PPO polypeptides resistant to PPO inhibitor herbicides and their use

Abstract

The present invention relates to the field of biotechnology, in particular to a PPO polypeptide having resistance to PPO-inhibiting herbicides and its use. The polypeptide contains the motif "LLLNYI", in which leucine L at position 3 is replaced with another amino acid, or tyrosine Y at position 5 is replaced with another amino acid. By using this in plants including commercial crops, the plant's resistance to PPO-inhibiting herbicides can be significantly improved according to herbicide resistance characteristics and herbicide selectivity, and the growth of weeds can be economically controlled.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to PPO polypeptides having resistance to PPO-inhibiting herbicides and their use.

Background Art

[0002] Weeds are one of the important factors affecting crop yields in agricultural production. Herbicides are the main technical means for weed control. The mode of action of herbicides has been classified by the Weed Science Society of America (weedscience.org) into 28 categories according to various target sites of herbicides in plants, and Group 14 (Group 14; HRAC GROUPE) is the protoporphyrinogen IX oxidase (PPO) inhibitor (http: / / www.weedscience.org / ).

[0003] Protoporphyrinogen IX oxidase (PPOX, PPX or PPO; EC 1.3.3.4) is the last common enzyme in the biosynthetic pathways of chlorophyll and heme. Protoporphyrinogen IX is converted to protoporphyrin IX by the catalytic action of PPO in the presence of oxygen molecules.

[0004] PPO is an important herbicide target site in plants, inhibiting plant protoporphyrinogen oxidase and causing intracellular accumulation of the substrate protoporphyrinogen that catalyzes the reaction. The accumulation of protoporphyrinogen in intracellular chloroplasts and mitochondria causes non-enzymatic oxidation of protoporphyrinogen by O2. Under light conditions, singlet oxygen is generated by non-enzymatic oxidation. Singlet oxygen causes lipid oxidation in the inner membrane system, and then causes oxidative damage to these inner membrane systems, thereby killing plant cells (Future Med Chem. 2014 Apr; 6(6): 597-599. doi:10.4155 / fmc.14.29).

[0005] The evolutionary relationships of PPO enzymes in the biological world have been studied by examining their sequence similarities, and PPO enzymes are classified into three categories: HemG, HemJ, and HemY. In most cases, a single species possesses only one of these categories. Of these, HemG is generally distributed in γ-proteobacteria, HemJ is distributed in α-proteobacteria and can be transferred to other proteobacteria and cyanobacteria, but HemY is the only PPO enzyme in eukaryotes (Genome Biol Evol. 2014 Aug;6(8):2141-55. doi: 10.1093 / gbe / evu170).

[0006] The PPO gene has been identified in specific organisms. For example, these genes that we have made public include the PPO1 gene (Genbank ID Y13465) and PPO2 gene (Genbank ID Y13466) of Nicotiana tabacum, the PPO gene (Genbank ID D83139) of Arabidopsis thaliana, the HemY gene (Genbank ID M97208) of Bacillus subtilis, the mouse PPO gene (Genbank ID D45185), the human PPO gene (Genbank ID D38537), the PPO gene (Genbank ID Z71381) of Saccharomyces cerevisiae, and the hemG gene (Genbank ID X68660) of Escherichia coli.

[0007] Generally, plants have at least two PPO genes, named PPO1 and PPO2, with PPO1 typically located in the chloroplasts of plants and PPO2 in the mitochondria of plant cells. However, the mRNA of the PPO2 gene in certain Amaranthaceae plants has different translation initiation sites (TIS), resulting in the production of PPO2 polypeptides of different lengths. For example, the PPO2 gene in spinach (Spinacia oleracea L) expresses two types of PPO2 proteins with molecular weights of 58 kD and 56 kD, respectively, and these two proteins differ in polypeptide length by 26 polypeptide units. Here, the longer one is located in the chloroplasts, and the shorter one is located in the mitochondria (J Biol Chem. 2001 Jun 8;276(23):20474-81. doi: 10.1074 / jbc.M101140200. Epub 2001 Mar 23).

[0008] When PPO activity is inhibited by certain compounds, the production of chlorophyll and heme is also inhibited. The substrate, protoporphyrinogen IX, is cleaved from the normal porphyrin biosynthesis pathway, rapidly separates from chloroplasts, and enters the cytoplasm. Protoporphyrinogen IX is oxidized to protoporphyrin IX, which accumulates on the cell membrane. The accumulated protoporphyrin IX becomes highly active singlet oxygen (X) upon the action of light and oxygen molecules. 1 It generates O2, causing cell membrane disruption and rapidly killing plant cells. Cases of weeds developing resistance to specific PPO inhibitor herbicides have been reported (Pest Manag Sci. 2014 Sep;70(9):1358-66. doi: 10.1002 / ps.3728. Epub 2014 Feb 24).

[0009] For example, in Amaranthus tuberculatus, a deletion of glycine at position 210 of the PPO2L gene (ΔG210) confers resistance to the herbicide lactofen (Proc Natl Acad Sci US A. 2006 Aug 15;103(33):12329-34. doi: 10.1073 / pnas.0603137103. Epub 2006 Aug 7).

[0010] In Amaranthus palmeri, a mutation in the PPO2 gene at position 98, changing arginine to glycine or methionine (R98G, R98M), confers resistance to the herbicide fomesaphen (Pest Manag Sci. 2017 Aug;73(8):1559-1563. doi: 10.1002 / ps.4581. Epub 2017 May 16).

[0011] In Amaranthus palmeri, resistance to fomesaphen is conferred by a mutation in the PPO2 gene at position 399, changing glycine to alanine (G399A) (Front Plant Sci. 2019 May 15;10:568. doi: 10.3389 / fpls.2019.00568. eCollection 2019).

[0012] In ragweed (Ambrosia artemisiifolia), a mutation from arginine to leucine at position 98 of the PPO2 gene (R98L) confers resistance to flumioxazine (Weed Science, 60(3):335-344 (2012)).

[0013] In goosegrass (Eleusine indica), a mutation from alanine to threonine at position 212 of the PPO1 gene (A212T) confers resistance to oxadiazone (Pest Manag Sci. 2020 May;76(5):1786-1794. doi: 10.1002 / ps.5703. Epub 2020 Jan 23). [Overview of the project]

[0014] The present invention relates to a PPO polypeptide or a bioactive fragment thereof that has resistance to PPO inhibitory herbicides.

[0015] The present invention also relates to isolated polynucleotides and corresponding plant genomes, vector constructs, or host cells.

[0016] In another embodiment, the present invention provides a method for producing plant cells or plants for acquiring or improving resistance to PPO inhibitory herbicides, and plants produced by the production method.

[0017] In another embodiment, the present invention provides a method for enabling plants to acquire or improve resistance to PPO inhibitory herbicides.

[0018] The present invention also provides a method for acquiring or improving resistance to PPO inhibitory herbicides in plant cells, plant tissues, plant parts, or plants.

[0019] The present invention further relates to the use of PPO polypeptides or their bioactive fragments or polynucleotides for acquiring or improving resistance of host cells, plant cells, plant tissues, plant parts, or plants to PPO inhibitory herbicides.

[0020] The present invention further relates to a method for controlling weeds in plant cultivation areas. [Brief explanation of the drawing]

[0021] [Figure 1]Figure 1 shows alignments of PPO amino acid sequences from various plants, with marked boxes indicating conserved amino acid motifs at the screening site, from top to bottom: rice (Oryza sativa L.), maize (Zea mays), Arabidopsis thaliana, soybean (Glycine max), tobacco (Nicotiana tabacum), sorghum (Sorghum bicolor), tomato (Solanum lycopersicum), barley (Hordeum vulgare), rapeseed (Brassica napus), peanut (Arachis hypogaea) Hypogaea), wheat (Triticum aestivum), cabbage (Brassica oleracea), millet (Setaria italica), radish (Raphanus sativus), potato (Solanum tuberosum), highland cotton (Gossypium hirsutum), cotton (Gossypium hirsutum), radish (Raphanus sativus), cabbage (Brassica oleracea), sweet potato (Dioscorea esculenta) Yam (Dioscorea cayenensis), Cassava (Manihot esculenta), Pepper (Capsicum annuum), Pumpkin (Cucurbita moschata), Cucumber (Cucumis sativus), Lettuce (Lactuca sativa)(sativa), sesame (Sesamum indicum), sunflower (Helianthus annuus), mulberry (Morus alba), cowpea (Vigna unguiculata), strawberry (Fragaria ananassa), apple (Malus domestica), peach (Prunus persica), cherry (Prunus pseudocerasus), apricot (Prunus armeniaca), European grape (Vitis vinifera), papaya (Carica papaya), alfalfa (Medicago sativa) It represents sativa)). [Figure 2] Figure 2 shows the cell proliferation levels of PPO-deficient Escherichia coli (ΔhemG) after transformation with a pET44a empty vector and the rice OsPPO1 wild-type gene (WT), followed by treatment with compound A at concentrations of 0 nM, 100 nM, 300 nM, and 1000 nM (nanomoles). [Figure 3] Figure 3 shows the cell proliferation levels of PPO-deficient Escherichia coli (ΔhemG) transformants transformed with the OsPPO1 wild-type gene (shown as WT) or various OsPPO1 mutant genes after treatment with compound A at concentrations of 0 nM and 500 nM. [Figure 4] Figure 4 shows the cell proliferation levels of PPO-deficient Escherichia coli (ΔhemG) transformants transformed with the OsPPO1 wild-type gene (shown as WT) or various OsPPO1 mutant genes after treatment with compound A at concentrations of 0 μM, 1 μM, 10 μM, 20 μM, 50 μM, and 100 μM. [Figure 5]Figure 5 shows the cell growth levels of PPO-deficient Escherichia coli (ΔhemG) transformants transformed with the ZmPPO1 wild-type gene (designated as ZmPPO1-WT) or various ZmPPO1 mutant genes when treated with compound A at concentrations of 0 μM, 5 μM, 50 μM, and 100 μM. [Figure 6] Figure 6 shows the tolerance tests of combinations of sites with other crop tolerances to different PPO-inhibiting herbicides such as compound A, sulfphenacyl, and flumioxazin. [Figure 7] Figure 7 shows the tolerance tests of combinations of sites with other crop tolerances to different PPO-inhibiting herbicides such as epirifene, sulfentrazone, and thiafenacyl. [Figure 8] Figure 8 shows the tolerance tests of combinations of sites with other crop tolerances to different PPO-inhibiting herbicides such as fomesafen and trifludimoxazin. [Figure 9] Figure 9 shows the cell growth levels of PPO-deficient Escherichia coli (ΔhemG) transformants transformed with the OsPPO1 wild-type gene (designated as WT) or various OsPPO1 mutant genes when treated with 100 nM flumioxazin, 100 nM oxyfluorfen, 500 nM sulfphenacyl, 5 μM pyraclonil, 1 μM carfentrazone ethyl, and 10 μM fomesafen. [Figure 10] Figure 10 shows the measurement of mutant enzyme activity. The differences between the enzyme reaction rate curves of rice OsPPO1 wild-type (designated as WT), Y425I, and L423S / Y425I are also shown. The enzyme activity of the L423S / Y425 mutant is higher than that of WT, and the enzyme activity of Y425I is lower than that of WT. [Figure 11] Figure 11 shows the growth ability of rice seedling strains with homologous substitution at the L423S / Y425I site in comparison with wild strains when treated with compound A at a rate of 9 g / ha. [Figure 12]Figure 12 shows seeds of Arabidopsis talliana overexpressing soybean PPO1 WT and L430S / Y432 treated with different concentrations of compound A. Compared to wild-type Arabidopsis talliana, both overexpressing soybean PPO1 WT and L430S / Y432I show a certain level of tolerance to compound A in Arabidopsis talliana, but the tolerance of overexpressing L430S / Y432I to compound A is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-GmPPO1 WT refers to overexpressing soybean PPO1; and pHSE-GmPPO1 L430S / Y432I refers to overexpressing soybean PPO1 L430S / Y432I. [Figure 13] Figure 13 shows seeds of Arabidopsis talliana overexpressing PPO1 WT and L424S / Y426I treated with different concentrations of compound A. Compared to wild-type Arabidopsis talliana, both overexpressing PPO1 WT and L424S / Y426I show a certain level of tolerance to compound A in Arabidopsis talliana, but the tolerance of overexpressing L424S / Y426I to compound A is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-BnPPO1-C5 WT refers to overexpressing PPO1; and pHSE-BnPPO1-C5 L424S / Y426I refers to overexpressing PPO1 L424S / Y426I. [Figure 14]Figure 14 shows seeds of Arabidopsis talliana overexpressing maize PPO1 WT and L424W / Y426L treated with different concentrations of compound A. Compared to wild-type Arabidopsis talliana, both overexpressing maize PPO1 WT and L424W / Y426L show a certain level of tolerance to compound A in Arabidopsis talliana, but the tolerance of overexpressing L424W / Y426L to compound A is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-ZmPPO1 WT refers to overexpressing maize PPO1; and pHSE-ZmPPO1 L424W / Y426L refers to overexpressing maize PPO1 L424W / Y426L. [Figure 15] Figure 15 shows seeds of Arabidopsis talliana overexpressing rice PPO1 WT and L423S / Y425I treated with different concentrations of compound A. Compared to wild-type Arabidopsis talliana, both overexpressing rice PPO1 WT and L423S / Y425I show a certain level of tolerance to compound A in Arabidopsis talliana, but the tolerance of overexpressing L423S / Y425I to compound A is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-OsPPO1 WT refers to overexpressing rice PPO1; and pHSE-OsPPO1 L423S / Y425I refers to overexpressing rice PPO1 L423S / Y425I. [Figure 16]Figure 16 shows seeds of Arabidopsis talliana overexpressing rice PPO1 WT and L423S / Y425I treated with different concentrations of flumioxazine. Compared to wild-type Arabidopsis talliana, both overexpressing rice PPO1 WT and L423S / Y425I show a certain level of resistance to flumioxazine in Arabidopsis talliana, but the resistance of overexpressing L423S / Y425I to flumioxazine is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-OsPPO1 WT refers to overexpressing rice PPO1; and pHSE-OsPPO1 L423S / Y425I refers to overexpressing rice PPO1 L423S / Y425I. [Figure 17] Figure 17 shows Arabidopsis talliana seeds of overexpressing rice PPO1 WT and L423S / Y425I treated with different concentrations of saflufenacil. Compared to wild-type Arabidopsis talliana, both overexpressing rice PPO1 WT and L423S / Y425I show a certain level of tolerance to saflufenacil in Arabidopsis talliana, but the tolerance of overexpressing L423S / Y425I to saflufenacil is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-OsPPO1 WT refers to overexpressing rice PPO1; and pHSE-OsPPO1 L423S / Y425I refers to overexpressing rice PPO1 L423S / Y425I. [Figure 18]Figure 18 shows Arabidopsis talliana seeds of overexpressing soybean PPO1 WT and L430S / Y432I treated with different concentrations of flumioxazine. Compared to wild-type Arabidopsis talliana, both overexpressing soybean PPO1 WT and L430S / Y432I show a certain level of resistance to flumioxazine in Arabidopsis talliana, but the resistance of overexpressing L430S / Y432I to flumioxazine is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-GmPPO1 WT refers to overexpressing soybean PPO1; and pHSE-GmPPO1 L430S / Y432I refers to overexpressing soybean PPO1 L430S / Y432I. [Figure 19] Figure 19 shows Arabidopsis talliana seeds of overexpressing soybean PPO1 WT and L430S / Y432I treated with different concentrations of saflufenacil. Compared to wild-type Arabidopsis talliana, both overexpressing soybean PPO1 WT and L430S / Y432I show a certain level of tolerance to saflufenacil in Arabidopsis talliana, but the tolerance of overexpressing L430S / Y432I to saflufenacil is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-GmPPO1 WT refers to overexpressing soybean PPO1; and pHSE-GmPPO1 L430S / Y432I refers to overexpressing soybean PPO1 L430S / Y432I. [Figure 20]Figure 20 shows seeds of Arabidopsis talliana overexpressing maize PPO1 WT and L424W / Y426L treated with different concentrations of flumioxazine. Compared to wild-type Arabidopsis talliana, both overexpressing maize PPO1 WT and L424W / Y426L show a certain level of tolerance to flumioxazine in Arabidopsis talliana, but the tolerance of overexpressing L424W / Y426L to flumioxazine is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-ZmPPO1 WT refers to overexpressing maize PPO1; and pHSE-ZmPPO1 L424W / Y426L refers to overexpressing maize PPO1 L424W / Y426L. [Figure 21] Figure 21 shows seeds of Arabidopsis talliana overexpressing maize PPO1 WT and L424W / Y426L treated with different concentrations of saflufenacil. Compared to wild-type Arabidopsis talliana, both overexpressing maize PPO1 WT and L424W / Y426L show a certain level of tolerance to saflufenacil in Arabidopsis talliana, but the tolerance of overexpressing L424W / Y426L to saflufenacil is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-ZmPPO1 WT refers to overexpressing maize PPO1; and pHSE-ZmPPO1 WT L424W / Y426L refers to overexpressing maize PPO1 L424W / Y426L. [Figure 22]Figure 22 shows seeds of Arabidopsis talliana overexpressing Brassica napus PPO1 WT and L424S / Y426I treated with different concentrations of flumioxazine. Compared to wild-type Arabidopsis talliana, both overexpressing Brassica napus PPO1 WT and L424S / Y426I show a certain level of resistance to flumioxazine in Arabidopsis talliana, but the resistance of overexpressing L424S / Y426I to flumioxazine is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-BnPPO1-C5 WT refers to overexpressing Brassica napus PPO1; and pHSE-BnPPO1-C5 L424S / Y426I refers to overexpressing Brassica napus PPO1 L424S / Y426I. [Figure 23] Figure 23 shows seeds of Arabidopsis talliana overexpressing Brassica napus PPO1 WT and L424S / Y426I treated with different concentrations of saflufenacil. Compared to wild-type Arabidopsis talliana, both overexpressing Brassica napus PPO1 WT and L424S / Y426I show a certain level of tolerance to saflufenacil in Arabidopsis talliana, but the tolerance of overexpressing L424S / Y426I to saflufenacil is much higher than that of the overexpressing wild-type. Here, wild-type refers to wild-type Arabidopsis talliana; pHSE-BnPPO1-C5 WT refers to overexpressing Brassica napus PPO1; and pHSE-BnPPO1-C5 L424S / Y426I refers to overexpressing Brassica napus PPO1 L424S / Y426I. [Figure 24] Figure 24 shows the test results of rice seedlings overexpressing rice PPO1 WT and L423S / Y425I, sprayed with different concentrations of compound A. Here, WT represents Huaidao No. 5 wild type; MT1 and MT2 represent overexpressing rice PPO1 WT; and MT3 and MT4 represent overexpressing rice PPO1 L423S / Y425I.

