Coronavirus detection

Abstract

A method for detecting nucleic acids of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is described. The method involves amplifying nucleic acids of a sample or nucleic acids derived from the nucleic acids of a sample by an isothermal amplification reaction using forward and reverse nucleic acid amplification primers, each of which specifically hybridizes to a nucleic acid sequence, or its complement, that is conserved in SARS-CoV-2 nucleic acids but not in other human coronavirus nucleic acids. The method is particularly useful for point-of-care (POC) testing. Kits, primers, probes, primer sets, oligonucleotide sets, and oligonucleotides, as well as their use in the method, are also described.

Description

[Technical Field]

[0001] The present invention relates particularly to a method for detecting the nucleic acid of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes coronavirus disease 2019 (COVID-19), for point-of-care (POC) testing, and also to a kit, primers, probes, primer sets, oligonucleotide sets and oligonucleotides, and the use thereof in the present method. [Background technology]

[0002] The 2019-2020 coronavirus pandemic is the ongoing pandemic of COVID-19, caused by SARS-CoV-2. First identified in Wuhan, Hubei Province, China in December 2019, the outbreak was recognized as a pandemic by the World Health Organization (WHO) on March 11, 2020. As of March 18, 2020, more than 203,000 cases of COVID-19 had been reported in more than 160 countries and territories, with major outbreaks occurring in mainland China, Europe, Iran, and South Korea. More than 8,200 people have died and more than 82,000 have recovered.

[0003] SARS-CoV-2 belongs to a broad family of viruses known as coronaviruses. Coronaviruses are named after the crown-shaped spikes on their surface. There are four main subgroups of coronaviruses, known as alpha, beta, gamma, and delta. The following are seven coronaviruses that can infect humans: 229E (alpha coronavirus); NL63 (alpha coronavirus); OC43 (beta coronavirus); HKU1 (beta coronavirus); MERS-CoV (beta coronavirus that causes Middle East Respiratory Syndrome or MERS); SARS-CoV (beta coronavirus that causes Severe Acute Respiratory Syndrome or SARS); and SARS-CoV-2.

[0004] Like other coronaviruses, SARS-CoV-2 possesses four structural proteins known as the S (spike), E (envelope), M (membrane), and N (nucleocapsid) proteins. The N protein holds the RNA genome, while the S, E, and M proteins work together to create the viral envelope. The spike protein, imaged at the atomic level using cryo-electron microscopy, is the protein responsible for the virus's attachment to the host cell membrane.

[0005] SARS-CoV-2 is a positive-sense single-stranded RNA (+ssRNA) virus. Like the SARS-related coronavirus strains associated with the 2003 SARS pandemic, SARS-CoV-2 is a member of the Sarbecovirus subgenus (beta-CoV lineage B). Its RNA sequence is approximately 30,000 nucleotides long (see SARS-CoV genome structure shown in Figure 1).

[0006] The ability to test, identify, and treat individuals infected with SARS-CoV-2 without delay is of paramount importance. Nucleic acid testing (NAT) is at the forefront of infectious disease diagnosis, but requires highly trained staff and specialized facilities, available only in highly advanced, centralized laboratories. Current NAT also requires samples to be sent frozen or refrigerated; results take 2-3 days, leading to "loss-to-follow-up," a common challenge in developing countries. Despite the arduous efforts of central and local authorities, Wuhan is experiencing prolonged delays in test results, particularly in hospitals lacking NAT testing capacity. Similar limitations are seen in other situations, such as on cruise ships. China is also experiencing amplicon contamination, which causes false positives, a common challenge with NAT. China's infrastructure is stretched and is experiencing some of the same challenges with diagnostic methods seen in developing countries.

[0007] Clearly, there is an urgent need for decentralized point-of-care (POC) diagnostic testing for COVID-19 for use in communities. [Overview of the project] [Means for solving the problem]

[0008] The inventors designed primers and probes specific to SARS-CoV-2 and developed a test with a sensitivity of at least 10 copies / reaction for two specific regions of the SARS-CoV-2 genome.

[0009] Primers and probes specific to the SARS-CoV-2 (COVID-19) genome have been designed for the ORF1 and nucleocapsid (N) genes. Alignment of all seven human coronaviruses was used during primer and probe selection to ensure high specificity.

[0010] The present invention provides a method for determining whether a sample contains severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleic acid, comprising the steps of amplifying the nucleic acid of the sample or amplifying nucleic acid derived from the nucleic acid of the sample by an isothermal amplification reaction using forward nucleic acid amplification primers and reverse nucleic acid amplification primers, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids.

[0011] If necessary, other human coronavirus nucleic acids include human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids.

[0012] Where necessary, nucleic acid sequences that are conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids include a continuous nucleic acid sequence of at least 19 nucleotides in length.

[0013] If necessary, the nucleic acid sequences conserved in SARS-CoV-2 nucleic acid are those conserved in the SARS-CoV-2 ORF1ab gene or nucleocapsid gene.

[0014] Conserved sequences can be identified by homology searches using tools such as BLAST, HMMER, and Infernal. Homology search tools can take individual nucleic acid sequences as input, or they can use statistical models generated from multiple sequence alignments of known closely related sequences. When searching for more distantly related sequences, statistical models such as profile-HMM, and RNA covariance models that also incorporate structural information, may be useful. The input sequences are then aligned against a database of sequences from closely related individuals or other species. The resulting alignments are then scored based on the number of matching bases and gaps or deletions generated by the alignment. Acceptable conserved substitutions can be identified using substitution matrices such as PAM and BLOSUM. Highly scoring alignments are assumed to originate from homologous sequences. Sequence conservation can then be inferred by detecting highly similar homologs across a broad phylogenetic range.

[0015] If necessary, the conserved SARS-CoV-2 nucleic acid is a nucleic acid that contains a nucleic acid sequence with up to two mismatches per 20 nucleotides compared to a reference SARS-CoV-2 nucleic acid sequence.

[0016] If necessary, the conserved SARS-CoV-2 nucleic acid is a nucleic acid containing a nucleic acid sequence with up to one mismatch per 20 nucleotides compared to a reference SARS-CoV-2 nucleic acid sequence.

[0017] If necessary, the preserved SARS-CoV-2 nucleic acid is a nucleic acid containing a nucleic acid sequence identical to the reference SARS-CoV-2 nucleic acid sequence.

[0018] Multiple sequence alignment can be used to visualize conserved sequences. The CLUSTAL format includes plain text keys for annotating the conserved columns of the alignment, displaying conserved sequences (*), conserved mutations (:), semi-conserved mutations (.), and non-conserved mutations ( ). Multiple sequence alignment can be performed using software such as MacVector.

[0019] If necessary, the nucleic acid amplification primers hybridize to a conserved SARS-CoV-2 nucleic acid sequence or its complement under stringent conditions, but not to other human coronavirus nucleic acids or their complements, or they specifically hybridize to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid or its complement.

[0020] The stringency of hybridization is influenced by conditions such as temperature, salt concentration, ionic strength, and hybridization buffer composition. Generally, low stringency conditions involve the melting point temperature (T) of the specific sequence at defined ionic strength and pH. m The temperature is selected to be approximately 30°C lower than ). The intermediate stringency condition is when the temperature is T m This is when the temperature is below 20°C, and high stringency conditions are when the temperature is T m This is the case when the temperature is 10°C lower. m This refers to a temperature under defined ionic strength and pH at which 50% of the target sequence hybridizes to a perfectly matched primer or probe. m This depends on the solution conditions as well as the base composition and length of the probe. For example, longer sequences hybridize specifically at higher temperatures. The maximum hybridization ratio is T mIt is obtained at a temperature about 16°C to a maximum of 32°C below. The presence of monovalent cations in the hybridization solution reduces the electrostatic repulsion force between the two nucleic acid strands, thereby promoting hybridization; this effect is visible at a sodium concentration of up to 0.4 M (at higher concentrations, this effect can be ignored). Formamide reduces the melting temperature of DNA-DNA and DNA-RNA duplexes by 0.6 - 0.7°C per percent formamide, and the addition of 50% formamide will reduce the hybridization ratio, but allows hybridization to be carried out at 30 - 45°C. Base pair mismatches reduce the duplex hybridization ratio and thermal stability. On average, and also for large probes, T m decreases by about 1°C for every 1% base mismatch. T m can be calculated using the following equations depending on the type of hybrid: 1) DNA-DNA hybrid (Meinkoth and Wahl, Anal. Biochem., 138: 267-284, 1984):

Number

Number

Number

Number

[0021] In addition to hybridization conditions, the specificity of hybridization typically depends on the function of post-hybridization washing. To remove background due to non-specific hybridization, the sample is washed with a dilute salt solution. Factors of significant importance in such washing include the ionic strength and temperature of the final washing solution: lower salt concentrations and higher washing temperatures result in higher stringency. Washing conditions are typically performed at or below the hybridization stringency. Positive hybridization produces a signal at least twice the background level. Generally, suitable stringent conditions for nucleic acid hybridization assays or gene amplification detection procedures are as shown above. Higher or lower stringent conditions may also be selected. Those skilled in the art will notice various parameters that can be modified during washing, which will maintain or alter the stringency conditions.

[0022] For example, typical stringent conditions (also referred to as high-stringency hybridization conditions) for DNA hybrids longer than 50 nucleotides include hybridization in 1×SSC at 65°C, or in 1×SSC and 50% formamide at 42°C, followed by washing in 0.3×SSC at 65°C. The length of the hybrid is the expected length for the nucleic acids to be hybridized. When nucleic acids of known sequences are hybridized, the length of the hybrid can be determined by aligning the sequences and identifying the conserved regions described herein. 1×SSC is 0.15 mM NaCl and 15 mM sodium citrate; the hybridization and washing solutions may additionally contain 5× Denhart reagent, 0.5–1.0% SDS, 100 μg / ml denatured fragmented salmon sperm DNA, and 0.5% sodium pyrophosphate.

[0023] For the purpose of defining levels of stringency, you can refer to Sambrook et al. (2001) Molecular Cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory Press, CSH, New York or Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989 and updated annually).

[0024] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or its complement.

[0025] If necessary, the forward nucleic acid primer specifically hybridizes to a nucleic acid sequence that is a complement to a conserved nucleic acid sequence in the ORF1ab gene of SARS-CoV-2.

[0026] If necessary, the forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0027] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or to its complement.

[0028] If necessary, reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene.

[0029] If necessary, the reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0030] If necessary, the forward and reverse nucleic acid amplification primers contain the respective nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in Table 1 below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 1-1] [Table 1-2]

[0031] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0032] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or its complement.

[0033] If necessary, the forward nucleic acid primer specifically hybridizes to a nucleic acid sequence that is a complement to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene.

[0034] If necessary, the forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0035] If necessary, the forward nucleic acid primer contains the nucleic acid sequence of SEQ ID NO: 14.

[0036] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or to its complement.

[0037] If necessary, reverse nucleic acid primers specifically hybridize to conserved nucleic acid sequences in the SARS-CoV-2 nucleocapsid gene.

[0038] If necessary, the reverse nucleic acid primers include the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length.

[0039] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0040] Figures 2A–D show the multiple sequence alignment of the ORF1ab region of all seven human coronaviruses (229E, SARS, HKU1, MERS, OC43, and NL63, as well as SARS-CoV-2 sequences from several different isolates) and bat SARS-like coronavirus sequences. In the figures, SARS-CoV-2 is referred to by its previous provisional name, "2019-nCoV" (2019 novel coronavirus). Figure 2 shows the locations in the SARS-CoV-2 ORF1ab gene sequence corresponding to the sequences of the forward primers SEQ ID NOs. 1–3 (2019-nCoV-ARP1.1F, 2019-nCoV-ARP1.2F, and 2019-nCoV-ARP1.3F, respectively) and the reverse complements of the sequences of the reverse primers SEQ ID NOs. 5 and 6 (2019-nCoV-ARP1.1R and 2019-nCoV-ARP1.2R, respectively).

