA damage response pathways and induce targeted DSBs that allow for custom modification.

[0145] The term "tracrRNA" refers to trans-acting CRISPR RNA; it is a non-coding RNA; it is partially complementary to crRNA; it forms an RNA double helix; it promotes crRNA processing; it is activated by RNase III; it binds to target DNA; endonuclease function cleaves it near the binding site; and it is required for activation of RNA-guided cleavage by CAS9.

[0146] The terms "transduction" and "transfect" refer to the introduction of molecules such as nucleic acids (viral vectors, plasmids) into cells. A cell is "transduced" or "transfected" when an exogenous nucleic acid is introduced inside the cell membrane. Therefore, a "transduced cell" is a cell into which a "nucleic acid" or "polynucleotide" has been introduced, or its offspring into which an exogenous nucleic acid has been introduced. In certain embodiments, a "transduced" cell (e.g., in mammals, e.g., in cell, tissue, or organ cells) undergoes genetic changes after the incorporation of an exogenous molecule, e.g., nucleic acid (e.g., a transgene). Transduced cells can be grown to transcribe and / or express the introduced nucleic acid as a protein.

[0147] In transfected or transfected cells, nucleic acids (viral vectors, plasmids) may or may not be incorporated into the genomic nucleic acid. Once the introduced nucleic acid is incorporated into the nucleic acid (genomic DNA) of a recipient cell or organism, it can be stably maintained within the cell or organism and further passed on to or inherited by the progeny cells or organisms of the recipient cell or organism. Finally, the introduced nucleic acid may exist outside the chromosome or transiently only in the recipient cell or host organism. Several techniques are known; see, for example, Graham et al. (1973) Virology, 52:456; Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York; Davis et al. (1986), Basic Methods in Molecular Biology, Elsevier; and Chu et al. (1981) Gene 13:197. Using such techniques, one or more exogenous DNA segments can be introduced into suitable host cells.

[0148] The term “transgene” is used herein to conveniently refer to a nucleic acid that is intended or introduced into a cell or organism. Transgenes include any nucleic acid, for example, a gene that is transcribed into a transcript or codes for a polypeptide or protein.

[0149] The term "vector" refers to the portion of a recombinant plasmid sequence that is ultimately packaged or encapsulated, either directly or in single-stranded or RNA form, to form a viral particle (e.g., AAV). When a recombinant plasmid is used to construct or produce a recombinant viral particle, the viral particle does not contain the portion of the plasmid that does not correspond to the vector sequence of the recombinant plasmid. This non-vector portion of the recombinant plasmid is called the "plasmid backbone," and while it is crucial for plasmid cloning and amplification, which are processes necessary for replication and recombinant virus production, it is not itself packaged or encapsulated in the viral particle (e.g., AAV). Therefore, the term "vector" refers to the nucleic acid packaged or encapsulated by the viral particle (e.g., AAV).

[0150] The term "ZFN" stands for zinc finger nuclease. These are fusions of zinc finger proteins with nonspecific DNA cleavage domains derived from FokI restriction endonucleases. ZFN dimers induce target DNA DSBs that stimulate the DNA damage response pathway. The designed binding specificity of the zinc finger domain directs the ZFN to specific genomic sites.

[0151] The term "ZFNickases" refers to zinc finger nickases. These ZFNs contain an inactivating mutation in one of their two FokI cleavage domains. ZFNickases perform only single-strand DNA cleavage and induce HDR without activating the mutagenic NHEJ pathway.

[0152] Gene editing methods Approaches that enable the manipulation of virtually any gene in diverse cell types and organisms have evolved over the past few decades. Such technologies are commonly referred to as "genome editing."

[0153] Nuclease One method of genome editing is based on the use of engineered nucleases. These consist of a sequence-specific DNA-binding domain fused to a non-specific DNA cleavage module. Such chimeric nucleases enable efficient and precise gene modification by inducing targeted DNA double-strand breaks (DSBs) that stimulate cellular DNA repair mechanisms, including error-prone non-homologous end joining (NHEJ) and homologous recombination repair (HR). The versatility of these methods stems from the ability to customize the DNA-binding domain to recognize virtually any sequence.

[0154] Therefore, the ability to perform genetic alterations depends heavily on the DNA binding specificity and affinity of the designed protein (Gaj, T., et al., Trends Biotechnol. 31(2013) 397-405).

[0155] Targeted nucleic acid substitution is introduced by homologous recombination between a chromosomal nucleic acid sequence and an exogenous donor nucleic acid sequence through site-directed nucleic acid exchange. This directional gene alteration is often referred to as "gene targeting" (see, e.g., Carroll, D., Genetics, 188(2011) 773-782).

[0156] Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / CAS are tools for targeted nucleic acid substitution. Clustered regulatory interspaced short palindromic repeat (CRISPR) / CAS-based RNA-guided DNA endonucleases rely on crRNA and tracrRNA for sequence-specific modification of DNA. Three types of CRISPR / CAS systems exist. In type II systems, for example, CAS9 acts as an RNA-guided DNA endonuclease that cleaves DNA upon recognition of a crRNA-tracrRNA target.

[0157] By co-delivering site-specific nucleases with donor plasmids having locus-specific homologous arms, single or multiple transgenes, i.e., exogenous nucleic acids including expression cassettes, can be efficiently incorporated into chromosomal target loci. Large transgenes (up to 14 kbp) have been introduced into various endogenous loci via NHEJ-mediated ligation, which synchronizes nuclease-mediated cleavage of donor DNA with chromosomal targets (Gaj, T., et al., Trends Biotechnol. 31(2013) 397-405).

[0158] When a double-stranded DNA "donor template" is supplied, nuclease-induced DSBs (HRs) can be used to introduce precise nucleic acid substitutions or insertions of up to 7.6 kbp at or near the cleavage site. Oligonucleotides can be used with ZFNs to introduce precise changes, small insertions, and large deletions. ZFNs have been used to introduce NHEJ or HR-mediated gene alterations (Joung, J.K. and Sander, J.D., Nat. Rev. Mol. Cell Biol. 14(2013) 49-55).

[0159] Typically, nuclease-coding genes are delivered to cells by plasmid DNA, viral vectors, or in vitro transcribed mRNA. Transfection of plasmid DNA or mRNA can be performed by electroporation or cationic lipid-based reagents. Integrase-deficient lentiviral vectors (IDLVs) can be used to deliver nucleases to transfection-resistant cell types. AAVs can also be used for nuclease delivery.

[0160] Zinc finger nuclease (ZFN) Zinc finger nucleases, which combine the nonspecific cleavage domain (N) of FokI endonuclease with a zinc finger protein (ZFP), provide a common method for introducing site-directed double-strand breaks (DSBs) into the genome.

[0161] The modular structure of zinc finger (ZF) motifs and modular recognition by the ZF domain make them versatile DNA recognition motifs for designing artificial DNA-binding proteins. Each ZF motif consists of approximately 30 amino acids and folds into a ββa structure stabilized by chelation of zinc ions by a conserved Cys2His2 residue. ZF motifs bind to DNA by inserting the a-helix into the major groove of the DNA double helix. Each finger primarily binds to triplets within the DNA substrate. Key amino acid residues at positions -1, +1, +2, +3, +4, +5, and +6 relative to the start point of the a-helix of each ZF motif contribute to the majority of sequence-specific interactions with the DNA site. These amino acids can be modified while maintaining the remaining amino acids as a consensus backbone to generate ZF motifs with different triplet sequence specificities. Binding to longer DNA sequences is achieved by tandem linking some of these ZF motifs to form ZFPs. The designed ZFPs offer a powerful technology because they can be fused with other functionalities such as a nonspecific FokI cleavage domain (N), a transcription activator domain (A), a transcription repressor domain (R), and a methylase (M) to form ZFNs, zinc finger transcription activators (ZFAs), zinc finger transcription repressors (ZFRs), and zinc finger methylases (ZFMs), respectively.

[0162] FokI restriction enzyme, a bacterial IIS-type restriction endonuclease, recognizes the non-palindromic pentadeoxyribonucleotide 5'-GGATG-3':5'-CATCC-3' (SEQ ID NO: 27) in double-stranded DNA and cleaves the 9 / 13 nt downstream of the recognition site. Durai et al. suggested that it is possible to create chimeric nucleases by replacing the FokI recognition domain with other naturally occurring DNA-binding proteins that recognize longer DNA sequences or other designed DNA-binding motifs (Durai, S., et al., Nucl. Acids Res. 33 (2005) 5978-5990).

[0163] Since the FokI nuclease functions as a dimer, two zinc finger arrays must be designed for each target site. The use of an obligate heterodimer FokI domain reduces the formation of undesirable homodimer species and therefore has improved specificity (Joung, J.K. and Sander, J.D., Nat. Rev. Mol. Cell Biol. 14(2013) 49-55). Thus, the ZFN target site consists of two zinc finger binding sites separated by a 5-7 bp spacer sequence recognized by the FokI cleavage domain (Gaj, T., et al., Trends Biotechnol. 31(2013) 397-405).

[0164] Transcription activator-like effector nucleases (TALENs) Fusion of a transcription activator-like (TAL) effector from a plant pathogenic Xanthomonas species to the FokI nuclease resulted in TALENs. These bind to DNA and cleave in pairs. Binding specificity is determined by a customizable array of polymorphic amino acid repeats in the TAL effector.

[0165] TAL effectors (TALEs) enter the nucleus, bind to effector-specific sequences in host gene promoters, and activate transcription. Their targeting specificity is determined by a central domain consisting of tandem 33-35 amino acid repeats followed by a single 20-amino acid cleavage repeat. Naturally occurring recognition sites are uniformly preceded by the T protein necessary for TAL effector activity (Cermak, T., et al., Nucl. Acids Res. 39 (2011) e82).

[0166] TALE specificity is determined by two hypervariable amino acids known as repeat variable duo (RVD). Similar to zinc fingers, modular TALE repeats ligate together to recognize adjacent DNA sequences (Gaj, T., et al., Trends Biotechnol. 31(2013) 397-405).

[0167] By fusing TAL effectors to the catalytic domain of FokI nucleases, target DNA double-strand breaks (DSBs) can be generated in vivo for genome editing. Because FokI cleaves as a dimer, these TAL effector nucleases (TALENs) function in pairs, binding to the opposite target across a spacer, where the FokI domains cleave together. DSBs are repaired in almost all cells by one of two highly conserved processes that can be used for gene insertion or substitution: non-homologous end joining (NHEJ) and homologous recombination (HR).

[0168] The assembly of a TALEN or TAL effector construct involves two steps: (i) assembling repeating modules into an intermediate array of 1 to 10 repeats, and (ii) joining the intermediate array to a framework for creating the final construct (Cermak, T., et al., Nucl. Acids Res. 39 (2011) e82).

[0169] The TALEN target site consists of two TALEN binding sites separated by spacer sequences of varying lengths (12-20 bp) (Gaj, T., et al., Trends Biotechnol. 31(2013) 397-405).

[0170] For typical heterodimeric target sites (i.e., those that would typically occur in native DNA sequences), paired TALEN constructs are transformed together into target cells.

[0171] One of the TALEN pairs directed to the target nucleic acid is subcloned into a mammalian expression plasmid using an appropriate restriction endonuclease. The resulting plasmid is introduced into target cells by transfection using LipofectAmine 2000 (Invitrogen) according to the manufacturer's protocol. Cells are harvested 72 hours after transfection (Cermak, T., et al., Nucl. Acids Res. 39 (2011) e82).

[0172] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-related protein 9 (CRISPR / CAS9) The naturally occurring CRISPR / CAS II system is being developed as a powerful gene editing tool for eukaryotic cells. In particular, the demonstration that crRNA and tracrRNA can be combined into a single guide RNA (sgRNA) paved the way for this development. Cas9 induces single-strand breaks in DNA. This method provides two ways to perform gene modification by utilizing DNA repair pathways in eukaryotic cells. The first method relies on non-homologous end joining (NHEJ) to join the broken ends. Second, homologous recombination repair (HDR) is used to repair damaged alleles using another DNA fragment homologous to the target. Any type of insertion, deletion, or sequence change can be achieved by providing DNA elements that can be inserted by recombination (Rath, D., et al., Biochim. 117(2015) 119-128).

[0173] In the Type II CRISPR / CAS system, a short segment of foreign DNA called a "spacer" is incorporated into the CRISPR genomic locus, transcribed, and processed into a short CRISPR RNA (crRNA). These crRNAs anneal to transactivating crRNA (tracrRNA), directing the CAS protein to sequence-specific cleavage and silencing of pathogenic DNA. Target recognition by the Cas9 protein has been shown to require a "seed" sequence within the crRNA and a conserved dinucleotide-containing protospacer facies motif (PAM) sequence upstream of the crRNA binding region. The CRISPR / CAS system has been shown to be directly transplantable into human cells by simultaneous delivery of the Cas9 endonuclease and a plasmid expressing the necessary crRNA components (Gaj, T., et al., Trends Biotechnol. 31(2013) 397-405).

[0174] Generation of recombinant cell lines Generally, for the efficient and large-scale production of a target proteinaceous compound, such as rAAV particles or therapeutic polypeptides, cells that stably express and, if possible, secrete the proteinaceous compound are required. Such cells are called “recombinant cells” or “recombinant-producing cells.” The process for generating such recombinant cells is called “cell line development” (CLD).

[0175] In the first step, suitable host cells are transfected with the necessary nucleic acid sequence encoding the proteinaceous compound of interest. Additional transfection of helper polypeptides may be required. In the second step, cells that stably express the proteinaceous compound of interest are selected. This can be done, for example, based on the co-expression of a selection marker co-transfected with the nucleic acid sequence encoding the proteinaceous compound of interest, or it can be the expression of the proteinaceous compound itself.

[0176] The expression of a coding sequence, i.e., an open reading frame, requires additional regulatory elements such as a promoter and a polyadenylation signal (sequence). Therefore, the open reading frame is operably linked to these additional regulatory elements for transcription. This can be achieved by incorporating it into a so-called expression cassette. The minimum regulatory elements required for an expression cassette to be functional in mammalian cells are a promoter functional in the mammalian cell, located upstream (i.e., at the 5' end) of the open reading frame, and a polyadenylation signal (sequence) functional in the mammalian cell, located downstream (i.e., at the 3' end) of the open reading frame. Furthermore, a terminator sequence may be present at the 3' end of the polyadenylation signal (sequence). For expression, the promoter, open reading frame / coding region, and polyadenylation signal sequence must be arranged in an operably linked form.

[0177] Similarly, nucleic acids that are transcribed into non-protein-coding RNAs are called "RNA genes". For the expression of RNA genes, additional regulatory elements such as promoters and transcription termination signals or polyadenylation signals (sequences) are also required. The nature and localization of such elements depend on the RNA polymerase intended to drive the expression of the RNA gene. Therefore, RNA genes are usually also incorporated into expression cassettes.

[0178] When the proteinaceous compound of interest is a heteromultimeric polypeptide composed of different (monomeric) polypeptides, not only is a single expression cassette required, but also one is required for each of the different polypeptides, i.e., open reading frames / coding sequences, and, if present, for each of the RNA genes. These expression cassettes differ at least in the included open reading frames / coding sequences, but may also differ in the promoter and / or polyadenylation signal sequences.

[0179] For example, when the proteinaceous compound of interest is a full-length antibody, a heteromultimeric polypeptide containing 2 copies of the light chain and 2 copies of the heavy chain, 2 different expression cassettes are required, one for the light chain and one for the heavy chain. For example, when the full-length antibody is a bispecific antibody, i.e., the antibody contains 2 different binding sites that specifically bind to 2 different antigens, each of the light chains as well as each of the heavy chains also differ from each other. Therefore, a bispecific full-length antibody is composed of 4 different polypeptides and thus requires 4 expression cassettes containing 4 different open reading frames encoding the 4 different polypeptides.

[0180] If the proteinaceous compound of interest is composed of different (monomeric) polypeptides and single-stranded DNA molecules and requires other accessory factors for production and encapsulation, in the case of AAV particles, a number of expression cassettes with different open reading frames / coding sequences are required. In this case, at least one expression cassette is required for each of the transgene, the different polypeptides forming the capsid of the AAV vector, and VA RNA for the necessary helper functions. Therefore, individual expression cassettes for each of the helper E1A, E1B, E2A, E4orf6, VA RNA, rep, and cap genes are required.

[0181] As outlined in the previous paragraph, the more complex the proteinaceous compound of interest or the greater the number of additional helper polypeptides and / or RNAs required, the greater the number of different expression cassettes required, respectively. In essence, along with the number of expression cassettes, the size of the nucleic acid integrated into the genome of the host cell also increases. However, there is a practical upper limit to the size of the transferable nucleic acid, which is in the range of about 15 kbp (kilobase pairs). Beyond this limit, handling and processing efficiency are significantly reduced. This problem can be addressed by using two or more separate nucleic acids. Thereby, different expression cassettes are assigned to different nucleic acids, and each nucleic acid contains only a part of the expression cassette.

[0182] For the development of cell lines, random integration (RI) of a nucleic acid carrying an expression cassette for the proteinaceous compound of interest can be used. Generally, by using RI, the nucleic acid or a fragment thereof is randomly integrated into the genome of the host cell.

[0183] Alternatively, for RI, targeted integration (TI) into the CLD can be used. In TI CLD, one or more nucleic acids containing different expression cassettes are introduced into a predetermined locus within the genome of the host cell.

[0184] In TI, either homologous recombination or recombinase-mediated cassette exchange (RMCE) can be used to incorporate nucleic acids (a) containing the respective expression cassettes into specific loci in the genome of TI host cells.

[0185] In a particular embodiment, a method is provided for the targeted incorporation of a single deoxyribonucleic acid into the genome of a (host) mammalian cell (i.e., a method for producing recombinant mammalian cells), the method comprising subsequently a nucleic acid encoding a proteinogenic compound, the method comprising the following steps: a) A step of providing a mammalian cell comprising an exogenous nucleotide sequence incorporated into a defined (optionally, single) site within a gene locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises first and second recombinant sequences adjacent to at least one first selection marker, so that all recombinant sequences are different and / or incompatible (i.e., they do not result in cross-exchange reactions); b) A step of introducing deoxyribonucleic acid containing two different recombinant sequences and 1 to 8 expression cassettes into mammalian cells provided in a), The aforementioned deoxyribonucleic acid is arranged in the 5' to 3' direction (in the following order): - The first recombinant sequence, -1 to 8 expression cassettes, one of which encodes a second choice marker, -Includes a second recombinant sequence, A step of introducing deoxyribonucleic acid, wherein the first and second recombinant sequences of the deoxyribonucleic acid are matched with the first and second recombinant sequences on the incorporated exogenous nucleotide sequence; c) Optionally, introduce or activate the mammalian cells obtained in step b) with the first and second recombinant sequences and a functional recombinase (by exchanging a portion of the exogenous nucleotide sequence between the first and second recombinant sequences with a portion of the deoxyribonucleic acid between the first and second recombinant sequences, thereby incorporating the latter into the genome of the mammalian cells); d) optionally including the step of selecting cells that express the second selection marker and produce a protein compound encoded by the introduced deoxyribonucleic acid, This process produces recombinant mammalian cells containing nucleic acids encoding proteinaceous compounds, thereby producing the proteinaceous compounds.

[0186] In a particular embodiment, a method is provided for the simultaneous targeted incorporation of two deoxyribonucleic acids into the genome of a (host) mammalian cell (i.e., a method for producing recombinant mammalian cells), comprising nucleic acids encoding a proteinogenic compound, wherein the proteinogenic compound is optionally expressed, the method comprising the following steps: a) Providing a mammalian cell comprising an exogenous nucleotide sequence incorporated into a defined (optionally, single) site within a gene locus of the mammalian cell genome, wherein the exogenous nucleotide sequence comprises first and second recombinant sequences adjacent to at least one first selection marker, and a third recombinant sequence located between the first and second recombinant sequences, and all recombinant sequences are different and / or incompatible (i.e., they do not result in cross-exchange reactions); b) A step of introducing two deoxyribonucleic acid compositions, each containing three different recombinant sequences and 1 to 8 expression cassettes, into the cells provided in a), The first deoxyribonucleic acid is located in the 5' to 3' direction (in the following order): - The first recombinant sequence, -One or more (up to four in one preferred embodiment) expression cassettes, -The 5' end portion of the expression cassette encoding one second choice marker, -Includes a first copy of the third recombinant sequence, and The second deoxyribonucleic acid is located in the 5' to 3' direction (in the following order): - The second copy of the third recombinant sequence, - The 3' end portion of the expression cassette encoding one second choice marker, -One or more (up to four in one preferred embodiment) expression cassettes, -Includes a second recombinant sequence, The first to third recombinant sequences of the first and second deoxyribonucleic acids match the first to third recombinant sequences of the incorporated exogenous nucleotide sequence. A step of introducing a composition of two deoxyribonucleic acids, wherein the 5' and 3' ends of an expression cassette encoding one second choice marker, when combined, form a functional expression cassette of one second choice marker; c) Optionally, introduce or activate the mammalian cells obtained in step b) with the first, second, and third recombinant sequences and functional recombinases (by exchanging a portion of the exogenous nucleotide sequence between the first and third sequences and a portion between the third and second recombinant sequences with a portion of the deoxyribonucleic acid between the first and third sequences and the third and second recombinant sequences, thereby incorporating the latter into the genome of the mammalian cells); d) optionally includes the step of selecting cells that express a second selection marker and optionally produce a protein product encoded by the introduced deoxyribonucleic acid, This produces recombinant mammalian cells containing nucleic acids encoding the aforementioned proteinaceous compound.