[0022] [Table 1] Detailed description of the invention TIFF0007837346000002.tif60170

[0023] Some terms used in this specification are defined as follows:

[0024] In this invention, the term "herbicide" refers to an active ingredient that can kill, control, or adversely affect the growth of plants. The terms "herbicide tolerance" or "herbicide resistance" refer to a situation in which plants continue to grow even after treatment with a herbicide that can kill, inhibit the growth of, or weaken or stop the growth of normal or wild-type plants compared to wild-type plants. The herbicides mentioned above include PPO inhibitors, which can be classified into pyrimidinedione, diphenyl ether, phenylpyrazole, N-phenylphthalimide, thiadiazole, oxadiazole, triazolinone, oxazolidinedione, and other herbicides having different chemical structures.

[0025] If the PPO inhibitory herbicides and / or other herbicidal compounds described herein and usable in connection with the present invention can form geometric isomers such as E / Z isomers, then both their pure isomers and mixtures thereof can be used in the compositions of the present invention. If the PPO inhibitory herbicides and / or other herbicidal compounds described herein have one or more chirality centers and consequently exist as enantiomers or diastereomers, then both their pure isomers and mixtures thereof can be used in the compositions of the present invention. If the PPO inhibitory herbicides and / or other herbicidal compounds described herein have ionizable functional groups, then they can also be used in the form of agriculturally acceptable salts. Generally, the salts of their cations and the acid addition salts of their acids should be such that their cations and anions do not adversely affect the activity of the active compound, respectively.Preferred cations are alkali metal ions, preferably lithium ions, sodium ions and potassium ions, alkaline earth metal ions, preferably calcium ions and magnesium ions, and transition metal ions, preferably manganese ions, copper ions, zinc ions and iron ions, and furthermore ammonium, and substituted ammonium in which 1 to 4 hydrogen atoms are substituted with C1-C4-alkyl, hydroxy-C1-C4-alkyl, C1-C4-alkoxy-C1-C4-alkyl, hydroxy-C1-C4-alkoxy-C1-C4-alkyl, phenyl or benzyl, preferably ammonium, methylammonium, isopropylammonium, dimethylammonium, diisopropylammonium, trimethylammonium, heptylammonium, dodecylammonium, tetradecylammonium, tetramethylammonium, tetraethylammonium, tetramethylammonium, tetraethylammonium, tetramethylammonium These include butylammonium, 2-hydroxyethylammonium (olamine salt), 2-(2-hydroxyethyl-1-oxy)etho-1-ylammonium (diglycolamine salt), di(2-hydroxyetho-1-yl)ammonium (diolamine salt), tris(2-hydroxyethyl)ammonium (trolamine salt), tris(2-hydroxypropyl)ammonium, benzyltrimethylammonium, benzyltriethylammonium, and N,N,N-trimethylethanolammonium (choline salt). Furthermore, these include phosphonium ions, sulfonium ions, preferably tri(C1-C4-alkyl)sulfonium such as trimethylsulfonium, and sulfoxonium ions, preferably tri(C1-C4-alkyl)sulfoxonium ions. Finally, they include salts of polybasic amines such as N,N-bis-(3-aminopropyl)methylamine and diethylenetriamine. Useful anions for acid addition salts are mainly ions of chlorides, bromides, fluorides, iodides, bisulfate, methyl sulfate, sulfuric acid, dihydrogen phosphate, hydrogen phosphate, nitric acid, bicarbonate, carbonic acid, hexafluorosilicic acid, hexafluorophosphate, benzoic acid, and anions of C1-C4-alkanoates, preferably formate, acetate, propionate, and butyrate.

[0026] The PPO inhibitory herbicides and / or other herbicidal compounds described herein, having a carboxyl group, can be used in the form of an acid, in the form of an agriculturally suitable salt as described above, or in the form of an agriculturally acceptable derivative, for example, as amides such as mono- and di-C1-C6-alkylamides or arylamides, as esters such as allyl esters, propargyl esters, C1-C10-alkyl esters, alkoxyalkyl esters, tefuryl((tetrahydrofuran-2-yl)methyl) esters, or as thioesters such as C1-C10-alkylthioesters. Preferred mono- and di-C1-C6-alkylamides are methylamide and dimethylamide. Preferred arylamides are, for example, anilides and 2-chloroanilides. Preferred alkyl esters are, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, mexyl(1-methylhexyl), meptyl(1-methylheptyl), heptyl, octyl, or isooctyl(2-ethylhexyl) esters. Preferred C1-C4-alkoxy-C1-C4-alkyl esters are linear or branched C1-C4-alkoxyethyl esters, such as 2-methoxyethyl ester, 2-ethoxyethyl ester, 2-butoxyethyl (butotyl) ester, 2-butoxypropyl ester, or 3-butoxypropyl ester. An example of a linear or branched C1-C10-alkylthioester is ethylthioester.

[0027] In exemplary embodiments, pyrimidinedione may include, but is not limited to, butphenacil (CAS No.: 134605-64-4), saflufenacil (CAS No.: 372137-35-4), benzfenzizone (CAS No.: 158755-95-4), thiafenacil (CAS No.: 1220411-29-9), [3-[2-chloro-4-fluoro-5-(1-methyl-6-trifluoromethyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-3-yl)phenoxy]-2-pyridyloxy]ethyl acetate (epiriphenacil, CAS No.: 353292-31-6), 1-methyl-6- Trifluoromethyl-3-(2,2,7-trifluoro-3-oxo-4-propa-2-inyl-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl)-1H-pyrimidine-2,4-dione (CAS No.: 1304113-05-0), 3-[7-chloro-5-fluoro-2-(trifluoromethyl)-1H-benzimidazole-4-yl]-1-methyl-6-(trifluoromethyl)-1H-pyrimidine-2,4-dione (CAS No.: 212754-02-4), flupropasil (CAS No.: 120890-70-2), isoxazoline-containing uracil disclosed in CN105753853A (for example, [ka] Examples include compounds of , uracilpyridine disclosed in WO2017 / 202768, and uracil disclosed in WO2018 / 019842.

[0028] Diphenyl ether herbicides include, but are not limited to, fomesaphen (CAS No.: 72178-02-0), oxyfluorphen (CAS No.: 42874-03-3), acroniphen (CAS No.: 74070-46-5), lactofen (CAS No.: 77501-63-4), clomethoxyfen (CAS No.: 32861-85-1), chlornitrofen (CAS No.: 1836-77-7), fluoroglycofen ethyl (CAS No.: 77501-90-7), acylfluorphen, or sodium. Examples include iodine salt (CAS number: 50594-66-6 or 62476-59-9), bifenox (CAS number: 42576-02-3), ethoxyphene (CAS number: 188634-90-4), ethoxyphene ethyl (CAS number: 131086-42-5), fluoronitrophene (CAS number: 13738-63-1), furyloxyphene (CAS number: 80020-41-3), nitrofluorophene (CAS number: 42874-01-1), and halosaphene (CAS number: 77227-69-1).

[0029] Examples of phenylpyrazole herbicides include, but are not limited to, pyraflufenethyl (CAS number: 129630-19-9) and fluazolate (CAS number: 174514-07-9).

[0030] Examples of N-phenylimide herbicides include, but are not limited to, flumioxazine (CAS number: 103361-09-7), synidone ethyl (CAS number: 142891-20-1), flumipropine (CAS number: 84478-52-4), and flumimicrolacpentyl (CAS number: 87546-18-7).

[0031] Examples of thiadiazole herbicides include, but are not limited to, fluthiaset-methyl (CAS number: 117337-19-6), fluthiaset (CAS number: 149253-65-6), and thiadiamine (CAS number: 123249-43-4).

[0032] Examples of oxadiazole herbicides, though not limited to them, include oxaziargyl (CAS number: 39807-15-3) and oxadiazone (CAS number: 19666-30-9).

[0033] Examples of triazolinone herbicides include, but are not limited to, carfentrazone (CAS number: 128621-72-7), carfentrazone ethyl (CAS number: 128639-02-1), sulfenthrazone (CAS number: 122836-35-5), azaphenidine (CAS number: 68049-83-2), and bencarbazone (CAS number: 173980-17-1).

[0034] Examples of oxazolidinedione herbicides include, but are not limited to, pentoxazone (CAS number: 110956-75-7).

[0035] Other herbicides include, but are not limited to, pyraclonil (CAS No.: 158353-15-2), flufenpyruethyl (CAS No.: 188489-07-8), profluazole (CAS No.: 190314-43-3), trifludimoxazine (CAS No.: 1258836-72-4), N-ethyl-3-(2,6-dichloro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide (CAS No.: 452098-92-9), and N-tetrahydro Furfuryl-3-(2,6-dichloro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide (CAS No.: 915396-43-9), N-ethyl-3-(2-chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide (CAS No.: 452099-05-7), N-tetrahydrofurfuryl-3-(2-chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methyl-1H- Pyrazole-1-carboxamide (CAS number: 452100-03-7), 3-[7-fluoro-3-oxo-4-(propa-2-inyl)-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl]-1,5-dimethyl-6-thioxo[1,3,5]triazinan-2,4-dione (CAS number: 451484-50-7), 2-(2,2,7-trifluoro-3-oxo-4-propa-2-inyl-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl)-4, 5,6,7-Tetrahydroisoindole-1,3-dione (CAS No.: 1300118-96-0), Methyl(E)-4-[2-chloro-5-[4-chloro-5-(difluoromethoxy)-1H-methylpyrazole-3-]yl]-4-fluorophenoxy]-3-methoxybuta-2-enoate (CAS No.: 948893-00-3), Phenylpyridine disclosed in WO2016 / 120116, Benzoxazinon derivatives disclosed in EP09163242.2, and General Formula I [ka] Examples of compounds shown in (see CN202011462769.7) include: In another exemplary embodiment, Q is [ka] It represents; Y represents a halogen, a C1-C6 alkyl halogen, or a cyano; Z represents halogen; M represents CH or N; X is -CX1X2-(C1-C6 alkyl). n -, -(C1-C6 alkyl)-CX1X2-(C1-C6 alkyl) n -or-(CH2) r - represents a negative number, n represents 0 or 1, and r represents an integer greater than or equal to 2; X1 and X2 independently represent hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogenated C1-C6 alkyl, halogenated C2-C6 alkenyl, halogenated C2-C6 alkynyl, C3-C6 cycloalkyl, C3-C6 cycloalkyl C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfanyl, hydroxy C1-C6 alkyl, C1-C6 alkoxy C1-C6 alkyl, phenyl, or benzyl; X3 and X4 independently represent O or S; W represents hydroxyl, C1-C6 alkoxy, C2-C6 alkenyloxy, C2-C6 alkynyloxy, halogenated C1-C6 alkoxy, halogenated C2-C6 alkenyloxy, halogenated C2-C6 alkynyloxy, C3-C6 cycloalkyloxy, phenoxy, sulfidyl, C1-C6 alkylsulfanyl, C2-C6 alkenylsulfanyl, C2-C6 alkynylsulfanyl, halogenated C1-C6 alkylsulfanyl, halogenated C2-C6 alkenylsulfanyl, halogenated C2-C6 alkynylsulfanyl, C3-C6 cycloalkylsulfanyl, phenylsulfanyl, amino, or C1-C6 alkylamino.

[0036] In another exemplary embodiment, a compound represented by general formula I is selected from compound A: Q is [ka] Y represents chlorine; Z represents fluorine; M represents CH; X represents -C * X1X2-(C1-C6 alkyl) n - represents (C * is a chiral center (R configuration), n represents 0; X1 represents hydrogen; X2 represents methyl; X3 and X4 independently represent O; and W represents methoxy.

[0037] The PPO inhibitory herbicides described above, which are useful for carrying out the present invention, are very often applied in combination with one or more other herbicides to obtain control of a wider range of undesirable vegetation. For example, PPO inhibitory herbicides can be further used in additional combination with herbicides to which crop plants are originally resistant or to which resistance is obtained through the expression of one or more additional transgenes as described above. When used in combination with other targeted herbicides, the compounds of the present invention can be formulated with one or more other herbicides, tank-mixed with one or more other herbicides, or applied sequentially with one or more other herbicides.

[0038] Suitable components for the mixture are selected from, for example, herbicides of class b1) to b15): b1) Lipid biosynthesis inhibitors; b2) Acetolactate synthase inhibitors (ALS inhibitors); b3) Photosynthesis inhibitors; b4) Protoporphyrinogen-IX oxidase inhibitors; b5) Bleach and herbicides; b6) Enolpyruvirshikimate 3-phosphate synthase inhibitors (EPSP inhibitors); b7) Glutamine synthase inhibitors; b8) 7,8-dihydropteroate synthase inhibitors (DHP inhibitors); b9) Mitotic inhibitors; b10) Very long-chain fatty acid synthesis inhibitors (VLCFA inhibitors); b11) Cellulose biosynthesis inhibitors; b12) Decoupler herbicides; b13) Auxin-based herbicides; b14) Auxin transport inhibitors; and b15) Bromobutide, Chlorflurenol, Chlorflurenol Methyl, Symmethilin, Cumilon, Darapon, Dazomet, Diphenzoquat, Diphenzoquat Methylsulfate, Dimethipine, DSMA, Daimuron, Endotal and its salts, Etobenzanide, Flamprop, Flamprop Isopropyl, Flamprop Methyl, Flamprop-M-Isopropyl, Flamprop-M-Methyl, Flurenol, Flurenol Butyl, Flurprimidol, Fosamine, Fosamine Ammonium, Indanophan, Indadiphram, Murray Other herbicides selected from the group consisting of hydrazide iodide, mefluidide, metham, methiozoline (CAS No.: 403640-27-7), methyl azide, methyl bromide, methyl dimuron, methyl iodide, MSMA, oleic acid, oxadiclomephone, pelargonic acid, pyributicarb, quinoclamin, triaziflame, tridiphan, and 6-chloro-3-(2-cyclopropyl-6-methylphenoxy)-4-pyridazinol (CAS No.: 499223-49-3) and its salts and esters; as well as agriculturally acceptable salts or derivatives thereof.

[0039] Furthermore, when used in combination with other herbicidal compounds as described above, it may be useful to apply a PPO inhibitor herbicide in combination with a phytotoxicity reducer. A phytotoxicity reducer is a compound that prevents or reduces damage to useful plants without significantly affecting the herbicidal effect of the herbicide on undesirable plants. The phytotoxicity reducer can be applied either before sowing (e.g., during seed treatment, at the sprout stage, or at the seedling stage), or before or after germination of useful plants.

[0040] Furthermore, phytotoxicity reducers, PPO inhibitor herbicides, and / or other herbicides can be applied simultaneously or consecutively.