[0041] Figures 3A–I show the multiple sequence alignment of the nucleocapsid regions of all seven human coronaviruses (229E, SARS, HKU1, MERS, OC43, and NL63, as well as SARS-CoV-2 sequences from several different isolates) and bat SARS-like coronavirus sequences. In the figures, SARS-CoV-2 is referred to by its previous provisional name, "2019-nCoV" (2019 novel coronavirus). Figure 3 shows the locations in the SARS-CoV-2 nucleocapsid gene sequence corresponding to the forward primer sequence of SEQ ID NO: 14 (SA-nCoV-F2.3) and the reverse complements of the reverse primer sequences of SEQ ID NOs: 15–17 (SA-nCoV-R2.3, SA-nCoV-R2.4, and SA-nCoV-R2.5, respectively).

[0042] Nucleic acids can be derived from the nucleic acids of a sample, for example, by reverse transcribing the SARS-CoV-2 nucleic acid of the sample and amplifying the reverse transcription product by an isothermal nucleic acid amplification reaction using forward and reverse nucleic acid amplification primers.

[0043] If necessary, the method of the present invention further comprises the steps of reverse transcribing the SARS-CoV-2 RNA of a sample and amplifying the reverse transcription product by an isothermal amplification reaction using forward and reverse nucleic acid amplification primers.

[0044] If necessary, the reverse nucleic acid primer further includes a promoter sequence for DNA-dependent RNA polymerase at its 5' end, and reverse transcription is performed using the reverse nucleic acid primer.

[0045] In the method of the present invention, any suitable method of isothermal nucleic acid amplification can be used. Several suitable methods of isothermal nucleic acid amplification are known to those skilled in the art. If necessary, isothermal nucleic acid amplification is transcription-based amplification. Such methods involve amplification of an RNA template using reverse transcriptase (RT), RNase H, and RNA polymerase activity, and include nucleic acid sequence-based amplification (NASBA), transcription-mediated amplification (TMA), and autosustained sequence replication (3SR) (Chan and Fox, Rev. Med. Microbiol. 10: 185-196 (1999); Guatelli et al., Proc. Natl. Acad. Sci. 87: 1874-1878 (1990); Compton, Nature 350:91-92 (1991)). NASBA and 3SR use RT (which also has RNase H activity) derived from avian myeloblastosis virus (AMV), RNase H derived from E. coli, and T7 RNA polymerase. TMA uses Moloney's mouse leukemia virus (MMLV) RT (which also has RNase H activity) and T7 RNA polymerase.

[0046] Isothermal amplification methods, such as transcription-based amplification methods, have several advantages over amplification using polymerase chain reaction (PCR). The reaction occurs simultaneously in a single tube and is performed under isothermal conditions, thus eliminating the need for a thermocycle. Amplification is faster than PCR (1 × 10⁻¹⁶ after 20 cycles of PCR). 6 Compared to doubling, 1 × 10 9 (Doubling amplification can be observed after 5 cycles). Since DNA background does not interfere with transcription-based amplification, this method is unaffected by double-stranded DNA contamination. The amplified product is single-stranded and can be detected without the need for any strand separation.

[0047] If necessary, the reverse nucleic acid primers further include a promoter sequence for DNA-dependent RNA polymerase at their 5' end. Such primers can be used for reverse transcription and transcription-based isothermal amplification reactions, thereby minimizing the number of primers required to perform reverse transcription and isothermal nucleic acid amplification.

[0048] For example, the promoter sequence is, [ka] The T7 promoter sequence may also contain . The T7 RNA polymerase initiates transcription at the underlined G in the promoter sequence. The polymerase then transcribes using the opposite strand as a template at 5'->3'. The first base in the transcript is G. Other examples of T7 promoter sequences for inclusion at the 5' end of reverse nucleic acid primers include the following nucleic acid sequences: [ka] [ka]

[0049] A transcription-based isothermal amplification reaction suitable for use in the method of the present invention will be described later with reference to Figure 4.

[0050] Antisense primer 1 contains a nucleic acid sequence complementary to the portion of the target RNA (e.g., SEQ ID NO: 5, 2019-CoV-ARP1.1R, reverse primer) so that the primer can specifically hybridize to the target RNA, and also contains a single-stranded version of the promoter sequence for DNA-dependent RNA polymerase (e.g., the T7 promoter sequence containing SEQ ID NO: 21) at its 5' end. Primer 1 is annealed to the RNA target. RNA-dependent DNA polymerase extends primer 1 to synthesize a complementary DNA (cDNA) copy of the RNA target. DNA / RNA double-strand specific ribonuclease digests the RNA of the RNA-cDNA hybrid. Sense primer 2 contains a nucleic acid sequence complementary to the portion of the cDNA. Primer 2 is annealed to the cDNA downstream of the portion of the cDNA formed by primer 1. Primer 2 is extended by DNA-dependent DNA polymerase, producing a second DNA strand that extends via a DNA-dependent RNA polymerase promoter sequence at one end (thus forming a double-stranded promoter). This promoter is then used by DNA-dependent RNA polymerase to synthesize a number of RNAs complementary to the original target sequence. These RNA products then serve as templates for the cycle phase of the reaction, but using an inverted primer annealing step, i.e., primer 2 followed by primer 1.

[0051] In a modified version of this method, primer 2 may also contain a single-stranded version of the promoter sequence for DNA-dependent RNA polymerase. This results in the production of RNA that has the same sense as the original target sequence (along with RNA complementary to the original target sequence).

[0052] In some conventional isothermal transcription-based amplification reactions, it is known that the target RNA is cleaved at its 5' end before it can function as a template for cDNA synthesis. An enzyme having RNase H activity is used to cleave the RNA portion of the RNA-DNA hybrid formed by adding an oligonucleotide (cleaved oligonucleotide) having a sequence complementary to the duplicated and adjacent regions to the 5' end of the target RNA. The cleaved oligonucleotide can be appropriately modified to prevent the extension reaction at its 3' end OH. In some embodiments of the present invention, a cleaved oligonucleotide can be used, but it is preferable that the method of the present invention be carried out in the absence of a cleaved oligonucleotide, thereby simplifying the required amplification reaction and components.

[0053] Isothermal nucleic acid amplification is advantageous because it can be easily used in resource-limited situations. Such methods do not require the use of thermal cyclers, which may not be available in resource-limited situations. Examples of suitable methods are described in WO2008 / 090340 and Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71.

[0054] Examples of reagents suitable for performing reverse transcription of RNA and isothermal amplification of the reverse transcription product are shown in WO2008 / 090340, and include, for example, the following enzyme activities: RNA-dependent DNA polymerase, DNA-dependent DNA polymerase, DNA / RNA double-strand specific ribonuclease, and DNA-dependent RNA polymerase.

[0055] In addition to the required enzyme activity, it will also be necessary to provide appropriate nucleotide triphosphates (for transcription-based amplification, ribonucleotide triphosphates (rNTPs, i.e., rATP, rGTP, rCTP, and rUTP) and deoxyribonucleotide triphosphates (dNTPs, i.e., dATP, dGTP, dCTP, and dTTP) are required), primers suitable for the specific amplification of the target nucleic acid, buffers suitable for carrying out the amplification reaction, and any necessary cofactors required by the enzyme activity (e.g., magnesium ions). Examples of suitable buffers include Tris-HCl, HEPES, or acetate buffer. Suitable salts such as potassium chloride or sodium chloride can be provided. Suitable concentrations of these components can be easily determined by those skilled in the art. Suitable rNTP concentrations are typically in the range of 0.25–5 mM or 0.5–2.5 mM. Suitable dNTP concentrations are typically in the range of 0.25–5 mM dNTP or 0.5–2.5 mM. The appropriate magnesium ion concentration is typically within the range of 5–15 mM.

[0056] Some conventional transcription-based amplification methods use very large amounts of T7 RNA polymerase (e.g., 142 units or more), in which case 1 unit incorporates 1 n mole of labeled nucleotide into an acid-insoluble material under standard assay conditions at 37°C for 1 hour, with the standard assay conditions being: 40 mM Tris-HCl (pH 8.0), 50 mM NaCl, 8 mM MgCl2, 5 mM DTT, 400 μM rNTP, 400 μM [ 3 The method uses H]-UTP (30 cpm / p mole), 20 μg / ml T7 DNA, 50 μg / ml BSA, 100 μl reaction volume, 37°C, 10 minutes). The method of the present invention is carried out using significantly less T7 RNA polymerase than such conventional methods, thereby reducing costs. For example, the method of the present invention can be carried out using less than 142 units of DNA-dependent RNA polymerase (e.g., T7 RNA polymerase), optionally less than 100 units or less than 50 units, for example, 30-40 units.

[0057] If necessary, the nucleic acids of the sample are isolated, and then the SARS-CoV-2 RNA present in the isolated nucleic acids is reverse transcribed.

[0058] Many suitable methods for isolating nucleic acids are known to those skilled in the art. Some methods use chaotropic agents such as guanidinium thiocyanate and organic solvents to lyse cells and denature proteins. For example, Boom et al. (Journal of Clinical Microbiology, 1990, Vol. 28(3): 495-503) describe a method in which a sample is brought into contact with silica particles in the presence of a lysis / binding buffer containing guanidinium thiocyanate. The released nucleic acids bind to the silica particles and are then washed with a washing buffer containing guanidinium thiocyanate, then with ethanol, and then with acetone. The bound nucleic acids are then eluted in an aqueous low-salt buffer (Tris-HCl, EDTA, pH 8.0).

[0059] Some methods avoid the requirement of chaotropic salts and organic solvents. For example, Hourfar et al. (Clinical Chemistry, 2005, 51(7): 1217-1222) describe a method in which the sample is mixed with magnetic silica particles in the presence of a solubility / binding buffer containing a chaotropic salt (ammonium sulfate) before the addition of proteinase K. After separation, the magnetic particles are washed with a washing buffer containing proteinase K and eluted at 80°C in an elution buffer (Tris-HCl, pH 8.5). Other suitable methods are described in WO2010 / 015835.

[0060] Nucleic acid isolation can be performed using conventional binding and / or elution buffers for solid-phase use, which can bind to the nucleic acid in the presence of a binding buffer at a first pH and then elute the nucleic acid therefrom at a second pH.

[0061] If necessary, the solid phase includes ionizable groups that change charge according to ambient conditions. The pKa of the ionizable groups is appropriate for the conditions desired for the binding of nucleic acids to and from the solid phase. Generally, nucleic acids will bind to the solid phase at a pH below or roughly equal to its pKa and be released at a higher pH (usually above the pKa). Solid phases suitable for binding nucleic acids at a first pH and for eluting bound nucleic acids at a second pH higher than the first pH are well known to those skilled in the art. For example, at the first pH, the solid phase may contain a positive charge, and at the second pH, the solid phase may have a smaller positive, neutral, or negative charge. Or, additionally, at the first pH, the solid phase may contain a neutral or smaller negative charge, and at the second pH, the solid phase may have a negative or larger negative charge. Such charge changes allow nucleic acids to be adsorbed to the solid phase at the first pH and released at the second pH.

[0062] For example, the solid phase may contain negatively ionizable groups having pKas between the first and second pH values. If the solid phase is neutral or negatively charged with a small pKa, the nucleic acids will bind to the solid phase; if the solid phase is negative or negatively charged with a large pKa, the nucleic acids will be released. Alternatively, the solid phase may contain positively ionizable groups having pKas between the first and second pH values. If the solid phase is positively charged, the nucleic acids will bind to the solid phase; if the solid phase is neutral or positively charged with a small pKa, the nucleic acids will be released.

[0063] Examples of solid phases that can be used for nucleic acid extraction include inorganic oxides such as silica or glass (e.g., as described in Boom et al or Hourfar et al), or solid phases containing aluminum oxide, glycopolymers, or charge switch materials (e.g., as described in WO02 / 48164).

[0064] The solid phase may be in any suitable form, such as a film, gel, or particles, including, for example, magnetic particles. Silica films or gels and magnetic silica particles are preferred examples. Silica films are particularly preferred. They are less expensive than magnetic silica particles (for example, used by Hourfar, et al.) and, unlike magnetic silica particles, do not require refrigerated storage.

[0065] The solid phase may be one in which the binding of nucleic acids to it is enhanced by the presence of a cosmotropic agent. If necessary, the binding of nucleic acids to the solid phase is carried out in the presence of a cosmotropic agent. Such agents are known to enhance the binding of nucleic acids to solid phases, such as silica-based solid phases.