[0187] To increase the selective pressure, the first selection marker is a negative selection marker, such as, in certain embodiments, a thymidine kinase derived from herpes simplex virus (making cells sensitive to thymidine analogs such as 5-iodo-2'-fluoro-2'-deoxy-1-β-D-arabino-flonosyluracil (FIAU) or ganciclovir) or a diphtheria toxin fragment A derived from Corynebacterium diphtheria (causing toxicity by inhibiting protein synthesis; for example, by phosphoglycerate kinase promoter (PGK)-driven expression of the diphtheria toxin A fragment gene). The negative selection marker is removed during exchange with the introduced deoxyribonucleic acid. This makes it possible to distinguish between correct targeted integration and incorrect random integration.

[0188] In all aspects and in specific embodiments of the embodiments, each expression cassette comprises a promoter, an open reading frame / coding sequence or RNA gene, and a polyadenylation signal sequence and / or a terminator sequence, in the 5' to 3' direction. In specific embodiments, the open reading frame encodes a polypeptide, and the expression cassette comprises a polyadenylation signal sequence with or without an additional terminator sequence. In specific embodiments, the expression cassette comprises an RNA gene, the promoter is a type 2 Pol III promoter, and a polyadenylation signal sequence or poly-U terminator is present. See, for example, Song et al. Biochemical and Biophysical Research Communications 323(2004) 573-578. In specific embodiments, the expression cassette comprises an RNA gene, the promoter is a type 2 Pol III promoter and a poly-U terminator sequence.

[0189] In all aspects and in specific embodiments of the embodiments, the open reading frame encodes a polypeptide, the promoter is a human CMV promoter with or without intron A, the polyadenylation signal sequence is a bGH (bovine growth hormone) polyA signal sequence, and the terminator is an hGT (human gastrin terminator).

[0190] In certain embodiments of all aspects and embodiments, the promoter is a human CMV promoter having intron A, the polyadenylation signal sequence is a bGH polyadenylation signal sequence, the terminator is hGT, and except for the expression cassette of the RNA gene and the expression cassette of the selection marker, for the selection marker, the promoter is a SV40 promoter, the polyadenylation signal sequence is a SV40 polyadenylation signal sequence, the terminator is absent, and for the RNA gene, the promoter is a wild-type type 2 polymerase III promoter, and the terminator is a polymerase II or III terminator.

[0191] In certain embodiments of all aspects and embodiments heretofore, the human CMV promoter has the sequence of SEQ ID NO: 28. In certain embodiments, the human CMV promoter has the sequence of SEQ ID NO: 29. In certain embodiments, the human CMV promoter has the sequence of SEQ ID NO: 30.

[0192] In certain embodiments of all aspects and embodiments heretofore, the bGH polyadenylation signal sequence is SEQ ID NO: 31.

[0193] In certain embodiments of all aspects and embodiments heretofore, GT has the sequence of SEQ ID NO: 32.

[0194] In certain embodiments of all aspects and embodiments heretofore, the SV40 promoter has the sequence of SEQ ID NO: 33.

[0195] In certain embodiments of all aspects and embodiments heretofore, the SV40 polyadenylation signal sequence is SEQ ID NO: 34.

[0196] It should be noted that the present invention does not encompass permanent human cell lines that include nucleic acid sequences for adenovirus gene functions E1A and E1B, as well as nucleic acid sequences for SV40 large T antigen or Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA-1).

[0197] Homologous recombination In certain embodiments, targeted integration is mediated by homologous recombination.

[0198] Targeted integration by homologous recombination is an established technique in this field. For example, homologous recombination has been used for over 30 years to introduce site-specific gene modifications in mouse embryonic stem cells (Doetschman, T., et al., Nature 330 (1987) 576-578; Thomas, K. and Capecchi, MR, Cell 51 (1987) 503-512; Thompson, S., et al., Cell 56 (1989) 313-321; Zijlstra, M., et al., Nature 342 (1989) 435-438; Bouabe, H. and Okkenhaug, K., Meth. Mol. Biol. 1064 (2013) 315-336).

[0199] In the case of homologous recombination for targeted integration, the recombinant sequence is homologous to the exogenous nucleic acid sequence and is called a "homologous arm." In this case, the deoxyribonucleic acid introduced into the host cell contains, as the first recombinant sequence, a sequence homologous to the exogenous nucleic acid sequence (i.e., the landing site) at sequence 5' (upstream), and as the second recombinant sequence, a sequence homologous to the exogenous nucleic acid sequence at sequence 3' (downstream). Generally, the frequency of targeted integration increases with the length and isogenicity of the homologous arm. Ideally, the homologous arm is derived from genomic DNA prepared from each host cell.

[0200] Nuclease In certain embodiments, targeted integration is achieved by homologous recombination mediated by site-specific nucleases.

[0201] In certain embodiments, site-specific nucleases are selected from zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-related protein 9 nuclease (Cas9) systems.

[0202] Nuclease-coding genes can be delivered to cells via plasmid DNA, viral vectors, or in vitro transcribed mRNA. Transfection of plasmid DNA or mRNA can be performed by electroporation or cationic lipid-based reagents. Integrase-deficient lentiviral vectors can be used to deliver nucleases to transfection-resistant cell types. AAV vectors can also be used for nuclease delivery.

[0203] Recombinase Recombination systems such as Cre / LoxP or Flp / FRT can be used for the exchange of partial nucleic acid sequences between different nucleic acid molecules, the excision of nucleic acid fragments from nucleic acid molecules, or the inversion of parts within nucleic acid molecules. The results of the action of the recombinase can be permanent using a single on / off event, or they can be defined but limited in duration and can be regulated to a defined specific cell type or tissue.

[0204] FLp recombinase The Flp / FRT site-specific recombination system involves sequence recombination between flippase-recognition target (FRT) sites by the recombinase flippase (Flp). The flippase is derived from Saccharomyces cerevisiae. The Flp sequence is available, for example, from UniProt P03870. The 34 bp FRT site has the sequence GAAGTTCCTATTCtctagaaaGAATAGGAACTTC (SEQ ID NO: 36; lowercase letters indicate the central spacer sequence), and the Flp recombinase binds to the inverted 13 bp repeat of GAAGTTCCTATTC (forward SEQ ID NO: 37; reverse SEQ ID NO: 38) adjacent to the 8 bp central spacer sequence. Exemplary FRT sites are shown in the table below (see Branda and Dymecki, Dev. Cell 6(2004)7-28): TIFF0007830449000002.tif22128

[0205] Cre recombinase The Cre / LoxP site-directed recombination system is widely used in many biological experimental systems. Cre recombinase is a 38 kDa site-directed DNA recombinase that recognizes a 34 bp LoxP sequence. Cre recombinase is derived from bacteriophage P1 and belongs to the tyrosine family of site-directed recombinases. Cre recombinase can mediate both intramolecular and intermolecular recombination between LoxP sequences. A canonical LoxP sequence consists of two 13 bp reverse repeats flanked by an 8 bp non-palindromic spacer sequence. Cre recombinase binds to the 13 bp repeats, thereby mediating recombination within the 8 bp spacer sequence. Cre / LoxP-mediated recombination occurs with high efficiency and does not require other host factors. If the two LoxP sequences are located on the same nucleotide sequence and in the same orientation, Cre recombinase-mediated recombination will cleave the DNA sequence located between the two LoxP sequences as a covalently closed ring. When two LoxP sequences are positioned opposite / in opposite directions on the same nucleotide sequence, Cre recombinase-mediated recombination reverses the orientation of the DNA sequence located between the two LoxP sequences. When the two LoxP sequences are on two different DNA molecules, and one of the DNA molecules is circular, Cre recombinase-mediated recombination results in the integration of the circular DNA sequence.

[0206] Cre recombinase can be introduced into or activated within cells by any known method. For example, liposome-based gene delivery (International Publication No. 93 / 24640; Mannino and Gould-Fogerite, BioTechniques 6(1988)682-691; U.S. Patent No. 5,279,833; International Publication No. 91 / 06309; Feigner et al., Proc. Natl. Acad. Sci. USA 84(9871)7413-7414), or viral vectors, such as papillomavirus, retroviral vectors, and adeno-associated virus vectors (e.g., Berns et al., Ann. NY Acad. Sci. 772(1995)95-104; Ali et al., Gene Ther. 1(1994)367-384; Haddada et al.) al.,Curr.Top.Microbiol.Immunol.199(1995)297-306;Buchscher et al.,J.Virol.66(1992)2731-2739;Johann et al.,J.Virol.66(1992)1635-1640;Sommerfelt et al. al.,Virol.176(1990)58-59;Wilson et al.,J.Virol.63(1989)2374-2378;Miller et al.,J.Virol.65(1991)2220-2224;International Publication No. 94 / 26877;Rosenburg and Fauci in Fundamental Immunology,Third Edition Paul (ed.) Raven Press, Ltd., New York (1993) and references therein; West et al., Virology 160 (1987) 38-47; US Patent No. 4,797,368; International Publication No. 93 / 24641; Kotin, Human Gene Therapy 5 (1994) 793-801; Muzyczka, J. Clin. Invest. 94 (1994) 1351; US ​​Patent No. 5,173,414; Tratschin et al. al.,Mol.Cell.Biol.5(1985)3251-3260;Tratschin et al.,Mol.Cell.Biol.4 (1984) 2072-2081; Hermonat and Muzyczka, Proc. Natl. Acad. Sci. USA 81 (1984) 6466-6470; Samulski et al., J. Virol. 63 (1989) 3822-3828). .

[0207] For example, recombinant AAV vectors of serotype 2 expressing Cre recombinase have been described by Li, X., et al. (PLOS ONE 7(2012)e50063) and Scammell, E., et al. (J. Neurosci. 23(2003)5762-5770). Using this rAAV-Cre, we were able to induce very complete recombination of the target LoxP site. For delivery based on rAAV vectors, see also Muzyczka, Curr. Top. Microbiol. Immunol. 158(1992)97-129; U.S. Patent No. 4,797,368; International Publication No. 91 / 18088; Samulski, Current Opinion in Genetic and Development 3(1993)74-80.

[0208] For example, a Cre recombinase expression plasmid can be used.

[0209] For example, a Cre recombinase that encodes mRNA can be used.

[0210] Numerous functional LoxP sites are known, such as Lox511, Lox66, Lox11, Lox76, Lox75, Lox43, and Lox44 (see, for example, Hoess, R., et al., Nucl. Acids Res. 14 (1986) 2287-2300; Albert, H., et al., Plant J. 7 (1995) 649-659).

[0211] For example, when Cre recombinase is used, the sequences to be exchanged are defined by the locations of two LoxP sites in the genome and the donor nucleic acid. These LoxP sites are recognized by Cre recombinase. Nothing more is needed, i.e., ATP is not required.

[0212] The Cre / LoxP system functions in various types of cells, including those of mammals, plants, bacteria, and yeast.

[0213] Targeted integration using recombinase In certain embodiments, targeted integration is performed by a recombinase-mediated cassette exchange reaction (RMCE).

[0214] RMCE is an enzymatic process in which the sequence of an integration site in the genome is exchanged with that of a donor nucleic acid. Any recombinase, such as Cre recombinase, Flp recombinase, Bxb1-integrase, pSR1-recombinase, or φC31-integrase, can be used in this process.

[0215] One specific TI method is dual recombinase-mediated cassette exchange (dual RMCE).

[0216] Dual RMCE is a method for producing recombinant mammalian cells containing deoxyribonucleic acid encoding a target proteinaceous compound by recombinase-mediated introduction of two nucleic acid sequences into the host cell genome at a single locus. After integration, the two nucleic acid sequences are operably linked to each other.

[0217] For example, but not limited to, the incorporated exogenous nucleotide sequence, i.e., the TI landing site, may contain two recombination recognition sites (RRS), and the (donor) nucleic acid sequence may contain two RRS that match the RRS on the incorporated exogenous nucleotide sequence. Such a single plasmid RMCE strategy allows for the introduction of multiple open reading frames by incorporating an appropriate number of expression cassettes in each sequence between pairs of RRS.

[0218] For example, but not limited to, the incorporated exogenous nucleotide sequence, i.e., the TI landing site, may include three recombination recognition sites (RRS), for example, a sequence in which a third RRS ("RRS3") is located between the first RRS ("RRS1") and the second RRS ("RRS2"), with the first (donor) nucleic acid containing two RRSs matching the first and third RRS on the incorporated exogenous nucleotide sequence, and the second (donor) nucleic acid containing two RRSs matching the third and second RRS on the incorporated exogenous nucleotide sequence. Such a dual RMCE strategy enables the introduction of multiple genes by incorporating an appropriate number of expression cassettes in each sequence between each pair of RRSs.

[0219] Furthermore, a two-plasmid RMCE also requires two selection markers. One selection marker expression cassette is divided into two parts. The first (front) nucleic acid may contain the promoter, followed by the translation start codon and the RRS3 sequence. The second (back) nucleic acid correspondingly contains the RRS3 sequence fused to the N-terminus of the selection marker coding sequence minus the translation start codon (e.g., ATG). Additional nucleotides may need to be inserted between the RRS3 site and the selection marker coding sequence to ensure in-frame translation from the fusion gene, i.e., a functional linkage. Only when both nucleic acids (front and back) are precisely inserted is a complete expression cassette of the selection marker assembled, and thus resistance to each selector is conferred to the cells.

[0220] Both single-nucleotide and dual-nucleotide nucleotide-enhanced registrar

[0221] RMCE involves a double recombination cross-event catalyzed by a recombinase between two heterospecific RRSs within a target genomic locus and a donor DNA molecule. Double RMCE is designed to introduce copies of DNA sequences from a front nucleic acid and a back nucleic acid into a designated locus in the mammalian cell genome. The RMCE procedure can be repeated using multiple DNA sequences.

[0222] In certain embodiments, targeted integration is achieved by dual RMCE, in which two different DNA sequences are both integrated into predetermined sites in the genome of a TI-suitable mammalian cell, and each DNA sequence includes at least one expression cassette encoding a portion of the target protein compound and / or two heterospecific RRSs adjacent to at least one select marker or a portion thereof. In certain embodiments, targeted integration is achieved by multiple RMCEs, in which DNA sequences derived from multiple nucleic acids are all integrated into predetermined sites in the genome of a TI-suitable mammalian cell, and each DNA sequence includes at least one expression cassette encoding a portion of the target protein compound and / or two heterospecific RRSs adjacent to at least one select marker or a portion thereof. In certain embodiments, the select marker may be partially encoded in a first nucleic acid (front) and partially encoded in a second nucleic acid (back), and as a result, expression of the select marker is possible only when both nucleic acids are precisely integrated by dual RMCE.

[0223] For single-RMCE and dual-RMCE, the methods for targeted integration of donor nucleic acids into the genome of recipient / target cells, as well as the methods for simultaneous targeted integration of two donor nucleic acids into the genome of recipient / target cells as outlined above, include an additional step of introducing / activating a recombinase.

[0224] Therefore, in a particular embodiment, the recombinant sequence is a recombinant recognition sequence, and the method involves the following steps: c) i) b) Simultaneously with the introduction of deoxyribonucleic acid; or ii) Subsequently, sequentially, A step of introducing or activating a recombinase, The recombinase further includes recognizing the recombinant recognition sequences of the first and second deoxyribonucleic acids (and optionally, one or more recombinases perform recombinase-mediated cassette exchange).

[0225] In certain embodiments, the RRS is selected from the group consisting of LoxP, L3, 2L, LoxFas, Lox511, Lox2272, Lox2372, Lox5171, Loxm2, Lox71, Lox66, FRT, F3, F5, Bxb1 attP, Bxb1 attB, φC31 attP, and φC31 attB sequences. If multiple RRSs must exist, the selection of each sequence depends on the other, insofar as non-identical RRSs are selected.

[0226] In certain embodiments, RRS can be recognized by Cre recombinase. In certain embodiments, RRS can be recognized by Flp recombinase. In certain embodiments, RRS can be recognized by Bxb1 integrase. In certain embodiments, RRS can be recognized by φC31 integrase. In certain embodiments, RRS can be recognized by pSR1 recombinase.

[0227] In certain embodiments where the RRS is the LoxP site, the cells require Cre recombinase to undergo recombination.

[0228] In certain embodiments where the RRS is the FRT site, the cells require Flp recombinase to undergo recombination.

[0229] In certain embodiments where the RRS is a Bxb1 attP site or a Bxb1 attB site, the cell requires Bxb1 integrase to undergo recombination.

[0230] In certain embodiments where the RRS is the φC31 attP site or the φC31attB site, the cell requires φC31 integrase to undergo recombination.

[0231] In certain embodiments, if RRS is the recognition site for pSR1-recombinase in Zygosaccharomyces rouxii, the cell requires pSR1-recombinase to undergo recombination.

[0232] Recombinase-coding genes can be delivered to cells as DNA, via viral vectors, or as mRNA. DNA or mRNA transfection can be carried out by electroporation or cationic lipid-based reagents. Integrase-deficient lentiviral vectors can be used to deliver recombinase to transfection-resistant cell types. AAV vectors can also be used for recombinase delivery. Recombinase proteins can also be introduced via non-vesicles.

[0233] In all aspects and in specific embodiments of the embodiments, the recombinase is introduced into the cell as mRNA.

[0234] In all aspects and in specific embodiments of the embodiments, the recombinase is introduced into the host cell as DNA. In specific embodiments, the DNA is a sequence encoding the recombinase contained in an expression cassette.

[0235] In all aspects and in specific embodiments of the embodiments, the recombinase is Cre recombinase, which is introduced into cells as Cre recombinase encoding mRNA encoding a polypeptide having the amino acid sequence of Sequence ID No. 07.

[0236] In all aspects and in specific embodiments of the embodiments, Cre recombinase mRNA encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 07 and further comprising a nuclear localization sequence at its N-terminus, C-terminus, or both. In specific embodiments, Cre recombinase mRNA encodes a polypeptide having the amino acid sequence of SEQ ID NO: 07 and further comprising 1 to 5 nuclear localization sequences at its N-terminus, C-terminus, or both, independently of each other.

[0237] In all aspects and in specific embodiments of the embodiments, the Cre recombinase encoding mRNA comprises the nucleotide sequence of SEQ ID NO: 08 or a variant thereof having different codon frequencies. In all aspects and in specific embodiments of the embodiments, the Cre recombinase encoding mRNA comprises the nucleotide sequence of SEQ ID NO: 08 or a variant thereof having different codon frequencies, and further comprises a further nucleic acid encoding a nuclear localization sequence at its 5' end, 3' end, or both. In all aspects and in specific embodiments of the embodiments, the Cre recombinase encoding mRNA comprises the nucleotide sequence of SEQ ID NO: 08 or a variant thereof having different codon frequencies, and further comprises a further 1 to 5 nucleic acids encoding a nuclear localization sequence independently of each other at its 5' end, 3' end, or both.

[0238] In certain embodiments, the LoxP sequence is a wild-type LoxP sequence. In certain embodiments, the LoxP sequence is a mutant LoxP sequence. The mutant LoxP sequence was developed to enhance the efficiency of Cre recombinase-mediated integration or substitution. In certain embodiments, the mutant LoxP sequence is selected from the group consisting of L3, 2L, LoxFas, Lox511, Lox2272, Lox2372, Lox5171, Loxm2, Lox71, and Lox66 sequences. For example, the Lox71 sequence has a 5bp mutation in the left 13bp repeat. The Lox66 sequence has a 5bp mutation in the right 13bp repeat. Both wild-type and mutant LoxP sequences can mediate Cre recombinase-dependent recombination.

[0239] The term "matching RRS" indicates that recombination occurs between two matching RRS. In a particular embodiment, the two matching RRS are the same. In a particular embodiment, both RRS are wild-type LoxP sequences. In a particular embodiment, both RRS are mutant LoxP sequences. In a particular embodiment, both RRS are wild-type FRT sequences. In a particular embodiment, both RRS are mutant FRT sequences. In a particular embodiment, the two matching RRS are different sequences but can be recognized by the same recombinase. In a particular embodiment, the first matching RRS is the Lox71 sequence and the second matching RRS is the Lox66 sequence. In a particular embodiment, the first matching RRS is the Bxb1 attP sequence and the second matching RRS is the Bxb1 attB sequence. In a particular embodiment, the first matching RRS is the φC31 attB sequence and the second matching RRS is the φC31 attB sequence.

[0240] In all aspects and in certain embodiments, the recombinant recognition sites in the dual RMCE are L3, 2L, and LoxFas. In certain embodiments, L3 includes the sequence of sequence number 17 as a spacer sequence, 2L includes the sequence of sequence number 18 as a spacer sequence, and LoxFas includes the sequence having the sequence of sequence number 19 as a spacer sequence. In certain embodiments, the first recombinant recognition site is L3, the second recombinant recognition site is 2L, and the third recombinant recognition site is LoxFas.

[0241] In all aspects and in specific embodiments of the embodiments, the expression cassette encoding the selection marker is partially 5' and partially 3' relative to a third recombinant recognition site, wherein the 5' portion of the expression cassette includes a promoter and a translation start codon, and the 3' portion of the expression cassette includes a coding sequence without a translation start codon and a polyA signal sequence.

[0242] In all aspects and in certain embodiments of the embodiments, the 5' portion of the expression cassette encoding the selection marker includes a promoter sequence operably linked to a translation start codon, thereby the promoter sequence is adjacent upstream to a second, third, or fourth expression cassette, respectively (i.e., located downstream of the second, third, or fourth expression cassette), the start codon is adjacent downstream to a third recombinant recognition sequence, and the 3' portion of the expression cassette encoding the selection marker includes a nucleic acid encoding a selection marker lacking a translation start codon, adjacent upstream to a third recombinant recognition sequence, adjacent downstream to a poly(A) signal sequence, and then adjacent to a third, fourth, or fifth expression cassette, respectively.

[0243] Any known or future mammalian cells suitable for targeted integration, including the exogenous nucleic acids described herein ("landing sites"), can be used in the present invention.