[0041] PPO inhibitor herbicides, herbicidal compounds of groups b1) to b15), and phytotoxicity reducers are known herbicides and phytotoxicity reducers, respectively. See, for example, WO2013 / 189984; The Compendium of Pesticide Common Names (http: / / www.alanwood.net / pesticides / ); Farm Chemicals Handbook 2000, Volume 86, Meister Publishing Company, 2000; B. Hock, C. Fedtke, RRSchmidt, Herbizide [herbicide], Georg Thieme Verlag, Stuttgart, 1995; WHAhrens, Herbicide Handbook, 7th edition, Weed Science Society of America, 1994 and KK Hatzios, Herbicide Handbook, supplement to the 7th edition, Weed Science Society of America, 1998.

[0042] The plants to which this invention applies are not particularly limited, but include monocots and dicots. Furthermore, the plants include herbaceous plants and woody plants. Examples of monocots include plants belonging to the Alismataceae, Hydrocharitaceae, Scutellaceae, Potamogetonaceae, Potamogetonaceae, Zosteraceae, Zosteraceae, Liliaceae, Haemodolaceae, Agaveaceae, Amaryllidaceae, Dioscoreaceae, Pontederiaceae, Iridaceae, Monotropaceae, Juncaceae, Commelinaceae, Eriocaulaceae, Gramineae, Poaceae, Araceae, Lemnaceae, Spikeaceae, Typhaceae, Cyperaceae, Musaceae, Zingiberaceae, Cannaceae, and Orchidaceae families.

[0043] Dicotyledonous plants include the families Diapensiaceae, Clethraceae, Pyrolaceae, Ericaceae, Myrsinaceae, Primulaceae, Plumbaginaceae, Pogoniaceae, Styracaceae, Symplocaceae, Oleaceae, Buddlejaceae, Gentianaceae, Menyanthesaceae, Apocynaceae, Asclepiadaceae, Rubiaceae, Polemoniaceae, Convolvulaceae, Boraginaceae, Verbenaceae, Lamiaceae, Solanaceae, Scrophulariaceae, Bignoniaceae, Acanthaceae, Pedicularaceae, Orobanchaceae, Gesneriaceae, Lentibulariaceae, Phrymaceae, Plantaginaceae, and S Lumpsweet family, Adoxaceae family, Valerian family, Dipsacaceae family, Campanulaceae family, Asteraceae family, Myricaceae family, Juglandaceae family, Salicaceae family, Betulaceae family, Fagaceae family, Ulmaceae family, Moraceae family, Urticaceae family, Sandalwood family, Mistletoeaceae family, Polygonaceae family, Phytolaccaceae family, Nyctaginaceae family, Pomegranate family, Portulacaceae family, Caryophyllaceae family, Chenopodiaceae family, Amaranthaceae family, Cactaceae family, Magnoliaceae family, Illiciaceae family, Lauraceae family, Ceratophyllum family, Ranunculaceae family, Berberidaceae family, Akebia family, Menispermaceae family, Nymphaeaceae family, Ceratophyllum family, Dioscoreaceae family, Saururaceae family Piperaceae, Chloranthaceae, Aristolochiaceae, Actinidiaceae, Theaceae, Hypericaceae, Droseraceae, Papaveraceae, Capranaceae, Brassicaceae, Platanaceae, Hamamelidaceae, Crassulaceae, Saxifragaceae, Eucommiaceae, Pittosporaceae, Rosaceae, Fabaceae, Oxalidaceae, Geraniaceae, Tropaeolaceae, Zygophyllaceae, Linaceae, Euphorbiaceae, Sphagnum, Rutaceae, Simaroubaceae, Meliaceae, Polygalaceae, Anacardiaceae, Aceraceae, Sapindaceae, Aesculus hippocastanum, Staphylinaceae, Impatiens textorii Examples of plants belonging to the following families include: Alnusaceae, Aquifoliaceae, Celastraceae, Staphyleaceae, Buxaceae, Crowberryaceae, Rhamnaceae, Vitaceae, Elaeocarpaceae, Tiliaceae, Malvaceae, Malvaceae, Thymelaeaceae, Elaeagnaceae, Ilexaceae, Violaceae, Passifloraceae, Tamariaceae, Laurelaceae, Begoniaceae, Cucurbitaceae, Lythraceae, Punicaceae, Onagraceae, Pomegranateaceae, Melonaceae, Cornaceae, Araliaceae, and Apiaceae.

[0044] In another exemplary embodiment, the plants include, but are not limited to, the following: (1) Food crops: Oryza species such as Oryza sativa, Oryza latifolia, Oryza sativa L., Oryza glaberrima; Triticum species such as Triticum aestivum, Triticum Turgidum ssp. durum; Hordeum species such as Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena sativa, Avena fatua Avena fatua var. sativa, Avena byzantine, Avena fatua var. sativaAvena species such as sativa and Avena hybrida; Pennisetum glaucum, sorghum (Sorghum bicolor), Sorghum vulgare, rye wheat, Zea mays or maize, millet, rice, foxtail millet, proso millet, Echinocloa species such as Sorghum bicolor and proso millet, buckwheat species, Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine korakana (2) Leguminous crops: Soybean species such as Glycine max, species of Vicia species, Vigna species, Pisum species, broad bean, Lupine species, Vicia species, Tamarindus indica, Lens Culinaris, Lathyrus species, Hyacinth bean, broad bean, etc. (3) Oil crops: Arachis hypogaea, peanut species, sesame species, sunflower species such as Helianthus annuus, oil palm such as Elaeis guineensis and Elaeis oleifera, rapeseed, Brassica napus, Sesamum orientale, Brassica juncea, rapeseed, Camellia oleifera, oil palm, olive, castor oil plants, Brassica napus L. L.), Brassica napus; (4) Fiber crops: Agave sisalana, cotton and cotton species such as Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana, Musa textilis Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L.)), Cannabis sativa, Cannabis sativa; (5) Fruit crops: Jujube species, Cucumis species, Passiflora edulis, Vitis species, Vaccinium species, Pyrus communis, Prunus species, Punica granatum, Apple species, Citrullus lanatus, Citrus species, Ficus carica, Fortunella species, Strawberry species, Hawthorn species, Diospyros species, Eugenia unifora, Eriobotrya japonica, Dimocarpus longan longan), Carica papaya, coconut species, Averrhoa carambola, silver vine species, Prunus amygdalus, banana species, Persea Americana, Psidium guajava, Mammea Americana, Mangifera indica, Canarium album (Olea europaea), Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus comosus), Annona genus species, Citrus reticulate (Citrus genus species), Breadfruit genus species, Litchi chinensis, Gooseberry genus species, Rubus genus species, Pear, Peach, Apricot, Plum, Bayberry, etc. Lemon, kumquat, durian, orange, blueberry, cucumber, cantaloupe, date palm, walnut, cherry; (6) Rhizomatous crops: species of the genus Ipomoea, Ipomoea batatas, Colocasia esculenta, tuber mustard, Allium cepa (onion), Eleocharis tuberose (water chestnut), Cyperus rotundus, Rhizoma dioscoreae; (7) Vegetable crops: species of spinach, species of bean, Lactuca sativa, species of bitter melon, Petroselinum crispum Crispum), Capsicum species, Solanum species (Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum, etc.), Tomato species (Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme, etc.), Macrotiloma spp., Kale, Luffa acutangula, Lentils, Okra, Onion, Potato, Artichoke, Asparagus, Broccoli, Brussels sprouts Sprouts, cabbage, carrots, cauliflower, celery, collard greens, Pumpkin, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranth species, Allium species, Abelmoschus species, Cichorium endivia, Pumpkin species, Coriandrum sativum, Brassica carinata, Rapbanus sativus, Brassica species (Brassica rapa ssp.), Brassica napus, Turnip (8) Flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia species, Cymbidium species, Crinum asiaticum L., Clivia, Hippeastrum rutilum, Rosa Rugosa, Rosa Chinensis, Jasminum sambac sambac), Tulipa gesneriana L., a species of cherry tree, Pharbitis nil (L.) Choisy, Calendula officinalis L., a species of lotus, Bellis perennis L.), Dianthus caryophyllus, Petunia hybrida, Tulipa gesneriana L., Lilium brownii, Prunus mume, Narcissus tazetta L., Jasminum nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata miniata), Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) sprung) Spreng, Cercis chinensis, Keria japonica, Weigela florida, Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum Mill, Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedschia aethiopica, Calendula officinalis (9) Medicinal plants: (9) Carthamus tinctorius, mint, Dheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum virosa 'Roul'.(Amomum villosum Lour.), Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, . Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn, Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus *Rugosus*, *Scutellaria baicalensis*, *Prunella vulgaris L.*, *Pyrethrum carneum*, *Cinchona ledgeriana*, *Hevea brasiliensis* (wild) , Piper Nigrum L.; (10) Raw material crops: Hevea brassiliensis, Ricinus communis, Vernicia fordii, Morus alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk, Rhus verniciflua stokes; (11) Forage crops: Amorphophallus species, Trifolium species, Miscanthus sinensis, Pennisetum species, Phalaris arundinacea, Panicum vilgatum virgatum), prairie grasses, Indian grass, Big bluestem grass, Phleum pratense, turfgrass, sedge (Kobresia pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Phleum pratense L.), Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea, Sesbania cannabina, Azolla imbircata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus, Astragalus, Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera phylloxeroides (12) Sugar crops: Saccharum officinarum (sugarcane), Beta vulgaris; (13) Beverage crops: Camellia sinensis, Camellia Sinensis, tea, coffee (coffee), Theobroma cacao, Humulus lupulus Linn; (14) Lawn plants: Ammophila arenaria, Poa pratensis (bluegrass), Agrostis matsumurae, Agrostis palustris Palustris, species of the genus Rhus, species of the genus Festuca ovina L.)), Zoysia japonica, Cynodon dactylon / Bermuda grass, Stenotaphrum secundatum, Paspalum notatum, Eremochloa ophiuroides (centipede grass), Digitaria genus, Bouteloua dactylides Dactyloides (Yagyu-shiba), Bouteloua genus variety (Bouteloua gracilis), Digitaria sanguinalis, . Cyperus rotundus, Kyllinga brevifolia, Cyperus amuricus, Erigeron canadensis, Hydrocotyle sibthorpioides, Kummerowia striata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex heterostachya (heterostoya), Zoysia grass; (15) Tree crops: Pinus species, Salix species, Maple species, Hibiscus species, Eucalyptus species, Ginkgo species, Bambusa species, Poplar species, Prosopis spp., Quercus species, Date palm species, Fagus species, Ceiba pentandra, Cinnamomum species, Phragmites australis, Physalis species, Desmodium species, Poplar, Hedera helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo bilova L. L.) Quercus genus, Ailanthus altissima, Schima superba, Ilex pur-purea, Platanus acerifolia, Ligustrum lucidum, Buxus megistopphylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus finlaysoniana, Pinus tabliformis (tabuliformis), Pinus koraiensis, Juglans nigra, Citrus limon, Platanus acerifoia, Syzygium jambos, Davidia involucrate, Bombax malabarica L., Ceiba pentandra (L.), Bauhinia blakeana, Albizia saman, Albizzia julibrissin, Erythrina corallodendron Corallodendron, Erythrina indica, Magnolia gradiflora, Cycas revolute, Lagerstroemia indica, coniferous trees, macrophanerophytes, shrubs, Morus alba L.(16) Nut crops: Bertholletia excelsea, species of chestnut, species of hazelnut, species of pecan, species of walnut, Pistacia vera, Anacardium occidentale, species of macadamia (Macadamia integrifolia), Carya ilinoensis Koch, species of macadamia, pistachio, . Badam, other nut-producing plants; (17) Others: Arabidopsis thaliana, Brachiaria eruciformis, Cenchrus echinatus, Setaria faberi, eleusin indica, Cadaba farinose, algae, Carex elata, ornamental plants, Carissa macrocarpa, species of Carissa, Daucus carota, species of Dioscorea, species of Erianthus, Festuca arundinacea, Hemerocallis fluva This includes species such as Lotus fulva, Luzula sylvatica, Medicago sativa, Morus nigra, Tobacco, Olive, Ornithopus spp., Pastinaca sativa, Elderberry, White Mustard, Myrtus, Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata, etc.

[0045] In one exemplary embodiment, the plants include rice (Oryza sativa L.), sorghum (Sorghum bicolour), wheat (Triticum aestivum), barley (Hordeum vulgare), millet (Setaria italica), maize (Zea maize), sugarcane (Saccharum officinarum), Arabidopsis taliana, soybean (Glycine max), peanut (Arachis hypogaea), tobacco (Nicotina tabacum), cotton (Sypium hirsutum), radish (Raphanus sativus), cabbage (Brassica oleracea), sweet potato (Dioscorea esculenta), yam (Dioscorea kaienesis), cassava (Manichoto esculenta), potato (Solanum tuberosum), tomato (Solanum scoparium). These include Ranum lycopersicum, pepper (Capsicum annam), eggplant (Solanum merogenea), watermelon (Citrus lanatus), pumpkin (Cucurbita moscata), cucumis sativa, lettuce (Ractaca sativa), sesame (Sesamum indicum), rapeseed (Brassica napus), sunflower (Helianthus annas), mulberry (Moras alba), cowpea (Vigna unguiculata), strawberry (Fragaria ananasa), apple (Mars domestica), peach (Prunus persica), cherry (Prunus pseudocerasus), apricot (Prunus armeniaca), European grape (Vitis vinifera), papaya (Carica papaya) or alfalfa (Medicago sativa).

[0046] In the present invention, the terms "plant tissue" or "plant part" include plant cells, protoplasts, plant tissue cultures, plant callus, plant masses, and plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, cores, spikes, roots, root tips, anthers, etc.

[0047] In the present invention, "plant cell" should be understood to mean any cell of plant origin or found in a plant that can form differentiated tissue such as undifferentiated tissue like callus, an embryo, a plant part, a plant, or a seed.

[0048] In the present invention, "host organism" should be understood to mean any single-celled or multicellular organism to which nucleic acids encoding mutant proteins can be introduced, such as bacteria such as Escherichia coli, fungi such as yeast (e.g., Saccharomyces cerevisiae), molds (e.g., Aspergillus), plant cells, and plants.

[0049] In one embodiment, the present invention discloses a PPO polypeptide or a bioactive fragment thereof having resistance to PPO inhibitory herbicides, wherein the polypeptide has the motif "LL L N Y It contains I (i.e., "leucine-leucine-leucine-aspartyl-tyrosine-isoleucine"), in which the leucine L at position 3 is substituted with another amino acid, or the tyrosine Y at position 5 is substituted with another amino acid.

[0050] In one embodiment, the motif "LL L N Y In "I", The third-ranked leucine L has mutated into serine S, and is abbreviated as "LLSNYI"; or The third-ranked leucine L has mutated into isoleucine I, and is abbreviated as "LLINYI"; or The third-ranked leucine L has mutated into glycine G, and is abbreviated as "LLGNYI"; or The third position, leucine L, is mutated into threonine T, and is abbreviated as "LLTNYI"; or The third-ranked leucine L has mutated into valine V, and is abbreviated as "LLVNYI"; or The third-ranked leucine L is mutated into tryptophan W, and is abbreviated as "LLWNYI"; or The tyrosine Y at position 5 is mutated into methionine M, and is abbreviated as "LLLNMI"; or The tyrosine Y at position 5 is mutated to isoleucine I, and is abbreviated as "LLLNII"; or The tyrosine Y at position 5 is mutated into leucine L, and is abbreviated as "LLLNLI"; or The fifth-ranked tyrosine Y has mutated into valine V, and is abbreviated as "LLLNVI".

[0051] In another embodiment, motif "LL" L N Y In "I", the leucine L at position 3 is substituted with another amino acid, and the tyrosine Y at position 5 is substituted with another amino acid.

[0052] In another embodiment, motif "LL" L N Y Within "I", The leucine L at position 3 is mutated to serine S, and the tyrosine Y at position 5 is mutated to isoleucine I, and is abbreviated as "LLSNII"; or The leucine L at position 3 is mutated to threonine T, and the tyrosine Y at position 5 is mutated to isoleucine I, and is abbreviated as "LLTNII"; or The 3rd position leucine L is mutated to threonine T, and the 5th position tyrosine Y is mutated to valine V, and it is abbreviated as "LLTNVI"; or The leucine L at position 3 is mutated to serine S, and the tyrosine Y at position 5 is mutated to valine V, and it is abbreviated as "LLSNVI"; or The 3rd position leucine L is mutated to valine V, and the 5th position tyrosine Y is mutated to leucine L, and is abbreviated as "LLVNLI"; or The 3rd position leucine L has mutated into tryptophan W, and the 5th position tyrosine Y has mutated into leucine L, resulting in the abbreviation "LLWNLI".