[0066] The terms "chaotropic" and "cosmotropic" agents originate from the Hofmeister series (Cacace et al., Q Rev Biophys 1997;30:241-77), which classifies agents according to their effects on macromolecules and water structure. Chaotropes can be defined as substances that disrupt solvent structure, while cosmotropes can be defined as substances that enhance solvent structure. Figure 1 by Cacace et al. shows the Hofmeister series and common organic solutes that affect protein structure / function. Examples of chaotropic agents, known to those skilled in the art, include sodium iodide, sodium perchlorate, guanidium thiocyanate, and guanidium hydrochloride. Examples of cosmotropic agents, known to those skilled in the art, include ammonium sulfate and lithium chloride.

[0067] If necessary, lysis is performed using a binding buffer. Binding buffers that can be used for cell lysis are known to those skilled in the art. The lysis buffer used by Boom et al. contains guanidinium thiocyanate, Tris hydrochloride, pH 6.4, EDTA (adjusted to pH 8), and Triton® X-100. If necessary, the lysis buffer does not contain chaotropic agents. For example, a lysis / binding buffer containing a cosmotropic agent can be used. If necessary, the buffer is an acidic buffer, preferably a strongly acidic buffer, having a pKa (25°C) in the range of 3–5.

[0068] If necessary, the method of the present invention further comprises the step of capturing the product of an isothermal amplification reaction by hybridizing the nucleic acid of the product to a nucleic acid capture probe, the capture probe specifically hybridizing to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids.

[0069] If necessary, other human coronavirus nucleic acids include human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids.

[0070] Where necessary, nucleic acid sequences that are conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids include a continuous nucleic acid sequence of at least 19 nucleotides in length.

[0071] If necessary, the capture probe will hybridize to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid or its complement under stringent conditions, but will not hybridize to other human coronavirus nucleic acids or their complements, or will specifically hybridize to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid or its complement.

[0072] If necessary, the forward and reverse nucleic acid primers specifically hybridize to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene, and the capture probe specifically hybridizes to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene.

[0073] If necessary, the capture probe may include the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof.

[0074] If necessary, the capture probe contains the nucleic acid sequence of sequence number 9.

[0075] If necessary, the forward and reverse nucleic acid primers specifically hybridize to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement, and the capture probe specifically hybridizes to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement.

[0076] If necessary, the capture probe may include the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof.

[0077] If necessary, the capture probe contains the nucleic acid of sequence number 18.

[0078] If necessary, the method of the present invention further comprises the step of detecting the product of an isothermal amplification reaction by hybridizing the product to a nucleic acid detector probe, the detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids.

[0079] If necessary, other human coronavirus nucleic acids include human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids.

[0080] Where necessary, nucleic acid sequences that are conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids include a continuous nucleic acid sequence of at least 19 nucleotides in length.

[0081] If necessary, the detection probe will hybridize to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid or its complement under stringent conditions, but will not hybridize to other human coronavirus nucleic acids or their complements, or will specifically hybridize to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid or its complement.

[0082] If necessary, the forward and reverse nucleic acid primers specifically hybridize to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene, and the detection probe specifically hybridizes to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene.

[0083] If necessary, the detection probe includes the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof.

[0084] If necessary, the method of the present invention comprises amplification using forward and reverse nucleic acid amplification primers, capture of the amplified product using a capture probe, and detection of the amplified product using a detection probe, wherein the amplification primers and the capture and detection probes include nucleic acid sequences according to any of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in Table 2 below, or nucleic acid sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such sequences along their entire length: [Table 2-1] [Table 2-2]

[0085] If necessary, the detection probe contains the nucleic acid sequence of sequence number 12.

[0086] If necessary, forward and reverse nucleic acid primers specifically hybridize to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement, and the detection probe specifically hybridizes to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement.

[0087] If necessary, the detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof.

[0088] If necessary, the detection probe contains the nucleic acid sequence of sequence number 19.

[0089] Figure 2 shows the locations in the SARS-CoV-2 ORF1ab gene sequence corresponding to the sequences of the capture probes for sequence numbers 8 and 9 (2019-nCoV-AR-CP1.1 and 2019-nCoV-AR-CP1.2, respectively) and the detection probes for sequence numbers 11 and 12 (2019-nCoV-AR-DP1.1 and 2019-nCoV-AR-DP1.2, respectively).

[0090] Figure 3 shows the locations in the SARS-CoV-2 nucleocapsid gene sequences corresponding to the capture probe for sequence number 18 (SA-nCoV-CP2.3) and the detection probes for sequence numbers 19 and 20 (SA-nCoV-DP2.3 and SA-nCoV-DP2.4, respectively).

[0091] Sequence identity between nucleic acid sequences can be determined by comparing their alignments. Molecules are identical at a given position if equivalent positions in the sequences being compared are occupied by the same nucleotides. The alignment scoring, as a percentage of identity, is a function of the number of identical nucleotides at positions shared by the sequences being compared. When comparing sequences, optimal alignment may require the introduction of gaps in one or more of the sequences to account for possible insertions and deletions. For the same number of identical molecules in the sequences being compared, a sequence comparison method may employ a gap penalty so that a sequence alignment with as few gaps as possible, reflecting a higher relevance between the two sequences being compared, achieves a higher score than one with many gaps. The calculation of maximum percentage identity involves the production of optimal alignments that take the gap penalty into account.

[0092] Suitable computer programs for performing sequence comparisons are widely available in the commercial and public sectors. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4: 29; program available from http: / / bitincka.com / ledion / matgat), Gap (Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443-453), FASTA (Altschul et al., 1990, J. Mol. Biol. 215: 403-410; program available from http: / / www.ebi.ac.uk / fasta), Clustal W2.0 and X2.0 (Larkin et al., 2007, Bioinformatics 23: 2947-2948; program available from http: / / www.ebi.ac.uk / tools / clustalw2), and the EMBOSS pairwise alignment algorithm (Needleman & Wunsch, Examples include 1970, see above; Kruskal, 1983, In: Time warps, string edits and macromolecules: the theory and practice of sequence comparison, Sankoff & Kruskal (eds), pp 1-44, Addison Wesley; and a program available from http: / / www.ebi.ac.uk / tools / emboss / align. All programs can be run using default parameters.

[0093] For example, sequence comparison can be attempted using the "needle" method of the EMBOSS pairwise alignment algorithm, which determines the optimal alignment (including gaps) of two sequences when considered over their entire lengths and provides a percentage identity score.

[0094] Where necessary, the detection probe is marked with a detectable marker. Where necessary, the marker is a visually detectable marker (i.e., a marker that can be detected by visual estimation without the use of an instrument).

[0095] Suitable visually detectable markers include colloidal metal sol particles, latex particles, or textile dye particles. An example of colloidal metal sol particles is colloidal gold particles.

[0096] If necessary, the capture and / or detection of the isothermal amplification reaction product is performed by a chromatographic dipstick assay.

[0097] For example, as described in WO2008 / 090340 and Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71, the products of isothermal nucleic acid amplification can be labeled with a visually detectable label and captured and detected using a chromatographic inspection strip.

[0098] If necessary, the sample may be a biological sample, for example, a biological sample obtained from a subject suspected of being infected with SARS-CoV-2. If necessary, the sample may be a swab sample obtained from a subject suspected of being infected with SARS-CoV-2. If necessary, the sample may be a nasopharyngeal or throat swab sample obtained from a subject suspected of being infected with SARS-CoV-2.

[0099] If necessary, the method of the present invention is an in vitro method.

[0100] If necessary, the method of the present invention includes the step of amplifying the nucleic acid of a sample by an isothermal amplification reaction using a first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer and a second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid.

[0101] If necessary, the present invention provides a method for capturing the product of an isothermal amplification reaction using a first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer by hybridizing the nucleic acid of the product to a first nucleic acid capture probe, wherein the first capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids; and hybridizing the nucleic acid of the product to a second nucleic acid capture probe, wherein the product is hybridized to a second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer. A step of capturing the product of an isothermal amplification reaction using a Mer, further comprising the step of a second capture probe specifically hybridizing to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, wherein the first capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid.

[0102] If necessary, the present invention provides a method for detecting the product of an isothermal amplification reaction using a first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer by hybridizing the nucleic acid of the product to a first nucleic acid detection probe, wherein the first detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids; and hybridizing the nucleic acid of the product to a second nucleic acid detection probe, wherein the first detection probe specifically hybridizes to a second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer. A step of detecting the product of an isothermal amplification reaction using a Mer, further comprising the step of a second detection probe specifically hybridizing to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, wherein the first detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid.

[0103] If necessary, the first forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4 along its entire length, or a complement thereof.

[0104] If necessary, the first reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, 6, or 7 along its entire length, or a complement thereof.

[0105] If necessary, the first forward and reverse nucleic acid amplification primers include the respective nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 3]

[0106] If necessary, the first forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the first reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0107] If necessary, the second forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or a complement thereof.

[0108] If necessary, the second reverse nucleic acid primer includes the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length, or a complement thereof.

[0109] If necessary, the second forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the second reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0110] If necessary, the first and / or second reverse nucleic acid primers further include a promoter sequence for DNA-dependent RNA polymerase at their 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primers.

[0111] If necessary, the first capture probe includes the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof.

[0112] If necessary, the first capture probe contains the nucleic acid sequence of sequence number 9.

[0113] If necessary, the second capture probe includes the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof.

[0114] If necessary, the first detection probe includes the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof.

[0115] If necessary, the first forward and reverse amplification primers and the first capture and detection probes include the respective nucleic acid sequences according to one of the combinations of forward and reverse primer sequences and capture probe (CP) and detection probe (DP) shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 4]

[0116] If necessary, the first detection probe contains the nucleic acid sequence of sequence number 12.

[0117] If necessary, the second detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof.

[0118] If necessary, a second detection probe may contain the nucleic acid sequence of sequence number 19.

[0119] Amplification using first forward and reverse amplification primers specific to the ORF1ab gene, and second forward and reverse amplification primers specific to the nucleocapsid gene (as well as capture and detection as needed using probes specific to the ORF1ab and nucleocapsid genes) results in a method with exceptional sensitivity and specificity.

[0120] For embodiments of the method of the present invention comprising isothermal amplification reactions using a first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer, and a second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, the capture and / or detection of the product of the isothermal amplification reaction can be performed by a chromatographic dipstick assay using a chromatographic test strip. The test strip may include a first capture zone for capturing the product of the amplification reaction using the first forward and reverse nucleic acid amplification primers, and a second separate capture zone for capturing the product of the amplification reaction using the second forward and reverse nucleic acid amplification primers.

[0121] The method of the present invention is particularly useful as a point-of-care (POC) test for testing or screening for SARS-CoV-2 infection. In particular, the method of the present invention can be performed rapidly without the use of laboratory facilities or thermal cyclers. SARS-CoV-2 infection can potentially be detected using the method of the present invention before a subject exhibits symptoms of COVID-19. Once a subject is identified as infected with SARS-CoV-2, they can be isolated, given appropriate treatment, and monitored for infection.

[0122] The present invention also provides a kit for carrying out the method of the present invention. In the present invention, a kit for determining whether a sample contains SARS-CoV-2 nucleic acid, Forward nucleic acid amplification primers and reverse nucleic acid amplification primers for amplifying a template nucleic acid by isothermal amplification reaction, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement; A nucleic acid capture probe and / or a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or a nucleic acid complement thereof, specifically hybridizes with the sequence. A nucleic acid detection probe that specifically hybridizes to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement, and optionally includes a detectable label for labeling the isothermal nucleic acid amplification product. A kit including this is also offered.

[0123] If necessary, other human coronavirus nucleic acids include human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids.

[0124] The forward and reverse nucleic acid amplification primers, or capture and / or detection probes, of the kit of the present invention may be any of the forward and reverse nucleic acid amplification primers, or any of the capture and / or detection probes, or any combination of primers and / or probes listed herein, for the method of the present invention.

[0125] Where necessary, nucleic acid sequences that are conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids include a continuous nucleic acid sequence of at least 19 nucleotides in length.

[0126] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or its complement.

[0127] If necessary, the forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0128] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or to its complement.

[0129] If necessary, the reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0130] If necessary, the forward and reverse nucleic acid amplification primers contain nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 5]

[0131] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0132] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or its complement.

[0133] If necessary, the forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0134] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or to its complement.