[0244] In all aspects and one preferred embodiment, the mammalian cell containing an exogenous nucleotide sequence integrated into a single site within a locus of the genome of the mammalian cell is a hamster cell or a human cell, and in a particular embodiment, a CHO cell.

[0245] Exemplary mammalian cells suitable for use in the present invention, which contain an exogenous nucleotide sequence integrated into a single site within a locus of their genome, are CHO cells, HEK293 cells, or Per.C6 cells that have a landing site (= an exogenous nucleotide sequence integrated into a single site within a locus of the genome of a mammalian cell) containing three heterospecific LoxP sites for Cre recombinase-mediated cassette exchange. In certain embodiments, these heterospecific LoxP sites are L3, LoxFas, and 2L (see, for example, Lanza et al., Biotechnol. J. 7 (2012) 898-908; Wong et al., Nucleic Acids Res. 33 (2005) e147), where L3 and 2L are adjacent to the 5' and 3' ends of the landing site, respectively, or vice versa, and LoxFas is located between the L3 and 2L sites. In all aspects and in certain embodiments of the embodiments, the landing site further comprises a bisistronic unit that links the expression of a selection marker via IRES to the expression of green fluorescent protein (GFP), thereby stabilizing the landing site by positive selection and enabling the selection of samples in which the site is absent after transfection and Cre recombinase-mediated recombination (negative selection). An exemplary GFP has the sequence of SEQ ID NO: 35.

[0246] Such a configuration of the landing site, as outlined in the previous paragraph, allows for the simultaneous integration of two nucleic acids contained in different plasmids: a so-called front nucleic acid with L3 and LoxFas sites, and a back nucleic acid with LoxFas and 2L sites. Functional elements of the selection marker gene, different from those present in the landing site, are distributed between the two nucleic acids: the promoter and translation start codon are located on the front nucleic acid, while the coding region and poly(A) signaling pathway are located on the back nucleic acid. Only correct Cre recombinase-mediated integration of both nucleic acids induces resistance to their respective selectors.

[0247] Generally, mammalian cells suitable for TI are mammalian cells that contain an exogenous nucleotide sequence integrated into a gene locus in their genome, the exogenous nucleotide sequence comprising first and second recombination recognition sites adjacent to at least one first selection marker, and a third recombination recognition site located between the first and second recombination recognition sites, all of which are distinct. The exogenous nucleotide sequence is called the “landing site”.

[0248] The subject matter disclosed in this invention uses mammalian cells suitable for TI with an exogenous nucleotide sequence. In certain embodiments, the mammalian cells suitable for TI contain an exogenous nucleotide sequence that is integrated into an integration site in the genome of the mammalian cell. Such mammalian cells suitable for TI may also be referred to as "TI host cells."

[0249] In all aspects and in specific embodiments of the embodiments, suitable mammalian cells for TI are hamster cells, human cells, rat cells, or mouse cells, including the landing site. In specific embodiments, suitable mammalian cells for TI are Chinese hamster ovary (CHO) cells, CHO K1 cells, CHO K1SV cells, CHO DG44 cells, CHO DUKXB-11 cells, CHO K1S cells, CHO K1M cells, human cells, HEK293 cells, or Per.C6 cells, each including the respective landing site.

[0250] In all aspects and in specific embodiments of the embodiments, a mammalian cell suitable for TI comprises an incorporated exogenous nucleotide sequence, the exogenous nucleotide sequence comprising one or more recombinant recognition sites (RRSs). In specific embodiments, the exogenous nucleotide sequence comprises at least two RRSs. The RRSs can be recognized by recombinases, such as Cre recombinase, Flp recombinase, Bxb1 integrase, or φC31 integrase. The RRSs may be selected from the group consisting of LoxP sites, L3 sites, 2L sites, LoxFas sites, Lox511 sites, Lox2272 sites, Lox2372 sites, Lox5171 sites, Loxm2 sites, Lox71 sites, Lox66 sites, FRT sites, F3 sites, F5 sites, Bxb1 attP sites, Bxb1 attB sites, φC31 attP sites, and φC31 attB sites.

[0251] In all aspects and in specific embodiments of the embodiments, the selection marker may be independently selected from the group consisting of genes encoding resistance to aminoglycoside phosphotransferases (APHs) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthase (GS), asparagine synthase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D), and puromycin, blasticidine, bleomycin, phleomycin, chloramphenicol, zeosin, and mycophenolic acid. Furthermore, the selection marker may be a fluorescent protein selected from the group consisting of green fluorescent protein (GFP), high-sensitivity GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), high-sensitivity YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald6, CyPet, mCFPm, Cerulean, and T-Sapphire.

[0252] An exogenous nucleotide sequence is a nucleotide sequence that does not originate from a specific cell but can be introduced into the cell by a DNA delivery method, such as transfection, transduction, electroporation, or transformation. In all aspects and in specific embodiments of the embodiments, a mammalian cell suitable for TI contains at least one exogenous nucleotide sequence integrated into many integration sites in the genome of the mammalian cell. In specific embodiments, the exogenous nucleotide sequence is integrated into an integration site within a specific gene locus in the genome of the mammalian cell.

[0253] In all aspects and in certain embodiments of the embodiments, the incorporated exogenous nucleotide sequence includes one or more recombination recognition sites (RRSs) that can be recognized by a recombinase. In certain embodiments, the incorporated exogenous nucleotide sequence includes at least two RRSs. In certain embodiments, the incorporated exogenous nucleotide sequence includes three RRSs, with the third RRS located between the first and second RRSs. In certain embodiments, the first and second RRSs are the same, and the third RRS is different from both the first and second RRSs. In certain embodiments, all three RRSs are different. In certain embodiments, the RRS can be independently selected from the group consisting of LoxP site, L3 site, 2L site, LoxFas site, Lox511 site, Lox2272 site, Lox2372 site, Lox5171 site, Loxm2 site, Lox71 site, Lox66 site, FRT site, F3 site, F5 site, Bxb1 attP site, Bxb1 attB site, φC31 attP site, and φC31 attB site.

[0254] In all aspects and in specific embodiments of the embodiments, the incorporated exogenous nucleotide sequence includes at least one selection marker. In specific embodiments, the incorporated exogenous nucleotide sequence includes a first RRS, a second RRS, and a third RRS, as well as at least one selection marker. In specific embodiments, the selection marker is located between the first RRS and the second RRS. In specific embodiments, the two RRSs are adjacent to at least one selection marker; that is, the first RRS is located 5' (upstream) of the selection marker and the second RRS is located 3' (downstream) of the selection marker. In specific embodiments, the first RRS is located next to the 5' end of the selection marker and the second RRS is located next to the 3' end of the selection marker.

[0255] In all aspects and in specific embodiments of the embodiments, the selection marker is located between a first RRS and a second RRS, and these two adjacent RRS are distinct from each other. In specific embodiments, the first adjacent RRS is the L3 sequence, and the second adjacent RRS is the 2L sequence. In specific embodiments, the L3 sequence (sequenced) is located on the 5' side of the selection marker, and the 2L sequence is located on the 3' side of the selection marker.

[0256] In all aspects and in certain embodiments of the embodiments, the first adjacent RRS is a LoxP sequence having a wild-type reverse repeat, and the second adjacent RRS is a LoxP sequence having one mutated reverse repeat. In a particular embodiment, the first adjacent RRS is a LoxP sequence having a first mutated reverse repeat, and the second adjacent RRS is a LoxP sequence having a second mutated reverse repeat that is the same as or different from the first mutated reverse repeat. In a particular embodiment, the first adjacent RRS is a LoxP sequence having a wild-type reverse repeat, and the third RRS is a LoxP sequence having one mutated reverse repeat. In a particular embodiment, the second adjacent RRS is a LoxP sequence having a wild-type reverse repeat, and the third RRS is a LoxP sequence having one mutated reverse repeat. In certain embodiments, the first adjacent RRS is a LoxP sequence having a first mutated reverse repeat, and the third RRS is a LoxP sequence having a second mutated reverse repeat. In all aspects and in certain embodiments of the embodiments, the second adjacent RRS is a LoxP sequence having a first mutated reverse repeat, and the third RRS is a LoxP sequence having a second mutated reverse repeat.

[0257] In all aspects and in specific embodiments of the embodiments, the first adjacent RRS is a wild-type FRT sequence, and the second adjacent RRS is a mutant FRT sequence. In specific embodiments, the first adjacent RRS is a first mutant FRT sequence, and the second adjacent RRS is a second mutant FRT sequence.

[0258] In all aspects and in certain embodiments of the embodiments, the first adjacent RRS is a Bxb1 attP sequence, and the second adjacent RRS is a Bxb1 attB sequence.

[0259] In all aspects and in specific embodiments of the embodiments, the first adjacent RRS is a φC31 attP sequence, and the second adjacent RRS is a φC31 attB sequence.

[0260] In all aspects and in specific embodiments of the embodiments, the incorporated exogenous nucleotide sequence includes a first and a second selection marker, where two RRSs are adjacent, and the first selection marker is distinct from the second selection marker. In specific embodiments, both of the two selection markers are independently selected from the group consisting of glutamine synthase selection markers, thymidine kinase selection markers, HYG selection markers, and puromycin resistance selection markers. In specific embodiments, the incorporated exogenous nucleotide sequence includes a thymidine kinase selection marker and a HYG selection marker. In specific embodiments, the first selection marker is an aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418). The second selection marker is selected from the group consisting of genes encoding resistance to APH, dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthase (GS), asparagine synthase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D), and puromycin, blasticidine, bleomycin, phleomycin, chloramphenicol, zeosin, and mycophenolic acid. The second selection marker is selected from the group consisting of GFP, eGFP, synthetic GFP, YFP, eYFP, CFP, mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire fluorescent proteins. In certain embodiments, the first selection marker is a glutamine synthase selection marker, and the second selection marker is a GFP-fluorescent protein. In certain embodiments, the two RRSs adjacent to both selection markers are different from each other.

[0261] In all aspects and in specific embodiments of the embodiments, the selection marker is operably linked to a promoter sequence. In specific embodiments, the selection marker is operably linked to the SV40 promoter. In specific embodiments, the selection marker is operably linked to the human cytomegalovirus (CMV) promoter.

[0262] Regardless of the method used for introducing donor deoxyribonucleic acid, successfully transfected cells can be selected based on the introduced second selection marker.

[0263] It should be noted that when the DNA element, DNA molecule, or VA RNA gene according to the present invention is used in combination with a recombinase-mediated cassette exchange reaction, different recombinases are used for RMCE and RMCI.

[0264] For example, in the DNA element, DNA molecule, or VA RNA according to the present invention, the Cre / LoxP system is used in a recombinase-mediated cassette exchange reaction (RMCE), and the Flp / FRT system is used in a recombinase-mediated cassette inversion (RMCI). Similarly, in the DNA element, DNA molecule, or VA RNA according to the present invention, the Flp / FRT system is used in a recombinase-mediated cassette exchange reaction (RMCE), and the Cre / LoxP system is used in a recombinase-mediated cassette inversion (RMCI).

[0265] Adeno-associated virus vector For a general review of the helper functions of AAV and adenoviruses or herpesviruses, see Berns and Bohensky, Advances in Virus Research, Academic Press, 32(1987)243-306. The AAV genome is described in Srivastava et al., J. Virol., 45(1983)555-564. U.S. Patent No. 4,797,368 describes design considerations for constructing recombinant AAV vectors (see also International Publication No. 93 / 24641). Further references describing AAV vectors are West et al., Virol. 160(1987)38-47; Kotin, Hum. Gene Ther. 5(1994)793-801; and Muzyczka J. Clin. Invest. 94(1994)1351. Construction of recombinant AAV vectors as described in U.S. Patent No. 5,173,414; Lebkowski et al., Mol. Cell. Biol. 8 (1988) 3988-3996; Tratschin et al., Mol. Cell. Biol. 5 (1985) 3251-3260; Tratschin et al., Mol. Cell. Biol. 4 (1994) 2072-2081; Hermonat and Muzyczka Proc. Natl. Acad. Sci. USA 81 (1984) 6466-6470; Samulski et al. J. Virol. 63 (1989) 3822-3828.

[0266] Adeno-associated viruses (AAVs) are replication-deficient parvoviruses. They can only replicate in cells where specific viral function is provided by co-infecting helper viruses such as adenoviruses, herpesviruses, and, in some cases, poxviruses such as vaccinia. Nevertheless, AAVs can replicate in substantially any cell line of human, monkey, or rodent origin, provided that appropriate helper viral function is present.

[0267] If the helper virus gene is absent, AAV establishes an incubation period in its host cell. Its genome is integrated into a specific site on chromosome 19 [(Chr)19(q13.4)], called adeno-associated virus integration site 1 (AAVS1). For certain serotypes such as AAV-2, other integration sites have been found, such as AAVS2 on chromosome 5 [(Chr)5(p13.3)] and AAVS3 on chromosome 3 [(Chr)3(p24.3)].

[0268] AAV is classified into different serotypes. These are assigned based on parameters such as hemagglutination, tumorigenicity, and DNA sequence homology. To date, more than 10 different serotypes and more than 100 sequences have been identified, corresponding to different clades of AAV.

[0269] The type and symmetry of the capsid protein determine the tissue tropism of each AAV. For example, AAV-2, AAV-4, and AAV-5 are specific to the retina; AAV-2, AAV-5, AAV-8, AAV-9, and AAVrh-10 are specific to the brain; AAV-1, AAV-2, AAV-6, AAV-8, and AAV-9 are specific to cardiac tissue; AAV-1, AAV-2, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, and AAV-10 are specific to the liver; and AAV-1, AAV-2, AAV-5, and AAV-9 are specific to the lungs.

[0270] Pseudotyping involves the cross-packaging of AAV genomes across different serotypes, meaning the genome is packaged with capsid proteins of different origins.

[0271] The wild-type AAV genome is approximately 4.7 kb in size. The AAV genome further contains two duplicate genes called rep and cap, which contain multiple open reading frames (see, e.g., Srivastava et al., J. Viral., 45(1983) 555-564; Hermonat et al., J. Viral. 51(1984) 329-339; Tratschin et al., J. Viral., 51(1984) 611-619). The Rep proteins, which encode open reading frames, provide four proteins of different sizes called Rep78, Rep68, Rep52, and Rep40. These are involved in AAV replication, rescue, and integration. The Cap proteins, which encode open reading frames, provide four proteins called VP1, VP2, VP3, and AAP. VP1, VP2, and VP3 are part of the proteinaceous capsid of the AAV particle. The combined open reading frames of rep and cap are flanked at their 5' and 3' ends by so-called reverse terminal repeats (ITRs). For replication, AAV requires, in addition to the Rep and Cap proteins, the products of adenovirus genes E1A, E1B, E4orf6, E2A, and VA, or corresponding factors from another helper virus.

[0272] For example, in the case of serotype 2 (AAV-2) AAV, each ITR is 145 nucleotides long and flanks a coding region of approximately 4470 nucleotides. Of the 145 nucleotides in the ITR, 125 nucleotides have a palindromic sequence and can form a T-shaped hairpin structure. This structure functions as a primer during viral replication. The remaining 20 unpaired nucleotides are shown as the D sequence.

[0273] The AAV genome has three transcription promoters, P5, P19, and P40, for the expression of rep and cap genes (Laughlin et al., Proc. Natl. Acad. Sci. USA 76(1979) 5567-5571).

[0274] ITR sequences must be cis relative to the coding region. ITRs provide functional origins of replication (ori), signals necessary for integration into the target cell genome, and efficient excision and rescue from host cell chromosomes or recombinant plasmids. ITRs further contain origin-of-replication elements such as Rep protein binding sites (RBS) and terminal dissociation sites (TRS). It has been found that ITRs themselves can function as transcription promoters in AAV vectors (Flotte et al., J. Biol. Chem. 268 (1993) 3781-3790; Flotte et al., Proc. Natl. Acad. Sci. USA 93 (1993) 10163-10167).

[0275] The replication of the viral single-stranded DNA genome and the formation of the capsid both require the trans transformation of the rep gene product and the cap gene product, respectively.

[0276] The rep locus contains two internal promoters called P5 and P19. It contains open reading frames for four proteins. Promoter P5 is operably ligated to nucleic acid sequences that provide a non-splicing 4.2kb mRNA encoding the Rep protein Rep78 (a chromatin niccasse for cell cycle arrest) and a splicing 3.9kb mRNA encoding the Rep protein Rep68 (a site-specific endonuclease). Promoter P19 is operably ligated to nucleic acid sequences that provide a non-splicing mRNA encoding the Rep protein Rep52 and a splicing 3.3kb mRNA encoding the Rep protein Rep40 (a DNA helicase for accumulation and packaging).

[0277] The two larger Rep proteins, Rep78 and Rep68, appear to be essential for AAV double-stranded DNA replication, while the smaller Rep proteins, Rep52 and Rep40, seem to be essential for the accumulation of single-stranded DNA in offspring (Chejanovsky & Carter, Virology 173(1989)120-128).

[0278] The larger Rep proteins, Rep68 and Rep78, can specifically bind to the hairpin conformation of the AAV ITR. They exhibit predetermined enzymatic activity required to degrade replication at the AAV terminus. Expression of Rep78 or Rep68 may be sufficient for infectious particle formation (Holscher, C., et al. J. Virol. 68(1994) 7169-7177 and 69(1995) 6880-6885).

[0279] All Rep proteins, mainly Rep78 and Rep68, are thought to exhibit regulatory activity such as induction and repression of AAV genes and inhibitory effects on cell proliferation (Tratschin et al., Mol.Cell.Biol.6(1986)2884-2894; Labow et al., Mol.Cell.Biol.,7(1987)1320-1325; Khleif et al., Virology,181(1991)738-741).

[0280] Recombinant overexpression of Rep78 results in a phenotype characterized by reduced cell proliferation due to induced DNA damage. This causes host cells to arrest in the S phase, thereby promoting latent viral infection (Berthet, C., et al., Proc. Natl. Acad. Sci. USA 102(2005)13634-13639).

[0281] Tratschin et al. reported that the P5 promoter is negatively autoregulated by Rep78 or Rep68 (Tratschin et al., Mol.Cell.Biol.6(1986)2884-2894). Due to the toxic effects of Rep protein expression, very low expression has been reported in certain cell lines after stable integration of AAV (see, for example, Mendelson et al., Virol.166(1988)154-165).

[0282] The cap locus contains a single promoter called P40. Promoter P40 is operably linked to nucleic acid sequences providing 2.6kb mRNA encoding the Cap proteins VP1 (87kDa, unspliced ​​mRNA transcript), VP2 (72kDa from spliced ​​mRNA transcript), and VP3 (61kDa from alternative start codon) through alternative splicing and the use of alternative start codons. VP1-VP3 constitute the building blocks of the viral capsid. The capsid has the function of binding to cell surface receptors and enabling intracellular transport of the virus. VP3 accounts for approximately 90% of the total viral particle protein. Nevertheless, all three proteins are essential for effective capsid production.

[0283] Inactivation of all three capsid proteins VP1-VP3 has been reported to prevent the accumulation of single-stranded progeny AAV DNA. Mutations at the amino terminus of VP1 ("lipid-negative" or "inf-negative") still allow the assembly of single-stranded DNA into the viral particle, thereby significantly reducing the infectivity titer.

[0284] The AAP open reading frame encodes the assembly activation protein (AAP). It is approximately 22 kDa in size and transports the native VP protein to the nucleolar region for capsid assembly. This open reading frame is located upstream of the VP3 protein-coding sequence.

[0285] Each AAV particle contains only a single-stranded DNA molecule. This can be either a "positive" or "negative" strand. AAV virus particles containing DNA molecules are infectious. Inside an infected cell, the parental infectious single strand is converted to a double strand and then amplified. Amplification results in a large pool of double-stranded DNA molecules from which single strands are substituted and packaged into a capsid.

[0286] Adeno-associated virus (AAV) vectors can transduce both dividing and quiescent cells. Transgenes introduced into target cells using AAV vectors are thought to be expressed for extended periods. One drawback of using AAV vectors is the limited size of the transgenes that can be introduced into cells.

[0287] Carter et al. demonstrated that the entire rep and cap open reading frames can be deleted and replaced with the transgene (Carter, BJ, "Handbook of Parvoviruses", ed. by P. Tijssen, CRC Press, pp. 155-168 (1990)). Furthermore, it has been reported that the ITR must be maintained to preserve the functions of replicating, rescuing, packaging, and integrating the transgene into the target cell genome.

[0288] When cells containing each viral helper gene are transduced by an AAV vector, or vice versa, when cells containing the incorporated AAV provirus are transduced by an appropriate helper virus, the AAV provirus is activated and the lytic infection cycle is restarted (Clark, KR, et al., Hum. Gene Ther. 6 (1995) 1329-1341; Samulski, RJ, Curr. Opin. Genet. Dev. 3 (1993) 74-80).

[0289] E1A is the first viral helper gene expressed after adenovirus DNA enters the cell nucleus. The E1A gene encodes 12S and 13S proteins based on the same E1A mRNA through alternative splicing. Expression of 12S and 13S proteins leads to the activation of other viral functions E1B, E2, E3, and E4. Furthermore, expression of 12S and 13S proteins pushes the cell into the S phase of the cell cycle. If only E1A-derived proteins are expressed, the cell dies (apoptosis).

[0290] E1B is the second viral helper gene that is expressed. It is activated by E1A-derived proteins 12S and 13S. E1B gene-derived mRNA can be spliced ​​in two different ways, resulting in a first 55kDa transcript and a second 19kDa transcript. The E1B 55kDa protein is involved in regulating the cell cycle, preventing the transport of cellular mRNA in the later stages of infection, and preventing E1A-induced apoptosis. The E1B 19kDa protein is involved in preventing E1A-induced apoptosis in cells.

[0291] The E2 gene codes for different proteins. The E2A transcript codes for single-strand binding proteins (SSBPs), which are essential for AAV replication.