[0053] In one embodiment, the polypeptide comprises a fragment thereof having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with a freely combinable amino acid sequence variant and the amino acid sequence represented by any one of SEQ ID NOs: 1 to 19, wherein the variant has one or more amino acid mutations as defined above.

[0054] In another embodiment, the polypeptide has the amino acid sequence shown in any one of SEQ ID NOs: 1 to 19, except that it has one or more amino acid mutations as defined above; preferably, the amino acid sequence of the polypeptide is as shown in any one of SEQ ID NOs: 1 to 19, except that it has one or more amino acid mutations as defined above.

[0055] In another embodiment, the amino acid sequence of the PPO polypeptide has one or more mutations at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type rice PPO1 protein shown in SEQ ID NO: 1, compared to the amino acid sequence of wild-type rice PPO1, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type maize PPO1, has one or more mutations at one or more positions (only) corresponding to positions 424 and 426 of the amino acid sequence of the wild-type maize PPO1 protein shown in SEQ ID NO: 2, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rapeseed PPO1, has one or more mutations at one or more positions (only) corresponding to positions 424 and 426 of the amino acid sequence of the wild-type rapeseed PPO1 protein shown in SEQ ID NO: 3, or The amino acid sequence of the PPO polypeptide has one or more mutations at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type rapeseed PPO1 protein shown in SEQ ID NO: 4, compared to the amino acid sequence of wild-type rapeseed PPO1, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type peanut PPO1, has one or more mutations at one or more positions (only) corresponding to positions 445 and 447 of the amino acid sequence of the wild-type peanut PPO1 protein shown in SEQ ID NO: 5, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type peanut PPO1, has one or more mutations at one or more positions (only) corresponding to positions 439 and 441 of the amino acid sequence of the wild-type peanut PPO1 protein shown in SEQ ID NO: 6, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type soybean PPO1, has one or more mutations at one or more positions (only) corresponding to positions 430 and 432 of the amino acid sequence of the wild-type soybean PPO1 protein shown in SEQ ID NO: 7, or The amino acid sequence of the PPO polypeptide has one or more mutations at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type sorghum PPO1 protein shown in SEQ ID NO: 8, compared to the amino acid sequence of wild-type sorghum PPO1, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type wheat PPO1, has one or more mutations at one or more positions (only) corresponding to positions 418 and 420 of the amino acid sequence of the wild-type wheat PPO1 protein shown in SEQ ID NOs. 9, 10, or 11, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type tomato PPO1, has one or more mutations at one or more positions (only) corresponding to positions 445 and 447 of the amino acid sequence of the wild-type tomato PPO1 protein shown in SEQ ID NO: 12, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type potato PPO1, has one or more mutations at one or more positions (only) corresponding to positions 444 and 446 of the wild-type potato PPO1 protein amino acid sequence shown in SEQ ID NO: 13, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type tobacco PPO1, has one or more mutations at one or more positions (only) corresponding to positions 440 and 442 of the amino acid sequence of the wild-type tobacco PPO1 protein shown in SEQ ID NO: 14, or The amino acid sequence of the PPO polypeptide is compared to the amino acid sequence of wild-type Arabidopsis thaliana PPO1, and it has one or more mutations at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type Arabidopsis thaliana PPO1 protein shown in SEQ ID NO: 15, or The amino acid sequence of the PPO polypeptide has one or more mutations at one or more positions (only) corresponding to positions 426 and 428 of the amino acid sequence of the wild-type highland cotton PPO1 protein shown in SEQ ID NO: 16, compared to the amino acid sequence of wild-type highland cotton PPO1, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type radish PPO1, has one or more mutations at one or more positions (only) corresponding to positions 425 and 427 of the amino acid sequence of the wild-type radish PPO1 protein shown in SEQ ID NO: 17, or The amino acid sequence of the PPO polypeptide has one or more mutations at one or more positions (only) corresponding to positions 422 and 424 of the amino acid sequence of the wild-type millet PPO1 protein shown in SEQ ID NO: 18, compared to the amino acid sequence of wild-type millet PPO1, or The amino acid sequence of the PPO polypeptide has one or more mutations at one or more positions (only) corresponding to positions 424 and 426 of the amino acid sequence of the wild-type cabbage PPO1 protein shown in SEQ ID NO: 19, compared to the amino acid sequence of wild-type cabbage PPO1.

[0056] In another embodiment, the amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rice PPO1, has one or more mutations selected from the group consisting of L423S, L423I, L423G, Y425M, Y425I, and Y425V at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type PPO1 protein shown in SEQ ID NO: 1; preferably, it has the following mutation: L423S / Y425I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type maize PPO1, has one or more mutations selected from the group consisting of L424T, L424S, L424V, Y424W, Y426V, Y426I, and Y426L at one or more positions (only) corresponding to positions 424 and 426 of the amino acid sequence of the wild-type maize PPO1 protein shown in Sequence ID No. 2; preferably, it has the following mutations: L424T / Y426V, L424S / Y426V, L424V / Y426L, L424W / Y426L, or L424S / Y426I. The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rapeseed PPO1, has one or more mutations selected from the group consisting of L424S and Y426I at one or more positions (only) corresponding to positions 424 and 426 of the amino acid sequence of the wild-type rapeseed PPO1 protein shown in SEQ ID NO: 3; preferably, it has the following mutation: L424S / Y426I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rapeseed PPO1, has one or more mutations selected from the group consisting of L423S and Y425I at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type rapeseed PPO1 protein shown in SEQ ID NO: 4; preferably, it has the following mutation: L423S / Y425I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type peanut PPO1, has one or more mutations selected from the group consisting of L445S and Y447I at one or more positions (only) corresponding to positions 445 and 447 of the amino acid sequence of the wild-type peanut PPO1 protein shown in SEQ ID NO: 5; preferably, it has the following mutation: L445S / Y447I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type peanut PPO1, has one or more mutations selected from the group consisting of L439S and Y441I at one or more positions (only) corresponding to positions 439 and 441 of the amino acid sequence of the wild-type peanut PPO1 protein shown in SEQ ID NO: 6; preferably, it has the following mutation: L439S / Y441I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type soybean PPO1, has one or more mutations selected from the group consisting of L430S and Y432I at one or more positions (only) corresponding to positions 430 and 432 of the amino acid sequence of the wild-type soybean PPO1 protein shown in SEQ ID NO: 7; preferably, it has the following mutation: L430S / Y432I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type sorghum PPO1, has one or more mutations selected from the group consisting of L423S and Y425I at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type sorghum PPO1 protein shown in SEQ ID NO: 8; preferably, it has the following mutation: L423S / Y425I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type wheat PPO1, has one or more mutations selected from the group consisting of L418S and Y420I at one or more positions (only) corresponding to positions 418 and 420 of the amino acid sequence of the wild-type wheat PPO1 protein shown in SEQ ID NOs. 9, 10, or 11; preferably, it has the following mutation: L418S / Y420I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type tomato PPO1, has one or more mutations selected from the group consisting of L445S and Y447I at one or more positions (only) corresponding to positions 445 and 447 of the amino acid sequence of the wild-type tomato PPO1 protein shown in SEQ ID NO: 12; preferably, it has the following mutation: L445S / Y447I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type potato PPO1, has one or more mutations selected from the group consisting of L444S and Y446I at one or more positions (only) corresponding to positions 444 and 446 of the amino acid sequence of the wild-type potato PPO1 protein shown in SEQ ID NO: 13; preferably, it has the following mutation: L444S / Y446I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type tobacco PPO1, has one or more mutations selected from the group consisting of L440S and Y442I at one or more positions (only) corresponding to positions 440 and 442 of the amino acid sequence of the wild-type tobacco PPO1 protein shown in SEQ ID NO: 14; preferably, it has the following mutation: L440S / Y442I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type Arabidopsis thaliana PPO1, has one or more mutations selected from the group consisting of L423S and Y425I at one or more positions (only) corresponding to positions 423 and 425 of the amino acid sequence of the wild-type Arabidopsis thaliana PPO1 protein shown in SEQ ID NO: 15; preferably, it has the following mutation: L423S / Y425I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type highland cotton PPO1, has one or more mutations selected from the group consisting of L426S and Y428I at one or more positions (only) corresponding to positions 426 and 428 of the amino acid sequence of the wild-type highland cotton PPO1 protein shown in SEQ ID NO: 16; preferably, it has the following mutation: L426S / Y428I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type radish PPO1, has one or more mutations selected from the group consisting of L425S and Y427I at one or more positions (only) corresponding to positions 425 and 427 of the amino acid sequence of the wild-type radish PPO1 protein shown in SEQ ID NO: 17; preferably, it has the following mutation: L425S / Y427I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type millet PPO1, has one or more mutations selected from the group consisting of L422S and Y424I at one or more positions (only) corresponding to positions 422 and 424 of the amino acid sequence of the wild-type millet PPO1 protein shown in SEQ ID NO: 18; preferably, it has the following mutation: L422S / Y424I, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type cabbage PPO1, has one or more mutations selected from the group consisting of L424S and Y426I at one or more positions (only) corresponding to positions 424 and 426 of the amino acid sequence of the wild-type cabbage PPO1 protein shown in SEQ ID NO: 19; preferably, it has the following mutation: L424S / Y426I.

[0057] In another embodiment, the polypeptide has the amino acid sequence shown in any one of SEQ ID NOs: 20-48; preferably, the amino acid sequence of the polypeptide is as shown in any one of SEQ ID NOs: 20-48.

[0058] The terms "motif" or "consensus sequence" refer to short, conserved regions in evolutionarily related protein sequences. Motifs are often part of a highly conserved domain, but may contain only a portion of a domain or be located outside of a conserved domain (when all amino acids in the motif are outside the defined domain).

[0059] The terms "protein," "polypeptide," and "peptide" are interchangeable in this invention and refer to polymers of amino acid residues, including polymers of chemical analogs in which one or more amino acid residues are native amino acid residues. The proteins and polypeptides of this invention may be produced by recombinant or chemically synthesized.

[0060] In this specification, the terminology for amino acid substitutions is as follows: the first letter represents a naturally occurring amino acid at a specific position in a particular sequence, the following number represents the position corresponding to SEQ ID NO: 1, and the second letter represents another amino acid that substitutes the naturally occurring amino acid. For example, L423S indicates that, compared to the amino acid sequence of SEQ ID NO: 1, leucine at position 423 is substituted with serine. In the case of double or multiple mutations, each mutation is separated by a " / ". For example, L423S / Y425I means that, compared to the amino acid sequence of SEQ ID NO: 1, leucine at position 423 is substituted with serine, and tyrosine at position 425 is substituted with isoleucine, and both mutations are present in the corresponding mutant OsPPO1 protein.

[0061] The position (number) of a specific amino acid in the protein of the present invention is determined by aligning the amino acid sequence of the target protein with SEQ ID NO: 1 or SEQ ID NOs: 2-19, etc., using a standard sequence alignment tool. For example, the Smith-Waterman algorithm or the ClustalW2 algorithm is used to align the two sequences, and the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated by the method described in Wilbur, WJ and Lipman, DJ (1983), “Rapid similarity searches of nucleic acid and protein data banks”, Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters used in the ClustalW2(1.82) algorithm are preferably: protein gap open penalty = 10.0; protein gap extended penalty = 0.2; protein matrix = Gonet; protein / DNA terminal gap = -1; protein / DNA GAPDIST = 4.

[0062] Preferably, the AlignX program (part of the vector NTI set) is used to match the default parameters of multiple alignments (gap open penalty: 10og, gap extended penalty: 0.05), and the position of a specific amino acid in the protein of the present invention is determined by aligning the amino acid sequence of the protein with SEQ ID NO: 1.

[0063] The identity of amino acid sequences can be determined using the BLAST algorithm (Altschul et al., 1990, Mol. Biol. 215:403-10), available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ), and conventional methods using default parameters.

[0064] It will be apparent to those skilled in the art that the structure of a protein can be altered without adversely affecting its activity and function, for example, that one or more conserved amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and embodiments of conserved amino acid substitutions are known to those skilled in the art. Specifically, an amino acid residue at a certain site may be replaced with another amino acid residue belonging to the same group as the amino acid being substituted, i.e., a nonpolar amino acid residue may be replaced with another nonpolar amino acid residue, a polar uncharged amino acid residue may be replaced with another polar uncharged amino acid residue, a basic amino acid residue may be replaced with another basic amino acid residue, and an acidic amino acid residue may be replaced with an acidic amino acid residue. Conservative substitutions in which one amino acid is replaced with another amino acid belonging to the same group are included in the scope of the present invention, as long as the substitution does not impair the biological activity of the protein.

[0065] Therefore, in addition to the mutations described above, the mutant proteins of the present invention may further contain other mutations, such as conserved substitutions, in their amino acid sequences. Furthermore, the present invention also encompasses mutant proteins that further contain one or more other non-conservative substitutions, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.

[0066] As is well known in the art, one or more amino acid residues can be deleted from the N-terminus and / or C-terminus of a protein, and the protein still retains its function and activity. Therefore, in another embodiment, the present invention also relates to a fragment that lacks one or more amino acid residues from the N-terminus and / or C-terminus of a mutant protein while retaining the desired function and activity. Within the scope of the present invention, the fragment is referred to as a bioactive fragment. In the present invention, “bioactive fragment” means a portion of the mutant protein of the present invention that retains the bioactivity of the mutant protein of the present invention. For example, a bioactive fragment of a mutant protein may be a bioactive fragment that lacks one or more amino acid residues (e.g., 1 to 50, 1 to 25, 1 to 10, or 1 to 5, e.g., 1, 2, 3, 4, or 5) at the N-terminus and / or C-terminus of the protein, but still retains the desired biological activity of the full-length protein.

[0067] As used herein, the term “mutation” refers to a change in a single amino acid in a polypeptide and / or a change in at least a single nucleotide in a nucleic acid sequence, compared to a normal sequence, a wild-type sequence, or a reference sequence. In some embodiments, a mutation refers to a change in a single amino acid in a polypeptide and / or a change in at least a single nucleotide in a nucleic acid sequence, compared to a nucleotide or amino acid sequence of a non-herbicide-resistant PPO protein. In certain embodiments, a mutation refers to having one or more mutations at an amino acid position corresponding to a reference PPO amino acid sequence, for example, shown in any of SEQ ID NOs: 1-19, or at a homologous position of a homologous gene from a different species. In certain embodiments, a mutation may include substitutions, deletions, inversions, or insertions. In some embodiments, substitutions, deletions, insertions, or inversions may involve changes at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides. In some embodiments, substitutions, deletions, insertions, or inversions may involve changes at 1, 2, 3, 4, 5, 6, 7, or 8 amino acid positions.

[0068] The term "wild-type" is related to variation and refers to the phenotype that is most frequent within a particular population, or to the lineage, organism, and gene that possesses that phenotype. In some cases, a wild-type allele refers to the standard allele at a locus, or the allele that is most frequent in a particular population, and may be represented by a specific amino acid sequence or nucleic acid sequence. For example, wild-type rice PPO protein may be represented by SEQ ID NO: 1. For example, wild-type maize PPO protein may be represented by SEQ ID NO: 2.

[0069] In another embodiment, according to the present invention, (1) Nucleic acid sequences encoding PPO polypeptides or their biologically active fragments, or partial sequences or complementary sequences thereof; (2) Nucleic acid sequences that hybridize with the sequences shown in (1) under stringent conditions; and (3) A nucleic acid sequence that codes for the same amino acid sequence as the sequence shown in (1) by degeneracy of the genetic code, or a complementary sequence thereof. Isolated polynucleotides containing nucleic acid sequences selected from the group consisting of are also provided.

[0070] In one embodiment, the polynucleotide is a DNA molecule.

[0071] The terms “polynucleotide,” “nucleic acid,” “nucleic acid molecule,” or “nucleic acid sequence” are interchangeable to refer to oligonucleotides, nucleotides, or polynucleotides, and their fragments or portions, which may be single-stranded or double-stranded, and represent sense or antisense strands. Nucleic acids may include DNA, RNA, or hybrids thereof, and may be of natural or synthetic origin. For example, nucleic acids may include mRNA or cDNA. Nucleic acids may include amplified nucleic acids (e.g., using polymerase chain reaction). Nucleic acid single-letter codes are listed in the U.S. Patent and Trademark Office's Manual of Patent Examining Procedure, section 2422, table 1. In this regard, the nucleotide symbol “R” means purines such as guanine or adenine; “Y” means pyrimidines such as cytosine or thymine (uracil in the case of RNA); “M” means adenine or cytosine; “K” means guanine or thymine; and “W” means adenine or thymine. The term "isolated," when referring to nucleic acids, means that they are separated from a substantial portion of the naturally occurring genome and / or substantially separated from other cellular components naturally associated with such nucleic acids. For example, nucleic acids produced synthetically (e.g., by sequential base condensation) are considered isolated. Similarly, nucleic acids that are expressed by recombination, cloned, produced by primer extension reactions (e.g., PCR), or otherwise excised from the genome are also considered isolated.