[0135] If necessary, the reverse nucleic acid primers include the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length.

[0136] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0137] If necessary, the reverse nucleic acid primer further includes a promoter sequence for DNA-dependent RNA polymerase at its 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primer.

[0138] If necessary, the forward and reverse nucleic acid primers specifically hybridize to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene, and the capture probe specifically hybridizes to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene.

[0139] If necessary, the capture probe may include the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof.

[0140] If necessary, the capture probe contains the nucleic acid sequence of sequence number 9.

[0141] If necessary, the forward and reverse nucleic acid primers specifically hybridize to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement, and the capture probe specifically hybridizes to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement.

[0142] If necessary, the capture probe may include the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof.

[0143] If necessary, the forward and reverse nucleic acid primers specifically hybridize to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene, and the detection probe specifically hybridizes to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene.

[0144] If necessary, the detection probe includes the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof.

[0145] If necessary, the kit of the present invention includes forward and reverse amplification primers and capture and detection probes, each comprising a nucleic acid sequence according to one of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in the table below, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such sequences along their entire length: [Table 6]

[0146] If necessary, the detection probe contains the nucleic acid sequence of sequence number 12.

[0147] If necessary, forward and reverse nucleic acid primers specifically hybridize to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement, and the detection probe specifically hybridizes to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement.

[0148] If necessary, the detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof.

[0149] If necessary, the detection probe contains the nucleic acid sequence of sequence number 19.

[0150] In the present invention, a kit for determining whether a sample contains SARS-CoV-2 nucleic acid, A first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer, and A second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, Each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, and the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid, and Second forward nucleic acid amplification primer and second reverse nucleic acid amplification primer; A first nucleic acid capture probe and a second nucleic acid capture probe, wherein the first and second nucleic acid capture probes each specifically hybridize to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid; and / or A first nucleic acid detection probe and a second nucleic acid detection probe, wherein the first and second nucleic acid detection probes each specifically hybridize to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. A kit including this is also offered.

[0151] If necessary, the first forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0152] If necessary, the first reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0153] If necessary, the first forward and reverse nucleic acid amplification primers include the respective nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 7-1] [Table 7-2]

[0154] If necessary, the first forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the first reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0155] If necessary, the second forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0156] If necessary, the second reverse nucleic acid primer includes the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length.

[0157] If necessary, the second forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the second reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0158] If necessary, the first and / or second reverse nucleic acid primers further include a promoter sequence for DNA-dependent RNA polymerase at their 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primers.

[0159] If necessary, the first capture probe includes the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof.

[0160] If necessary, the first capture probe contains the nucleic acid sequence of sequence number 9.

[0161] If necessary, the second capture probe includes the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof.

[0162] If necessary, the first detection probe includes the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof.

[0163] If necessary, the first forward and reverse amplification primers and the first capture and detection probes include the respective nucleic acid sequences according to one of the combinations of forward and reverse primer sequences and capture probe (CP) and detection probe (DP) shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 8-1] [Table 8-2]

[0164] If necessary, the first detection probe contains the nucleic acid sequence of sequence number 12.

[0165] If necessary, the second detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof.

[0166] If necessary, a second detection probe may contain the nucleic acid sequence of sequence number 19.

[0167] If necessary, the kit of the present invention further comprises RNA-dependent DNA polymerase, DNA-dependent DNA polymerase, DNA / RNA double-strand specific ribonuclease, and DNA-dependent RNA polymerase.

[0168] If necessary, the kit of the present invention further comprises suitable nucleotide triphosphates (for transcription-based amplification, ribonucleotide triphosphates (rNTPs, i.e., rATP, rGTP, rCTP, and rUTP) and deoxyribonucleotide triphosphates (dNTPs, i.e., dATP, dGTP, dCTP, and dTTP) are required), a buffer suitable for carrying out the amplification reaction, and any necessary cofactors required by the enzyme activity (e.g., magnesium ions). Examples of suitable buffers include Tris-HCl, HEPES, or acetate buffer. Suitable salts, such as potassium chloride or sodium chloride, can be provided. Suitable concentrations of these components can be easily determined by those skilled in the art. Suitable rNTP concentrations are typically in the range of 0.25–5 mM or 0.5–2.5 mM. Suitable dNTP concentrations are typically in the range of 0.25–5 mM or 0.5–2.5 mM. Suitable magnesium ion concentrations are typically in the range of 5–15 mM.

[0169] The kit of the present invention may further include a detectable label (e.g., a visually detectable label) and / or a chromatographic test strip for labeling the product of isothermal nucleic acid amplification, and a reagent for capturing and detecting the product of isothermal nucleic acid amplification. Examples of suitable labels, test strips and reagents, and methods for capturing and detecting the product of isothermal nucleic acid amplification by a simple amplification-based assay (SAMBA) are described in WO2008 / 090340 and Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71. Amplification devices for performing the SAMBA method and apparatus for performing an automated SAMBA method are described in WO2014 / 140640.

[0170] For embodiments of the kit of the present invention comprising first forward and reverse nucleic acid primers, second forward and reverse nucleic acid primers, first and second nucleic acid capture probes, and / or first and second nucleic acid detection probes, the chromatography test strip may include a first capture zone for capturing the product of an amplification reaction using the first forward and reverse nucleic acid amplification primers, and a second separate capture zone for capturing the product of an amplification reaction using the second forward and reverse nucleic acid amplification primers.

[0171] SAMBA enables complex NAT to be performed in clinics, primary care and community healthcare settings, as well as in smaller hospitals, where complex NAT techniques are not feasible. This technology can be useful in public health emergencies such as the current coronavirus pandemic. SAMBA POC testing increases testing capacity, mitigates delays caused by sample transport, and determines the placement of infected patients. SAMBA enables accurate NAT in POC situations within approximately one hour, thus enabling healthcare workers to rapidly and accurately identify, isolate, and treat patients infectious for SARS-CoV-2—a key factor in limiting the current pandemic. SAMBA will give more hospitals the capability for SARS-CoV-2 RNA testing, allowing infected patients to be identified and treated without waiting for results from centralized testing laboratories.

[0172] The kit of the present invention may further include reagents for isolating nucleic acids from a sample, for example, using the nucleic acid extraction method described above. Reagents suitable for nucleic acid extraction may include a lysis buffer for lysing cells present in the sample, a solid phase for binding nucleic acids, a binding buffer for binding nucleic acids to the solid phase (if necessary, the lysis buffer is the same as the binding buffer), a washing buffer for washing the nucleic acids bound to the solid phase (if necessary), and an elution buffer for eluting nucleic acids from the solid phase. Suitable lysis, washing, and elution buffers are described above, along with solid phases suitable for use with buffers.

[0173] If necessary, the kit of the present invention further comprises a lysis / binding buffer, an elution buffer, and optionally a washing buffer for extracting nucleic acids from a biological sample obtained from a subject.

[0174] The kit of the present invention may further include a swab stick for obtaining a nasopharyngeal or pharyngeal swab sample from a subject.

[0175] If necessary, the kit of the present invention includes a first swab stick for obtaining a nasopharyngeal swab sample from a subject and a second swab stick for obtaining a throat swab sample from a subject.

[0176] A suitable swab stick is commercially available: Copan Diagnostics Nylon Flocked Dry Swabs in Peel Pouches (Copan Diagnostics 503CS01).

[0177] If necessary, the kit of the present invention further includes a chromatography test strip for capturing and detecting the product of isothermal nucleic acid amplification.

[0178] If necessary, the kit of the present invention further comprises positive and / or negative controls.

[0179] If necessary, the kit of the present invention further includes instructions for using the kit to carry out the method of the present invention.

[0180] The present invention also provides a set of primers for amplifying SARS-CoV-2 nucleic acid by isothermal nucleic acid amplification reaction, comprising forward nucleic acid amplification primers and reverse nucleic acid amplification primers, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids.

[0181] If necessary, other human coronavirus nucleic acids include human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids.

[0182] The forward and reverse nucleic acid amplification primers of the primer set of the present invention may be any of the forward and reverse nucleic acid amplification primers listed herein for the method of the present invention, or any combination of primers.

[0183] Where necessary, nucleic acid sequences that are conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids include a continuous nucleic acid sequence of at least 19 nucleotides in length.

[0184] If necessary, the nucleic acid sequences conserved in SARS-CoV-2 nucleic acids are the nucleic acid sequences conserved in the SARS-CoV-2 ORF1ab gene or nucleocapsid gene, or their complements.

[0185] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or its complement.

[0186] If necessary, the forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0187] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or to its complement.

[0188] If necessary, the reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0189] If necessary, the forward and reverse nucleic acid amplification primers contain nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 9]

[0190] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0191] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or its complement.

[0192] If necessary, the forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0193] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or to its complement.

[0194] If necessary, the reverse nucleic acid primers include the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length.

[0195] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0196] If necessary, the reverse nucleic acid primer further includes a promoter sequence for DNA-dependent RNA polymerase at its 5' end.

[0197] If necessary, forward and / or reverse nucleic acid primers may be up to 50 nucleotides in length. In the present invention, a set of primers for amplifying SARS-CoV-2 nucleic acid by isothermal nucleic acid amplification reaction, A first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer; and Second forward nucleic acid amplification primer and second reverse nucleic acid amplification primer Includes, A set of primers is also provided in which each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid.

[0198] If necessary, the first forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0199] If necessary, the first reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0200] If necessary, the first forward and reverse nucleic acid amplification primers include the respective nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 10]

[0201] If necessary, the first forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the first reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0202] If necessary, the second forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0203] If necessary, the second reverse nucleic acid primer includes the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length.

[0204] If necessary, the second forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the second reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0205] If necessary, the first and / or second reverse nucleic acid primers further include a promoter sequence for DNA-dependent RNA polymerase at their 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primers.

[0206] In the present invention, a set of oligonucleotides for amplifying SARS-CoV-2 nucleic acid by an isothermal nucleic acid amplification reaction, and for capturing and / or detecting the product of the amplification reaction, A set of primers of the present invention, A nucleic acid capture probe that specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement, and / or A nucleic acid detection probe that specifically hybridizes to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement, and optionally includes a detectable label for labeling the isothermal nucleic acid amplification product. A set of oligonucleotides, including the one mentioned above, is also provided.

[0207] If necessary, other human coronavirus nucleic acids include human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids.

[0208] The forward and reverse nucleic acid amplification primers, or capture and / or detection probes, for the set of oligonucleotides of the present invention may be any of the forward and reverse nucleic acid amplification primers, or any of the capture and / or detection probes, or any combination of primers and / or probes listed herein, for the method of the present invention.

[0209] Where necessary, nucleic acid sequences that are conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids include a continuous nucleic acid sequence of at least 19 nucleotides in length.

[0210] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or its complement.

[0211] If necessary, the forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0212] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 ORF1ab gene, or to its complement.

[0213] If necessary, the reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0214] If necessary, the forward and reverse nucleic acid amplification primers contain nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 11]

[0215] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0216] If necessary, the forward nucleic acid primer specifically hybridizes with a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or its complement.

[0217] If necessary, the forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0218] If necessary, the reverse nucleic acid primers specifically hybridize to the conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene, or to its complement.

[0219] If necessary, the reverse nucleic acid primers include the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length.

[0220] If necessary, the forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 16.

[0221] If necessary, the reverse nucleic acid primer further includes a promoter sequence for DNA-dependent RNA polymerase at its 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primer.

[0222] If necessary, the forward and reverse nucleic acid primers specifically hybridize to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene, and the capture probe specifically hybridizes to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene.

[0223] If necessary, the capture probe may include the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof.

[0224] If necessary, the capture probe contains the nucleic acid sequence of sequence number 9.

[0225] If necessary, the forward and reverse nucleic acid primers specifically hybridize to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement, and the capture probe specifically hybridizes to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement.

[0226] If necessary, the capture probe may include the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof.

[0227] If necessary, the forward and reverse nucleic acid primers specifically hybridize to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene, and the detection probe specifically hybridizes to the nucleic acid sequence or its complement in the SARS-CoV-2 ORF1ab gene.

[0228] If necessary, the detection probe includes the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof.