[0292] The E4 gene also codes for several proteins. The 34kDa protein derived from the E4 gene (E4orf6), along with the E1B 55kDa protein, prevents the accumulation of cellular mRNA in the cytoplasm, but also promotes the transport of viral RNA from the cell nucleus to the cytoplasm.

[0293] Generally, different complementary plasmids are simultaneously transfected into host cells to produce recombinant AAV particles. One plasmid contains a transgene sandwiched between two cis-acting AAV ITRs. The open reading frames of the missing AAV elements, namely the Rep and Cap proteins, necessary for replication and subsequent packaging of the progeny recombinant genome are trans-contained on the second plasmid. Overexpression of the Rep protein results in an inhibitory effect on cell proliferation (Li, J., et al., J. Virol. 71(1997) 5236-5243). Furthermore, a third plasmid containing helper virus genes, namely adenovirus-derived E1, E4orf6, E2A, and VA, is required for AAV replication.

[0294] To reduce the number of plasmids required, the Rep, Cap, and adenovirus helper genes may be combined on a single plasmid.

[0295] Alternatively, the host cells may already be stably expressing the E1 gene product. Such cells are HEK293 cells. The human embryonic kidney clone, designated as 293, was created in 1977 by incorporating adenovirus DNA into human embryonic kidney cells (HEK cells) (Graham, FL, et al., J. Gen. Virol. 36(1977) 59-74). The HEK293 cell line contains base pairs 1-4344 of the adenovirus serotype 5 genome. This includes the E1A and E1B genes as well as the adenovirus packaging signal (Louis, N., et al., Virology 233(1997) 423-429).

[0296] When using HEK293 cells, the missing E2A, E4orf6, and VA genes can be introduced by co-infection with adenovirus or by co-transfection with E2A, E4orf6, and VA expression plasmids (e.g., Samulski, RJ, et al., J. Virol. 63 (1989) 3822-3828; Allen, JM, et al., J. Virol. 71 (1997) 6816-6822; Tamayose, K., et al., Hum. Gene Ther. 7 (1996) 507-513; Flotte, TR, et al., Gene Ther. 2 (1995) 29-37; Conway, JE, et al., J. Virol. 71 (1997) 8780-8789; Chiorini, JA, et al., Hum. Gene Ther. 71 (1997) 8780-8789; Chiorini, JA, et al., Hum. Gene Ther. Ther.6(1995)1531-1541;Ferrari,FK,et al.,J.Virol.70(1996)3227-3234;Salvetti,A.,et al.,Hum.Gene Ther.9(1998)695-706;Xiao,X.,et al., J. Virol. 72 (1998) 2224-2232; Grimm, D., et al., Hum. Gene Ther. 9 (1998) 2745-2760; Zhang, X., et al., Hum. Gene Ther. 10 (1999) 2527-2537). Alternatively, adenovirus / AAV or herpes simplex virus / AAV hybrid vectors can be used (see, for example, Conway, JE, et al., J. Virol. 71 (1997) 8780-8789; Johnston, KM, et al., Hum. Gene Ther. 8 (1997) 359-370; Thrasher, AJ, et al., Gene Ther. 2 (1995) 481-485; Fisher, JK, et al., Hum. Gene Ther. 7 (1996) 2079-2087; Johnston, KM, et al., Hum. Gene Ther. 8 (1997) 359-370).

[0297] Therefore, cell lines into which the rep gene is incorporated and expressed tend to grow slowly or express the Rep protein at very low levels.

[0298] A major safety concern is contamination of rAAV particle preparations with reproducible adenovirus (RCA). RCA is produced when the vector genome and adenovirus DNA integrated into the host cell are recombined during viral replication via homologous recombination (Lochmueller, H., et al., Hum. Gene Ther. 5 (1994) 1485-1491; Hehir KM, et al., J. Virol. 70 (1996) 8459-8467). Therefore, HEK293 cells are not suitable for producing adenovirus vectors for pharmaceutical use.

[0299] To restrict the activity of a transgene to a specific tissue, i.e., to restrict the integration site, the transgene can be operably linked to an inducible promoter or a tissue-specific promoter (see, for example, Yang, Y., et al. Hum. Gene. Ther. 6 (1995) 1203-1213).

[0300] To date, the main difficulty in rAAV particle production has been the inefficient packaging of rAAV vectors, resulting in low titers. Packaging has been difficult for several reasons, including: - If wild-type AAV genomes are present, their preferred capsid formation; -Difficulty in generating sufficient complementary functions, such as those provided by wild-type rep and cap genes, due to inhibitory effects associated with the rep gene product; - Limited efficiency of simultaneous transfection of plasmid constructs.

[0301] All of these problems stem from the biological properties of Rep proteins. In particular, the inhibitory (cell proliferation suppression and cytotoxic) properties of Rep proteins, as well as their ability to reverse the immortalization phenotype of cultured cells, are problematic. Furthermore, Rep proteins downregulate their own expression when the widely used AAV P5 promoter is used (see, for example, Tratschin et al., Mol. Cell. Biol. 6 (1986) 2884-2894).

[0302] Exemplary compounds and compositions according to the present invention This specification reports a novel DNA construct and a method for using the same. The novel DNA construct according to the present invention is useful for the simultaneous transcriptional activation of at least two open reading frames using site-directed recombinase technology. The present invention utilizes the intentional unproductive arrangement of promoters and open reading frames on the coding and template strands of a double-stranded DNA molecule, which are converted to their productive forms by inversion with site-directed recombinase.

[0303] The underlying principle of the technical concept of this invention is the activation of gene expression through a combination of DNA inversion and operable ligation to a promoter.

[0304] One independent aspect of the present invention is a double-stranded DNA element comprising a (positively oriented) coding strand and a (negatively oriented) template strand, The code chain is oriented in the positive direction (i.e., from 5' to 3'), -Positive orientation, first promoter, - A first recombinase recognition sequence containing a mutation in one of the positively oriented, reverse-directed repeats, - Negative orientation, second promoter (i.e., negative orientation with respect to the code chain), -Negative orientation, first polyadenylation signal sequence and / or transcription terminator element (i.e., inverted with respect to the 5'-3' direction of the coding strand), - A first open reading frame (i.e., inverted with respect to the 5'-3' direction of the code strand), which is negatively oriented and optionally operably linked to a first polyadenylated signal sequence and / or transcription terminator element. -The second recombinase recognition sequence contains mutations in each of the other reverse repeats other than the first recombinase recognition sequence, and is negatively oriented (i.e., oriented opposite to the first recombinase recognition sequence and inverted with respect to the 5'-3' direction of the coding strand), - A second open reading frame with positive orientation, and - Characterized by comprising, in the above order, a second polyadenylated signal sequence and / or transcription terminator element, which is positively oriented and optionally operably linked to a second open reading frame.

[0305] One independent aspect of the present invention is a double-stranded DNA element, wherein in the 5' to 3' direction, The first promoter (i.e., positive orientation) in the -5' to 3' direction, - The first recombinase recognition sequence, oriented 5' to 3', contains a mutation in one of the reverse repeats. A second promoter (i.e., negative orientation) in the -3' to 5' direction, -3' to 5' direction, the first polyadenylation signal sequence and / or transcription terminator element (i.e., inverted with respect to the 5' to 3' orientation of the coding strand), A first open reading frame in the -3' to 5' direction, which is optionally operably connected to a first polyadenylated signal sequence and / or transcription terminator element. -The mutations include each other reverse repeats other than the first recombinase recognition sequence, and the second recombinase recognition sequence in the 3' to 5' direction (i.e., in the opposite direction to the first recombinase recognition sequence), The second open reading frame in the -5' to 3' direction, and A double-stranded DNA element comprising, in the order described above, a second polyadenylated signal sequence and / or transcription terminator element, optionally operably linked to a second open reading frame in the -5' to 3' direction.

[0306] In all aspects and in specific embodiments of the embodiments, incubation of a double-stranded DNA element with the first and second recombinase recognition sequences and functional recombinases is performed. - This causes a sequence inversion between the first recombinase recognition sequence and the second recombinase recognition sequence (thereby operably linking the first promoter to the first open reading frame and the second promoter to the second open reading frame), and - This results in the generation of a (third) recombinase recognition sequence that no longer functions with the recombinase between the recombinated first promoter and the first open reading frame, or between the second promoter and the second open reading frame.

[0307] Therefore, the DNA element according to the present invention is non-functional with respect to the transcription of the first and second open reading frames it contains. By being non-functional with respect to the transcription of the first and second open reading frames, the DNA element according to the present invention can be incorporated into the cell genome without the risk that the contained open reading frames will already be expressed immediately after incorporation. After introduction into the cell, the open reading frames are transcribed when a recombinase that functions with the recombination recognition sequence of the DNA element, i.e., recognizes the recognition sequence, is activated in the cell or introduced into the cell. This initiates a recombinase-mediated cassette inversion (RMCI) between the first and second recombinase recognition sequences in the DNA element incorporated into the genome according to the present invention. RMCI results in the inversion of that portion of the DNA element according to the present invention located between the two reverse recombinase recognition sequences. This operatively links the first promoter to the first open reading frame and the second promoter to the second open reading frame. Only thereafter are the first and second open reading frames transcribed and their respective encoded proteins expressed. Therefore, the DNA element according to the present invention is particularly useful for the simultaneous activation of transcription of two open reading frames within a cell.

[0308] The left portion of Figure 1 schematically shows a DNA element according to the present invention having a transcriptionally inactive open reading frame. The right portion of Figure 1 shows an inverted DNA element resulting from an operably linked promoter and open reading frame, i.e., an RMCI having a transcriptionally active open reading frame.

[0309] Therefore, one independent aspect of the present invention is a double-stranded DNA element, wherein the 5' to 3' direction, The first promoter (i.e., positive orientation) in the -5' to 3' direction, - A first recombinase recognition sequence in the 5' to 3' direction, containing mutations in both reverse repeats or not containing mutations in either reverse repeat. - A first open reading frame, oriented 5' to 3', operably connected to the first promoter, A first polyadenylated signal sequence and / or transcription terminator element, optionally operably linked to a first open reading frame in the -5' to 3' direction, Second promoter in the -5' to 3' direction, - If the first recombinase recognition sequence does not have mutations in the reverse repeat, then the second recombinase recognition sequence contains mutations in both reverse repeats, or if the first recombinase recognition sequence has mutations in both reverse repeats, then the second recombinase recognition sequence does not have mutations in the reverse repeat. - A second open reading frame, oriented 5' to 3', operably connected to the second promoter, and A double-stranded DNA element comprising, in the order described above, a second polyadenylated signal sequence and / or transcription terminator element, optionally operably linked to a second open reading frame in the -5' to 3' direction.

[0310] The recombinase recognition sequence is maintained in the inverted and activated construct. Since the exchange reaction is an enzymatic reaction, a second, i.e., inversion reaction is possible if the enzyme is still present / active or reintroduced, as the recombinase recognition sequence, e.g., the LoxP site, retains its functionality after any exchange. The inversion reaction will result in transcriptional inactivation of the previously activated open reading frame. The reversibility of recombinase-mediated cassette inversion depends on the recombinase recognition sequence used and the recombinase used.

[0311] For example, the RMCI reaction catalyzed by Cre recombinase is a reversible reaction. Therefore, cells containing active Cre recombinase and LoxP sites in their genome tend to exhibit intended reversal events, but also tend to exhibit unintended reversal events, because the recombinase recognition sequence remains functional after each exchange reaction.

[0312] Therefore, it is necessary to control the activity and / or site of action and / or reversibility of the recombinase system to prevent secondary, unintended inversion reactions after the primary, intended inversion reaction has occurred.

[0313] Therefore, the DNA element according to the present invention includes a unilaterally mutated recombinase recognition sequence. Thus, each recombinase recognition sequence has one wild-type and one mutated reverse repeat. For example, the first recombinase recognition sequence has a mutated left reverse repeat (and a right wild-type repeat), and the second recombinase recognition sequence has a mutated right reverse repeat (and a left wild-type repeat). After RMCI, the activated and productive DNA includes one recombinase recognition sequence with two wild-type reverse repeats and one recombinase recognition sequence with two mutated reverse repeats. The double-mutated recombinase recognition sequence is no longer recognized by the recombinase, thereby preventing a potential reverse reaction. Based on this intentional design, only a single, i.e., one RMCI can occur, and transcription is stably activated.

[0314] In all aspects and one preferred embodiment, the recombinase is Cre recombinase, and the recombinase recognition sequence is the RE and LE-LoxP sites.

[0315] In all aspects and one preferred embodiment, the recombinase is Flp recombinase, and the recombinase recognition sequence is the RE and LE-FRT sites.

[0316] Alternatively, phiC31-mediated RMCI can be used. During such inversion reactions, the recombination sites are not preserved. More specifically, in contrast to Cre or FLP systems, the attP and attB sites recombinate to produce incompatible attL and attR sites, thus preventing a continuous exchange reaction. Therefore, they can be used in a single unidirectional RMCI by aligning the reverse attP and attB sites, respectively, with the sequence to be inverted (see, e.g., Haecker, I., et al., Nat. Sci. Rep. 7 (2017) 43883).

[0317] In all aspects and one preferred embodiment, the recombinase is phiC31-integrase, and the recombinase recognition sequences are attP and attB. AttP and attB are considered recombinase recognition sequences having a mutation in one of the repeats according to the present invention, since the use of these sequences results in a recombinase recognition sequence that no longer functions after RMCI.

[0318] To further enhance the advantageous effects of the DNA element according to the present invention, the promoter used may also be selected to be inducible / activatable. Thus, transcription of the open reading frame can only be turned on by further specific promoter activation after recombinase-mediated inversion. This results in improved control of the transcription of the open reading frame on the one hand, and on the other hand, the possibility of turning the transcription off again. The combination of the DNA element of the present invention and an inducible promoter can suppress the potential leakage of the inducible promoter when used in isolation. Inducible systems such as the Tet on / off system are known in the art.

[0319] The subject matter of this disclosure provides not only methods for gene constructs suitable for producing recombinant mammalian cells having inducible transcription of multiple open reading frames, but also methods for the stable, large-scale production of each proteinaceous compound. Similarly, recombinant, stably producing mammalian cells with high productivity of the proteinaceous compound of interest can be obtained.

[0320] The method according to the present invention involves any site-specific recombinase such as Cre recombinase, Flp recombinase (which recognizes FRT sites such as GAAGTTCCTATTC-TCTAGAAA-GTATAGGAACTTC (SEQ ID NO: 36)), phiC31-integrase, and Dre recombinase (which recognizes roxP sites such as TAACTTTAAATA-ATGCCAAT-TATTTAAAGTTA (SEQ ID NO: 42); Bessern, JL, et al., Nat. Commun. 10 (2019) 1937), or Tre, Brec These manipulated variants can be used with 1 and VCre (recognizing LoxP variants such as LoxLTR (ACAACATCCTATT-ACACCCTA-TATGCCAACATGG (SEQ ID NO: 43)) and LoxBTR (AACCCACTGCTTA-AGCCTCAA-TAAAGCTTGCCTT (SEQ ID NO: 44)), or LoxV (TCAATTTCTGAGA-ACTGTCAT-TCTCGGAAATTGA (SEQ ID NO: 45); Sarkar, I., et al., Science 316 (2007) 1912-1915, Karpinski, J., et al., Nat. Biotechnol. 34 (2016) 401-409, Bessern, JL, et al., Nat. Commun. 10 (2019) 1937) using their respective recombinase-specific LoxP sites, FRT sites, attB / attP sites, and roxP sites). The only prerequisite is that the recombinase recognition sequences used are incompatible, meaning they interact only with a second identical copy and do not exhibit detectable indiscrimination with closely related sequences.

[0321] A method according to the present invention using a Cre / LoxP system in which the site-specific recombinase is Cre recombinase and the recombination recognition site is the LoxP site is illustrated below. This is done to illustrate the concept of the present invention. It will be immediately apparent to those skilled in the art that the concept of the present invention, as shown with the Cre / LoxP system, can also be applied to other site-specific recombinase systems such as the Flp / FRT system, or the phiC31 / att system, or the Dre / roxP system. Accordingly, in the examples and definitions provided below, the term "Cre-recombinase" can be replaced with "Flp-recombinase," or "phiC31 integrase," or "Dre integrase," respectively, and the term "LoxP site" can be replaced with the term "FRT site," or "att site," or "roxP site," respectively.

[0322] Depending on the orientation and identity / non-identity of the LoxP sites, the recombinase inverts, excises, or replaces the intervening DNA sequence. Therefore, in the first mode, the two LoxP sites are oriented in the same direction. This results in deletion of the intervening DNA sequence upon interaction with Cre recombinase, leaving an isolated LoxP site. In the second mode, the two LoxP sites are oriented head-to-head, meaning they are opposite each other. In this orientation, interaction with Cre recombinase results in inversion of the intervening DNA sequence, leaving the two LoxP sites. During the inversion of the DNA sequence in the second mode, the coding and template strands between the LoxP sites are exchanged; that is, the coding strand before interaction with Cre recombinase becomes the template strand after interaction, and vice versa. This process is called recombinase-mediated cassette inversion (RMCI). In the third mode, two molecules interact with Cre recombinase, each containing DNA sequences adjacent to first and second LoxP sites oriented in the same direction, such that one LoxP site on the first molecule and one LoxP site on the second molecule are identical, and the second LoxP site on the first molecule is identical to each of the other LoxP sites on the second molecule. This interaction results in an exchange of DNA sequences between the LoxP sites of the two molecules. This process is called recombinase-mediated cassette exchange, or RMCE for short.

[0323] Variant LoxP sites that do not match wild-type LoxP sites are known in the art. However, the number of these non-matching LoxP sites is limited. Some of these sites that are not LoxP match sites with non-differentiating, i.e., nonspecific interactions, are listed in Table 1a below. (Table 1a) Incompatible LoxP sites. TIFF0007830449000003.tif139143

[0324] Incompatible FRT sites are known in the art. However, the number of these incompatible FRT sites is limited. Some incompatible FRT sites that do not have non-discriminatory, i.e., nonspecific interactions are listed in Table 1b below. (Table 1b) Non-compatible FRT sites. TIFF0007830449000004.tif45143

[0325] A single specific incompatible LoxP site can be easily identified (see Table 1a above). If more than one Cre-lox base exchange must be performed in a single nucleic acid, more than one incompatible LoxP site is required, i.e., a set containing two or more incompatible LoxP sites. This means that each LoxP site in the set must be incompatible with all other LoxP sites in the set. Such a set is particularly needed when more than one open reading frame is selectively activated.

[0326] For example, Lee and Saito (Gene 216(1998)55-65) synthesized a complete set of 24 LoxP spacer mutants with single nucleotide substitutions and 30 LoxP spacer mutants with double nucleotide substitutions. Of these, two LoxP spacer mutants, namely mutants Lox5171 and Lox2272, were identified. These efficiently recombine with the same mutant but not with other mutants or wild-type LoxP.

[0327] Similarly, Langer, SJ, et al. (Nucl. Acids Res. 30(2002) 3067-3077) conducted a gene screening designed to identify novel mutant spacer-containing LoxP sites that exhibit enhanced incompatibility with canonical LoxP sites. As can be seen from Table 1 by Langer et al., it is possible to identify LoxP sets that are incompatible with each other. (Table 2) Table 1 by Langer et al. TIFF0007830449000005.tif45143 The lowercase letters indicate a nucleotide different from the loxP spacer sequence. (Sequences 16, 20, 23, 24, 25, 49)

[0328] Missirlis, PI, et al. (BMC Genomics 7(2006)73,A13) performed a high-throughput screening to identify the sequences and indiscriminate properties of the LoxP spacer region in Cre-recombinase-mediated recombination. They identified 31 unique and novel self-recombination sequences, two of which had only a single recombination partner.

[0329] Table 3 lists exemplary sets of non-compatible LoxP sites. (Table 3) Incompatible LoxP parts set. TIFF0007830449000006.tif109135 The nucleotides in bold indicate sequence differences between each publication and Lee and Saito.

[0330] Langer, SJ et al. reported that the use of a LoxP site with complementary mutant reverse repeats (Lox66 and Lox71) enables efficient recombination in trans, thereby generating a wild-type LoxP site and a deletion site with both reverse repeats mutated. Since the LoxP site with both reverse repeats mutated is no longer an efficient substrate for the recombinase, the reaction is driven in one direction.

[0331] These complementary mutant reverse repeats contain a modified base pentet at one of the ends of the repeat sequence. Mutants with mutations at the end of a left reverse repeat are called LE mutants. Similarly, those with mutations at the end of a right reverse repeat are called RE mutants. In the LE mutant Lox71, 5 bp at the 5' end of the left reverse repeat are changed from the wild-type sequence to TACCG (SEQ ID NO: 50), and in the RE mutant Lox66, five of the 3' bases are changed to CGGTA (SEQ ID NO: 51). After the recombinase reaction between Lox71 and the cis-located inverted Lox66 site, the resulting LoxP sites are still cis-located surrounding the target DNA sequence, but one of the resulting LoxP sites is a double mutant site, meaning there is a mutation in each terminal sequence, and therefore it contains both LE reverse repeat mutants and RE reverse repeat mutants. Each of the other resulting LoxP sites corresponds to the wild-type sequence. The aforementioned double mutation LoxP site is no longer functional in Cre recombinase-mediated recombination (see, for example, Langer et al.; Missirlis et al., both cited above).

[0332] Various LoxP RE and LE variant sequences are known. Some are shown in Table 4a below. (Table 4a) LoxP RE mutant sequences and LE mutant sequences. TIFF0007830449000007.tif168138*: Has the highest stability after exchange reaction; reverse spacer as defined by Hoess et al. (1982).

[0333] For example, the RE variant sequence and the LE variant sequence Lox71 and Lox66, or LoxJT15 and LoxJTZ17 can be used as a pair.