[0072] It will be apparent to those skilled in the art that, due to the degeneracy of the genetic code, various different nucleic acid sequences can encode the amino acid sequences disclosed herein. Those skilled in the art can generate additional nucleic acid sequences encoding the same protein, and therefore, the present invention encompasses nucleic acid sequences encoding the same amino acid sequence due to the degeneracy of the genetic code. For example, to achieve high expression of heterologous genes in host organisms such as plants, genes can be optimized using codons preferred by the host to enhance expression.

[0073] According to the present invention, a plant genome containing the above-mentioned polynucleotides is also provided.

[0074] In one embodiment, the plant genome is modified by at least one mutation. In another embodiment, the plant genome is modified by at least two mutations.

[0075] In one embodiment, the plastid PPO gene is modified by a plant genome mutation such as that of the rice plastid OsPPO1. In another embodiment, the plastid PPO gene allele is modified by a plant genome mutation such as that of BnPPO1-C5 or BnPPO1-A10.

[0076] The present invention also provides a vector construct comprising a polynucleotide and a homologous or non-homologous promoter operably linked thereto.

[0077] According to the present invention, a host cell containing a polynucleotide or vector construct is also provided.

[0078] In one embodiment, the host cell is a plant cell.

[0079] The present invention also provides a method for producing plant cells to acquire or improve resistance to PPO inhibitory herbicides, comprising producing the above-mentioned polynucleotide or vector construct within plant cells using a gene editing method, or introducing the above-mentioned polynucleotide or vector construct into plant cells using a transgenic method.

[0080] The present invention also provides a method for producing plants to acquire or improve resistance to PPO inhibitory herbicides, which includes regenerating the plant cells described above or plant cells produced by the production method described above.

[0081] According to the present invention, plants produced by the manufacturing method described above are also provided.

[0082] In one embodiment, the plant or plant cell described above is non-transgenic.

[0083] In another embodiment, the plant or plant cell described above is transgenic.

[0084] The term “transgenic” plant refers to a plant containing heterologous polynucleotides. Preferably, the heterologous polynucleotides are stably incorporated into the genome so that the polynucleotides are passed on to subsequent generations. Heterologous polynucleotides may be incorporated into the genome alone or as part of a recombinant expression cassette. As used herein, “transgenic” is used to refer to any cell, cell line, callus, tissue, plant part, or plant whose genotype has been altered by the presence of heterologous nucleic acids, and includes the first transgenic organism or cell thus modified, and transgenic cells or cells produced by crossing or asexual reproduction from the first transgenic organism or cell. As used herein, the term “transgenic” is not intended to encompass alterations of the genome (chromosomal or extrachromosomal) by conventional plant breeding methods (e.g., crossing) or by spontaneous events such as, for example, self-fertilization, random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant translocation, or spontaneous mutation.

[0085] The terms “gene-edited plant,” “gene-edited plant portion,” or “gene-edited plant cell” refer to a plant, plant portion, or plant cell containing one or more endogenous genes edited by a gene-editing system. The term “gene-editing system” refers to a protein, nucleic acid, or combination thereof that, when introduced into a cell, can modify a target gene locus of an endogenous DNA sequence. Numerous gene-editing systems suitable for use in the methods of the present invention are known in the art and are not limited to, but include zinc finger nuclease systems (ZFNs), transcription activator-like effector nuclease systems (TALENs), and CRISPR / Cas systems. As used in the present invention, the term “gene editing” usually refers to a technique in which DNA is inserted, deleted, modified, or replaced within a genome. For example, a common gene-editing method used by those skilled in the art is the knock-in method. See “Gene Target: A Practical Method” (Edited by Joyner, Oxford University Press, 2000).

[0086] The present invention also provides a method for enabling plants to acquire or improve resistance to PPO inhibitory herbicides, comprising introducing a modification to a gene encoding a protein having PPO activity to produce a PPO polypeptide or a bioactive fragment thereof.

[0087] According to the present invention, a method for acquiring or improving resistance to a PPO inhibitor in plant cells, plant tissue, plant parts, or plants, comprising expressing a PPO polypeptide or a bioactive fragment thereof in plant cells, plant tissue, plant parts, or plants; or This includes hybridizing a plant expressing a PPO polypeptide or a bioactive fragment thereof with another plant, and screening the plant or part thereof that can acquire or improve resistance to PPO inhibitory herbicides; or This includes gene editing of plant cells, plant tissues, plant parts, or plant proteins having PPO activity to achieve the expression of PPO polypeptides or their bioactive fragments. The aforementioned method is also provided.

[0088] The present invention also provides the use of PPO polypeptides or their bioactive fragments, or polynucleotides, for acquiring or improving resistance of host cells, plant cells, plant tissues, plant parts, or plants to PPO inhibitory herbicides.

[0089] In one embodiment, the host cell is a bacterial cell or a fungal cell.

[0090] Herbicide-resistant PPO proteins can be obtained from natural sources by extraction and purification using methods widely known in the art. Alternatively, they may be obtained as synthetic proteins prepared by chemical synthesis, or as recombinant proteins prepared by genetic engineering. When chemically synthesized, the protein can be obtained by polypeptide synthesis methods widely known in the art. When using genetic engineering, nucleic acids encoding the herbicide-resistant PPO protein are inserted into a suitable expression vector, this vector is transformed into host cells, the host cells are cultured to express the target protein, and then the herbicide-resistant PPO protein is recovered from the host cells. After expressing the protein in selected host cells, general biochemical separation techniques, such as treatment with protein precipitants (salting out), centrifugation, sonication, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, can be used for separation and purification. Generally, these methods may be used in combination to separate the protein with high purity.

[0091] Herbicide-resistant PPO nucleic acid molecules can be isolated or prepared using standard molecular biological techniques, such as chemical synthesis or recombinant methods. Alternatively, commercially available molecules may be used.

[0092] The PPO proteins provided herein can be introduced into plants and used to enhance their herbicide resistance.

[0093] The herbicide-resistant PPO gene provided herein can be introduced into plants by various methods known in the art, and can be transgenic or gene-edited using an expression vector for plant transformation.

[0094] Suitable promoters that may be included in the vector may be any promoter commonly used in the art for plant transgenicity or gene editing. For example, promoters commonly used for plant transgenicity or gene editing include, but are not limited to, the SP6 promoter, T7 promoter, T3 promoter, PM promoter, maize ubiquitin promoter, cauliflower mosaic virus (CaMV) 35S promoter, nopalin synthase (nos) promoter, fig mosaic virus 35S promoter, sugarcane rod-shaped virus promoter, Commelina communis yellow spot virus promoter, photoinducible promoter derived from the small subunit of ribulose-1,5-bisphosphate carboxylase (ssRUBISCO), rice cytozol triose phosphate isomerase (TPI) promoter, Arabidopsis thaliana adenine phosphoribosyltransferase (APRT) promoter, octopin synthase promoter, and BCB (blue copper-binding protein) promoter.

[0095] Plant transgenic vectors or gene editing vectors contain polyadenylation signal sequences that induce 3' end polyadenylation, including, but are not limited to, the NOS 3' end from the nopalin synthase gene of Agrobacterium tumefaciens, the octopine synthase 3' end from the octopine synthase gene of Agrobacterium tumefaciens, the 3' end of the protease inhibitor I or II gene of tomato or potato, the CaMVPolyA signal sequence, the 3' end of the α-amylase gene of rice, and the 3' end of the phaseolin gene.

[0096] In the transgenic vector described above, a transit peptide necessary for targeting chloroplasts may be attached to the 5' end of the PPO gene in order to express the herbicide-resistant PPO gene in chloroplasts.

[0097] The vector may further contain a gene encoding a selection marker as a reporter molecule, and examples of selection markers include, but are not limited to, resistance genes to antibiotics (e.g., neomycin, carbenicillin, kanamycin, spectinomycin, hygromycin, bleomycin, chloramphenicol, etc.) or herbicides (glyphosate, glufosinate, phosphinothricin, etc.).

[0098] Vector transformation methods include Agrobacterium-mediated transformation, electroporation, microparticle bombardment, and polyethylene glycol-mediated uptake, among others, for the introduction of recombinant plasmids into plants.

[0099] The plants to be transformed in this invention include plant cells (including suspension cultured cells), protoplasts, callus, hypocotyls, seeds, cotyledons, shoots, and mature plants.

[0100] The scope of transgenic plants or gene-edited plants includes contemporary plants into which genes have been introduced, and their clones or progeny (T1 generation, T2 generation, or subsequent generations). For example, it includes transgenic plants or gene-edited plants containing nucleotide sequences encoding PPO polypeptides resistant to PPO inhibitory herbicides provided in the present invention, as well as progeny obtained by sexual and asexual reproduction containing nucleotide sequences encoding the aforementioned PPO polypeptides resistant to PPO inhibitory herbicides, and plants that have inherited the herbicide resistance characteristic. The scope of the present invention also includes all mutants and variants exhibiting the characteristics of the initial transgenic plant or gene-edited plant, as well as all hybridization and fusion products of the transgenic plants or gene-edited plants described above. Furthermore, the scope of the present invention also includes plant parts such as seeds, flowers, stems, fruits, leaves, roots, tubers, and rhizomes derived from plants that have been previously transgenic or genetically modified by the method of the present invention, or their progeny, and which consist of at least a portion of the introduced gene or genetically modified cells.

[0101] The present invention also provides a method for controlling weeds in a plant cultivation area, comprising applying an effective amount of a PPO inhibitor-type herbicide to the cultivation area, wherein the plant includes the plant described above or a plant produced by the method described above.

[0102] In one embodiment, a PPO inhibitor herbicide is used to control weeds.

[0103] In another embodiment, two or more PPO inhibitory herbicides are used sequentially or simultaneously to control weeds.

[0104] In another embodiment, a PPO inhibitor herbicide is applied in combination with one or more additional herbicides.

[0105] In the present invention, "cultivation site" includes the soil and other places where the plants of the present invention are cultivated, and also includes, for example, plant seeds, plant seedlings, and grown plants. The term "effective herbicide amount" means an amount of herbicide sufficient to affect the growth or development of a target weed, for example, an amount sufficient to prevent or inhibit the growth or development of a target weed, or to kill the weed. Advantageously, such an effective herbicide amount does not have a significant effect on the seeds, seedlings, or growth and / or development of the plants of the present invention. Those skilled in the art can determine such an effective herbicide amount through conventional experiments.

[0106] The present invention can be embodied in many different forms and should not be construed as being limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure may be thorough and complete and so that the scope of the invention may be fully conveyed to those skilled in the art. Throughout, similar reference numerals refer to similar elements.

[0107] Terms such as "first," "second," and "third" may be used in this specification to describe various elements or components, but it will be understood that these elements or components should not be limited by these terms. These terms are used solely to distinguish one element or component from another.

[0108] The terms used herein are intended solely to describe specific embodiments and are not intended to limit them. Where used herein, the singular forms “a,” “an,” and “the” include the plural form unless otherwise clearly indicated by the context. Furthermore, the terms “comprise” and / or “comprising,” or “include” and / or “including” as used herein, identify the presence of the described features, elements, and / or components, but do not exclude the presence or addition of one or more other features, elements, or components and / or groups thereof. Where used herein, the term “and / or” encompasses any combination of one or more of the related enumerated items.

[0109] Although the present invention has been described in detail in relation to numerous embodiments, the present invention is not limited to such disclosed embodiments. Rather, the present invention can be modified to incorporate any number of variations, changes, substitutions or equivalent configurations that are not described herein but are within the scope of the invention.

[0110] The beneficial effect of the present invention is that the mutant forms can reduce the inhibitory effect of PPO-inhibiting herbicides on PPO having the mutant form, while at the same time, these mutants do not reduce the catalytic activity of PPO itself. Plant resistance to PPO-inhibiting herbicides can be significantly improved by modifying endogenous PPO into these mutant forms by gene editing, or by introducing genes having such PPO mutant forms into plants by transgenic means. Such PPO mutant forms can be used in plants, including commercial crops, according to their herbicide resistance characteristics and herbicide selectivity, in order to economically control weed growth. [Examples]

[0111] The present invention will be further described in conjunction with the following examples. All methods and operations described in the examples are provided as examples and should not be construed as limiting.

[0112] Example 1: Alignment of the amino acid sequence of plant-derived PPO PPO is present in animals, plants, bacteria, and fungi, and catalyzes the conversion of protoporphyrinogen IX to protoporphyrin IX in the presence of molecular oxygen. PPO is the final crucial enzyme in the biosynthesis of tetrapyrroles, including ferroheme and chlorophyll as its main synthesis products. Two types of PPO isozymes exist in plants, located in mitochondria and chloroplasts, respectively. Figure 1 shows rice (NCBI number: XM_015770568.2 (SEQ ID NO: 1)), maize (NCBI number: NM_001112094 (SEQ ID NO: 2)), rapeseed (NCBI number: BnPPO1-C5:XM_013841402.2 (SEQ ID NO: 3); BnPPO1-A10:XM_013810914.2 (SEQ ID NO: 4)), and peanut (NCBI number: AhPPO1-A:XM_025762937.2 (SEQ ID NO: 5); AhPPO 1-B:XM_025820369.2 (Sequence ID 6), Soybean (NCBI number:XM_003535957.4 (Sequence ID 7)), Sorghum (NCBI number:XM_002455439.2 (Sequence ID:6)), Wheat (NCBI number:TaPPO1-A:XP_037432241.1 (Sequence ID:9);TaPPO1-B:XM_037583444.1 (Sequence ID:10);TaPPO1-D:(Sequence ID:11)), Tomato ( NCBI number: NM_001348379.1 (Sequence ID: 12)), Potato (NCBI number: NP_001275224.1 (Sequence ID: 13)), Tobacco (NCBI number: XM_016654498.1 (Sequence ID: 14)), Arabidopsis taliana (NCBI number: AT4G01690 (Sequence ID: 15)), Highland cotton (NCBI number: XM_016840317.1 (Sequence ID: 16)), Radish (NCBI number: XP_0 18459031.1 (Sequence ID: 7), Millet (NCBI ID: XP_004967639.1 (Sequence ID: 18)), Cabbage (NCBI ID: XM_013731605.1 (Sequence ID: 19)), Yam (NCBI ID: XP_039129342.1), Cassava (NCBI ID: XM_021757904.2), Pepper (NCBI ID: XM_016683798.1), Pumpkin (NCBI ID: XM_023107680.1) Barley (NCBI number: XM_045092307.1), Cucumber (NCBI number: XM_004149431.3), Lettuce (NCBI number: XM_023904577.2), Sesame (NCBI number: XM_011081162.2), Sunflower (NCBI number: XM_022132124.2), Mulberry (NCBI number: XM_010093132.2), Cowpea (NCBI number: XM_017556834.1), Strawberry (NCBI number: XM_004289391.2), Apple (NCBI number: XM_00 This shows alignments of PPO amino acid sequences from different plants, including 8383404.3), peach (NCBI number: XM_007221411.2), cherry (NCBI number: XM_021956996.1), apricot (NCBI number: XM_034353497.1), European grape (NCBI number: XM_013613689.3), papaya (NCBI number: XM_022041496.1), and alfalfa (NCBI number: XM_013613689.3), which are PPO protein motifs LL. L N Y This indicates that I is conserved across different plant species. Therefore, the biological effects of mutations in the corresponding sites of this motif may also be consistent across different species.

[0113] Example 2: Cloning of the rice proporphyrinogen oxidase PPO1 gene The protoporphyrinogen IX oxidase (PPO) gene in rice (Oryza sativa, Japonica Group) is located at site Os01g18320 on chromosome 1. Primers NusOs-F:acgattgatgacgacgacaagATGGCGGCGGCGGCGGCG and NusOs-R:tccacgagctcccggactcTTACTTGTACGCATACTTGGTC were designed and synthesized according to their cDNA sequences and vector pET-44a sequences. Wild-type rice cDNA was used as a template, and Kod DNA polymerase was used for PCR amplification. Amplification was performed under the following conditions: 2 minutes at 98°C; then 35 cycles of 20 seconds at 98°C, 30 seconds at 65°C, and 60 seconds at 68°C; and finally 5 minutes at 68°C. The amplified fragment was shown to be 1.6 Kb by agarose gel electrophoresis, and after recovery, the DNA concentration was measured by UV absorption.