[0229] If necessary, the oligonucleotide set of the present invention includes forward and reverse amplification primers and capture and detection probes, each containing a nucleic acid sequence according to one of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in the table below, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence along its entire length: [Table 12]

[0230] If necessary, the detection probe contains the nucleic acid sequence of sequence number 12.

[0231] If necessary, forward and reverse nucleic acid primers specifically hybridize to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement, and the detection probe specifically hybridizes to a conserved nucleic acid sequence in the SARS-CoV-2 nucleocapsid gene or its complement.

[0232] If necessary, the detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof.

[0233] If necessary, the detection probe contains the nucleic acid sequence of sequence number 19.

[0234] If necessary, the capture and / or detection probes are up to 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides long.

[0235] In the present invention, a set of oligonucleotides for amplifying SARS-CoV-2 nucleic acid by an isothermal nucleic acid amplification reaction, and for capturing and / or detecting the product of the amplification reaction, A first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer, and A second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, Each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, and the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid, and Second forward nucleic acid amplification primer and second reverse nucleic acid amplification primer; A first nucleic acid capture probe and a second nucleic acid capture probe, wherein the first and second nucleic acid capture probes each specifically hybridize to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid; and / or A first nucleic acid detection probe and a second nucleic acid detection probe, wherein the first and second nucleic acid detection probes each specifically hybridize to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. A set of oligonucleotides, including the one mentioned above, is also provided.

[0236] If necessary, the first forward nucleic acid primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[0237] If necessary, the first reverse nucleic acid primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, 6, or 7.

[0238] If necessary, the first forward and reverse nucleic acid amplification primers include the respective nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 13]

[0239] If necessary, the first forward nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 1, and the first reverse nucleic acid amplification primer contains the nucleic acid sequence of SEQ ID NO: 5.

[0240] If necessary, the second forward nucleic acid primer includes the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length.

[0241] Optionally, the second reverse nucleic acid primer includes the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 15, 16 or 17 along its entire length.

[0242] Optionally, the second forward nucleic acid amplification primer includes the nucleic acid sequence of SEQ ID NO: 14, and the second reverse nucleic acid amplification primer includes the nucleic acid sequence of SEQ ID NO: 16.

[0243] Optionally, the first and / or second reverse nucleic acid primers further include a promoter sequence for DNA-dependent RNA polymerase at their 5' ends for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primers.

[0244] Optionally, the first capture probe includes the nucleic acid of the sequence: GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 8, 9 or 10 along its entire length, or its complement.

[0245] Optionally, the first capture probe includes the nucleic acid sequence of SEQ ID NO: 9.

[0246] If necessary, the second capture probe includes the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof.

[0247] If necessary, the first detection probe includes the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof.

[0248] If necessary, the first forward and reverse amplification primers and the first capture and detection probes include the respective nucleic acid sequences according to one of the combinations of forward and reverse primer sequences and capture probe (CP) and detection probe (DP) shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length: [Table 14-1] [Table 14-2]

[0249] If necessary, the first detection probe contains the nucleic acid sequence of sequence number 12.

[0250] If necessary, the second detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof.

[0251] If necessary, a second detection probe may contain the nucleic acid sequence of sequence number 19.

[0252] In the present invention, an oligonucleotide, The nucleic acid sequence of CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or its complement; Nucleic acid sequences of GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 2, or their complements; A nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 3 along its entire length, or a complement thereof; The nucleic acid sequence of CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 4 along its entire length, or its complement; The nucleic acid sequence of CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5 along its entire length, or its complement; The nucleic acid sequence of CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 6 along its entire length, or its complement; Nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 7 along its entire length, or their complements; Nucleic acid sequences of GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 8 along its entire length, or their complements; Nucleic acid sequences of GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 9 along its entire length, or their complements; The nucleic acid sequence ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 10 along its entire length, or its complement; Nucleic acid sequences of CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 11 along its entire length, or their complements; Nucleic acid sequences of GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 12 along its entire length, or their complements; Nucleic acid sequences of GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 13 along its entire length, or their complements; Nucleic acid sequences of TAGTTGATGACCCGTGTCCT (SEQ ID NO: 14), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or their complements; Nucleic acid sequences of TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15 along its entire length, or their complements; The nucleic acid sequence of CAACACGAACGTCATGATAC (SEQ ID NO: 16), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or its complement; The nucleic acid sequence of CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 17 along its entire length, or its complement; A nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof; A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 along its entire length, or a complement thereof; The nucleic acid sequence GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 20 along its entire length, or its complement. Oligonucleotides containing these oligonucleotides are also provided.

[0253] The set of primers, the set of oligonucleotides, or the oligonucleotides of the present invention can be used in the kit or method of the present invention.

[0254] The primers, probes, or oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention may have a length of at least 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 nucleotides.

[0255] Primers, probes or oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention may be up to 20, 25, 30, 35, 40, 45, 50, 55, 60 or 100 nucleotides in length.

[0256] Primers or oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 1 may be up to 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90 or 100 nucleotides in length.

[0257] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the complement of the nucleic acid sequence of SEQ ID NO: 1 may be up to 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90 or 100 nucleotides in length.

[0258] Primers or oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 2 may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90 or 100 nucleotides in length.

[0259] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 2, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0260] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 3, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0261] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 3, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0262] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 4, may be up to 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0263] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 4, may be up to 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0264] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 5, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0265] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 5, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0266] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 6, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0267] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 6, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0268] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 7, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0269] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 7, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0270] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 8, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0271] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 8, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0272] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 9, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0273] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 9, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0274] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 10, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0275] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 10, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0276] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 11, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0277] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 11, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0278] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 12, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0279] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 12, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0280] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 13, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0281] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 13, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0282] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 14, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0283] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 14, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0284] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 15, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0285] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 15, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0286] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 16, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0287] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 16, may be up to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0288] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 17, may be up to 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0289] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 17, may be up to 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0290] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 18, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0291] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 18, may be up to 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0292] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 19, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0293] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 19, may be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0294] A primer or oligonucleotide for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, comprising the nucleic acid sequence of SEQ ID NO: 20, may be up to 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0295] Oligonucleotides for use in the present invention, or in a set of primers or oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, including a complement to the nucleic acid sequence of SEQ ID NO: 20, may be up to 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0296] The oligonucleotides of the present invention may include, over their entire length, a sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, or 100% identical to, any nucleotide sequence of SEQ ID NOs: 1 to 20, or a nucleotide sequence comprising a complementary thereof.

[0297] Oligonucleotides can be labeled with detectable labels, such as visually detectable labels. In particular, oligonucleotides containing or comprising nucleic acid sequences of sequence numbers 11, 12, 13, 19, or 20, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to sequence numbers 11, 12, 13, 19, or 20 along their entire length, or their complements, can be labeled with visually detectable labels. Examples of visually detectable labels include colloidal metal sol particles, latex particles, or textile dye particles. An example of colloidal metal sol particles is colloidal gold particles.

[0298] The primer or oligonucleotide set of the present invention may contain the oligonucleotides of the present invention.

[0299] The Kit of the present invention may include a set of primers, a set of oligonucleotides, or oligonucleotides.

[0300] In the present invention, the use of a set of primers, a set of oligonucleotides, or oligonucleotides in the method of the present invention is also provided.

[0301] The embodiments of the present invention will be described below as merely one example, with reference to the attached drawings shown below. [Brief explanation of the drawing]

[0302] [Figure 1] Figure 1 shows the genome structure of SARS-CoV-2 (isopropyl Wuhan-Hu-1, GenBank Acc MN908947).

[0303] [Figure 2A] Figures 2A–D show the multiple sequence alignment of the ORF1ab region for all seven human coronaviruses (229E, SARS, HKU1, MERS, OC43, and NL63, as well as SARS-CoV-2 sequences from several different isolates) and bat SARS-like coronavirus sequences. In the figures, SARS-CoV-2 is referred to by its previous provisional name, "2019-nCoV" (2019 novel coronavirus). The locations in the SARS-CoV-2 ORF1ab gene sequence corresponding to the sequences of the forward primers SEQ ID NOs. 1–3 (2019-nCoV-ARP1.1F, 2019-nCoV-ARP1.2F, and 2019-nCoV-ARP1.3F, respectively) and the reverse complements of the sequences of the reverse primers SEQ ID NOs. 5 and 6 (2019-nCoV-ARP1.1R and 2019-nCoV-ARP1.2R, respectively) are also shown. [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above.

[0304] [Figure 3A]Figures 3A–I show multiple sequence alignments of the nucleocapsid regions of all seven human coronaviruses (229E, SARS, HKU1, MERS, OC43, and NL63, as well as SARS-CoV-2 sequences from several different isolates) and bat SARS-like coronavirus sequences. In the figures, SARS-CoV-2 is referred to by its previous provisional name, "2019-nCoV" (2019 novel coronavirus). The locations in the SARS-CoV-2 nucleocapsid gene sequence corresponding to the forward primer sequence of SEQ ID NO: 14 (SA-nCoV-F2.3) and the reverse complements of the reverse primer sequences of SEQ ID NOs: 15–17 (SA-nCoV-R2.3, SA-nCoV-R2.4, and SA-nCoV-R2.5, respectively) are also shown. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 3E] Same as above. [Figure 3F] Same as above. [Figure 3G] Same as above. [Figure 3H] Same as above. [Figure 3I] Same as above.

[0305] [Figure 4] Figure 4 schematically illustrates the steps for transcription-based amplification of the target RNA.

[0306] [Figure 5] Figure 5 shows the results of a point-of-care (POC) nucleic acid test for detecting SARS-CoV-2 using the method according to an embodiment of the present invention. [Examples]

[0307] (Example 1) Primer and probe design from coronavirus Orf1ab sequence alignment Nucleic acid sequences of the Orf1ab gene were obtained for all seven human coronaviruses (229E, SARS, HKU1, MERS, OC43, NL63, and SARS-CoV-2), and these were combined with three different SARS-CoV-2 sequences and a bat SARS-like coronavirus sequence. These sequences were aligned using CLUSTAL 0(1.2.4) multiplex sequence alignment software. The multiplex sequence alignment is shown in Figure 2. In Figure 2, SARS-CoV-2 is referred to by its previous provisional name, 2019-nCoV (2019 novel coronavirus).

[0308] The resulting sequence is shown below: [ka] [ka] Primer and probe array

[0309] Primer and probe sequences for the specific amplification and detection of the SARS-CoV-2 Orf1ab nucleic acid sequence were designed based on multiple sequence alignment and are presented below. [ka] (Example 2) Primer and probe design from coronavirus nucleocapsid gene sequence alignment

[0310] Nucleic acid sequences were obtained for the genes encoding the nucleocapsid (N) protein of all seven human coronaviruses (229E, SARS, HKU1, MERS, OC43, NL63, and SARS-CoV-2), and these sequences were combined with three different SARS-CoV-2 sequences and a bat SARS-like coronavirus sequence. These sequences were aligned using CLUSTAL 0(1.2.4) multiplex sequence alignment software. The multiplex sequence alignment is shown in Figure 3. In Figure 3, SARS-CoV-2 is referred to by its previous provisional name, 2019-nCoV (2019 novel coronavirus).

[0311] The resulting sequence is shown below: [ka] [ka] [ka] Primer and probe array

[0312] Primer and probe sequences for the specific amplification and detection of the SARS-CoV-2 nucleocapsid nucleic acid sequence were designed based on multiple sequence alignment and are presented below. [ka] [ka] (Example 3) Point-of-care (POC) nucleic acid testing for SARS-CoV-2 detection

[0313] Using a simple amplification-based assay (SAMBA) method similar to the one described in Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71, SARS-CoV-2 target RNA was extracted, reverse transcribed, amplified by isothermal nucleic acid amplification, and the amplified product was detected by rapid visual detection using a dipstick.