[0334] Similarly, different FRT RE and LE variant sequences are known. Some are shown in Table 4b below. (Table 4b) FRT RE mutant sequences and LE mutant sequences. TIFF0007830449000008.tif50138

[0335] In general, recombination sites containing a (functional) start codon in the sequence on either strand (e.g., LoxP, Lox511, Lox5171, Lox66, or Lox71) should not be positioned after recombination so that the start codon is located on the coding strand at the 5' UTR of the gene that is activated. Otherwise, the start codon may suppress translation of the open reading frame. In such cases, the recombination site may be positioned (immediately) 3' of the promoter's TATA element or between the TATA element and the transcription start site so that the start codon is not transcribed (start codon silencing).

[0336] In all aspects and in specific embodiments of the present invention, the DNA elements of the present invention are combined into dimers, trimers and arrays, provided that the recombinase recognition sites used are incompatible. This is the only requirement when using different DNA elements of the present invention in combination. This makes it possible to sequentially activate the transcription of two, four, six, or even more open reading frames / genes at once, when the same recombinase is used, or when incompatible recombinase recognition sites of different recombinases are used in each DNA element of the present invention.

[0337] In all aspects and in specific embodiments of the embodiments, sequential activation of two, four, six, and more open reading frames / genes is achieved when two or more DNA elements according to the present invention are combined, and each DNA element requires a different recombinase for RMCI. This can be achieved by combining two of the different site-specific recombinase systems outlined above, such as the combination of the Cre / LoxP system and the Flp / FRT system, or the Cre / LoxP system and the Dre / roxP system (see, for example, Chuang, K., et al., Genes Genom. Genet. 6 (2016) 559-571), or the combination of the Cre / LoxP system and the phiC31-integrase / att system, or the Flp / FRT system and the phiC31-integrase / att system.

[0338] In all aspects and certain embodiments of the embodiments, sequential activation of one, two, three, four, five, six and more open reading frames / genes is achieved, using one DNA element according to the present invention (sequential activation of one or two open reading frames), or two or more DNA elements according to the present invention are combined (sequential activation of two, three, four or more open reading frames), thereby, in the case of two or more DNA elements, each DNA element requires a different recombinase for RMCI, and either the first or second promoter is an inducible promoter (in the case of sequential activation of two open reading frames), or each second promoter is an inducible promoter (in the case of sequential activation of two or more open reading frames).

[0339] Therefore, in all aspects and in specific embodiments of the embodiments, either the first promoter or the second promoter is an inductive promoter. In specific embodiments, the inductive promoter is selected from the group of inductive promoters including a tetracycline-controlled promoter, a kmet-controlled promoter, a FKBP12-mTOR-controlled promoter, a rapamycin-controlled promoter, a FKCsA-controlled promoter, an abscisic acid-controlled promoter, a tamoxifen-controlled promoter, and a riboswitch-controlled promoter (FKCsA = a heterodimer of FK506 and cyclosporine A).

[0340] For a review of inductive promoters, see, for example, Kallunki, T., et al., Cells 8(2019)796.

[0341] In all aspects and certain embodiments of the embodiments, sequential activation of one, two, three, four, five, six and more open reading frames / genes is achieved, using one DNA element according to the present invention (sequential activation of one or two open reading frames), or two or more DNA elements according to the present invention are combined (sequential activation of two, three, four or more open reading frames), thereby, in the case of two or more DNA elements, each DNA element requires a different recombinase for RMCI, and either the first or second promoter is a repressive promoter (in the case of sequential activation of two open reading frames), or each second promoter is a repressive promoter (in the case of sequential activation of two or more open reading frames).

[0342] Therefore, in all aspects and in specific embodiments of the embodiments, either the first promoter or the second promoter is a repressive promoter. In specific embodiments, the repressive promoter is selected from the group of repressive promoters, including tetracycline-controlled promoters, GAL4 / UAS-controlled promoters, and LexA / lexAop-controlled promoters.

[0343] To enable even more combinations, constitutive, inductive, and repressive promoters can be combined. For example, when combining a tetracycline-dependent inductive promoter and a repressive promoter, the addition of tetracycline silences one promoter and activates the other, allowing for the switching of transcription of different open reading frames.

[0344] Figure 2 shows a combination of two DNA elements according to the present invention. The first DNA element includes a first recombinase recognition sequence (RRS1) having a mutation in a forward left reverse repeat, a reverse first open reading frame (SG1) operably ligated to a reverse first polyadenylation signal sequence, a second recombinase recognition sequence (RRS2) having a mutation in a reverse right reverse repeat compatible with RRS1, and a forward open reading frame (SG2) operably ligated to a second polyadenylation signal sequence. The second DNA element includes a third recombinase recognition sequence (RRS3) having a mutation in a forward left reverse repeat that does not match RRS1 and RRS2, a reverse third open reading frame (SG3) operably linked to a third polyadenylation signal sequence, a fourth recombinase recognition sequence (RRS4) having a mutation in a reverse right reverse repeat that does not match RRS1 and RRS2 but matches RRS3, and a fourth open reading frame (SG4) operably linked to a fourth polyadenylation signal sequence.

[0345] If all RRSs are recognized by a single, i.e., the same recombinase, two inversion reactions occur during incubation with it: the DNA fragments between RRS1 and RRS2 and between RRS3 and RRS4 are inverted. This ligates all four open reading frames operably to their respective promoters for transcription. The respective exchange reactions are shown in Figure 3. For example, when using Cre recombinase, incompatible RRS pairs such as Lox71 / Lox66 and L3-LE / L3-RE can be used, respectively.

[0346] When RRS1 and RRS2 are recognized by the first recombinase and RRS3 and RRS4 are recognized by the second recombinase, only one inversion reaction occurs during incubation with the first recombinase; that is, the DNA fragment between RRS1 and RRS2 is inverted, while the DNA fragment between RRS3 and RRS4 is maintained. As a result, only two open reading frames are operably linked to their respective promoters and transcribed. When the respective second recombinases are introduced into the respective cells after the first recombinase, the DNA fragment between RRS3 and RRS4 is also inverted, and their respective open reading frames are activated. The respective exchange reactions are shown in Figure 4. For example, the first recombinase could be Cre recombinase, RRS1 / RRS2 could be the LoxP site, the second recombinase could be phiC31-integrase, and RRS3 / RRS4 could be attP and attB.

[0347] If at least one of the promoters is an inductive promoter, transcription of operably linked open reading frames may require the presence of each inducer after RMCI, or if at least one of the promoters is a repressive promoter, transcription of operably linked open reading frames may be repressed after RMCI by the addition of each repressor.

[0348] Recombinant AAV particles The production of recombinant AAV particles requires the expression of Rep protein and Cap protein, helper proteins E1A, E1B, E2A, and E4orf6, and adenovirus VA RNA in a single mammalian cell. In particular, Rep protein expression negatively affects the growth and viability of mammalian cells. These drawbacks can be overcome by using the DNA elements according to the present invention. Exemplary designs are outlined below, and examples using one or two DNA elements according to the present invention are shown in Figures 5, 6, and 7. Helper proteins E1A, E1B, E2A, and E4orf6 can be expressed using any promoter shown by Matsushita et al. (Gene Ther. 5 (1998) 938-945), especially the CMV IE promoter. Therefore, any promoter can be used below.

[0349] E1A, E1B, E2A, E4 or F6 Open Reading Frames Therefore, one independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles), a) E1A open reading frame and E1B open reading frame; and b) Including E2A open reading frames and E4 or E6 open reading frames, The first and second open reading frames of a) or b) are characterized in that they are contained within a double-stranded DNA element (according to the present invention) comprising a (positively oriented) code strand and a (negatively oriented) template strand. The code chain is arranged in the following order, from 5' to 3': - The first promoter, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter that is inverted relative to the code chain (it is in the opposite direction), --A first polyadenylated signal sequence and / or transcription termination element, which is inverted relative to the code strand and operably linked to a first open reading frame, - The first open reading frame (inverted) of a) or b) which is inverted relative to the code chain, - The second recombinase recognition sequence contains a mutation in the right-reverse repeat, which is oriented in the opposite direction to the first recombinase recognition sequence. -If the first open reading frame is of a), then the second open reading frame of a), or if the first open reading frame is of b), then the second open reading frame of b), - Includes a second polyadenylated signal sequence and / or transcription termination element operably linked to a second open reading frame.

[0350] In all aspects and in specific embodiments of the embodiments, each other open reading frame is located within the expression cassette, i.e., operably coupled to the promoter and the polyadenylation signal sequence and / or transcription termination element.

[0351] Figures 9 and 10 show the scheme of the above embodiment a) before RMCI (Figure 9) and after RMCI (Figure 10).

[0352] Figures 11 and 12 show the scheme of the above embodiment b) before RMCI (Figure 11) and after RMCI (Figure 12).

[0353] The sequences of recombination recognition sites in the DNA element of the present invention must have orientations specific to each other. The first recombination recognition site is positively oriented, and the second recombination recognition site is inverted / opposite to the first recombination recognition site.

[0354] For example, in the case of a LoxP site having the following sequence in the 5' to 3' direction, such as on the code strand / forward strand / positive strand: 5'-ataacttcgtata-atgtatgc-tatacgaagttat-3' The inverted sequence, which should be positioned in the coding chain, i.e., from 5' to 3', is obtained by substituting each nucleotide with its complementary base and starting from the 3' end of the original sequence, thereby obtaining the following inverted coding chain sequence: 5'-ataacttcgtata-gcatacat-tatacgaagttat-3'.

[0355] Similarly, other inverted sequences can be obtained that are combined in the DNA element of the present invention. Therefore, an exemplary DNA element according to the present invention has the following sequence on the coding strand. First promoter in normal orientation - 5'-ataacttcgtata-atgtatgc-tatacgaagttat-3' (the first recombinase recognition sequence in normal orientation) - The second promoter is in the opposite direction. The first polyA / terminator sequence is in reverse orientation. The first open reading frame is inverted. 5'-ataacttcgtata-gcatacat-tatacgaagttat-3' (the second recombinase recognition sequence, which is reversed) - Second open reading frame (in normal orientation) - A second poly(A) / terminator sequence in a normal orientation.

[0356] Furthermore, one independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles), a) E1A open reading frame and E1B open reading frame; and b) Including E2A open reading frames and E4 or E6 open reading frames, a) The first and second open reading frames are contained within a double-stranded DNA element (according to the present invention), and b) The first and second open reading frames are contained within a double-stranded DNA element (according to the present invention) (i.e., the DNA contains two of the aforementioned DNA elements according to the present invention), characterized in that each double-stranded DNA element contains a coding strand (positively oriented) and a template strand (negatively oriented). The code chain runs from 5' to 3'. - The first promoter, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter that is inverted relative to the code chain (it is in the opposite direction), -A first polyadenylation signal and / or transcription termination element, which is inverted relative to the code strand and operably linked to a first open reading frame, - The first open reading frame (inverted) of a) or b) which is inverted relative to the code chain, - The second recombinase recognition sequence contains a mutation in the right-reverse repeat, which is oriented in the opposite direction to the first recombinase recognition sequence. -If the first open reading frame is of a), then the second open reading frame of a), or if the first open reading frame is of b), then the second open reading frame of b), and - A second polyadenylation signal and / or transcription termination element operably linked to a second open reading frame, in the order described above.

[0357] In either case, incubation of the double-stranded DNA molecule with the first and second recombinase recognition sequences and functional recombinases is performed. - This causes a sequence inversion between the first recombinase recognition sequence and the second recombinase recognition sequence (thereby operably linking the first promoter to the first open reading frame and the second promoter to the second open reading frame), and - This results in the generation of a (third) recombinase recognition sequence that no longer functions with the recombinase, located between the recombinated first promoter and the first open reading frame.

[0358] In the two embodiments described above, similarly, the first recombinase recognition sequence may contain mutations in the right reverse repeat, and the second recombinase recognition sequence may contain mutations in the left reverse repeat. This results in the generation of a recombinase recognition sequence that no longer functions with the recombinase, located between the recombinated second promoter and the second open reading frame.

[0359] Temporal expression of recombinases, such as Cre recombinase, can be achieved by using an inducible promoter that drives the expression of the recombinase gene, or by introducing a recombinase encoding mRNA. An exemplary inducible Cre recombinase expression system was reported by Carter, Z. and Delneri, D. (Yeast 27(2010)765-775). In this system, Cre recombinase expression was induced in transformants by exposure to galactose (YPGal) for several hours.

[0360] The coding sequences for E1A and E1B (open reading frames) are derived in all aspects and specific embodiments from human adenoviruses, for example, particularly human adenovirus serotype 2 or serotype 5. An exemplary sequence for human Ad5 (adenovirus serotype 5) can be found in GenBank entry X02996, AC_000008, and an exemplary sequence for human Ad2 can be found in GenBank entry AC_000007. In all aspects and specific embodiments, nucleotides 505-3522 include nucleic acid sequences encoding human adenovirus serotype 5 E1A and E1B. Plasmid pSTK146, reported in EP 1 230 354 B1, and plasmids pGS119 and pGS122, reported in International Publication 2007 / 056994, can also be used as sources for E1A and E1B open reading frames.

[0361] Rep / Cap Open Reading Frame The rep and cap open reading frames can also be conditionally activated using the principle of gene activation through a combination of DNA inversion and operable linking to a promoter.

[0362] With the exception of the P5 promoter, the promoters driving the open reading frame expression of rep and cap are located within the Rep polypeptide coding sequence. Therefore, for conditional activation of the rep and cap open reading frames by recombinase-mediated sequence inversion and simultaneous operable linkage to the promoters, one of the incompatible recombinase recognition sequences must be located between the P5 promoter and the rep open reading frame, and the other incompatible recombinase recognition sequence must be located between the cap open reading frame and the polyadenylation signal. This is schematically illustrated in the left-hand diagram of Figure 7.

[0363] Therefore, one independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles) comprising a double-stranded DNA element (according to the present invention) including a (positively oriented) coding strand and a (negatively oriented) template strand, The code chain runs from 5' to 3'. - A first promoter, in one preferred embodiment, adeno-associated virus promoter P5 or a functional fragment thereof or a variant thereof, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A rep and cap open reading frame comprising further promoters for the expression of the Rep protein and the Cap protein, the open reading frame being inverted (reverse-oriented) with respect to the coding strand, - A second recombinase recognition sequence containing a mutation in the right reverse repeat, which is in the opposite direction to the first recombinase recognition sequence, and -Includes polyadenylation signals in the order listed above.

[0364] Another independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors or particles) comprising a double-stranded DNA element (according to the present invention) including a (positively oriented) coding strand and a (negatively oriented) template strand, The code chain runs from 5' to 3'. - A first promoter, in one preferred embodiment, adeno-associated virus promoter P5 or a functional fragment thereof or a variant thereof, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter inverted (reverse-oriented) with respect to the code chain, in one preferred embodiment, adeno-associated virus promoter P19 or a functional fragment thereof or a variant thereof, - A first polyadenylation signal and / or transcription termination element that is inverted relative to the coding chain, - A coding sequence that codes for either the Rep78 protein only or the Rep68 protein only, but not both, in which the internal P40 promoter is inactivated, the splice donor and splice acceptor sites are removed, and the coding sequence is inverted (in reverse orientation) relative to the coding strand. - A second recombinase recognition sequence containing a mutation in the right reverse repeat, which is in the opposite direction to the first recombinase recognition sequence, and -Includes the Rep52 / Rep40 genes and the Cap gene, which contain a common polyadenylation signal, in the order listed above.

[0365] Figures 13 and 14 show the schemes of the above configuration before (Figure 13) and after (Figure 14) RMCI. See also the schematic diagram in the center of Figure 7.

[0366] Another independent aspect of the present invention is a (double-stranded) DNA (molecule) (for the production of recombinant adeno-associated virus vectors and particles) comprising a double-stranded DNA element (according to the present invention) including a (positively oriented) coding strand and a (negatively oriented) template strand, The code chain runs from 5' to 3'. - A first promoter, in one preferred embodiment, adeno-associated virus promoter P5 or a functional fragment thereof or a variant thereof, - The first recombinase recognition sequence containing a mutation in the left reverse repeat, - A second promoter inverted (reverse-oriented) with respect to the code chain, in one preferred embodiment, adeno-associated virus promoter P19 or a functional fragment thereof or a variant thereof, -A first polyadenylation signal and / or transcription termination element that is inverted (i.e., in an inverted / negative orientation) with respect to the coding chain (direction) and operably linked to the Rep78 or Rep68 coding sequence, - A coding sequence that codes for either the Rep78 protein only or the Rep68 protein only, but not both, in which the internal P40 promoter is inactivated, the splice donor and splice acceptor sites are removed, and the coding sequence is inverted (reverse-oriented) relative to the coding strand. - A second recombinase recognition sequence containing a mutation in the right reverse repeat, which is reciprocal / reverse to the first recombinase recognition sequence. - A Rep52 open reading frame containing a polyadenylation signal sequence (i.e., the polyadenylation signal is operably linked to the open reading frame), and -Optionally, a third promoter, a cap-open reading frame, and a polyadenylation and / or terminator sequence are included in the above order (all operably linked).

[0367] Please also refer to the simplified diagram on the right in Figure 7.

[0368] In each of the above embodiments, incubation of a double-stranded DNA molecule with the recombinases that function together with the first and second recombinase recognition sequences and / or the third and fourth recombinase recognition sequences is, -A sequence inversion occurs between the first / third recombinase recognition sequence and the second / fourth recombinase recognition sequence (thereby the first / third promoter is operably linked to the first / third open reading frame, and the second / fourth promoter is operably linked to the second / fourth open reading frame), and - This results in the generation of a recombinase-recognition sequence that no longer functions with the recombinase between the recombinated first / third promoter and the first / third open reading frame.

[0369] In the three embodiments described above, similarly, the first recombinase recognition sequence may contain mutations in the right reverse repeat, and the second recombinase recognition sequence may contain mutations in the left reverse repeat. This results in the generation of a recombinase recognition sequence that no longer functions with the recombinase, located between the recombinated second promoter and the second open reading frame.

[0370] Temporal expression of recombinases, such as Cre recombinase, can be achieved by using an inducible promoter that drives the expression of the recombinase gene, or by introducing a recombinase encoding mRNA. An exemplary inducible Cre recombinase expression system was reported by Carter, Z. and Delneri, D. (Yeast 27(2010)765-775). In this system, Cre recombinase expression was induced in transformants by exposure to galactose (YPGal) for several hours.

[0371] Adenovirus VA RNA gene The principle of gene activation through a combination of DNA inversion and operable linking to a promoter can also be used to conditionally activate adenovirus VA RNA gene transcription.

[0372] The adenovirus VA RNA gene is driven by a type 2 polymerase III promoter containing two intragene elements, the A-box and the B-box. Snouwaert et al. (Nucl. Acids Res. 15 (1987) 8293-8303) identified a variant of the VA RNAI B-box that completely disables promoter activity. These mutations are unlikely to affect VA RNAI binding to PKR and related functions (Clark, KR, et al., Hum. Gene Ther. 6 (1995) 1329-1341).

[0373] A further aspect of the present invention is a novel adenovirus VA RNA gene. The adenovirus VA RNA gene according to the present invention enables Cre recombinase-mediated gene activation by inversion. In the adenovirus VA RNA according to the present invention, the adenovirus VA RNA gene can be driven by any promoter having a precise transcription start site together with a LoxP site introduced into the non-coding element of the adenovirus VA RNA, i.e., the regulatory element.

[0374] The inventors have found that a TATA box can be incorporated into an 8bp spacer of a LoxP site to yield a novel, specifically manipulated LoxP site. The novel LoxP spacer sequence AGTTTATA (SEQ ID NO: 01) is denoted as Lx. This novel spacer sequence can be combined with any known reverse repeat sequence, for example, the wild-type LoxP reverse repeat sequence of SEQ ID NOs: 14 and 15 (=SEQ ID NO: 14 + SEQ ID NO: 01 + SEQ ID NO: 15), and reverse repeat sequences including the LE- and RE- variant sequences of SEQ ID NOs: 50 and 51 (=SEQ ID NOs: 03 and 05), in both forward and reverse (inv) forms (=SEQ ID NO: 14 + SEQ ID NO: 02 + SEQ ID NO: 15). Lx ataacttcgtata-agtttata-tatacgaagttat Lx(inv)ataacttcgtata-tataaact-tatacgaagttat Lx-LE taccgttcgtata-agtttata-tatacgaagttat Lx-RE ataacttcgtata-agtttata-tatacgaacggta

[0375] Below the sequence alignment of the LoxP site (1), the Lx-LE site (having a mutated left reverse repeat) (2) and an exemplary TATA box (3) according to the present invention are shown (underlined are TATA boxes, bold are spacer sequences): TIFF0007830449000009.tif11128

[0376] The Lx-LE region according to the present invention retains the TATA box without alteration and includes a mutant left repeat (LE), a wild-type right repeat, and a novel Lx spacer sequence.

[0377] Therefore, one aspect of the present invention is the Cre recombinase recognition sequence Lx-LE of SEQ ID NO: 30 (TACCGTTCGTATAAGTTTATATATACGAAGTTA T).

[0378] Therefore, an independent aspect of the present invention is the LoxP site AGTTTATA (SEQ ID NO: 01 forward; SEQ ID NO: 02 reverse).

[0379] In all aspects and in specific embodiments of the embodiments, the spacer sequence of SEQ ID NO: 01 or SEQ ID NO: 02 is combined with a wild-type left reverse repeat sequence and a wild-type right reverse repeat sequence. This Cre recombinase recognition sequence has a direct combination of the sequences of SEQ ID NO: 14 + SEQ ID NO: 01 + SEQ ID NO: 15 in the forward direction and a direct combination of the sequences of SEQ ID NO: 14 + SEQ ID NO: 02 + SEQ ID NO: 15 in the reverse direction.