[0114] The pET-44a plasmid (Novagen) was digested with PshAI (NEB, New England Biolabs, Boston, USA) at 37°C for 1 hour, and then the PshAI was inactivated by heating to 65°C. Equal volumes of OsPPO1 DNA fragments and PshAI-linearized pET-44a vector were mixed, and then equal volumes of 2× Gibson Assembly Master Mix (Hanbio, Shanghai, China) were added. After mixing, the homogeneous mixture was incubated at 50°C for 1 hour. Competent Escherichia coli DH5a were transformed using 5 μl of ligation product; this suspension was spread on the surface of an LB solid medium plate containing 100 ppm ampicillin and incubated overnight at 37°C. The following day, individual clones were selected, and the exact clones were confirmed by individual bacterial colony PCR. Three exact clones were then incubated overnight at 37°C to extract sufficient plasmid DNA, which was sent to Qingke Biotechnology Co., Ltd. (Beijing, China) for Sanger sequencing. The sequencing primers used were NUS-F:GCTGCTGCGAAATTTGAACG and NUS-R:TACAGCTGTGCGGCCGCAAG. Sequencing revealed that the full-length rice OsPPO1 coding region DNA was obtained accurately, and the resulting wild-type rice PPO expression vector was named pET44a-OsPPO1WT.

[0115] The resistance of rice OsPPO1 to herbicides was tested using PPO-deficient Escherichia coli (ΔhemG). The ΔhemG strain is an Escherichia coli strain lacking the hemG-type PPO gene and resistant to kanamycin (Watanabe N, Che FS, Iwano M, et al. Dual Targeting of Spinach Protoporphyrinogen Oxidase II to Mitochondria and Chloroplasts by Alternative Use of Two In-frame Initiation Codons[J]. Journal of Biological Chemistry, 2001, 276(23):20474-20481). The cloned rice OsPPO1 plasmid prepared above was transfected into competent cells of ΔhemG, and PPO activity of the knockout bacteria was restored by electrotransmission. The rice OsPPO1 plasmid could be grown in LB AGAR medium supplemented with ampicillin and kanamycin.

[0116] To verify whether this system can be used for evolutionary screening of rice PPO1 gene resistance to compound A, we tested the differences in growth of complementary strains of wild-type rice pET44a-OsPPO1 WT on plates containing a PPO inhibitor herbicide. Transformed complementary strains ΔhemG / pET44a and ΔhemG / pET44a-OsPPO1WT clones were selected and resuspended in 100 μl of LB medium. The diluted solutions were then rediluted four times consecutively by a factor of 10. Next, 3 μl of each dilution was added to LB agar plates (culture dishes) containing compound A at concentrations of 0 nM, 300 nM, and 1000 nM. The LB agar plates were incubated at 28°C, and growth inhibition was evaluated after 40–48 hours of incubation.

[0117] As shown in Figure 2, in a culture medium without herbicides, the ΔhemG / pET44a complementary strain did not grow, whereas the complementary strain of transgenic rice ΔhemG / pET44a-OsPPO1 WT was able to grow normally. This suggests that the complementary OsPPO1 performs normal PPO function in deficient Escherichia coli.

[0118] The proliferation of wild-type rice ΔhemG / pET44a-OsPPO1 WT complementary strains was inhibited at 300 nM, and clones did not proliferate on plates in media containing various concentrations of compound A. Furthermore, it was demonstrated that this system can be used for evolutionary screening of rice OsPPO1 gene resistance to compound A.

[0119] Example 3: Screening of rice OsPPO1-resistant sites for compound A using PPO-deficient Escherichia coli (ΔhemG). To screen for the resistance site of the rice OsPPO1 gene to compound A, according to the alignment results of PPO amino acids from different plants in Example 1, the rice motif LL L N YSaturated amino acid mutations were performed at the site containing I. This was achieved by PCR amplification of a primer containing the desired mutation that alters the amino acid coding sequence to NNK, and another suitable conventional primer. In NNK, N represents A / T / G / C, K represents G / T, and the NNK codon can encode either 20 amino acids or a stop codon. Thus, this was saturated mutagenesis. See Kille S, Acevedo-Rocha CG, Parra LP, Zhang ZG, Opperman DJ, ReetzMT, AcevedoJP (2013) Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis. ACS Synth Biol 2(2):83-92;Directed Evolution Library Creation: methods and protocols 2nd ed. Edited by Elizabeth MJ Gillam, Janine N. Copp and David F. Ackerley New York, NY United States: Springer, 2014. doi:10.1007 / 978-1-4939-1053-3. A large number of mutants will be generated. Plasmids constructed from saturated libraries containing different sites were transformed into ΔhemG-competent cells, and resistance to compound A at different sites of the rice PPO1 gene was screened using the Escherichia-Coli screening system of Example 2. Subsequently, resistant clones that grew normally from plates containing compound A were selected, and their genotypes were identified. Six single-amino acid mutants were screened: L423S (SEQ ID NO: 20), L423I (SEQ ID NO: 21), L423G (SEQ ID NO: 22), Y425M (SEQ ID NO: 23), Y425I (SEQ ID NO: 24), and Y425V (SEQ ID NO: 25). As shown in Figure 3, compared to the wild type, these resistant mutants grew normally on LB medium containing 500 nM of compound A.

[0120] Specific experimental method: 1. Using OsPPO1-423-F and OsPPO1-423-R as primers, the pET44a-OsPPO1 WT plasmid prepared in Example 2 was used as a template for PCR amplification using Kod DNA polymerase. Amplification was performed under the following conditions: 3 minutes at 98°C; 35 cycles of 20 seconds at 98°C, 30 seconds at 65°C, and 3 minutes at 72°C; and 5 minutes at 72°C. After detection by agarose gel electrophoresis, bands of the correct size (approximately 9KB) were collected, and the concentration was measured by UV absorption. 2. 5 μl of the recovered product was added to an equal volume of 2 × Gibson Assembly Master Mix (Hanbio, Shanghai, China), thoroughly mixed, and incubated at 50°C for 1 hour; 5 μl of the ligation product was used to transform competent Escherichia coli DH5α, and this bacterial suspension was spread onto the surface of an LB solid medium plate containing 100 ppm ampicillin and incubated overnight at 37°C. All clones (colonies) on the plate were scraped off, plasmids were extracted, and DNA was quantified by UV absorption. 3. 100 ng of the constructed plasmid was transformed into ΔhemG competent cells, spread onto LB medium plates containing 500 nM of compound A, and cultured overnight. Resistant clones that grew normally were selected from the plates containing compound A, and their genotypes were identified.

[0121] [Table 2]

[0122] Example 4: Verification of herbicide resistance of combinations of parts of rice OsPPO1 that possess resistance using PPO-deficient Escherichia coli (ΔhemG). To further enhance the resistance of rice OsPPO1 to PPO inhibitory herbicides, screened single mutants L423S and Y425I, which exhibit resistance to compound A, were preferably selected and combined, and their resistance to herbicides was tested using the Escherichia-Coli screening system. The L423S / Y425I site combination (SEQ ID NO: 26) also showed resistance to compound A. The screened single sites or site combinations were cultured on plates containing compound A at different concentrations of 0 μM, 1 μM, 10 μM, 20 μM, 50 μM, and 100 μM, and their growth inhibition was observed. The screening results are shown in Figure 4. While significant growth inhibition occurred in certain site combinations as the concentration of compound A increased, the mutant site combination L423S / Y425I showed high resistance to treatment with compound A at a concentration of 100 μM, and also exhibited normal growth. This suggests that the combination of mutant sites L423S / Y425I improves rice's resistance to herbicide compound A compared to the single mutants L423S and Y425I.

[0123] Specific experimental method: 1. Using the synthesized OsPPO1-423S / 425I-F and OsPPO1-423S / 425I-R as primers, PCR amplification was performed using Kod DNA polymerase with the pET44a-OsPPO1 WT plasmid prepared in Example 2 as a template. Amplification was performed under the following conditions: 3 minutes at 98°C; 35 cycles of 20 seconds at 98°C, 30 seconds at 65°C, and 3 minutes at 72°C; and 5 minutes at 72°C. After detection by agarose gel electrophoresis, bands of the correct size (approximately 9KB) were collected, and the concentration was measured by UV absorption. 2. 5 μl of the recovered product was added to an equal volume of 2 × Gibson Assembly Master Mix (Hanbio, Shanghai, China), thoroughly mixed, and incubated at 50°C for 1 hour; 5 μl of the ligation product was used to transform competent Escherichia coli DH5α, and this bacterial suspension was spread onto the surface of a plate of LB solid medium containing 100 ppm ampicillin and incubated overnight at 37°C. All clones (colonies) on the plate were scraped off, plasmids were extracted, and DNA was quantified by UV absorption. 3. 100 ng of the constructed plasmid was used to transform ΔhemG-competent cells, which were then spread onto LB medium plates containing 500 nM of compound A and cultured overnight. Growth inhibition was observed. 4. Clones of the transformed complementary strains ΔhemG / pET44a-OsPPO1 WT, ΔhemG / pET44a-OsPPO1 L423S, ΔhemG / pET44a-OsPPO1 Y425I, and ΔhemG / pET44a-OsPPO1 L423S / Y425I were selected and resuspended in 100 μl of LB medium. The diluted solutions were then diluted four times consecutively by a factor of 10. Next, 3 μl of each dilution was added to LB agar plates (culture dishes) containing compound A at concentrations of 0 nM, 1 nM, 10 nM, 20 nM, 50 nM, and 100 nM. The LB agar plates were incubated at 28°C, and growth inhibition was evaluated after 40-48 hours of incubation.

[0124] Example 5: Verification of resistance of the mutant LLLNYI protein motif to compound A in maize ZmPPO1. Protein motif LL conserved in PPO1 of other plants L N Y To investigate whether herbicide resistance can also be conferred by mutations in I, we used the protein motif LL. L N YCombinations of mutations in the leucine residue at position 3 and the tyrosine residue at position 5 of I were performed using the same method as described in the examples above, and screening was performed using LB medium containing herbicidal compound A to observe growth inhibition. As shown in Figure 5, compared to wild-type ZmPPO1-WT (SEQ ID NO: 2), protein motif LL including L424T / Y426V (SEQ ID NO: 27), L424S / Y426V (SEQ ID NO: 28), L424V / Y426L (SEQ ID NO: 29), and L424W / Y426L (SEQ ID NO: 30) were observed. L N Y The combination of mutations in the leucine residue at position 3 and the tyrosine residue at position 5 in compound I resulted in normal growth without inhibition on plates containing compound A at a concentration of 5 μM. The majority of these showed high tolerance to increasing concentrations of compound A, which is a conserved protein motif LL in PPO of various plants. L N Y This suggests that the herbicide resistance conferred by mutations in the corresponding site of I has a consistent effect.

[0125] Example 6: Verification of resistance of LLLNYI protein motif mutations to compound A and other PPO inhibitory herbicides in PPO1 of other crops. Protein motifs LL conserved in PPO of other crops L N YTo further investigate the effect of mutations in the corresponding sites of I on herbicide resistance, we used OsPPO1 WT (SEQ ID NO: 1) from wild-type rice PPO1, OsPPO1 L423S / Y425I (SEQ ID NO: 26) from mutant rice PPO1, ZmPPO1 WT (SEQ ID NO: 2) from wild-type maize PPO1, ZmPPO1 L424S / Y426I (SEQ ID NO: 31) from mutant maize PPO1, TaPPO1-A WT (SEQ ID NO: 9) from wild-type wheat PPO1, TaPPO1-A L418S / Y420I (SEQ ID NO: 38) from mutant wheat PPO1, BnPPO1-A10 WT (SEQ ID NO: 4) from wild-type rapeseed PPO1, BnPPO1-A10 L423S / Y425I (SEQ ID NO: 33) from mutant rapeseed PPO1, and GhPPO1 from wild-type cotton PPO1. WT (SEQ ID NO: 16), mutant cotton PPO1 GhPPO1 L426S / Y428I (SEQ ID NO: 45), wild-type Arabidopsis talliana PPO1 AtPPO1 WT (SEQ ID NO: 15), and mutant Arabidopsis talliana PPO1 AtPPO1 L423S / Y425I (SEQ ID NO: 44) were constructed and transformed into PPO-deficient Escherichia coli (ΔhemG) using the same methods as described in Examples 3 and 4 and the primers shown in Table 2. Clones of PPO-deficient Escherichia coli (ΔhemG) transformed with wild-type PPO1 genes from various crops or various mutant PPO1 genes were selected, resuspended in 100 μl of LB medium, and then the diluted solution was diluted twice again by a factor of 10.Next, 3 μl of each dilution was placed in LB agar (culture dish) containing compound A at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, respectively; LB agar (culture dish) containing saflufenacil at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, respectively; LB agar (culture dish) containing flumioxazin at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, respectively; LB agar (culture dish) containing epiriphenacil at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, and... LB agar (culture dish) containing ruphenthrazone at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, respectively; LB agar (culture dish) containing thiafenacil at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, respectively; LB agar (culture dish) containing fomesaphen at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 100 μM, respectively; and LB agar (culture dish) containing trifludimoxazine at concentrations of 0.1 μM, 0.5 μM, 1 μM, 10 μM, and 10 μM, respectively, were added. The LB agar was cultured in a 28°C incubator, and growth inhibition was evaluated after 40-48 hours of incubation. The results are shown in Figures 6-8, demonstrating that the resistant parts or combinations in Examples 3 and 4 are also resistant to other PPO herbicides.

[0126] [Table 3]

[0127] Example 7: Verification of resistance of rice OsPPO1 to various types of PPO herbicides in resistant parts or combinations. To verify whether the resistant sites or combinations in Examples 3 and 4 also possessed resistance to other PPO herbicides, several sites or combinations were selected and their resistance to various types of PPO herbicides was tested. Clones of PPO-deficient Escherichia coli (ΔhemG) transformants transformed with wild-type (WT) OsPPO1 genes or various mutant OsPPO1 genes were selected, resuspended in 100 μl of LB medium, and then the diluted solution was rediluted twice consecutively by a factor of 10. Then, 3 μl of each dilution was added to LB agar plates (culture dishes) containing 100 nM flumioxazine, 100 nM oxyfluorphene, 500 nM saflufenacil, 5 μM pyraclonil, 1 μM carfentrazon ethyl, and 10 μM fomesaphene, respectively. The LB agar plates were incubated in a 28°C incubator, and growth inhibition was evaluated after 40–48 hours of incubation. The results are shown in Figure 9, demonstrating that the resistant parts or combinations in Examples 3 and 4 are also resistant to other PPO herbicides.

[0128] Example 8: In vitro enzyme activity and resistance test of combined protein (polypeptide) with resistance sites of rice OsPPO1 1. Preparation of protoporphyrinogen Protoporphyrinogen, a substrate catalyzed by PPO, was prepared by reducing protoporphyrin with sodium amalgam. 10 mg of protoporphyrin was dissolved in 10 mL of solvent, and 0.2 g / mL of 20% sodium amalgam was added. The mixture was reacted for 2 hours and then filtered in the dark under nitrogen protection. After the reaction was complete, the reaction solution was colorless or light brown. The reaction solution was diluted with reaction buffer (100 mM Tris-HCl, 1 mM EDTA, 5 mM DTT, 0.1% Tween 20 / 80), and the pH was adjusted to approximately 8.0 using 10% hydrochloric acid. Finally, protoporphyrinogen at a concentration of approximately 100 μM was obtained, which was subpackaged and stored in liquid nitrogen or at -80°C. 2. Expression and purification of the OsPPO1 protein 1) Using 28MBP-OsPPO1-T38F:CCGCGCGGCAGCCATATGGCGGGTTCTGGTACGATTG and 28MBP-OsPPO1-T38Rn:GAGCTCGAATTCGGATCCTTACTTGTACGCATACTTGGTCAG as primers, pET44a-OsPPO1-WT and screening mutants were used as templates for PCR amplification using Kod DNA polymerase. Amplification was performed under the following conditions: 3 minutes at 95°C; 10 seconds at 98°C, 30 seconds at 60°C, 1 minute at 68°C, 35 cycles; 5 minutes at 68°C. After detection by agarose gel electrophoresis, bands of the correct size (approximately 1.5 KB) were collected and their concentrations were measured by UV absorption. 2) 4 μl of the recovered product and 1 μl of the pET28a-MBP vector were added to equal volumes of 2× Gibson Assemble Master Mix (Hanbio, Shanghai, China), mixed, and incubated at 50°C for 1 hour; 5 μl of the ligation product was used to transform competent Escherichia coli DH5α, and this bacterial suspension was spread onto the surface of an LB solid medium plate containing 100 mg / L kanamycin sulfate and incubated overnight at 37°C. All clones on the plate were selected and sequenced. 3) The constructed fusion expression vector pET28a-MBP-OsPPO1 was introduced into Escherichia coli BL21(DE3), expression was induced with 0.5 mM IPTG, then purified by Ni-NTA column, followed by thrombin digestion and dialyze. Further purification was performed using dextrin and Ni columns. The specific method is as follows: OsPPO1 enzyme recombinant expression vector was transformed into BL21(DE3) cells, clones were selected in 10 ml of LB medium, cultured overnight in Kana-resistant conditions at 37°C and 200 rpm on a shaker, then transferred to a 2 L shaking flask containing 1 L of TB medium, cultured at 37°C and 200 rpm on a shaker until the OD600 reached 0.6-0.8, cooled to 18°C, and expression was induced overnight with 0.5 mM IPTG. The strains were collected by centrifugation at 4000 × g. The collected bacterial strains were resuspended in Ni buffer A (50 mM Tris, pH 8.0, 500 mM NaCl, 50 mM imidazole), homogenized in a high-pressure cell homogenizer, and centrifuged at 4000 × g at 4°C for 30 minutes; the supernatant was purified using a Ni column, and its purity was detected by SDS-PAGE. Thrombin enzyme was added according to the amount of protein, and the solution was dialyzed with 50 mM pH 8.0 Tris, 500 mM NaCl, and 1 mM DTT buffer. On day 2, further purification was performed using dextrin and Ni columns; the eluate containing the target protein was collected, concentrated, subpackaged, and stored at -80°C for later use. 3. Activity test of OsPPO1 Measurement of substrate affinity and enzyme catalytic activity: Reaction solutions containing substrate protoporphyrinogen at various concentrations were prepared using reaction buffer (100 mM Tris-HCl, 1 mM EDTA, 5 mM DTT, 0.1% Tween 20 / 80), with test concentrations of 0.125 μM, 0.5 μM, 2 μM, 4 μM, 8 μM, and 16 μM. The OsPPO1 enzyme was diluted to 10 μM, and 5 μl was absorbed into a black 96-well ELISA plate. The reaction solution was then added until the total volume reached 100 μl. The final usable enzyme concentration was 500 nM. The solutions were immediately mixed thoroughly and monitored with a fluorescence microplate reader. The mixture was stimulated at 410 nm and detected at 630 nm. Reaction curves were constructed as shown in Figure 10.