[0314] In short, a reverse nucleic acid amplification primer contains a nucleic acid sequence complementary to a portion of the SARS-CoV-2 target RNA, and also contains a single-stranded version of the promoter sequence for DNA-dependent RNA polymerase at its 5' end, so that the primer can specifically hybridize to the target RNA. The reverse primer hybridizes to the RNA target. RNA-dependent DNA polymerase extends the reverse primer to synthesize a complementary DNA (cDNA) copy of the RNA target. DNA / RNA double-strand specific ribonuclease digests the RNA of the RNA-cDNA hybrid. A forward nucleic acid amplification primer contains a nucleic acid sequence complementary to a portion of the cDNA. The forward primer hybridizes to a portion of the cDNA formed by the reverse primer downstream of the cDNA. The forward primer is extended by DNA-dependent DNA polymerase to produce a second DNA strand that extends via the DNA-dependent RNA polymerase promoter sequence at one end (thus forming a double-stranded promoter). This promoter is used by DNA-dependent RNA polymerase to synthesize a large number of RNAs complementary to the original target sequence. These RNA products then serve as templates for the cycle phase of the reaction, but using an inverted primer hybridization step, i.e., a forward primer followed by a reverse primer.

[0315] The following primer / probe sequences were used for isothermal amplification, capture, and detection of SARS-CoV-2 nucleic acid: [ka] [ka]

[0316] The sensitivity of the tests was determined by performing isothermal amplification, capture, and detection for 1000, 100, 10, and 0 copies of SARS-CoV-2 RNA target copies per test.

[0317] The chromatography strip includes a capture zone with a capture probe 2019-CoV-AR-CP1.2(GAGGACAATCAGACAACTACTATTC; SEQ ID NO: 9) (for capturing amplified nucleic acids in the ORF1ab region) immobilized on a first upper line, and a capture probe SA_nCoV_CP2.3(CTGGTTCTAAATCACCCATTCA; SEQ ID NO: 18) (for capturing amplified nucleic acids in the nucleocapsid region) immobilized on a separate second lower line. The third uppermost line includes a capture probe for hybridizing to an amplified nucleic acid of the internal control.

[0318] Isothermal amplification, capture, and detection of SARS and MERS target RNAs (>100,000 copies per test) were also performed.

[0319] The results are recorded in Figure 5. The results show that SARS-CoV-2 target RNA was efficiently detected at a low level of 10 copies / test, and that the test results were highly specific to SARS-CoV-2 target RNA than to SARS and MERS target RNA. (Example 4) Sensitivity and specificity of POC nucleic acid testing for detecting SARS-CoV-2 in clinical samples

[0320] This embodiment describes the evaluation of the clinical sensitivity and specificity of a SARS-CoV-2 test according to the present invention in 102 blinded frozen clinical samples collected from symptomatic individuals.

[0321] Samples were independently tested according to the real-time RT-PCR reference method described in Corman et al., “Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR”, Euro Surveill. 2020;25(3):pii=2000045. The results obtained by this method were compared with the results obtained using a method according to an embodiment of the present invention similar to the method described in Example 3, performed using an automated sample processing system similar to that described in WO2014 / 140640. This method is referred to herein as the SAMBA II SARS-CoV-2 test. This test is a fully automated isothermal nucleic acid amplification test performed using a CE-marked SAMBA II instrument system consisting of a SAMBA II assay module and a tablet module.

[0322] 102 types of nasal / pharyngeal swab samples were collected from symptomatic individuals into Viral Transport Medium (VTM) and diluted 1:2 with buffer before being supplied for testing. Samples were provided blinded and coded, and patient information was not available to the testers. a) Testing criteria [Table 15] b) Clinical results compared with the reference method (qPCR): % Sensitivity: ≥98% %specificity: 100% result: [Table 16-1] [Table 16-2] [Table 16-3] [Table 16-4]

[0323] A total of 102 samples were tested using SAMBA. Of these, 74 were positive, 25 were negative, and 3 were invalid. The invalid samples were further diluted in buffer at 1:4 and 1:10 and retested, resulting in 1 positive and 2 negative results.

[0324] Compared to the reference laboratory test, SAMBA produced 75 matched positives, 26 matched negatives, and 1 false negative (see table below). Therefore, the SAMBA II SARS-CoV-2 test has a sensitivity of 98.68% (95% CI 92.89–99.97%), a specificity of 100% (95% CI 87.23–100%), a PPV of 100%, and an NPV of 96.43% (79.39–99.47%) compared to the reference method. The one mismatched sample gave a high Ct value (>31) in the reference method, and since UTM was found to interfere with the assay, it was further diluted (1:2) for the SAMBA test, which can explain the false negative result.

[0325] Clinical outcomes in 102 types of blinded surplus clinical samples compared to a reference method: [Table 17] Conclusion:

[0326] Compared to the reference method, when tested in a 1:2 buffer solution, the sensitivity and specificity of the SAMBA II SARS-CoV-2 test were 98.68% (95% CI 92.89–99.97%) and 100% (95% CI 87.23–100%), respectively. In certain embodiments, for example, the following items are provided: (Item 1) A method for determining whether a sample contains severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleic acid, comprising the steps of amplifying the nucleic acid of the sample or amplifying nucleic acid derived from the nucleic acid of the sample by an isothermal amplification reaction using a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids. (Item 2) The method according to item 1, wherein the other human coronavirus nucleic acids are human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids. (Item 3) The method according to item 1 or 2, wherein the nucleic acid sequence conserved in SARS-CoV-2 nucleic acid is a nucleic acid sequence conserved in the ORF1ab gene or nucleocapsid gene of SARS-CoV-2. (Item 4) The method according to any of the preceding items, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 5) The method according to item 4, wherein the forward nucleic acid primer comprises the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence 1, 2, 3, or 4 along its entire length, or a complement thereof. (Item 6) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1) or its complement. (Item 7) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or a complement thereof. (Item 8) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises the nucleic acid sequence GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2) or its complement. (Item 9) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 2 along its entire length, or a complement thereof. (Item 10) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises the nucleic acid sequence GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3) or its complement. (Item 11) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 3 along its entire length, or a complement thereof. (Item 12) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises the nucleic acid sequence CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4) or its complement. (Item 13) The method according to item 4 or 5, wherein the forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 4 along its entire length, or a complement thereof. (Item 14) The method according to any of the preceding items, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 15) The method according to item 14, wherein the reverse nucleic acid primer comprises the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, 6, or 7 along its entire length, or a complement thereof. (Item 16) The method according to item 14 or 15, wherein the reverse nucleic acid primer comprises the nucleic acid sequence CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5) or its complement. (Item 17) The method according to item 14 or 15, wherein the reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5 along its entire length, or a complement thereof. (Item 18) The method according to item 14 or 15, wherein the reverse nucleic acid primer comprises the nucleic acid sequence CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6) or its complement. (Item 19) The method according to item 14 or 15, wherein the reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 6 along its entire length, or a complement thereof. (Item 20) The method according to item 14 or 15, wherein the reverse nucleic acid primer comprises the nucleic acid sequence AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7) or its complement. (Item 21) The method according to item 14 or 15, wherein the reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 7 along its entire length, or a complement thereof. (Item 22) The method according to any of the preceding items, wherein the forward and reverse nucleic acid amplification primers include nucleic acid sequences according to any of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length. Table 18-1 Table 18-2 (Item 23) The method according to any one of items 1 to 5, 14, 15, or 22, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 5. (Item 24) The method according to any one of items 1 to 3, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement. (Item 25) The method according to item 24, wherein the forward nucleic acid primer comprises the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or a complement thereof. (Item 26) The method according to item 24 or 25, wherein the forward nucleic acid primer comprises the nucleic acid sequence TAGTTGATGACCCGTGTCCT (SEQ ID NO: 14) or its complement. (Item 27) The method according to item 24 or 25, wherein the forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or a complement thereof. (Item 28) The method according to any one of items 1 to 3 or 24 to 27, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 29) The method according to item 28, wherein the reverse nucleic acid primer comprises the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 15, 16, or 17 along its entire length, or a complement thereof. (Item 30) The method according to item 28 or 29, wherein the reverse nucleic acid primer comprises the nucleic acid sequence TGGGGTCCATTATCAGACAT (SEQ ID NO: 15) or its complement. (Item 31) The method according to item 28 or 29, wherein the reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 15 along its entire length, or a complement thereof. (Item 32) The method according to item 28 or 29, wherein the reverse nucleic acid primer comprises the nucleic acid sequence CAACACGAACGTCATGATAC (SEQ ID NO: 16) or its complement. (Item 33) The method according to item 28 or 29, wherein the reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or a complement thereof. (Item 34) The method according to item 28 or 29, wherein the reverse nucleic acid primer comprises the nucleic acid sequence CATAGAACGAACAACGCAC (SEQ ID NO: 17) or its complement. (Item 35) The method according to item 28 or 29, wherein the reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 17 along its entire length, or a complement thereof. (Item 36) The method according to any one of items 24, 25, 28, or 29, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 16. (Item 37) The method according to any of the preceding items, further comprising the steps of reverse transcribing the SARS-CoV-2 RNA of the sample and amplifying the product of the reverse transcription by an isothermal amplification reaction using the forward and reverse nucleic acid amplification primers. (Item 38) The method according to item 37, wherein the reverse nucleic acid primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5' end, and reverse transcription is performed using the reverse nucleic acid primer. (Item 39) The method according to item 37 or 38, further comprising the steps of isolating the nucleic acid of the sample and then reverse transcribing the SARS-CoV-2 RNA of the sample present in the isolated nucleic acid. (Item 40) The method according to any of the preceding items, further comprising the step of capturing the product of the isothermal amplification reaction by hybridizing the nucleic acid of the product to a nucleic acid capture probe, wherein the capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids. (Item 41) The method according to item 40, wherein the other human coronavirus nucleic acids are human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids. (Item 42) The method according to item 40 or 41, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement. (Item 43) The method according to item 42, wherein the capture probe comprises the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof. (Item 44) The method according to item 42 or 43, wherein the capture probe comprises the nucleic acid of sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8) or its complement. (Item 45) The method according to item 42 or 43, wherein the capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 8 along its entire length, or a complement thereof. (Item 46) The method according to item 42 or 43, wherein the capture probe comprises the nucleic acid of sequence:GAGGACAATCAGACAACTACTATTC (Sequence ID 9) or its complement. (Item 47) The method according to item 42 or 43, wherein the capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 9 along its entire length, or a complement thereof. (Item 48) The method according to item 42 or 43, wherein the capture probe comprises the nucleic acid of sequence:ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10) or its complement. (Item 49) The method according to item 42 or 43, wherein the capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 10 along its entire length, or a complement thereof. (Item 50) The method according to any one of items 40 to 42, wherein the capture probe comprises the nucleic acid sequence of sequence number 9. (Item 51) The method according to item 40 or 41, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 52) The method according to item 51, wherein the capture probe comprises the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof. (Item 53) The method according to item 51 or 52, wherein the capture probe comprises the nucleic acid sequence CTGGTTCTAAATCACCCATTCA (Sequence ID 18) or its complement. (Item 54) The method according to item 51 or 52, wherein the capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof. (Item 55) The method according to any of the preceding items, further comprising the step of detecting the product of the isothermal amplification reaction by hybridizing the product to a nucleic acid detection probe, wherein the detection probe specifically hybridizes to a SARS-CoV-2 nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids. (Item 56) The method according to item 55, wherein the other human coronavirus nucleic acids are human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids. (Item 57) The method according to item 55 or 56, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 58) The method according to item 57, wherein the detection probe comprises the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof. (Item 59) The method according to item 57 or 58, wherein the detection probe comprises the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11) or its complement. (Item 60) The method according to item 57 or 58, wherein the detection probe comprises a nucleic acid sequence or its complement that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 11 along its entire length. (Item 61) The method according to item 57 or 58, wherein the detection probe comprises the nucleic acid sequence GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12) or its complement. (Item 62) The method according to item 57 or 58, wherein the detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 12 along its entire length, or a complement thereof. (Item 63) The method according to item 57 or 58, wherein the detection probe comprises the nucleic acid sequence GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13) or its complement. (Item 64) The method according to item 57 or 58, wherein the detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 13 along its entire length, or a complement thereof. (Item 65) The method according to any of the preceding items, comprising amplification using forward and reverse nucleic acid amplification primers, capture of the amplified product using a capture probe, and detection of the amplified product using a detection probe, wherein the amplification primers and the capture and detection probes each contain nucleic acid sequences according to any of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length. Table 19-1 Table 19-2 (Item 66) The method according to any one of items 55 to 58, wherein the detection probe includes the nucleic acid sequence of sequence number 12. (Item 67) The method according to item 55 or 56, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 68) The method according to item 67, wherein the detection probe comprises the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof. (Item 69) The method according to item 67 or 68, wherein the detection probe comprises the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19) or its complement. (Item 70) The method according to item 67 or 68, wherein the detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 along its entire length, or a complement thereof. (Item 71) The method according to item 67 or 68, wherein the detection probe comprises the nucleic acid sequence GGAACCTAAATTGGGTAGTCTTG (Sequence ID 20) or its complement. (Item 72) The method according to item 67 or 68, wherein the detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 20 along its entire length, or a complement thereof. (Item 73) The method according to any one of items 55, 56, 67, or 68, wherein the detection probe includes the nucleic acid sequence of sequence number 19. (Item 74) The method according to any one of items 55 to 73, wherein the detection probe is marked with a visually detectable marker. (Item 75) The method according to any one of items 1 to 3, comprising the steps of amplifying the nucleic acid of a sample by an isothermal amplification reaction using a first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer, and a second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. (Item 76) The method according to item 75, wherein the first forward nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 1 or its complement. (Item 77) The method according to item 75, wherein the first forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or a complement thereof. (Item 78) The method according to item 75, wherein the first forward nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 2 or its complement. (Item 79) The method according to item 75, wherein the first forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 2 along its entire length, or a complement thereof. (Item 80) The method according to item 75, wherein the first forward nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 3 or its complement. (Item 81) The method according to item 75, wherein the first forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 3 along its entire length, or a complement thereof. (Item 82) The method according to item 75, wherein the first forward nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 4 or its complement. (Item 83) The method according to item 75, wherein the first forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 4 along its entire length, or a complement thereof. (Item 84) The method according to any one of items 75 to 83, wherein the first reverse nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 5 or its complement. (Item 85) The method according to any one of items 75 to 83, wherein the first reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5 along its entire length, or a complement thereof. (Item 86) The method according to any one of items 75 to 83, wherein the first reverse nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 6 or its complement. (Item 87) The method according to any one of items 75 to 83, wherein the first reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 6 along its entire length, or a complement thereof. (Item 88) The method according to any one of items 75 to 83, wherein the first reverse nucleic acid primer comprises the nucleic acid sequence of SEQ ID NO: 7 or its complement. (Item 89) The method according to any one of items 75 to 83, wherein the first reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 7 along its entire length, or a complement thereof. (Item 90) The method according to item 75, wherein the first forward and reverse nucleic acid amplification primers each comprise a nucleic acid sequence according to one of the forward and reverse primer sequence combinations shown in the table below, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such sequences along their entire length. Table 20 (Item 91) The method according to item 75, wherein the first forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 1, and the first reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 5. (Item 92) The method according to any one of items 75 to 91, wherein the second forward nucleic acid primer comprises the nucleic acid sequence TAGTTGATGACCCGTGTCCT (SEQ ID NO: 14) or its complement. (Item 93) The method according to any one of items 75 to 91, wherein the second forward nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or a complement thereof. (Item 94) The method according to any one of items 75 to 93, wherein the second reverse nucleic acid primer comprises the nucleic acid sequence TGGGGTCCATTATCAGACAT (SEQ ID NO: 15) or its complement. (Item 95) The method according to any one of items 75 to 93, wherein the second reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 15 along its entire length, or a complement thereof. (Item 96) The method according to any one of items 75 to 93, wherein the second reverse nucleic acid primer comprises the nucleic acid sequence CAACACGAACGTCATGATAC (SEQ ID NO: 16) or its complement. (Item 97) The method according to any one of items 75 to 93, wherein the second reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or a complement thereof. (Item 98) The method according to any one of items 75 to 93, wherein the second reverse nucleic acid primer comprises the nucleic acid sequence CATAGAACGAACAACGCAC (SEQ ID NO: 17) or its complement. (Item 99) The method according to any one of items 75 to 93, wherein the second reverse nucleic acid primer comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 17 along its entire length, or a complement thereof. (Item 100) The method according to any one of items 75 to 92, wherein the second forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 14, and the second reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 16. (Item 101) The method according to any one of items 75 to 100, wherein the first and / or second reverse nucleic acid primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primer. (Item 102) A step of capturing the product of the isothermal amplification reaction using the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer by hybridizing the nucleic acid of the product to a first nucleic acid capture probe, wherein the first capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids; and a step of capturing the product of the isothermal amplification reaction using the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer by hybridizing the nucleic acid of the product to a second nucleic acid capture probe. The method according to any one of items 75 to 101, further comprising the step of capturing a product, wherein the second capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, wherein the first capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. (Item 103) The method according to item 102, wherein the first capture probe comprises the nucleic acid of sequence GGCAGTGAGGACAATCAGCAACTAC (sequence number 8) or its complement. (Item 104) The method according to item 102, wherein the first capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 8 along its entire length, or a complement thereof. (Item 105) The method according to item 102, wherein the first capture probe comprises the nucleic acid of sequence GAGGACAATCAGACAACTACTATTC (sequence number 9) or its complement. (Item 106) The method according to item 102, wherein the first capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 9 along its entire length, or a complement thereof. (Item 107) The method according to item 102, wherein the first capture probe comprises the nucleic acid of sequence ACCCGTCCTTGATTGGCTTG (sequence number 10) or its complement. (Item 108) The method according to item 102, wherein the first capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 10 along its entire length, or a complement thereof. (Item 109) The method according to any one of items 102 to 108, wherein the second capture probe comprises the nucleic acid of the sequence, and the second capture probe comprises the nucleic acid of sequence CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18) or its complement. (Item 110) The method according to any one of items 102 to 108, wherein the second capture probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof. (Item 111) A step of detecting the product of the isothermal amplification reaction using the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer by hybridizing the nucleic acid of the product to a first nucleic acid detection probe, wherein the first detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids; and a step of detecting the product of the isothermal amplification reaction using the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer by hybridizing the nucleic acid of the product to a second nucleic acid detection probe The method according to any one of items 75 to 110, further comprising the step of detecting a product, wherein the second detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, wherein the first detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second detection probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. (Item 112) The method according to item 111, wherein the first detection probe comprises the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11) or its complement. (Item 113) The method according to item 111, wherein the first detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 11 along its entire length, or a complement thereof. (Item 114) The method according to item 111, wherein the first detection probe comprises the nucleic acid sequence GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12) or its complement. (Item 115) The method according to item 111, wherein the first detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 12 along its entire length, or a complement thereof. (Item 116) The method according to item 111, wherein the first detection probe comprises the nucleic acid sequence GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13) or its complement. (Item 117) The method according to item 111, wherein the first detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 13 along its entire length, or a complement thereof. (Item 118) The method according to any one of items 75 to 117, wherein the first forward and reverse amplification primers, and the first capture and detection probes, each include a nucleic acid sequence according to one of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in the table below, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such sequences along their entire length. Table 21-1 Table 21-2 (Item 119) The method according to any one of items 111 to 118, wherein the second detection probe comprises the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19) or its complement. (Item 120) The method according to any one of items 111 to 118, wherein the second detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 along its entire length, or a complement thereof. (Item 121) The method according to any one of items 111 to 118, wherein the second detection probe comprises the nucleic acid sequence GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20) or its complement. (Item 122) The method according to any one of items 111 to 118, wherein the second detection probe comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of sequence number 20 along its entire length, or a complement thereof. (Item 123) The method according to any one of items 40 to 122, wherein the capture and / or detection of the product of the isothermal amplification reaction is performed by a chromatographic dipstick assay. (Item 124) The method according to any of the preceding items, wherein the sample is a biological sample obtained from a subject suspected of being infected with SARS-CoV-2. (Item 125) The