[0380] In all aspects and in specific embodiments of the embodiments, the spacer sequence of SEQ ID NO: 01 or SEQ ID NO: 02 is combined with a mutated left reverse repeat sequence and a wild-type right reverse repeat sequence. This Cre recombinase recognition sequence is shown as Lx-LE and has the sequence of SEQ ID NO: 03 in the forward direction and the sequence of SEQ ID NO: 04 in the reverse direction.

[0381] In all aspects and in specific embodiments of the embodiments, the spacer sequence of SEQ ID NO: 01 or SEQ ID NO: 02 is combined with a mutated right reverse repeat sequence and a wild-type left reverse repeat sequence. This Cre recombinase recognition sequence is denoted as Lx-RE and has the sequence of SEQ ID NO: 05 in the forward direction and the sequence of SEQ ID NO: 06 in the reverse direction.

[0382] A further independent aspect of the present invention is the use of the Cre recombinase recognition sequence of Sequence ID No. 03 in the transcription of the adenovirus VA RNA gene.

[0383] A further independent aspect of the present invention is a novel adenovirus VA RNA gene. The adenovirus VA RNA gene according to the present invention enables Cre recombinase-mediated gene activation by inversion. In the adenovirus VA RNA according to the present invention, transcription of the adenovirus VA RNA gene can be driven by any promoter having a precise transcription start site together with a LoxP site introduced into the non-coding element of the adenovirus VA RNA, i.e., the regulatory element.

[0384] This embodiment of the present invention is shown in Figure 16.

[0385] Virus-associated RNA (VA RNA) is the non-coding RNA of adenoviruses (Ad) that regulates translation. The adenovirus genome contains two independent copies: VAI (VA RNA I) and VAII (VA RNA II). Both are transcribed by RNA polymerase III (e.g., Machitani, M., et al., J. Contr. Rel. 154 (2011) 285-289).

[0386] The structure, function, and evolution of adenovirus-associated RNAs using a phylogenetic approach were investigated by Ma, Y. and Mathews, MB (J. Virol. 70(1996) 5083-5099). They provided alignment and consensus VA RNA sequences based on 47 known human adenovirus serotypes. The foregoing disclosure is incorporated in its entirety by reference.

[0387] VA RNA, VAI, and VAII consist of 157 to 160 nucleotides (nt).

[0388] Depending on the serotype, adenoviruses contain one or two VA RNA genes. VA RNAI is thought to play the role of the dominant provirus, while VA RNAII can partially compensate for the absence of VA RNAI (Vachon, VKand Conn, GL, Virus Res. 212 (2016) 39-52).

[0389] VA RNA is not essential, but it plays a crucial role in efficient viral replication by overcoming the cell's antiviral mechanisms. That is, although VA RNA is not essential for viral replication, VA RNA-deficient adenoviruses may not be able to replicate during the early stages of vector generation, when only a few copies of the viral genome exist per cell, because other viral genes that block the cell's antiviral mechanisms may not be sufficiently expressed (see Maekawa, A., et al. Nature Sci. Rep. 3 (2013) 1136).

[0390] The A-box and B-box, which constitute the internal regulatory region (or promoter) of RNA polymerase III, are experimentally defined for adenovirus serotype 2 (Ad2) VA RNA I. These are well conserved. All VA RNAs have both boxes in similar positions. B-box homology is very high. The A-box, located 34-40 nt upstream of the B-box, has slightly lower homology in some VA RNAs. The pair of mutually complementary tetranucleotides that form part of the apical stem of the VA RNA, CCGG (SEQ ID NO: 77) and (U / C)CCGG (SEQ ID NO: 78), are fairly well conserved in VA RNA sequences. The first CCGG containing the first two bases of the B-box is invariant. All VA RNA genes except one have sequences that are 5' half-homologous to the tRNA transcription start element, the A-box and B-box consensus sequences RRYNNARYGG (SEQ ID NO: 79) and GWTCRANNC (SEQ ID NO: 80), respectively. A-box homology in VA RNA II genes is generally weaker than that in VA RNA I genes, consistent with the finding that A-boxes are generally less important to VA RNA transcription than B-boxes. The ends of VA RNA coding sequences contain a chain of T residues adjacent to nucleotides C and G, typical of polymerase III termination sites. The number of thymidines varies from a minimum of 4 to more than 10, and A residues are absent at least 3nt on either side of T-rich runs (except for Ad 12 and Ad 18, which have A residues in the middle of very long T runs) (Ma, Y. and Mathews, MB, J. Virol. 70(1996) 5083-5099).

[0391] The B-box sequences of VA RNAI and VA RNAII are known to be essential for the activity of the internal polymerase III promoter.

[0392] Maekawa, A., et al. (Nature Sci. Rep. 3 (2013) 1136) reported the efficient production of an adenovirus vector lacking the gene for virus-associated RNA that disrupts the cellular RNAi mechanism. In this study, HEK293 cells constitutively and highly expressing flipper jelly combinase were infected, and VA RNA-deficient adenoviruses were obtained by FLP recombinase-mediated excision of the VA RNA locus.

[0393] The sequence of human adenovirus 2 VA RNAI (nucleotides 10586-10810 of GenBank entry AC_000007) is shown in SEQ ID NO: 81; the G58T / G59T / C68A (sequential residue numbering) version is shown in SEQ ID NO: 82. The sequence of human adenovirus 5 VA RNAI (nucleotides 10579-10820 of GenBank entry AC_000008) is shown in SEQ ID NO: 83; the sequences of human adenovirus 5 VA RNAI and VA RNAII are shown in SEQ ID NO: 84.

[0394] Hahn, S. (Nat. Struct. Mol. Biol. 11 (2004) 394-403) and Revyakin, A., et al. (Gen. Devel. 26 (2012) 1691-1702) reported on the structure and mechanism of RNA polymerase II transcription, while Nikitina, TV and Tishchenko, LI (Mol. Biol. 39 (2005) 161-172) outlined the RNA polymerase III transcription mechanism. These are summarized below.

[0395] Transcription, or RNA synthesis on a DNA template, is carried out by DNA-dependent RNA polymerase (Pols, [EC 2.7.7.6]). In addition to RNA polymerase, further factors called basic transcription factors (GTFs) are involved. These are necessary for promoter sequence recognition, response to regulatory factors, and conformational changes required for polymerase activity during transcription.

[0396] The core promoter (the minimal DNA sequence required to identify non-regulated or basal transcription) helps position Pol in a state called the pre-start complex (PIC). In this state, Pol and GTF are all bound to the promoter, but they are not in a conformation that is active for initiating transcription.

[0397] Eukaryotic cells contain three Pols, designated as I, II, and III, which differ in their subunit composition.

[0398] Genes transcribed by a particular Pol are assigned to correspond to class I, II, or III.

[0399] Pol I transcribes pre-rRNA genes. Pol II transcribes all protein-coding genes and snRNA genes except U6 snRNA. Pol III transcribes 5S rRNA, tRNA, U6 snRNA, 7SK RNA, 7SL RNA genes; Alu repeats; some viral genes; and genes for small, stable uncoding RNAs.

[0400] Different classes of genes have different promoter structures that determine the Pol involved in the formation of basic transcription factors and PICs.

[0401] RNA polymerase II (Pol II) is responsible for the flow of genetic information from DNA to messenger RNA (mRNA) in eukaryotic cells. Studies have identified GTF-TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIH, which assemble with Pol II at the promoter site into the PIC, initiating transcription initiation at the basal activity level. Further regulation of transcriptional activity depends on cis-regulatory elements in the DNA template recognized by sequence-specific activators / repressors assisted by coactivators.

[0402] Sequence elements found in the Pol II core promoter include the TATA element (TATA-binding protein (TBP) binding site), BRE (TFIIB recognition element), Inr (initiation factor element), and DPE (downstream promoter element). Most promoters contain one or more of these elements, but none of them are absolutely essential for promoter function. Promoter elements are binding sites for subunits of the transcription mechanism and help to asymmetrically orient the transcription mechanism within the promoter to direct unidirectional transcription.

[0403] The core domain of TBP consists of two incomplete repeats that form a molecule that binds to DNA with an 8 bp TATA element. In a TATA-containing promoter, the formation of this protein-DNA complex is the first step in the assembly of the transcription mechanism. The TATA-like sequence is located approximately 30 bp upstream of the transcription start site.

[0404] RNA polymerase III (Pol III) has the most complex structure of all eukaryotic Pol enzymes: the enzyme consists of 17 subunits ranging from approximately 10 kDa to 160 kDa, with a total molecular weight of 600 to 680 kDa.

[0405] Class III genes transcribed by Pol III primarily contain three structurally altered promoters located within the gene. The basic transcription factors of the Pol III mechanism are TFIIIA, TFIIIB, TFIIIC, and the small nuclear RNA-activated protein complex (SNAPc).

[0406] The assembly of PICs on different promoters of class III genes (types 1, 2, and 3) requires one or more A-boxes, B-boxes, and C-boxes; an internal regulatory region (ICR); a TATA box; and distal (DSE) and proximal (PSE) sequence elements. Type 1 genes include an A-box at +57 and a C-box at +90 relative to transcription initiation at +1. Type 2 genes include an A-box and a B-box. Type 3 genes include a DSE at -250, a PSE at -60, and a TATA box at -27 relative to transcription initiation at +1. An A-box may be present but is not required.

[0407] The recruitment of Pol III and transcription initiation in all three promoters require the action of transcription factor IIIB (TFIIIB) and are highly regulated. The TFIIIB binding site is + / - 8nt around the TATA box. Furthermore, TBP is required for transcription by all three polymerases (Han, Y., et al., Cell. Discover. 4 (2018) 40).

[0408] Regarding the three types of Pol III genes, Oler, AJ, et al. (Nat. Struct. Mol. Biol. 17 (2010) 620-628) outlined the factors required to direct Pol III to target genes and the three “types” of Pol III genes in humans, based on 1) the presence and location of cis regulatory elements, and 2) the need for specific basal or subtranscriptional factors. Briefly, 5S rRNA is the only type 1 gene and uniquely requires TFIIIA. Both type 1 and type 2 genes require TFIIIC, a basal and targeting complex that recognizes the internal A-box and B-box elements of type 2 genes, not type 1 genes. The TFIIIB complex contains TBP, which is necessary for TATA / promoter recognition and Pol III initiation. Type 2 and type 3 genes utilize alternative assemblies of TFIIIB: BRF1 (TFIIIB-related factor 1) for type 2 genes and BRF2 (TFIIIB-related factor 2) for type 3 genes. Type 3 genes lack an internal A-box or B-box, are independent of TFIIIC, and instead depend on upstream PSE and DSE as well as specific factors for targeting (OCT1, SNAPc, etc.). In particular, type 3 Pol III promoters are similar to Pol II genes in their structure, utilizing upstream regulatory elements rather than internal gene elements.

[0409] In certain embodiments, the novel adenovirus VA RNA gene according to the present invention is, in the 5' to 3' direction, - At least six 5' terminal nucleotides of adenovirus VA RNAI, including the transcription start site (TSS) (to prevent bypass of the subsequent polymerase III (polyIII) terminator); - Functional polymerase III terminator (to prevent transcription of reverse complementary VA RNA from an optionally present constitutively active upstream promoter), - Contains the inverted adenovirus VA RNAI sequence (3' to 5' direction) in the order described above.

[0410] In all aspects and in specific embodiments of the embodiments, the VA RNA gene further comprises a polymerase promoter fused to its 5' end.

[0411] In all aspects and in specific embodiments of the embodiments, the adenovirus VA RNA gene according to the present invention further comprises the Cre recombination site of SEQ ID NO: 03, either directly or via a nucleotide linker fused to its 5' end. In specific embodiments, the adenovirus VA RNA gene according to the present invention comprises the Cre recombinase site of SEQ ID NO: 03, either directly or via a nucleotide linker fused to its 5' end, and the Cre recombinase site of SEQ ID NO: 06, either directly or via a nucleotide linker fused to its 3' end. In all aspects and in specific embodiments of the embodiments, the adenovirus VA RNA sequence according to the present invention includes all or part of the wild-type sequence of SEQ ID NO: 62, SEQ ID NO: 81, or SEQ ID NO: 83: gggcactctt ccgtggtctg gtggataaat tcgcaagggt atcatggcgg acgaccgggg ttcgaacccc ggatccggcc gtccgccgtg atccatgcgg ttaccgcccg cgtgtcgaac ccaggtgtgc gacgtcagac aacgggggag cgctcctttt ggcttccttc caggcgcggc ggctgctgcg ctagcttttt t.

[0412] In all aspects and in specific embodiments of the embodiments, the adenovirus VA RNA sequence according to the present invention comprises all or part of the wild-type sequence having mutants G58T, G59T and C68A (sequence numbering) (SEQ ID NO: 62): gggcactctt ccgtggtctg gtggataaat tcgcaagggt atcatggcgg acgaccgttg ttcgaacacc ggatccggcc gtccgccgtg atccatgcgg ttaccgcccg cgtgtcgaac ccaggtgtgc gacgtcagac aacgggggag cgctcctttt ggcttccttc caggcgcggc ggctgctgcg ctagcttttt t.

[0413] Figure 15 shows the alignment including the sequences of sequence numbers 62 and 63.

[0414] The adenovirus VA RNA gene according to the present invention, fused to SEQ ID NO: 03 at its 5' end and to SEQ ID NO: 06 at its 3' end, is shown in Figure 16 (before RMCI) and Figure 17 (after RMCI).

[0415] In a particular embodiment, the adenovirus VA RNA according to the present invention comprises the following sequence in the 5' to 3' direction in the following order: (1) taccgttcgt ataagtttat atatacgaag ttat (Sequence code 03) (1a) Optionally, the stuffer sequence ggacgaaaca cc (sequence number 68) (2) gggcac (Sequence ID 64) (3) tttttt (Sequence No. 65) (4)aggagcgctc ccccgttgtc tgacgtcgca cacctgggtt cgacacgcgg gcggtaaccg catggatcac ggcggacggc cggatccggt gttcgaacaa cggtcgtccg ccatgatacc cttgcgaatt tatccaccag accacggaag agtgccc (Sequence ID 66) (5) taccgttcgt atatataaac ttatacgaag ttat (Sequence code 06)

[0416] In a particular embodiment, the adenovirus VA RNA gene according to the present invention includes the following sequence: taccgttcgt ataagtttat atatacgaag ttatggacga aacaccgggc acttttttca gtggccaaaa aagctagcgc agcagccgcc gcgcctggaa ggaagccaaa aggagcgctc ccccgttgtc tgacgtcgca cacctgggtt cgacacgcgg gcggtaaccg catggatcac ggcggacggc cggatccggt gttcgaacaa cggtcgtccg ccatgatacc cttgcgaatt tatccaccag accacggaag agtgcccggt gtttcgtcct accgttcgta tatataaact tatacgaagt tat (Sequence number 67).

[0417] In a particular embodiment, the Lx-LE region according to the present invention includes the following sequence, which includes a stuffer sequence for appropriate spacing: taccgttcgt ataagtttat atatacgaag ttatggacga aacacc (Sequence ID 69).

[0418] Another aspect of the present invention is a cell containing the adenovirus VA RNA according to the present invention in either its original form or an inverted form.

[0419] Exemplary uses and methods including DNA elements and DNA molecules according to the present invention The double-stranded DNA elements or molecules and any nucleic acids according to the present invention can be used in the production of recombinant AAV vectors and recombinant AAV particles containing them.

[0420] Various methods known in the art for generating rAAV particles. For example, transfection using an AAV plasmid and an AAV helper sequence in conjunction with co-infection with one AAV helper virus (e.g., adenovirus, herpesvirus, or vacciniavirus), or transfection with a recombinant AAV plasmid, an AAV helper plasmid, and a helper functional plasmid. Non-limiting methods for generating rAAV particles are described, for example, in U.S. Patent No. 6,001,650, U.S. Patent No. 6,004,797, International Publication No. 2017 / 096039, and International Publication No. 2018 / 226887. After recombinant rAAV particle production (i.e., particle generation in a cell culture system), rAAV particles can be obtained and purified from host cells and cell culture supernatants.

[0421] Aspects of the present invention are methods for transducing molecules such as nucleic acids (e.g., plasmids) according to the present invention into cells and the production of the respective gene products. Furthermore, when such cells are transduced with sequences such as plasmids encoding viral packaging proteins and / or helper proteins, they can produce recombinant viral particles containing nucleic acids encoding the protein of interest or sequences transcribed into the transcript of interest, at least one of which contains a DNA element or nucleic acid according to the present invention, which then produces recombinant viral particles in high yield.

[0422] The present invention provides a viral (e.g., AAV) particle manufacturing platform that includes features distinguishing it from current "industry standard" viral (e.g., AAV) particle manufacturing processes by using nucleic acids or DNA (elements) according to the present invention.

[0423] When discussing nucleic acids (plasmids), a specific polynucleotide sequence or structure may be described herein in accordance with the convention of providing the sequence in the 5' to 3' direction.

[0424] More generally, cells transfected or transfected with DNA elements or nucleic acids according to the present invention may be called “recombinant cells.” Such cells may be yeast cells, insect cells, or mammalian cells used as recipients of nucleic acids (plasmids) encoding packaging proteins such as AAV packaging proteins, nucleic acids (plasmids) encoding helper proteins, nucleic acids (plasmids) that encode proteins or are transcribed into a desired transcript, i.e., transgenes placed between two AAV ITRs, or other transgenic nucleic acids (plasmids), at least one of which contains DNA elements or molecules according to the present invention. This term includes offspring of the transfected original cell. It is understood that offspring of a single parental cell may not necessarily be morphologically or genomically or in terms of whole nucleic acid complements to the original parent due to natural, accidental, or intentional mutations.

[0425] Numerous suitable cell growth media are commercially available or can be easily manufactured to maintain cell viability or to provide cell growth and / or proliferation. Examples of such media include serum-free eukaryotic growth media, such as media for maintaining viability or media for providing growth of mammalian (e.g., human) cells. Non-limiting examples include Ham's F12 or F12K medium (Sigma-Aldrich), FreeStyle (FS) F17 medium (Thermo-Fisher Scientific), MEM, DMEM, RPMI-1640 (Thermo-Fisher Scientific), and mixtures thereof. Such media may be supplemented with vitamins and / or trace minerals and / or salts and / or amino acids, such as essential amino acids for mammalian (e.g., human) cells.

[0426] Helper protein plasmids can take the form of plasmids, phages, transposons, or cosmids. In particular, it has been demonstrated that complete complementation of adenovirus genes is not required for helper function. For example, adenovirus mutants that are unable to perform DNA replication and late gene synthesis have been shown to allow AAV replication. Ito et al., J. Gen. Virol. 9 (1970) 243; Ishibashi et al, Virology 45 (1971) 317.

[0427] Mutants within the E2B and E3 regions have been shown to support AAV replication, suggesting that the E2B and E3 regions are likely not involved in providing helper function. Carter et al., Virology 126(1983)505. However, adenoviruses with defects in the E1 region or deletions in the E4 region cannot support AAV replication. Therefore, in the case of adenovirus helper proteins, the E1A and E4 regions are likely required for AAV replication, either directly or indirectly (see, for example, Laughlin et al., J.Virol.41(1982)868; Janik et al., Proc.Natl.Acad.Sci.USA 78(1981)1925; Carter et al., Virology 126(1983)505). Other characteristic adenovirus variants include: E1B (Laughlin et al. (1982), previously mentioned; Janik et al. (1981), previously mentioned; Ostrove et al., Virology 104 (1980) 502); E2A (Handa et al., J.Gen.Virol.29 (1975) 239; Strauss et al., J.Virol.17 (1976) 140; Myers et al., J.Virol.35 (1980) 665; Jay et al., Proc.Natl.Acad.Sci.USA 78 (1981) 2927; Myers et al., J.Biol.Chem.256 (1981) 567); E2B (Carter, Adeno-Associated Virus Helper Functions, in I CRC Handbook of Parvoviruses (P. Tijssen ed., 1990); E3 (Carter et al. (1983), cited above); and E4 (Carter et al. (1983), cited above; Carter (1995)).

[0428] Studies of helper proteins provided by adenoviruses with mutations in E1B have reported that the E1B 55kDa protein is required for AAV particle production, while the E1B 19kDa protein is not. Furthermore, International Publication No. 97 / 17458 and Matshushita et al. (Gene Therapy 5(1998) 938-945) described helper functional plasmids encoding various adenovirus genes. Examples of helper plasmids include the adenovirus VA RNA coding region, the adenovirus E4 ORF6 coding region, the adenovirus E2A 72kDa coding region, the adenovirus E1A coding region, and the adenovirus E1B region lacking the intact E1B 55kDa coding region (see, for example, International Publication No. 01 / 83797).

[0429] Accordingly, this specification provides a method for producing recombinant AAV vectors or AAV particles, comprising a recombinant AAV vector containing a nucleic acid that encodes a protein or is transcribed into a desired transcript, using a DNA element or nucleic acid or DNA according to the present invention.

[0430] One aspect of the present invention is a method for producing a recombinant AAV vector comprising a nucleic acid encoding a protein or a nucleic acid to be transcribed into a transcript of interest, or AAV particles comprising the recombinant AAV vector, (i) A step of providing one or more plasmids comprising nucleic acids encoding an AAV packaging protein and / or a helper protein, wherein at least one of the plasmids comprises a DNA element or molecule according to the present invention; (ii) A step of providing a plasmid comprising nucleic acid that encodes a protein of interest or is transcribed into a transcript of interest; (iii) The step of bringing one or more mammalian or insect cells into contact with the provided plasmid; (iv) A step of further adding a transfection reagent and optionally incubating the plasmid / transfection reagent / cell mixture; or a step of introducing nucleic acid into cells by physical means such as electric current; (v) A step of culturing transfected cells and inducing RMCI at a certain point in time / cultivation period during culture; (vi) A step of recovering cultured cells and / or culture medium from the cultured cells to produce a cell and / or culture medium recovery product; and (vii) A method comprising the step of isolating and / or purifying recombinant AAV vectors or AAV particles from cells and / or culture medium recoveries to produce recombinant AAV vectors or AAV particles containing nucleic acids that encode a protein of interest or are transcribed into a transcript of interest.