[0129] Example 9: CRISPR / cas9-mediated homologous substitution of rice PPO1 mutants to acquire herbicide resistance To obtain non-transgenic rice with herbicide resistance, the aforementioned L423S / Y425I mutant site combination was subjected to CRISPR / cas9-mediated homologous substitution. The rice OsPPO1 gene contained nine exons and eight introns, with the two target sites L423S and Y425I located in the eighth exon.

[0130] gRNA design: One gRNA was designed upstream of L423S and downstream of Y425I, and each site was cleaved once; the DNA between the two sites was simultaneously replaced using homologous substitution. The sequence of rice OsPPO1 was used. http: / / crispor.tefor.net / crispor.pyWe entered the data and evaluated all possible gRNAs. Following the principle that the specificity score should be greater than 90 (Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat Biotechnol. 2013 Sep;31(9):827-32. doi: 10.1038 / nbt.2647. Epub 2013 Jul 21), we avoided off-target effects, shortened the length as much as possible, and selected the following two gRNAs: gRNA: Osppo1 gRNA5-2: acatgaactagtaatgattg ggg (upper strand); and Osppo1 gRNA8-3:agcagctggagttgaaaaac agg (Lower strand). Here, the underlined part was the PAM sequence.

[0131] Repair template design: The length of the DNA fragment cleaved by the two selected target RNAs was 1212 bp. However, due to the proximity of sites 423 and 425, the length of the left homology arm was 1127 bp and the length of the right homology arm was 82 bp during repair template design. In addition, digestion target sites were left at both ends to excavate the repair template from the vector. Therefore, the total length of the template was 1258 bp (SEQ ID NO: 49).

[0132] Editing vectors: Osppo1 gRNA5-2 and Osppo1 gRNA8-3 were expressed using the rice U3 promoter, respectively. Therefore, the two gRNA expression cassettes, along with repair templates, were sent to GenScript (Nanjing) Co., Ltd. for synthesis. The two synthesized gRNA expression cassettes and vector pRGEB32 (Addgene#63142) were enzymatically digested with BsaI enzyme, detected by agarose gel electrophoresis, then purified and recovered. The resulting compounds were then ligated and transformed using T4 DNA ligase (NEB, New England Biolabs, Boston, USA) to produce the editing vector.

[0133] Transformation, screening, differentiation, rooting, and soil-grown seedlings using a gene gun: The edited vectors constructed above were validated by sequencing and multi-enzyme digestion, and used in rice transformation using a gene gun along with the synthesized repair template NDA.

[0134] Specific methods for transforming rice calluses using gene guns: 1. High-quality seeds of rice varieties Huaidao No. 5 and Jinjing 818 were selected, sterilized with a solution containing 70% alcohol and 20% sodium hypochlorite, rinsed with sterile water, and inoculated into callus induction medium. After one week of culture, embryos were removed, and the detached callus was inoculated into callus induction medium. After two weeks, subculturing was performed for subsequent infection. 2. Preparation of microprojectiles and gene gun transformation (1) Preparation of gold powder suspension: 30 mg of gold powder (0.6 μm in diameter) was weighed into a 1.5 mL imported EP tube, 1 mL of 70% ethanol was added to it, and the mixture was vortexed thoroughly. The supernatant was discarded by centrifugation; sterile water was added and this process was repeated three times. 500 μL of sterile glycerol (50%) was added and the mixture was vortexed thoroughly to prepare a gold powder suspension with a concentration of 60 μg / μL, which was then stored at -20°C. (2) DNA wrapping: 25 μL of gold powder suspension (60 μg / μL), editing vector and repair template (1:10), 25 μL of CaCl2 (SIGMA) (2.5 mol / L), and 10 μL of spermidine (0.1 mol / L) were successively added to a 1.5 mL centrifuge tube. The above mixed sample was vortexed thoroughly for 3-5 minutes, allowed to stand on ice for 10 minutes, and the supernatant was discarded by centrifugation; finally, 30 μL of anhydrous ethanol was added for resuspension and final volume. (3) Gene gun irradiation: The super clean bench was cleaned, the top of the bench was wiped with alcohol, the equipment was adjusted, and irradiation was performed according to the operating instructions. The irradiation parameters were adjusted to 27 vacuum degrees, 1100 psi, and 6 cm. After irradiation, the callus was cultured at 25°C in the dark for 16 hours, and then the callus was transferred to recovery medium at 25°C and cultured in the dark for 1 week. (4) Screening of resistant callus and plant differentiation: Callus was transferred to a screening medium and the medium was changed every two weeks. After four weeks of screening, samples were taken to detect whether target replacement had occurred. (5) Positive callus was transferred to differentiation medium and cultured in a light incubator at 28°C.

[0135] After inducing resistant callus in rice seedlings, genomic DNA was extracted from transgenic rice, and PCR amplification tests were performed using this DNA as a template. By simultaneously substituting the L423S / Y425I site of the rice OsPPO1 gene, we successfully obtained T0 generation rice lines. To further verify the resistance of the obtained T0 generation rice seedlings to compound A, the seedlings were treated with compound A at a rate of 9 g / ha. As shown in Figure 11, the lines with homologous substitution at the L423S / Y425I site proliferated normally compared to the wild-type lines, which withered after 3 days. This suggests that the mutation in the rice OsPPO1 gene at the L423S / Y425I site conferred resistance to the herbicide compound A to the plants. From seeds collected and cultivated, T1 and T2 generation rice seedlings were obtained. The obtained T1 and T2 generation rice seedlings were also found to be resistant to compound A, and the resistance of the T2 generation rice seedlings to compound A is shown in Table 3.

[0136] [Table 4]

[0137] Example 10: Overexpression of resistance to compound A of LLLNYI protein motif mutation in PPO1 from other crops in Arabidopsis talliana LL in PPO1 derived from various crops L N Y To rapidly verify the resistance of protein motif mutations to compound A, vectors of wild-type and mutant PPO1 genes overexpressed in rice, maize, soybean, and rapeseed were constructed, respectively.

[0138] 1. Construction of an overexpression vector 1) Primers: Primers were designed according to selected restriction enzyme cleavage sites and the nucleotide sequence of the gene itself to amplify wild-type and mutant genes. The designed primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. [Table 5] 2) PCR amplification: The target gene was amplified using synthesized primers and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplified product was detected by agarose gel electrophoresis and collected according to the instructions for the TIAN quick Midi Purification kit. After collection was complete, the concentration of the extracted DNA was measured using Nanodrop. 3) Construction of overexpression vectors: Using the collected PPO1 fragments and plasmid pHSE401V digested with XbaI and SacI, overexpression vectors were constructed using the HB-infusion™ seamless cloning kit from HanBio Biotechnology Co., Ltd. (Shanghai). These vectors were then transformed into competent Escherichia coli DH5α to obtain positive clones; these positive clones were then validated by sequencing and restriction endonuclease digestion, and subsequently transformed into Agrobacterium for later use.

[0139] 2. Transformation of Arabidopsis thaliana by immersion of inflorescences 1) Sowing: Selected seeds of swollen wild-type Arabidopsis taliana with accelerated flowering and fruiting were treated with 75% alcohol for 1 minute, disinfected with 10% NaClO for 6 minutes, and washed 5-6 times with sterile water. After sterilization was complete, the seeds were left to stand on MS medium plates for 1 week, then transplanted into sterile nutrient soil (nutrient soil:vermiculite = 1:1) and cultured in a greenhouse at (25±2)℃ with a photoperiod of 16 hours / 8 hours (light / dark). 2) Activation and preparation of Agrobacterium: Agrobacterium strains containing expression vectors stored at low temperatures were streaked onto resistance plates containing clarithromycin and rifampicin. Single colonies were scraped off and inoculated into 5 mL of liquid LB medium supplemented with the corresponding antibiotic, and cultured with shaking at 28°C and 250 rpm for 18–24 hours. The culture was then expanded under the same conditions according to a 1:100 inoculation ratio until the total volume of bacterial solution reached 50 mL, with an OD6000 in the range of 1.0–1.5. 3) Preparation of infection solution: The culture bacterial solution was centrifuged at 6000 rpm for 10 minutes, and the supernatant was discarded. Stain was resuspended in the infection solution containing 5% sucrose until the OD6000 was approximately 0.8. Silwet L-77 (0.02%~0.04%) was added to the bacterial solution and mixed thoroughly. 4) Infection of Arabidopsis thaliana inflorescences: Uninfected Arabidopsis thaliana plants with good growth and abundant inflorescences were selected for infection, and their fruit pods were removed from the plants with scissors before transformation. The Arabidopsis thaliana inflorescences were immersed in the prepared infection solution for 0.5 to 1 minute. The infected Arabidopsis thaliana seedlings were then left to stand in a humid, dark place for 24 hours. After one week, infection was repeated. 5) Screening of transgenic strains After transmutation of Arabidopsis talliana inflorescences, seeds of the T0 generation of Arabidopsis talliana were collected and seeded on resistant MS plates containing 30 mg / L hygromycin to screen for positive plants. Screened positive seedlings were transferred to pots filled with soil and left to stand in a greenhouse for cultivation, yielding the following: overexpressing rice OsPPO1 L423S / Y425I and overexpressing OsPPO1 WT seedlings or events in Arabidopsis talliana; overexpressing soybean GmPPO1 L430S / Y432I and overexpressing GmPPO1 WT seedlings or events in Arabidopsis talliana; overexpressing rapeseed BnPPO1-C5 L424S / Y426I and overexpressing BnPPO1-C5 WT seedlings or events in Arabidopsis talliana; overexpressing maize ZmPPO1 L424T / Y426V, ZmPPO1 L424S / Y426V, ZmPPO1 L424V / Y426L, ZmPPO1 L424W / Y426L, ZmPPO1 L424S / Y426I, and overexpressing ZmPPO1 WT seedlings or events.

[0140] 3. Herbicide resistance test As shown in Figures 12-23, overexpression mutants of various crops and seeds of wild-type Arabidopsis thaliana were tested for resistance on MS medium (Petri dishes) containing various concentrations of PPO inhibitory herbicides. Compared to wild-type Arabidopsis thaliana, overexpression of LL in PPO1 from various crops was compared. L N Y Both mutations in the I protein motif and overexpressed PPO1 WT showed a certain level of tolerance / resistance to the herbicide in this invention, with their tolerance levels occurring at an application concentration of 50 nM. However, at a higher application concentration of 2 μM, overexpressed LL in PPO1 from various crops showed resistance. L N Y While the I protein motif mutation still showed resistance, overexpression PPO1 WT from various crops did not show any difference from wild-type Arabidopsis thaliana controls, which indicates LL in PPO1 from various crops. L N Y This suggests that crops exhibiting overexpression of protein motif mutations exhibit greater resistance to PPO inhibitory herbicides.

[0141] Example 11: Overexpression of the rice OSPPO1 L423S / Y425I mutation to acquire herbicide resistance To further test the resistance of the obtained mutants to compound A in plants, the mutant L423S / Y425I, screened from rice, was overexpressed in rice.

[0142] 1. Construction of an overexpression vector 1) Primers: To amplify the mutant L423S / Y425I, primers were designed according to selected restriction enzyme cleavage sites and the nucleotide sequence of the gene itself. Designed primers containing PPO1-F:GCCAGTGCCAAGCTCTGCAGattcgggtcaaggcgga and PPO1-R:ACATGATTACGAATTCtctagtaacatagatgacaccgcgc were synthesized by Beijing Qingke Biotechnology Co., Ltd. 2) The target gene was amplified using Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplified product was detected by agarose gel electrophoresis and collected according to the instructions for the TIAN quick Midi Purification Kit. After collection was complete, the concentration of the extracted DNA was measured using Nanodrop. 3) Construction of rice overexpression vector: Using the collected PPO1 fragment and plasmid pCAMBIA1301 digested with KpnI and HindIII, the rice overexpression vector pCAMBIA1301-OsPPO1 L423S / Y425I was constructed using the HB-infusion™ seamless cloning kit from HanBio Biotechnology Co., Ltd. (Shanghai). This vector was then transformed into competent Escherichia coli DH5α to obtain positive clones. After sequencing and validation by restriction endonuclease digestion, the positive clones were transformed into Agrobacterium.

[0143] 2. Transformation and transgenic event generation of rice callus via Agrobacterium: 1) 100 ng each of the rice overexpression vector pCAMBIA1301-OsPPO1 L423S / Y425I and pCAMBIA1301-OsPPO1WT vector plasmids were aspirated and added to competent Agrobacterium EH105, respectively. The cells were left on ice for 5 minutes, rapidly frozen by immersion in liquid nitrogen for 5 minutes, removed and left at 37°C for 5 minutes, and finally left on ice for 5 minutes. 500 μl of YEB solution culture (antibiotic-free) was added, and the cells were cultured on a shaker at 28°C and 200 rpm / min for 2-3 hours. Colonies were collected by centrifugation at 3500 rpm / min, the collected cells were coated on YEB (clarithromycin + rifampicin) plates, and cultured in a 28°C incubator for 2 days. Single clones were scraped off, cultured in liquid medium, and stored at -80°C to preserve bacterial lifespan. 2) Culture of Agrobacterium: A single clone of transformed Agrobacterium was scraped and cultured with shaking in YEB liquid medium (clarithromycin + rifampicin) at 28°C until the OD600 reached 0.5. Colonies were collected at 3500 rpm and diluted with an equal volume of AAM (1 ml AAM + 1 μl 1000 × AS) liquid medium to infect callus. 3) Induction of callus from Huaidao No. 5 rice variety: Before preparing Agrobacterium, rice callus was first prepared. The rice seeds were hulled and washed with sterile water as needed until the washing water ran clear. The seeds were then disinfected with 70% alcohol for 30 seconds, followed by disinfection with 5% sodium hypochlorite. The seeds were cultured in a horizontal shaker for 20 minutes, disinfected with sodium hypochlorite, washed five times with sterile water, allowed to stand on sterile absorbent paper to air dry the surface moisture of the seeds, and inoculated into induction medium to cultivate the callus at 28°C. 4) Agrobacterium infection of rice callus: Huaidao No. 5 callus with a diameter of 3 mm was selected for subculturing for 10 days, and the callus was collected in a 50 ml centrifuge tube. A concentration-adjusted Agrobacterium bacterial suspension was added to the centrifuge tube containing the callus, and the centrifuge tube was placed on a 28°C, 200 rpm shaker for 20 minutes to infect the callus; after infection was complete, the bacterial suspension was discarded, the callus was placed on sterile filter paper and air-dried for about 20 minutes, and co-cultured on a co-culture plate covered with sterile filter paper moistened with AAM (1 ml AAM + 30 μl 1000 × AS) liquid culture; three days after infection, Agrobacterium was washed away (i.e., washed five times with sterile water, then washed with 500 mg / L cephalosporin antibiotic for 20 minutes), and the callus was then screened and cultured in 50 mg / L hygromycin screening medium. 5) Screening, differentiation, and rooting of resistant callus: Co-cultured callus was transferred to screening medium for the first round of screening (2 weeks); after completion of the first round of screening, newly grown callus was transferred to screening medium (containing 50 mg / L hygromycin) for the second round of screening (2 weeks); after completion of screening, yellowish-white callus with good growth was scraped off and differentiated, and seedlings of about 1 cm were obtained after 3-4 weeks. Differentiated seedlings were transferred to rooting medium for rooting culture; rooted seedlings were acclimatized and then transferred to pots filled with soil for cultivation in a greenhouse; then overexpressing OsPPO1 L423S / Y425I and overexpressing OsPPO1 WT seedlings or events were obtained. 3. Detection of herbicide resistance in transgenic seedlings (T0 generation): For resistance testing, T0 generation rice seedlings, specifically overexpressing rice OsPPO1 L423S / Y425I and OsPPO1 WT, were sprayed with various concentrations of compound A. As shown in Figure 24, both overexpressing rice OsPPO1 L423S / Y425I and OsPPO1 WT showed a certain level of resistance to compound A compared to wild-type Huaidao No. 5. These tolerance levels were similar at a 45 g / ha application, and even at higher application concentrations such as 135 g / ha and 270 g / ha, the overexpressing OsPPO1 L423S / Y425I still showed resistance. However, the overexpressing OsPPO1 WT did not show any difference from the wild-type control, suggesting that rice overexpressing OsPPO1 L423S / Y425I has increased tolerance to compound A.