[0431] One aspect of the present invention is a method for producing a recombinant AAV vector comprising a nucleic acid encoding a protein or a nucleic acid to be transcribed into a transcript of interest, or AAV particles comprising the recombinant AAV vector, (i) A step of providing one or more plasmids comprising nucleic acids encoding an AAV packaging protein and / or a helper protein, wherein at least one of the plasmids comprises a DNA element or molecule according to the present invention; (ii) A step of providing a plasmid comprising nucleic acid that encodes a protein of interest or is transcribed into a transcript of interest; (iii) The step of bringing one or more mammalian or insect cells into contact with the plasmid provided in (i); (iv) A step of further adding a transfection reagent and optionally incubating the plasmid / transfection reagent / cell mixture; or a step of introducing nucleic acid into cells by physical means such as electric current; (v) A step to select stably transfected cells; (vi) The step of contacting the selected cells from (v) with the provided plasmid from (ii); (vii) A step of further adding a transfection reagent and optionally incubating the plasmid / transfection reagent / cell mixture; or a step of introducing nucleic acids into cells by physical means such as electric current; (viii) A step of culturing transfected cells of (viii) and inducing RMCI at a certain point in time / culturing time during culture; (ix) A step of recovering cultured cells and / or culture medium from the cultured cells to produce a cell and / or culture medium recovery product; and (x) A method comprising the step of isolating and / or purifying recombinant AAV vectors or AAV particles from cells and / or culture medium recoveries to produce recombinant AAV vectors or AAV particles containing nucleic acids that encode a protein of interest or are transcribed into a transcript of interest.

[0432] One aspect of the present invention is a method for producing a recombinant AAV vector comprising a nucleic acid encoding a protein or a nucleic acid to be transcribed into a transcript of interest, or AAV particles comprising the recombinant AAV vector, (i) A step of providing mammalian or insect cells comprising nucleic acids encoding an AAV packaging protein and / or a nucleic acid encoding a helper protein, wherein at least one of the nucleic acids comprises a DNA element or molecule according to the present invention; (ii) A step of providing a plasmid comprising nucleic acid that encodes a protein of interest or is transcribed into a transcript of interest; (iii) The step of bringing the cells from (i) into contact with the provided plasmid from (ii); (iv) A step of further adding a transfection reagent and optionally incubating the plasmid / transfection reagent / cell mixture; or a step of introducing nucleic acid into cells by physical means such as electric current; (v) A step to select stably transfected cells; (vi) A step of culturing cells that have been stably transfected according to (v), and inducing RMCI at a certain point in time / cultivation period during culture; (vii) A step of recovering cultured cells and / or culture medium from the cultured cells to produce a cell and / or culture medium recovery product; and (viii) A method comprising the step of isolating and / or purifying recombinant AAV vectors or AAV particles from cells and / or culture medium recoveries to produce recombinant AAV vectors or AAV particles containing nucleic acids that encode a protein of interest or are transcribed into a transcript of interest.

[0433] The introduction of nucleic acids containing the DNA element or DNA molecule of the present invention into cells can be carried out by multiple methods.

[0434] A variety of methods for DNA transfer into mammalian cells have been reported in the art. All of these are useful in the methods according to the present invention. In all aspects and in specific embodiments of the embodiments, electroporation, nucleofection, or microinjection is used for nucleic acid transfer / transfection. In all aspects and in specific embodiments of the embodiments, inorganic substances (e.g., calcium phosphate / DNA coprecipitation), cationic polymers (e.g., polyethyleneimine, DEAE-dextran), or cationic lipids (lipofection) are used for nucleic acid transfer / transfection. Calcium phosphate and polyethyleneimine are the most commonly used reagents for transfection for nucleic acid transfer on a larger scale (see, for example, Baldi et al., Biotechnol. Lett. 29 (2007) 677-684), with polyethyleneimine being preferred.

[0435] In all aspects and in specific embodiments of the embodiments, nucleic acids comprising DNA elements or DNA molecules according to the present invention are provided in a composition in combination with polyethyleneimine (PEI) and optionally in combination with cells. In specific embodiments, the composition comprises a plasmid / PEI mixture having a plurality of components: (a) one or more plasmids comprising nucleic acids encoding an AAV packaging protein and / or a helper protein, at least one of which comprises a DNA element or molecule according to the present invention; (b) a plasmid comprising nucleic acids encoding a protein or to be transcribed into a transcript of interest; and (c) a polyethyleneimine (PEI) solution. In specific embodiments, the plasmids are in a molar ratio range of about 1:0.01 to about 1:100 or in a molar ratio range of about 100:1 to about 1:0.01, and the mixture of components (a), (b), and (c) is optionally incubated for a period of about 10 seconds to about 4 hours.

[0436] In all aspects and in certain embodiments of the embodiment, the composition further comprises cells. In certain embodiments, the cells are in contact with a plasmid / PEI mixture of components (a), (b), and / or (c).

[0437] In all aspects and in specific embodiments of the embodiments, the composition further comprises free PEI, optionally in combination with cells. In specific embodiments, the cells are in contact with the free PEI.

[0438] In all aspects and in certain embodiments of the embodiments, the cells are in contact with a mixture of components (a), (b), and / or (c) for at least about 4 hours, or about 4 hours to about 140 hours, or about 4 hours to about 96 hours. In one preferred embodiment, the cells are in contact with a mixture of components (a), (b), and / or (c), and optionally free PEI, for at least about 4 hours.

[0439] In addition to nucleic acids comprising DNA elements or DNA molecules according to the present invention, the composition may further comprise plasmids. Such plasmids and cells may be in contact with free PEI. In certain embodiments, the plasmids and / or cells are in contact with free PEI for at least about 4 hours, or about 4 hours to about 140 hours, or about 4 hours to about 96 hours.

[0440] The present invention also provides a method for producing transfected cells using nucleic acids comprising the DNA element or DNA molecule of the present invention. This method comprises the steps of: providing a nucleic acid comprising the DNA element or DNA molecule of the present invention and optionally one or more further plasmids; providing a solution comprising polyethyleneimine (PEI); and mixing the nucleic acid and optionally the plasmid with the PEI solution to produce a nucleic acid / plasmid / PEI mixture. In certain embodiments, such a mixture is incubated for a period ranging from about 10 seconds to about 4 hours. In such a method, cells are then brought into contact with the nucleic acid / plasmid / PEI mixture to produce a nucleic acid / plasmid / PEI cell culture. Free PEI is then added to the produced nucleic acid / plasmid / PEI cell culture to produce a free PEI / nucleic acid / plasmid / PEI cell culture. The produced free PEI / nucleic acid / plasmid / PEI cell culture is then incubated for at least about 4 hours to produce transfected cells. In certain embodiments, the plasmid comprises a nucleic acid that encodes a protein or is transcribed into a transcript of interest.

[0441] A method for producing transfected cells that produce recombinant AAV vectors or AAV particles, comprising one or more plasmids comprising nucleic acids encoding an AAV packaging protein and / or a helper protein, wherein at least one of the plasmids comprises a DNA element or molecule according to the present invention; providing plasmids comprising nucleic acids that encode a protein or are transcribed into a transcript of interest; providing a solution comprising polyethyleneimine (PEI); and mixing the aforementioned plasmids with the PEI solution, wherein the plasmids are in a molar ratio range of about 1:0.01 to about 1:100, or about 100:1 to about 1:0.0 A method is further provided that comprises generating a plasmid / PEI mixture in a molar ratio range of 1 (and optionally incubating the plasmid / PEI mixture for a period ranging from about 10 seconds to about 4 hours); contacting cells with the plasmid / PEI mixture to produce a plasmid / PEI cell culture; adding free PEI to the produced plasmid / PEI cell culture to produce a free PEI / plasmid / PEI cell culture; and incubating the free PEI / plasmid / PEI cell culture for at least about 4 hours to thereby produce transfected cells that produce recombinant AAV vectors or particles containing nucleic acids that encode a protein or are transcribed into a transcript of interest.

[0442] A method for producing recombinant AAV vectors or AAV particles comprising nucleic acids encoding a protein or being transcribed into a transcript of interest, comprising providing one or more plasmids comprising nucleic acids encoding an AAV packaging protein and / or a helper protein, wherein at least one of the plasmids comprises a DNA element or molecule according to the present invention; providing plasmids comprising nucleic acids encoding a protein of interest or being transcribed into a transcript of interest; providing a solution comprising polyethyleneimine (PEI); mixing the aforementioned plasmids with the PEI solution to produce a plasmid / PEI mixture in which the plasmids are in a molar ratio range of about 1:0.01 to about 1:100 or in a molar ratio range of about 100:1 to about 1:0.01 (and optionally incubating the plasmid / PEI mixture for a period of about 10 seconds to about 4 hours). A method is further provided comprising: contacting cells with a plasmid / PEI mixture produced as described to produce a plasmid / PEI cell culture; adding free PEI to the plasmid / PEI cell culture produced as described to produce a free PEI / plasmid / PEI cell culture; incubating the plasmid / PEI cell culture or the produced free PEI / plasmid / PEI cell culture for at least about 4 hours to produce transfected cells; recovering the produced transfected cells and / or culture medium from the produced transfected cells to produce a cell and / or culture medium recovery; and isolating and / or purifying recombinant AAV vectors or particles from the produced cell and / or culture medium recovery to thereby produce recombinant AAV vectors or particles containing nucleic acids that encode a protein or are transcribed into a transcript of interest.

[0443] A method for producing recombinant AAV vectors or AAV particles using DNA elements according to the present invention may include one or more further steps or features. Exemplary steps or features include, but are not limited to, the step of recovering the cultured cells produced and / or the culture medium from the cultured cells produced to produce cells and / or culture medium recoveries. Further exemplary steps or features, but are not limited to, the step of isolating and / or purifying the recombinant AAV vector or AAV particles from the cells and / or culture medium recoveries to produce recombinant AAV vectors or AAV particles containing nucleic acids that encode proteins or are transcribed into a transcript of interest.

[0444] In all aspects and in specific embodiments of the embodiments, PEI is added to the plasmid and / or cells at various points in time. In specific embodiments, free PEI is added to the cells before, simultaneously with, or after contacting the plasmid / PEI mixture with the cells.

[0445] In all aspects and in specific embodiments of the embodiments, the cells have a specific density and / or cell growth phase and / or viability when in contact with the plasmid / PEI mixture and / or free PEI. In one preferred embodiment, the cells have a density in the range of about 1 × 10⁵ cells / mL to about 1 × 10⁸ cells / mL when in contact with the plasmid / PEI mixture and / or free PEI. In specific embodiments, the viability of the cells when in contact with the plasmid / PEI mixture or free PEI is about 60% or greater than 60%, or the cells are in the logarithmic growth phase when in contact with the plasmid / PEI mixture, or the viability of the cells when in contact with the plasmid / PEI mixture or free PEI is about 90% or greater than 90%, or the cells are in the logarithmic growth phase when in contact with the plasmid / PEI mixture or free PEI.

[0446] In all aspects and in specific embodiments of the embodiments, the encoded AAV packaging protein includes AAV rep and / or AAV cap proteins. In all aspects and in specific embodiments of the embodiments, such AAV packaging protein includes AAV rep and / or AAV cap proteins of any AAV serotype.

[0447] The encoded helper proteins include, in all aspects and in specific embodiments of the embodiments, adenovirus E2 and / or E4, VARNA proteins, and / or non-AAV helper proteins.

[0448] In all aspects and in specific embodiments, nucleic acids (plasmids) are used in specific amounts or ratios. In specific embodiments, the total amount of plasmids containing nucleic acids encoding a protein or transcribed into a transcript of interest, and one or more plasmids containing nucleic acids encoding an AAV packaging protein and / or a helper protein, wherein at least one of them contains the DNA element or molecule according to the present invention, is in the range of about 0.1 μg to about 15 μg per cell mL. In specific embodiments, the molar ratio of plasmids containing nucleic acids encoding a protein or transcribed into a transcript of interest, and one or more plasmids containing nucleic acids encoding an AAV packaging protein and / or a helper protein, wherein at least one of them contains the DNA element or molecule according to the present invention, is in the range of about 1:5 to about 1:1, or in the range of about 1:1 to about 5:1.

[0449] Plasmids can contain nucleic acids on different or the same plasmid. In all aspects and in certain embodiments of the embodiments, the first plasmid contains nucleic acids encoding an AAV packaging protein, and the second plasmid contains nucleic acids encoding a helper protein. At least one of these nucleic acids contains a DNA element or molecule according to the present invention.

[0450] In all aspects and in specific embodiments of the embodiments, the molar ratio of a plasmid containing nucleic acid encoding a protein or to be transcribed into a transcript of interest to a first plasmid containing nucleic acid encoding an AAV packaging protein and a second plasmid containing nucleic acid encoding a helper protein is in the range of approximately 1 to 5:1:1, or 1:1 to 5:1, or 1:1:1 to 5 in simultaneous transfection.

[0451] In all aspects and in specific embodiments of the embodiments, the cells are eukaryotic cells. In specific embodiments, the eukaryotic cells are mammalian cells. In one preferred embodiment, the cells are HEK293 cells or CHO cells.

[0452] Culture can be carried out using conditions commonly used for eukaryotic cell culture, such as approximately 37°C, 95% humidity, and 8% CO2 by volume. Culture can be carried out in serum-containing medium or serum-free medium, in adherent culture or suspension culture. Suspension culture can be carried out in any fermentation vessel, such as a stirred tank reactor, wave reactor, shaker or spinner vessel, or so-called roller bottle. Transfection can be carried out in high-throughput and screening formats, for example, in 96 or 384-well formats.

[0453] The method according to the present invention comprises AAV particles of any serotype or variant thereof. In all aspects and in specific embodiments of the embodiments, the recombinant AAV particles comprise any of AAV serotypes 1-12, AAV VP1, VP2 and / or VP3 capsid proteins, or modified or variant AAV VP1, VP2 and / or VP3 capsid proteins, or wild-type AAV VP1, VP2 and / or VP3 capsid proteins. In all aspects and in specific embodiments of the embodiments, the AAV particles comprise an AAV serotype or an AAV pseudotype, the AAV pseudotype comprises an AAV capsid serotype different from the ITR serotype.

[0454] Methods according to the present invention that provide or include AAV vectors or particles may also include other elements. Examples of such elements include, but are not limited to, introns, expression regulatory elements, one or more adeno-associated virus (AAV) reverse-end repeat sequences (ITRs) and / or filler / stuffer polynucleotide sequences. Such elements may be present in or adjacent to a nucleic acid encoding a protein or transcribed to a transcript of interest, or expression regulatory elements may be operably ligated to a nucleic acid encoding a protein or transcribed to a transcript of interest, or AAV ITRs may be adjacent to the 5' or 3' end of a nucleic acid encoding a protein or transcribed to a transcript of interest, or filler polynucleotide sequences may be adjacent to the 5' or 3' end of a nucleic acid encoding a protein or transcribed to a transcript of interest.

[0455] Expression regulatory elements include constitutive or modulotable regulatory elements such as tissue-specific expression regulatory elements or promoters (e.g., those providing expression in the liver).

[0456] ITR may be any of the following: AAV2 or AAV6 or AAV8 or AAV9 serotype, or a combination thereof. AAV particles may contain any VP1, VP2 and / or VP3 capsid protein having 75% or more sequence identity to any of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV10, AAV11, AAV-2i8 or AAV rh74 VP1, VP2 and / or VP3 capsid proteins, or may contain modified or variant VP1, VP2 and / or VP3 capsid proteins selected from any of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV10, AAV11, AAV-2i8 and AAV rh74 AAV serotypes.

[0457] After the production of recombinant virus (e.g., AAV) particles as described herein, the virus (e.g., rAAV) particles can, if desired, be purified and / or isolated from host cells using a variety of conventional methods. Such methods include column chromatography and CsCl gradients. For example, multiple column purification steps can be used, such as purification by anion exchange columns, affinity columns and / or cation exchange columns (see, e.g., WO 02 / 12455 and US 2003 / 0207439). Alternatively or additionally, a CsCl gradient step can be used (see, e.g., US 2012 / 0135515 and US 2013 / 0072548). Furthermore, if infectious viruses are used for packaging and / or expression of helper proteins, residual viruses can be inactivated using a variety of methods. For example, adenoviruses can be inactivated by heating at a temperature of about 60°C for, for example, 20 minutes or more. AAV is heat-stable, but helper adenoviruses are heat-unstable; therefore, this treatment effectively inactivates helper viruses.

[0458] Viral vectors, such as parvovirus particles containing AAV serotypes and their variants, provide means of delivering nucleic acids to cells ex vivo, in vitro, and in vivo, encoding proteins so that cells express the encoded proteins. AAV is a useful virus as a gene therapy vector because it can penetrate cells and introduce nucleic acids / genetic material so that the nucleic acids / genetic material can be stably maintained within the cell. Furthermore, these viruses can introduce nucleic acids / genetic material to specific sites, for example. Since AAV is not associated with pathogenic disease in humans, AAV vectors can deliver heterologous polynucleotide sequences (e.g., therapeutic proteins and drugs) to human patients without causing substantial AAV pathogenesis or disease.

[0459] The viral vectors that may be used include, but are not limited to, adeno-associated virus (AAV) particles of multiple serotypes (e.g., AAV-1 to AAV-12) and hybrid / chimeric AAV particles.

[0460] AAV particles can be advantageously used as vehicles for effective gene delivery. Such particles possess several desirable characteristics for such applications, including targeting of dividing and non-dividing cells. Early clinical experience with these vectors has shown no persistent toxicity and minimal or undetectable immune responses. AAV is known to infect a wide variety of cell types in vivo and in vitro via receptor-mediated endocytosis or transcytosis. These vector systems have been tested in humans targeting retinal epithelium, liver, skeletal muscle, airways, brain, joints, and hematopoietic stem cells.

[0461] Recombinant AAV particles typically do not contain viral genes associated with the pathogenesis. Such vectors typically have one or more wild-type AAV genes that are entirely or partially deleted, such as the rep and / or cap genes, but retain at least one functional flanking ITR sequence as needed for the rescue, replication, and packaging of the recombinant vector into AAV particles. For example, only essential parts of the vector, e.g., the ITR element and LTR element, respectively, are included. Thus, the AAV vector genome will contain sequences necessary for cis-replication and packaging (e.g., functional ITR sequences).

[0462] Recombinant AAV vectors, as well as methods and uses thereof, may include any viral strain or serotype. As a non-limiting example, a recombinant AAV vector may be based on any AAV genome, e.g., AAV-1, -2, -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, 2i8, or AAV rh74. Such vectors may be based on the same strain or serotype (or subgroup or variant), or they may be different from each other. As a non-limiting example, a recombinant AAV vector based on a single serotype genome may be identical to one or more of the capsid proteins packaging the vector. Furthermore, a recombinant AAV vector genome may be based on an AAV (e.g., AAV2) serotype genome different from one or more of the AAV capsid proteins packaging the vector. For example, an AAV vector genome may be based on AAV2, but at least one of the three capsid proteins may be, for example, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, or AAV rh74 or a variant thereof. AAV variants include variants and chimeras of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, and AAV rh74 capsids.

[0463] In all aspects and in specific embodiments of the embodiments, adeno-associated virus (AAV) vectors include, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, and AAV rh74, as well as their variants (e.g., capsid variants, e.g., amino acid insertions, additions, substitutions, and deletions), as described in International Publication No. 2013 / 158879, International Publication No. 2015 / 013313, and U.S. Patent Application Publication No. 2013 / 0059732 (disclosing LK01, LK02, LK03, etc.).

[0464] AAV and AAV variants (e.g., capsid variants) and serotypes (e.g., VP1, VP2, and / or VP3 sequences) may or may not be distinguishable from other AAV serotypes, including AAV1-AAV12 (e.g., different from any of the VP1, VP2, and / or VP3 sequences of AAV1-AAV12 serotypes).

[0465] In all aspects and in specific embodiments of the embodiments, the AAV particles associated with the reference serotype have a polynucleotide, polypeptide, or a subsequence thereof that is identical to or consists of at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%) of one or more AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV12, AAV-2i8, or AAV rh74 (e.g., an ITR sequence, or a VP1 sequence, a VP2 sequence, and / or a VP3 sequence, etc.) of the sequence.

[0466] The compositions, methods, and uses of the present invention include AAV sequences (polypeptides and nucleotides), as well as partial sequences that exhibit less than 100% sequence identity to reference AAV serotypes such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, or AAV rh74, but are distinct from and not identical to known AAV genes or proteins such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, or AAV rh74 genes or proteins. In all aspects and in specific embodiments of the embodiments, the AAV polypeptide or a subsequence thereof contains or comprises a sequence that is at least 75% identical to any reference AAV sequence or a subsequence thereof, e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, or AAV rh74 (e.g., VP1, VP2 and / or VP3 capsid or ITR), up to 100% identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc. In certain embodiments, the AAV variant has 1, 2, 3, 4, 5, 5-10, 10-15, 15-20 or more amino acid substitutions.

[0467] Recombinant AAV particles, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-2i8, or AAV rh74, as well as variants, related, hybrid, and chimeric sequences, can be constructed using recombinant techniques known to those skilled in the art to include one or more nucleic acid sequences (transgenes) adjacent to one or more functional AAV ITR sequences.