[0144] Simultaneously, numerous studies have revealed that introducing the corresponding resistance sites or combinations of the present invention into other plants using transgenic or gene-editing technologies similarly confers resistance to PPO inhibitory herbicides, suggesting its significant industrial value.

[0145] All publications and patent applications referenced herein are incorporated herein by reference as if each publication or patent application were incorporated herein by reference individually and specifically.

[0146] The invention described above will be further explained in detail by examples and embodiments for a clearer understanding, but it will be clear that certain changes and modifications may be implemented within the scope of the appended claims, and all such changes and modifications are within the scope of the present invention.

Claims

1. A PPO polypeptide having resistance to PPO inhibitory herbicides, wherein the polypeptide comprises the motif "LLLNYI", and in the motif, leucine L at position 3 is substituted with another amino acid, and tyrosine Y at position 5 is substituted with another amino acid, and The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rice PPO1, has L423S / Y425I mutations at positions corresponding to positions 423 and 425 of the amino acid sequence of the wild-type rice PPO1 protein shown in SEQ ID NO: 1, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type maize PPO1, has mutations of L424T / Y426V, L424S / Y426V, L424V / Y426L, L424W / Y426L, or L424S / Y426I at positions corresponding to positions 424 and 426 of the amino acid sequence of wild-type maize PPO1 protein shown in SEQ ID NO: 2, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rapeseed PPO1, has L424S / Y426I mutations at positions corresponding to positions 424 and 426 of the amino acid sequence of the wild-type rapeseed PPO1 protein shown in SEQ ID NO: 3, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type rapeseed PPO1, has L423S / Y425I mutations at positions corresponding to positions 423 and 425 of the amino acid sequence of wild-type rapeseed PPO1 protein shown in SEQ ID NO: 4, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type peanut PPO1, has L445S / Y447I mutations at positions corresponding to positions 445 and 447 of the amino acid sequence of the wild-type peanut PPO1 protein shown in SEQ ID NO: 5, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type peanut PPO1, has an L439S / Y441I mutation at positions corresponding to positions 439 and 441 of the amino acid sequence of the wild-type peanut PPO1 protein shown in SEQ ID NO: 6, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type soybean PPO1, has L430S / Y432I mutations at positions corresponding to positions 430 and 432 of the amino acid sequence of wild-type soybean PPO1 protein shown in SEQ ID NO: 7, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type sorghum PPO1, has L423S / Y425I mutations at positions corresponding to positions 423 and 425 of the amino acid sequence of the wild-type sorghum PPO1 protein shown in SEQ ID NO: 8, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type wheat PPO1, has an L418S / Y420I mutation at positions corresponding to positions 418 and 420 of the amino acid sequence of wild-type wheat PPO1 protein shown in SEQ ID NOs. 9, 10, or 11, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type tomato PPO1, has an L445S / Y447I mutation at positions corresponding to positions 445 and 447 of the amino acid sequence of wild-type tomato PPO1 protein shown in SEQ ID NO: 12, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type potato PPO1, has L444S / Y446I mutations at positions corresponding to positions 444 and 446 of the amino acid sequence of wild-type potato PPO1 protein shown in SEQ ID NO: 13, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type tobacco PPO1, has an L440S / Y442I mutation at positions corresponding to positions 440 and 442 of the amino acid sequence of the wild-type tobacco PPO1 protein shown in SEQ ID NO: 14, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type Arabidopsis thaliana PPO1, has L424S / Y426I mutations at positions corresponding to positions 424 and 426 of the amino acid sequence of wild-type Arabidopsis thaliana PPO1 protein shown in SEQ ID NO: 15, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type highland cotton PPO1, has L426S / Y428I mutations at positions corresponding to positions 426 and 428 of the amino acid sequence of the wild-type highland cotton PPO1 protein shown in SEQ ID NO: 16, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type radish PPO1, has L425S / Y427I mutations at positions corresponding to positions 425 and 427 of the amino acid sequence of wild-type radish PPO1 protein shown in SEQ ID NO: 17, or The amino acid sequence of the PPO polypeptide, compared to the amino acid sequence of wild-type millet PPO1, has L422S / Y424I mutations at positions corresponding to positions 422 and 424 of the amino acid sequence of the wild-type millet PPO1 protein shown in SEQ ID NO: 18, or The amino acid sequence of the PPO polypeptide has L424S / Y426I mutations at positions corresponding to positions 424 and 426 of the amino acid sequence of the wild-type cabbage PPO1 protein shown in SEQ ID NO: 19, compared to the amino acid sequence of wild-type cabbage PPO1. The aforementioned PPO polypeptide.

2. The PPO polypeptide according to claim 1, having an amino acid sequence represented by any of sequence numbers 26 to 48.

3. (1) A nucleic acid sequence encoding a PPO polynucleotide as described in claim 1 or 2, or a complementary sequence thereof; (2) Nucleic acid sequences that hybridize with the sequences shown in (1) under stringent conditions; and (3) An isolated polynucleotide containing a nucleic acid sequence that codes for the same amino acid sequence as the sequence shown in (1) by degeneracy of the genetic code, or a nucleic acid sequence selected from its complementary sequence.

4. A polynucleotide according to claim 3, which is a DNA molecule.

5. A plant genome comprising the polynucleotide described in claim 3 or 4.

6. A vector construct comprising a polynucleotide according to claim 3 or 4 and a homologous promoter or non-homologous promoter operably linked thereto.

7. The host cell is a host cell comprising the polynucleotide according to claim 3 or 4 or the vector construct according to claim 6.

8. The host cell according to claim 7, which is a plant cell.

9. A method for producing plant cells to acquire or improve resistance to PPO inhibitory herbicides, comprising producing the polynucleotide described in claim 3 or 4 or the vector construct described in claim 6 within plant cells using a gene editing method, or introducing the polynucleotide described in claim 3 or 4 or the vector construct described in claim 6 into plant cells using a transgenic method.

10. A method for producing plants to acquire or improve resistance to PPO inhibitory herbicides, comprising regenerating plant cells described in claim 8 or plant cells produced by the method described in claim 9.

11. A plant comprising an isolated polynucleotide according to claim 3 or 4 or a vector construct according to claim 6, produced by the method described in claim 10.

12. A method for enabling a plant to acquire or improve resistance to a PPO inhibitory herbicide, comprising introducing a modification to a gene encoding a protein having PPO activity to produce the PPO polypeptide described in claim 1 or 2.

13. A method for acquiring or improving resistance to a PPO inhibitor in plant cells, plant tissue, plant parts, or plants, comprising expressing the PPO polypeptide described in claim 1 or 2 in the plant cells, plant tissue, plant parts, or plants; or The method comprises hybridizing a plant expressing the PPO polypeptide described in claim 1 or 2 with another plant, and screening the plant or part thereof that can acquire or improve resistance to a PPO inhibitory herbicide; or This includes gene editing of the plant cells, plant tissues, plant parts, or plant proteins having PPO activity to achieve the expression of the PPO polypeptide described in claim 1 or 2. The aforementioned method.

14. The use is the use of a PPO polypeptide according to claim 1 or 2, or a polynucleotide according to claim 3 or 4, for acquiring or improving resistance of host cells, plant cells, plant tissues, plant parts, or plants to PPO inhibitory herbicides.

15. The use according to claim 14, wherein the host cell is a bacterial cell or a fungal cell.

16. A method for controlling weeds in a plant cultivation area, comprising applying an effective amount of a PPO inhibitory herbicide to the cultivation area, wherein the plant comprises the plant described in claim 11, or a plant expressing the PPO polypeptide described in claim 1 or 2, produced by the method described in claim 10, 12, or 13.

17. The method according to claim 16, wherein the PPO inhibitor herbicide is applied in combination with one or more additional herbicides.

18. The plant genome according to claim 5, the host cell according to claim 7 or 8, or the plant according to claim 11, wherein the plant is a monocotyledonous or dicotyledonous plant.

19. The aforementioned plants include rice (Oryza sativa L.), sorghum (Sorghum bicolor), wheat (Triticum aestivum), barley (Hordeum vulgare), millet (Setaria italica), corn (Zea mays), sugarcane (Saccharum officinarum), Arabidopsis thaliana, soybean (Glycine max), peanut (Arachis hypogaea), tobacco (Nicotiana tabacum), and cotton (Gossypium hirsutum). (Hirsutum), Radish (Raphanus sativus), Cabbage (Brassica oleracea), Sweet potato (Dioscorea esculenta), Yam (Dioscorea cayenensis), Cassava (Manihot esculenta), Potato (Solanum tuberosum), Tomato (Solanum lycopersicum), Pepper (Capsicum annuum), Eggplant (Solanum melongena), Watermelon (Citrullus lanatus), Pumpkin (Cucurbita moscata) (moschata), cucumber (Cucumis sativus), lettuce (Lactuca sativa), sesame (Sesamum indicum), rapeseed (Brassica napus), sunflower (Helianthus annuus)A plant genome according to claim 5, a host cell according to claim 7 or 8, or a plant according to claim 11, which is a mulberry (Morus alba), cowpea (Vigna unguiculata), strawberry (Fragaria ananassa), apple (Malus domestica), peach (Prunus persica), cherry (Prunus pseudocerasus), apricot (Prunus armeniaca), European grape (Vitis vinifera), papaya (Carica papaya), or alfalfa (Medicago sativa).

20. The method according to claim 10, 12, 13, or 16, or the use according to claim 14 or 15, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.

21. The plant is rice (Oryza sativa L.), sorghum (Sorghum bicolor), wheat (Triticum aestivum), barley (Hordeum vulgare), millet (Setaria italica), maize (Zea mays), sugarcane (Saccharum officinarum), Arabidopsis thaliana, soybean (Glycine max), peanut (Arachis hypogaea), tobacco (Nicotiana tabacum), cotton (Gossypium hirsutum) (Hirsutum), Radish (Raphanus sativus), Cabbage (Brassica oleracea), Sweet potato (Dioscorea esculenta), Yam (Dioscorea cayenensis), Cassava (Manihot esculenta), Potato (Solanum tuberosum), Tomato (Solanum lycopersicum), Pepper (Capsicum annuum), Eggplant (Solanum melongena), Watermelon (Citrullus lanatus), Pumpkin (Cucurbita moscata) (moschata), cucumber (Cucumis sativus), lettuce (Lactuca sativa), sesame (Sesamum indicum), rapeseed (Brassica napus), sunflower (Helianthus annuus)The method according to claim 10, 12, 13, or 16, or the use according to claim 14 or 15, wherein the fruit is annuus), mulberry (Morus alba), cowpea (Vigna unguiculata), strawberry (Fragaria ananassa), apple (Malus domestica), peach (Prunus persica), cherry (Prunus pseudocerasus), apricot (Prunus armeniaca), European grape (Vitis vinifera), papaya (Carica papaya), or alfalfa (Medicago sativa).

22. The method according to claim 10, 12, 13, or 16, or the use according to claim 14 or 15, wherein the PPO inhibitor is one or more compounds selected from the group consisting of pyrimidinedione, diphenyl ether, phenylpyrazole, N-phenylphthalimide, thiadiazole, oxadiazole, triazolinone, oxazolidinedione, and others.

23. (1) Examples of pyrimidinedione include butaphenacil, saflufenasylbenzufenzizone, thiafenasil, [3-[2-chloro-4-fluoro-5-(1-methyl-6-trifluoromethyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-3-yl)phenoxy]-2-pyridyloxy]ethyl acetate, 1-methyl-6-trifluoromethyl-3-(2,2,7-trifluoro-3-oxo-4-propa-2-inyl-3,4-dihydro-2H-benzo[1,4]oxazine-6-yl)-1H-pyrimidine-2,4-dione, 3-[7-chloro-5-fluoro-2-(trifluoromethyl)-1H-benzimidazole-4-yl]-1-methyl-6-(trifluoromethyl)-1H-pyrimidine-2,4-dione, flupropacil, and 【Chemistry 1】 For example; (2) Examples of diphenyl ethers include fomesaphen, oxyfluorophene, acroniphene, lactofen, clomethoxyfen, chlornitrofen, fluoroglycofen ethyl, acinfluorphene or its sodium salt, bifenox, ethoxyfen, ethoxyfen ethyl, fluoronitrofen, furyloxyfen, nitrofluorophene, and halosaphene; (3) Examples of phenylpyrazoles include pyraflufenethyl and fluazolate; (4) Examples of N-phenylphthalimides include flumioxazine, synidone ethyl, flumipropine, and flumimicrolacpentyl; (5) Examples of thiadiazoles include fluthiacetomethyl, fluthiaceto, and tidiadimine; (6) Examples of oxadiazoles include oxaziargyl and oxadiazone; (7) Examples of triazolinones include carfentrazone, carfentrazone ethyl, sulfenthrazone, azaphenidine, and bencarbazone; (8) An example of an oxazolidinedione is pentoxazone; (9) Others include pyraclonil, flufenpyruethyl, profluazole, trifludimoxazine, N-ethyl-3-(2,6-dichloro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide, N-tetrahydrofurfuryl-3-(2,6-dichloro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide, N-ethyl-3-(2-chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide, N-tetrahydrofurfuryl-3-(2-chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methyl-1H-pyrazole-1-carboxamide Mido, 3-[7-fluoro-3-oxo-4-(propa-2-inyl)-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl]-1,5-dimethyl-6-thioxo[1,3,5]triazinan-2,4-dione, 2-(2,2,7-trifluoro-3-oxo-4-propa-2-inyl-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl)-4,5,6,7-tetrahydroisoindole-1,3-dione, methyl(E)-4-[2-chloro-5-[4-chloro-5-(difluoromethoxy)-1H-methylpyrazole-3-yl]-4-fluorophenoxy]-3-methoxybuta-2-enoate, phenylpyridine, benzoxazinon derivatives, and general formula I 【Chemistry 2】 [In the formula, Q is 【Transformation 3】 It represents; Y represents a halogen, a C1-C6 alkyl halogen, or a cyano; Z represents halogen; M represents CH or N; X is -CX １ X ２ - (C1-C6 alkyl) ｎ -,-(C1-C6 alkyl)-CX １ X ２ - (C1-C6 alkyl) ｎ - or - (CH ２ ) ｒ '-' represents a negative sign, n represents 0 or 1, and r represents an integer greater than or equal to 2; X １ and X ２ each independently represents hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogenated C1-C6 alkyl, halogenated C2-C6 alkenyl, halogenated C2-C6 alkynyl, C3-C6 cycloalkyl, C3-C6 cycloalkyl C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfanyl, hydroxy C1-C6 alkyl, C1-C6 alkoxy C1-C6 alkyl, phenyl or benzyl; X ３ and X ４ represents either O or S independently; W represents hydroxyl, C1-C6 alkoxy, C2-C6 alkenyloxy, C2-C6 alkynyloxy, halogenated C1-C6 alkoxy, halogenated C2-C6 alkenyloxy, halogenated C2-C6 alkynyloxy, C3-C6 cycloalkyloxy, phenoxy, sulfidyl, C1-C6 alkylsulfanyl, C2-C6 alkenylsulfanyl, C2-C6 alkynylsulfanyl, halogenated C1-C6 alkylsulfanyl, halogenated C2-C6 alkenylsulfanyl, halogenated C2-C6 alkynylsulfanyl, C3-C6 cycloalkylsulfanyl, phenylsulfanyl, amino, or C1-C6 alkylamino. Examples of compounds represented by the following are: The method or use of claim 22.

24. Q is 【Chemistry 4】 The method or use according to claim 23, wherein C* represents a chiral center and the compound has an R configuration.

Images