[0468] Recombinant particles (e.g., rAAV particles) can be incorporated into pharmaceutical compositions. Such pharmaceutical compositions are particularly useful for administration and delivery to subjects in vivo or ex vivo. In certain embodiments, the pharmaceutical composition contains pharmaceutically acceptable carriers or excipients. Such excipients include any pharmaceuticals that do not induce an adverse immune response in the individual receiving the composition and can be administered without excessive toxicity.

[0469] Protocols for the production of adenovirus vectors are described in U.S. Patent Nos. 5,998,205; 6,228,646; 6,093,699; 6,100,242; International Publication Nos. 94 / 17810 and International Publication Nos. 94 / 23744, which are incorporated herein by reference in their entirety.

[0470] Despite their pathogenicity to humans, the objective of rAAV vector production and purification systems is to implement strategies to minimize / control the generation of production-related impurities, such as wild-type / pseudowild-type AAV species (wtAAV) and AAV-encapsulated residual DNA impurities, as well as proteins, nucleic acids, and vector-related impurities.

[0471] Given that rAAV particles represent only a small fraction of biomass, they need to be purified to a level of purity suitable for use as a clinical human gene therapy product (see, for example, reports from Smith PH, et al., Mo. Therapy 7(2003)8348; Chadeuf G., et al, Mo. Therapy 12(2005)744; and CHMP gene therapy expert group meeting, European Medicines Agency EMEA / CHMP 2005,183989 / 2004).

[0472] As a first step, typically, cultured cells producing rAAV particles are recovered, optionally combined with the recovered cell culture supernatant (medium) in which the rAAV particle-producing cells (suspension or adherent) were cultured. The recovered cells and optionally the cell culture supernatant can be used as is or concentrated as needed. Furthermore, if infection is used to express helper function, residual helper viruses can be inactivated. For example, adenoviruses can be inactivated by heating them to a temperature of approximately 60°C for, for example, 20 minutes or more, which inactivates only the helper viruses because AAV is heat-stable while helper adenoviruses are heat-unstable.

[0473] The supernatant of the cells and / or recovered material is dissolved by chemical or physical means, such as detergent, microfluidization, and / or homogenization, to disrupt the cells and release rAAV particles. During or after cell lysis, a nuclease, such as benzonase, is added to degrade the contaminating DNA. Typically, the resulting lysate is clarified to remove cell debris, for example, by filtration or centrifugation, to give a clarified cell lysate. In specific examples, the lysate is filtered through a micron-diameter pore filter (e.g., a filter with a pore size of 0.1–10.0 μm, e.g., a filter with a pore size of 0.45 μm and / or 0.2 μm) to produce a clarified lysate.

[0474] The lysate (optionally clarified) contains AAV particles (including the rAAV vector and empty capsid) and production / process-related impurities, such as soluble cellular components from host cells, which may include, in particular, cellular proteins, lipids and / or nucleic acids, as well as components of the cell culture medium. The optionally clarified lysate is then subjected to a purification step to purify the AAV particles (including the rAAV vector) from impurities using chromatography. The clarified lysate may be diluted or concentrated with a suitable buffer before the first chromatography step.

[0475] After cell lysis, optional clarification, and optional dilution or concentration, rAAV particles can be purified using a series of subsequent chromatography steps.

[0476] The first chromatography step may be cation exchange chromatography or anion exchange chromatography. If the first chromatography step is cation exchange chromatography, the second chromatography step may be anion exchange chromatography or size exclusion chromatography (SEC). Thus, in all aspects and in specific embodiments of the embodiments, rAAV particle purification is performed by cation exchange chromatography, followed by purification by anion exchange chromatography.

[0477] Alternatively, if the first chromatography step is cation exchange chromatography, the second chromatography step may be size exclusion chromatography (SEC). Thus, in all aspects and in specific embodiments of the embodiments, rAAV particle purification is performed by cation exchange chromatography, followed by purification by size exclusion chromatography (SEC).

[0478] Alternatively, the first chromatography step may be affinity chromatography. If the first chromatography step is affinity chromatography, the second chromatography step may be anion exchange chromatography. Thus, in all aspects and in specific embodiments of the embodiments, rAAV particle purification is performed by affinity chromatography, followed by purification by anion exchange chromatography.

[0479] Optionally, a third chromatography step can be added to the aforementioned chromatography process. Typically, the optional third chromatography step follows cation exchange, anion exchange, size exclusion, or affinity chromatography.

[0480] Therefore, in all aspects and in specific embodiments of the embodiments, rAAV particle purification is performed by cation exchange chromatography, followed by purification by anion exchange chromatography, and then by size exclusion chromatography (SEC).

[0481] Furthermore, in all aspects and in certain embodiments of the embodiments, further rAAV particle purification is performed by cation exchange chromatography, followed by purification by size exclusion chromatography (SEC), and then by anion exchange chromatography.

[0482] In all aspects and further embodiments of the embodiments, rAAV particle purification is performed by affinity chromatography, followed by purification by anion exchange chromatography, and then by size exclusion chromatography (SEC).

[0483] In all aspects and further embodiments of the embodiments, rAAV particle purification is performed by affinity chromatography, followed by purification by size exclusion chromatography (SEC), and then by anion exchange chromatography.

[0484] Cation exchange chromatography functions to separate AAV particles from cellular and other components present in lysates and / or column eluents clarified from affinity chromatography or size exclusion chromatography. Examples of strong cation exchange resins that can bind to rAAV particles over a wide pH range include, but are not limited to, any sulfonic acid resins characterized by the presence of sulfonate functional groups, including aryl and alkyl-substituted sulfonates such as sulfopropyl or sulfoethyl resins. Typical matrices include, but are not limited to, POROS HS, POROS HS 50, POROS XS, POROS SP, and POROS S (strong cation exchangers available from Thermo Fisher Scientific, Inc., Waltham, MA, USA). Further examples include Capto S, Capto S ImpAct, and Capto S ImpRes (strong cation exchangers available from GE Healthcare, Marlborough, MA, USA), as well as the commercially available DOWEX®, AMBERLITE®, and AMBERLYST® resin families from Aldrich Chemical Company (Milliwaukee, WI, USA). Weak cation exchange resins include, but are not limited to, any carboxylic acid-based resins. Exemplary cation exchange resins include carboxymethyl (CM), phospho(phosphate-based), methyl sulfonate (S), and sulfopropyl (SP) resins.

[0485] Anion exchange chromatography functions to separate AAV particles from proteins, cellular components, and other components present in the lysate and / or column eluate clarified from affinity chromatography, cation exchange chromatography, or size exclusion chromatography. Anion exchange chromatography can also be used to reduce and control the amount of empty capsids in the eluate. For example, an anion exchange column bound to rAAV particles can be washed with a solution containing a moderate concentration of NaCl (e.g., about 100–125 mM, e.g., 110–115 mM), allowing some of the empty capsids to flow through without substantially eluting the rAAV particles. Subsequently, the rAAV particles bound to the anion exchange column can be eluted with a solution containing a higher concentration of NaCl (e.g., about 130–300 mM NaCl) to produce a column eluate with a reduced or depleted amount of empty capsids and a proportionally increased amount of rAAV vector-containing rAAV particles.

[0486] Examples of anion exchange resins include, but are not limited to, those based on polyamine resins and other resins. Examples of strong anion exchange resins include, but are not limited to, those based on quaternary nitrogen atoms, including quaternary ammonium salt resins such as trialkylbenzylammonium resins. Suitable exchange chromatography materials include, but are not limited to, MACRO PREP Q (strong anion exchanger available from BioRad, Hercules, CA, USA); UNOSPHERE Q (strong anion exchanger available from BioRad, Hercules, CA, USA); POROS 50HQ (strong anion exchanger available from Applied Biosystems, Foster City, CA, USA); POROS XQ (strong anion exchanger available from Applied Biosystems, Foster City, CA, USA); POROS SOD (weak anion exchanger available from Applied Biosystems, Foster City, CA, USA); POROS 50PI (weak anion exchanger available from Applied Biosystems, Foster City, CA, USA); Capto Q, Capto XQ, Capto Q ImpRes, and SOURCE 30Q (GE Examples include a strong anion exchanger available from Healthcare, Marlborough, MA, USA; DEAE Sepharose (a weak anion exchanger available from Amersham Biosciences, Piscataway, NJ, USA); and Q Sepharose (a strong anion exchanger available from Amersham Biosciences, Piscataway, NJ, USA). Further exemplary anion exchange resins include aminoethyl (AE), diethylaminoethyl (DEAE), diethylaminopropyl (DEPE), and quaternary aminoethyl (QAE).

[0487] The manufacturing process for purifying recombinant AAV particles intended as a product for treating human diseases should achieve the following objectives: 1) consistent particle purity, efficacy, and safety; 2) scalability of the manufacturing process; and 3) acceptable manufacturing costs.

[0488] An exemplary process for purifying recombinant AAV particles is described in International Publication No. 2019 / 006390.

[0489] The purification and production methods for recombinant adeno-associated virus particles (rAAV particles) outlined below can be scaled up to large volumes, for example, up to 5, 10, 10-20, 20-50, 50-100, 100-200 or more liters of suspension culture. The purification and production methods for recombinant adeno-associated virus particles are applicable to a wide variety of AAV serotypes / capsid variants.

[0490] In all aspects and in specific embodiments of the embodiments, the purification of rAAV particles includes the following steps: (a) A step of collecting the cell culture supernatant containing cells and / or rAAV particles to produce a recovered product; (b) Optionally, a step of concentrating the recovered material produced in step (a) to produce a concentrated recovered material; (c) A step of dissolving the recovered material produced in step (a) or the concentrated recovered material produced in step (b) to produce a dissolved product; (d) A step of processing the lysate produced in step (c) to reduce the amount of contaminating nucleic acids in the lysate, thereby producing a nucleic acid-reduced lysate; (e) Optionally, filter the nucleic acid-reduced lysate produced in step (d) to produce a clarified lysate, and optionally, dilute the clarified lysate to produce a diluted clarified lysate; (f) Subjecting the nucleic acid reduction lysate from step (d), the clarified lysate from step (e), or the diluted clarified lysate produced in step (e) to cation exchange column chromatography to produce a column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or other manufacturing / process-related impurities, and optionally diluting the column eluate to produce a diluted column eluate; (g) The column eluate or diluted column eluate generated in step (f) is subjected to anion exchange chromatography to produce a second column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or manufacturing / process-related impurities, and optionally the second column eluate is concentrated to produce a concentrated second column eluate; (h) The second column eluate or concentrated second column eluate generated in step (g) is subjected to size exclusion column chromatography (SEC) to generate a third column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or manufacturing / process-related impurities, and optionally the third column eluate is concentrated to generate a concentrated third column eluate; and (i) A step of filtering the third column eluate or concentrated third column eluate produced in step (h) to produce purified rAAV particles.

[0491] In certain embodiments, steps (a) to (f) are maintained and combined with the following steps. (g) The column eluate or concentrated column eluate generated in step (f) is subjected to size exclusion column chromatography (SEC) to produce a second column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or other manufacturing / process-related impurities, and optionally diluting the second column eluate to produce a concentrated second column eluate; (h) The second column eluate or diluted second column eluate produced in step (g) is subjected to anion exchange chromatography to produce a third column eluate containing rAAV particles, thereby separating the rAAV particles from the production / process-related impurities of the protein impurities, and optionally diluting the third column eluate to produce a diluted third column eluate; and (i) A step of filtering the third column eluate or concentrated third column eluate produced in step (h) to produce purified rAAV particles.

[0492] In certain embodiments, steps (a) to (g) are maintained and combined with the following steps. (h) A step of filtering the second column eluate or concentrated second column eluate produced in step (g) to produce purified rAAV particles.

[0493] In this embodiment, steps (a) to (e) are maintained and combined with the following steps. (f) The nucleic acid reduction lysate from step (d), or the clarified lysate or diluted clarified lysate produced in step (e), is subjected to AAV affinity chromatography to produce a column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or other manufacturing / process-related impurities, and optionally concentrating the column eluate to produce a concentrated column eluate; (g) The column eluate or concentrated column eluate generated in step (f) is subjected to size exclusion column chromatography (SEC) to produce a second column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or other manufacturing / process-related impurities, and optionally diluting the second column eluate to produce a diluted second column eluate; (h) optionally subject the second column eluate or diluted second column eluate produced in step (g) to anion exchange chromatography to produce a third column eluate containing rAAV particles, thereby separating the rAAV particles from protein impurities or other manufacturing / process-related impurities, and optionally diluting the third column eluate to produce a diluted third column eluate; and (i) A step of filtering the second column eluate or diluted second column eluate produced in step (g), or filtering the third column eluate or concentrated third column eluate produced in step (h), thereby producing purified rAAV particles.

[0494] In all aspects and in certain embodiments of the embodiments, the concentration in step (b) and / or step (f) and / or step (g) and / or step (h) is by ultrafiltration / dialysis filtration, for example, tangential flow filtration (TFF).

[0495] In all aspects and in certain embodiments of the embodiments, the concentration in step (b) reduces the volume of the recovered cells and cell culture supernatant by about 2 to 20 times.

[0496] In all aspects and in specific embodiments of the embodiments, the concentration in step (f) and / or step (g) and / or step (h) reduces the volume of the column eluate by approximately 5 to 20 times.

[0497] In all aspects and in specific embodiments of the embodiments, the dissolution of the recovered material produced in step (a) or the concentrated recovered material produced in step (b) is by physical or chemical means. Non-limiting examples of physical means include microfluidization and homogenization. Non-limiting examples of chemical means include detergents. Detergents include nonionic detergents and ionic detergents. Non-limiting examples of nonionic surfactants include Triton X-100. Non-limiting examples of detergent concentrations are about 0.1–1.0% (v / v) or (w / v) (including both ends).

[0498] In all aspects and in specific embodiments of the embodiments, step (d) includes treatment with a nuclease to reduce the contaminating nucleic acid. Non-limiting examples of nucleases include benzonase.

[0499] In all aspects and in specific embodiments of the embodiments, the filtration of the clarified or diluted clarified solution in step (e) is performed by a filter. Non-limiting examples of filters include those having a pore size of approximately 0.1 microns to 10.0 microns (including both ends).

[0500] In all aspects and in specific embodiments of the embodiments, the dilution of the clarified solution in step (e) is with buffered phosphoric acid, acetic acid, or an aqueous Tris solution. Non-limiting examples of solution pH are about pH 4.0 to pH 7.4 (inclusive). Non-limiting examples of Tris solution pH are greater than pH 7.5, for example, about pH 8.0 to pH 9.0 (inclusive).

[0501] In all aspects and in specific embodiments of the embodiments, the dilution of the column eluate in step (f) or the second column eluate in step (g) is with ...

Claims

1. A double-stranded DNA element comprising a coding strand and a template strand, The aforementioned code chain, in the direction from 5' to 3', is arranged in the following order: - The first promoter, - A first recombinase recognition sequence containing a mutation in either a left-reverse repeat or a right-reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - A first polyadenylation signal sequence and / or transcription termination element inverted relative to the coding strand, - A first open reading frame, which is inverted with respect to the code strand and operably coupled to the first polyadenylation signal sequence and / or transcription termination element, - A second recombinase recognition sequence, each containing mutations in other reverse repeats relative to the first recombinase recognition sequence, and oriented in the opposite direction to the first recombinase recognition sequence, - The second open reading frame, and - A second polyadenylation signal sequence and / or transcription termination element operably connected to the second open reading frame. It is characterized by including, Incubation of the double-stranded DNA element or molecule with a recombinase functional to the first recombinase recognition sequence and the second recombinase recognition sequence, - Sequence inversion occurs between the first recombinase recognition sequence and the second recombinase recognition sequence, thereafter the first promoter is operably connected to the first open reading frame, and the second promoter is operably connected to the second open reading frame, and - This results in the generation of a third recombinase recognition sequence after recombination, where the third recombinase recognition sequence is (a) When the first recombinase recognition sequence contains a mutation in a left reverse repeat and the second recombinase recognition sequence contains a mutation in a right reverse repeat, the first promoter and the first gene are located, (b) When the first recombinase recognition sequence contains a mutation in a right reverse repeat and the second recombinase recognition sequence contains a mutation in a left reverse repeat, the second promoter and the second gene are located there, The third recombinase recognition sequence contains mutations in both reverse repeats, thereby rendering it non-functional. Double-stranded DNA element.

2. A double-stranded DNA element comprising a coding strand and a template strand, (a) The code chain is arranged in the following order from 5' to 3': - The first promoter, - A first recombinase recognition sequence containing a mutation in either a left-reverse repeat or a right-reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - A first polyadenylation signal sequence and / or transcription termination element inverted relative to the coding strand, - A code array, It codes for either the Rep78 protein only or the Rep68 protein only, but not both. (i) optionally, the internal P40 promoter is inactivated, and / or (ii) The start codon of Rep52 / 40 has been mutated to a non-start codon, and / or (iii) The splice donor site and acceptor site have been removed. It is inverted with respect to the aforementioned code chain, and The first polyadenylation signal sequence and / or transcription termination element is operably connected, Code array, - A second recombinase recognition sequence having mutations in other reverse repeats relative to the first recombinase recognition sequence, and being oriented in the opposite direction to the first recombinase recognition sequence, and - Rep52 / Rep40 open reading frame and Cap open reading frame, comprising a polyadenylation signal operably connected to the said open reading frame. including, or (b) The code chain is arranged in the following order from 5' to 3': - The first promoter, - A first recombinase recognition sequence containing a mutation in either a left-reverse repeat or a right-reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - A first polyadenylation signal sequence and / or transcription termination element inverted relative to the coding strand, - A code array, It codes for either the Rep78 protein only or the Rep68 protein only, but not both. (i) optionally, the internal promoter is inactivated, and / or (ii) The start codon of the Rep52 / 40 open reading frame has been mutated to a non-start codon, and (iii) The splice donor site and acceptor site have been removed, It is inverted with respect to the aforementioned code chain, and The first polyadenylation signal sequence and / or transcription termination element is operably connected, Code array, - A second recombinase recognition sequence having mutations in other reverse repeats relative to the first recombinase recognition sequence, and being oriented in the opposite direction to the first recombinase recognition sequence, and - The Rep52 open reading frame, or the Rep40 open reading frame, wherein the splice donor site and acceptor site have been optionally removed, and the Rep40 open reading frame includes a polyadenylation signal operably connected to the open reading frame. Includes, Incubation of the double-stranded DNA element or molecule with a recombinase functional to the first recombinase recognition sequence and the second recombinase recognition sequence, - Sequence inversion occurs between the first recombinase recognition sequence and the second recombinase recognition sequence, thereafter the first promoter is operably connected to the first open reading frame, and the second promoter is operably connected to the second open reading frame, and - This results in the generation of a third recombinase recognition sequence after recombination, where the third recombinase recognition sequence is (a) When the first recombinase recognition sequence contains a mutation in a left reverse repeat and the second recombinase recognition sequence contains a mutation in a right reverse repeat, the first promoter and the first gene are located, (b) When the first recombinase recognition sequence contains a mutation in a right reverse repeat and the second recombinase recognition sequence contains a mutation in a left reverse repeat, the second promoter and the second gene are located there, The third recombinase recognition sequence contains mutations in both reverse repeats, thereby rendering it non-functional. Double-stranded DNA element.

3. The double-stranded DNA element according to claim 2, wherein the first promoter is a P5 promoter.

4. The double-stranded DNA element according to claim 2 or 3, wherein the second promoter is a P19 promoter.

5. The code chain has a 3' end to it - A third promoter, a cap open reading frame, and a polyadenylated signal sequence and / or terminator sequence, all of which are operably linked. Further including, A double-stranded DNA element according to any one of claims 2 to 4.

6. (a) E1A open reading frame and E1B open reading frame; and / or (b) E2A open reading frame and E4 or E6 open reading frame A double-stranded DNA molecule containing, (a) or / and (b) is characterized in that the first open reading frame and the second open reading frame are contained within a double-stranded DNA element including a coding strand and a template strand. The aforementioned code chain, in the direction from 5' to 3', is arranged in the following order: - The first promoter, - A first recombinase recognition sequence containing a mutation in either a left-reverse repeat or a right-reverse repeat, - A second promoter that is inverted with respect to the aforementioned code chain, - The first open reading frame (a) or (b) which is inverted with respect to the code chain, - A second recombinase recognition sequence, each containing mutations in other reverse repeats relative to the first recombinase recognition sequence, and being oriented in the opposite direction to the first recombinase recognition sequence, - The second open reading frame of (a) or (b) Includes, Incubation of the double-stranded DNA element or molecule with a recombinase functional to the first recombinase recognition sequence and the second recombinase recognition sequence, - Sequence inversion occurs between the first recombinase recognition sequence and the second recombinase recognition sequence, thereafter the first promoter is operably connected to the first open reading frame, and the second promoter is operably connected to the second open reading frame, and - This results in the generation of a third recombinase recognition sequence after recombination, where the third recombinase recognition sequence is (a) When the first recombinase recognition sequence contains a mutation in a left reverse repeat and the second recombinase recognition sequence contains a mutation in a right reverse repeat, the first promoter and the first gene are located, (b) When the first recombinase recognition sequence contains a mutation in a right reverse repeat and the second recombinase recognition sequence contains a mutation in a left reverse repeat, the second promoter and the second gene are located there, The third recombinase recognition sequence contains mutations in both reverse repeats, thereby rendering it non-functional. double stranded DNA molecule.

7. A double-stranded DNA molecule comprising two or more double-stranded DNA elements or molecules selected from claims 1 to 6.

8. - One or more double-stranded DNA elements as described in claim 1, or - At least one double-stranded DNA element according to any one of claims 2 to 5, or - A single double-stranded DNA element according to any one of claims 2 to 5 and a single double-stranded DNA molecule according to claim 6, or - At least one double-stranded DNA molecule as described in claim 6, or - One or more double-stranded DNA molecules as described in claim 7 Mammalian cells, including those mentioned above.

Images