method according to any of the preceding items, wherein the sample is a nasopharyngeal or throat swab sample obtained from a subject suspected of being infected with SARS-CoV-2. (Item 126) An in vitro method, as described in any of the preceding items. (Item 127) A kit for determining whether a sample contains SARS-CoV-2 nucleic acid, Forward nucleic acid amplification primers and reverse nucleic acid amplification primers for amplifying a template nucleic acid by isothermal amplification reaction, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement; A nucleic acid capture probe that specifically hybridizes to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement; and / or A nucleic acid detection probe that specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, and optionally includes a detectable label for labeling the product of the isothermal nucleic acid amplification. A kit that includes this. (Item 128) The kit described in item 127, wherein the other human coronavirus nucleic acids are human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids. (Item 129) The kit according to item 127 or 128, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 130) The kit according to item 129, wherein the forward nucleic acid primer comprises the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1, 2, 3, or 4. (Item 131) The kit according to any one of items 127 to 130, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 132) The kit according to item 131, wherein the reverse nucleic acid primer comprises the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 5, 6, or 7. (Item 133) A kit according to any one of items 127 to 132, wherein the forward and reverse nucleic acid amplification primers include a nucleic acid sequence according to one of the forward and reverse primer sequence combinations shown in the table below, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence along its entire length. Table 22 (Item 134) The kit according to any one of items 127 to 133, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 5. (Item 135) The kit according to item 127 or 128, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the SARS-CoV-2 nucleocapsid gene or its complement. (Item 136) The kit according to item 135, wherein the forward nucleic acid primer comprises the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length. (Item 137) The kit according to any one of items 127, 128, 135, or 136, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement. (Item 138) The kit according to item 137, wherein the reverse nucleic acid primer comprises the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17. (Item 139) The kit according to any one of items 135 to 138, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 16. (Item 140) The kit according to any one of items 127 to 139, wherein the reverse nucleic acid primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primer. (Item 141) The kit according to any one of items 127 to 140, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement. (Item 142) The kit according to item 141, wherein the capture probe comprises the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof. (Item 143) The kit according to item 141 or 142, wherein the capture probe comprises the nucleic acid sequence of sequence number 9. (Item 144) The kit according to any one of items 127, 128, or 135 to 140, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 145) The kit according to item 144, wherein the capture probe comprises the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof. (Item 146) The kit according to any one of items 127 to 136 or 141 to 143, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement. (Item 147) The kit according to item 146, wherein the detection probe comprises the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof. (Item 148) A kit according to any of items 127 to 134, 140 to 143, 146 or 147, comprising forward and reverse amplification primers, as well as capture and detection probes, each containing a nucleic acid sequence according to one of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in the table below, or nucleic acid sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such sequences along their entire length. Table 23 (Item 149) The kit according to any one of items 146 to 148, wherein the detection probe includes the nucleic acid sequence of sequence number 12. (Item 150) The kit according to any one of items 127, 128, or 135 to 140, 144, or 145, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 151) The kit according to item 150, wherein the detection probe comprises the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof. (Item 152) The kit according to any of items 127, 128, 135 to 140, 144, 145, 150, or 151, wherein the detection probe comprises the nucleic acid sequence of sequence number 19. (Item 153) A first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer, and A second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, Each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, and the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid, and Second forward nucleic acid amplification primer and second reverse nucleic acid amplification primer; A first nucleic acid capture probe and a second nucleic acid capture probe, wherein the first and second nucleic acid capture probes each specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid; and / or A first nucleic acid detection probe and a second nucleic acid detection probe, wherein the first and second nucleic acid detection probes each specifically hybridize to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. The kits listed in item 127 or 128, including the kits listed in item 127 or 128. (Item 154) A kit as described in items 127, 128, comprising forward and reverse nucleic acid amplification primers listed in any of items 1 to 74, and optionally capture and / or detection probes, or a kit as described in item 153, comprising a first forward and reverse nucleic acid amplification primer and a second forward and reverse nucleic acid amplification primer as described in any of items 75 to 122, and optionally first and second capture probes and / or first and second detection probes. (Item 155) A kit as described in any of items 127 to 152, further comprising RNA-dependent DNA polymerase, DNA-dependent DNA polymerase, DNA / RNA double-strand specific ribonuclease, and DNA-dependent RNA polymerase. (Item 156) A kit as described in any of items 127 to 155, further comprising a swab stick for obtaining a nasopharyngeal or pharyngeal swab sample from a subject. (Item 157) A kit according to any one of items 127 to 156, further comprising a first swab stick for obtaining a nasopharyngeal swab sample from a subject, and a second swab stick for obtaining a pharyngeal swab sample from a subject. (Item 158) The kit according to any one of items 127 to 157, further comprising a chromatographic inspection strip for capturing and detecting the product of the isothermal nucleic acid amplification. (Item 159) A kit according to any one of items 127 to 158 for extracting nucleic acids from a biological sample obtained from the subject, further comprising a lysis / binding buffer, an elution buffer, and optionally a washing buffer. (Item 160) A set of primers for amplifying SARS-CoV-2 nucleic acid by isothermal nucleic acid amplification reaction, comprising forward nucleic acid amplification primers and reverse nucleic acid amplification primers, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids. (Item 161) The set of primers described in item 160, wherein the other human coronavirus nucleic acids are human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids. (Item 162) A set of primers according to item 160 or 161, wherein the nucleic acid sequence conserved in SARS-CoV-2 nucleic acid is a nucleic acid sequence conserved in the SARS-CoV-2 ORF1ab gene or nucleocapsid gene, or its complement thereof. (Item 163) A set of primers according to any one of items 160 to 162, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 164) A set of primers according to item 163, wherein the forward nucleic acid primer comprises the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence 1, 2, 3, or 4. (Item 165) A set of primers according to any one of items 160 to 164, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 166) A set of primers according to item 165, wherein the reverse nucleic acid primer comprises a nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 5, 6, or 7. (Item 167) A set of primers according to any one of items 160 to 166, wherein the forward and reverse primers each contain nucleic acid sequences according to one of the forward and reverse primer sequence combinations shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length. Table 24 (Item 168) A set of primers according to any one of items 160 to 168, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 5. (Item 169) A set of primers according to any one of items 160 to 162, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement. (Item 170) A set of primers according to item 168, wherein the forward nucleic acid primer comprises the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length. (Item 171) A set of primers according to any one of items 160 to 162, 169, or 170, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement. (Item 172) A set of primers according to item 171, wherein the reverse nucleic acid primer comprises a nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17. (Item 173) A set of primers according to any one of items 160 to 162 or 169 to 172, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 16. (Item 174) A set of primers according to any one of items 160 to 173, wherein the reverse nucleic acid primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5' end. (Item 175) A set of primers according to any one of items 160 to 174, wherein the forward and / or reverse nucleic acid primers are up to 50 nucleotides in length. (Item 176) A set of primers as described in item 160 or 161, comprising forward and reverse nucleic acid amplification primers listed in any of items 1 through 74, or a first forward and reverse nucleic acid amplification primer and a second forward and reverse nucleic acid amplification primer listed in any of items 75 through 122. (Item 177) A set of oligonucleotides for amplifying SARS-CoV-2 nucleic acid by an isothermal nucleic acid amplification reaction, and for capturing and / or detecting the product of the amplification reaction, A set of primers as described in any of items 160 to 176; A nucleic acid capture probe that specifically hybridizes to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement; and / or A nucleic acid detection probe that specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, and optionally includes a detectable label for labeling the product of the isothermal nucleic acid amplification. A set of oligonucleotides containing [specific oligonucleotides]. (Item 178) The set of oligonucleotides described in item 177, wherein the other human coronavirus nucleic acids are human coronavirus 229E, SARS, HKU1, MERS, OC43, and NL63 nucleic acids. (Item 179) A set of oligonucleotides according to item 177 or 178, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 180) A set of oligonucleotides according to item 179, wherein the forward nucleic acid primer comprises the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), GTCAACAAACTGTTGGTCAA (SEQ ID NO: 2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence that, along its entire length, has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence 1, 2, 3, or 4. (Item 181) A set of oligonucleotides according to any one of items 177 to 180, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement. (Item 182) A set of oligonucleotides according to item 181, wherein the reverse nucleic acid primer comprises the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), AGGTGACAATTTGTCCACCGAC (SEQ ID NO: 7), or a nucleic acid sequence that, along its entire length, has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, 6, or 7. (Item 183) A set of oligonucleotides according to any one of items 177 to 182, wherein the forward and reverse nucleic acid amplification primers each contain a nucleic acid sequence according to one of the combinations of forward and reverse primer sequences shown in the table below, or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences along their entire length. Table 25-1 Table 25-2 (Item 184) A set of oligonucleotides according to any one of items 177 to 183, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 1, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 5. (Item 185) A set of oligonucleotides according to item 177 or 178, wherein the forward nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement. (Item 186) A set of oligonucleotides according to item 185, wherein the forward nucleic acid primer comprises the nucleic acid sequence of TAGTGATGACCCGTGTCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length. (Item 187) A set of oligonucleotides according to any one of items 177, 178, 185, or 186, wherein the reverse nucleic acid primer specifically hybridizes with a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement thereof. (Item 188) A set of oligonucleotides according to item 187, wherein the reverse nucleic acid primer comprises the nucleic acid sequence: TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), CAACACGAACGTCATGATAC (SEQ ID NO: 16), CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence that, along its entire length, is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15, 16, or 17. (Item 189) A set of oligonucleotides according to any one of items 185 to 188, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 14, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of SEQ ID NO: 16. (Item 190) A set of oligonucleotides according to any one of items 177 to 189, wherein the reverse nucleic acid primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5' end for reverse transcription of SARS-CoV-2 RNA using the reverse nucleic acid primer. (Item 191) A set of oligonucleotides according to any one of items 177 to 190, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement. (Item 192) A set of oligonucleotides according to item 191, wherein the capture probe comprises the nucleic acid sequence:GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 8, 9, or 10 along its entire length, or a complement thereof. (Item 193) The capture probe is a set of oligonucleotides according to item 191 or 192, comprising the nucleic acid sequence of sequence number 9. (Item 194) A set of oligonucleotides according to any one of items 177, 178, or 185 to 190, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 195) The capture probe comprises a set of oligonucleotides according to item 194, which includes the nucleic acid of sequence:CTGGTTCTAAATCACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or a complement thereof. (Item 196) A set of oligonucleotides according to any one of items 177 to 184 or 190 to 193, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2 or its complement. (Item 197) A set of oligonucleotides according to item 196, wherein the detection probe comprises the nucleic acid sequence CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), GAGGTTCAACCTCAATTAGAGATGG (SEQ ID NO: 12), GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence SEQ ID NO: 11, 12, or 13 along its entire length, or a complement thereof. (Item 198) A set of oligonucleotides as described in items 177 to 184 or 190 to 193, 196 or 197, comprising forward and reverse amplification primers and capture and detection probes, each containing a nucleic acid sequence according to one of the combinations of forward and reverse primer sequences and capture probes (CP) and detection probes (DP) shown in the table below, or nucleic acid sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such sequences along their entire length. Table 26 (Item 199) The detection probe is a set of oligonucleotides according to any one of items 196 to 198, comprising the nucleic acid sequence of sequence number 12. (Item 200) A set of oligonucleotides according to any one of items 177, 178, 185 to 190, 194 or 195, wherein the forward and reverse nucleic acid primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2 or its complement. (Item 201) A set of oligonucleotides according to item 200, wherein the detection probe includes the nucleic acid sequence GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 or 20 along its entire length, or a complement thereof. (Item 202) The detection probe is a set of oligonucleotides described in any of items 177, 178, 185 to 190, 194, 195, 200, or 201, which includes the nucleic acid sequence of sequence number 19. (Item 203) A first forward nucleic acid amplification primer and a first reverse nucleic acid amplification primer, and A second forward nucleic acid amplification primer and a second reverse nucleic acid amplification primer, Each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, and the first forward nucleic acid amplification primer and the first reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second forward nucleic acid amplification primer and the second reverse nucleic acid amplification primer specifically hybridize to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid, and Second forward nucleic acid amplification primer and second reverse nucleic acid amplification primer; A first nucleic acid capture probe and a second nucleic acid capture probe, wherein the first and second nucleic acid capture probes each specifically hybridize to a nucleic acid sequence or complement thereof that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid capture probe specifically hybridizes to a nucleic acid sequence or complement thereof that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid; and / or A first nucleic acid detection probe and a second nucleic acid detection probe, wherein the first and second nucleic acid detection probes each specifically hybridize to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, the first nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the ORF1ab gene of SARS-CoV-2 nucleic acid, and the second nucleic acid detection probe specifically hybridizes to a nucleic acid sequence or its complement that is conserved in the nucleocapsid gene of SARS-CoV-2 nucleic acid. A set of oligonucleotides listed in item 177 or 178, including the set of oligonucleotides listed in item 177 or 178. (Item 204) A set of oligonucleotides as described in item 177 or 178, comprising forward and reverse nucleic acid amplification primers listed in any of items 1 through 74 and, optionally, capture and / or detection probes, or a set of oligonucleotides as described in item 203, comprising a first forward and reverse nucleic acid amplification primer and a second forward and reverse nucleic acid amplification primer listed in any of items 75 through 122 and, optionally, first and second capture probes and / or first and second detection probes. (Item 205) The capture and / or detection probes are a set of oligonucleotides as described in any of items 177 to 204, with a maximum length of 50 nucleotides. (Item 206) The nucleic acid sequence of CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 2, or its complement, The nucleic acid sequence of GTCAACAAACTGTTGGTCAACA (SEQ ID NO: 3), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 3 along its entire length, or its complement, The nucleic acid sequence of CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO: 4), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 4 along its entire length, or its complement, The nucleic acid sequence of CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, or its complement, The nucleic acid sequence of CTGGTGTAAGTTCCATCTCT (SEQ ID NO: 6), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 6 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 7, or its complement, along its entire length. Nucleic acid sequences of GGCAGTGAGGACAATCAGCAACTAC (SEQ ID NO: 8), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 8 along its entire length, or their complements. The nucleic acid sequence of GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 9 along its entire length, or its complement, The nucleic acid sequence ACCCGTCCTTGATTGGCTTG (SEQ ID NO: 10), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 10 along its entire length, or its complement, The nucleic acid sequence of CAAACAATTGTTGAGGTTCAACCTC (SEQ ID NO: 11), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 11 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 12 along its entire length, or its complement, The nucleic acid sequence of GGAAGGTGTAGAGTTTCTTAGAGAC (SEQ ID NO: 13), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 13 along its entire length, or its complement, Nucleic acid sequences of TAGTTGATGACCCGTGTCCT (SEQ ID NO: 14), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or their complements, Nucleic acid sequences of TGGGGTCCATTATCAGACAT (SEQ ID NO: 15), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 15 along its entire length, or their complements, The nucleic acid sequence of CAACACGAACGTCATGATAC (SEQ ID NO: 16), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or its complement, The nucleic acid sequence of CATAGAACGAACAACGCAC (SEQ ID NO: 17), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 17 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 along its entire length, or a complement thereof, The nucleic acid sequence GGAACCTAAATTGGGTAGTCTTG (SEQ ID NO: 20), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 20 along its entire length, or its complement. Oligonucleotides containing this material. (Item 207) The nucleic acid sequence of CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or its complement, The nucleic acid sequence of CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 5, or its complement, The nucleic acid sequence of GAGGACAATCAGACAACTACTATTC (SEQ ID NO: 9), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 9 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 12 along its entire length, or its complement, Nucleic acid sequences of TAGTTGATGACCCGTGTCCT (SEQ ID NO: 14), or nucleic acid sequences that are at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or their complements, The nucleic acid sequence of CAACACGAACGTCATGATAC (SEQ ID NO: 16), or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or its complement, A nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or its complement, The nucleic acid sequence of GAACCTAAATTGGGTAGTCTTGTAG (SEQ ID NO: 19), or a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 19 along its entire length, or its complement. Oligonucleotides, including those listed in item 206. (Item 208) Oligonucleotides as described in item 206 or 207, having a maximum length of 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides. (Item 209) A kit according to any of items 127 to 159, comprising a set of primers according to any of items 160 to 176, a set of oligonucleotides according to any of items 177 to 205, or an oligonucleotide according to any of items 206 to 208. (Item 210) Use of a set of primers described in any of items 160 to 176, a set of oligonucleotides described in any of items 177 to 205, or an oligonucleotide described in any of items 206 to 208, in a method described in any of items 1 to 126.

Claims

1. A method for determining whether a sample contains severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleic acid, comprising the steps of amplifying the nucleic acid of the sample by an isothermal amplification reaction using forward nucleic acid amplification primers and reverse nucleic acid amplification primers, or amplifying nucleic acid produced by reverse transcription of the nucleic acid of the sample, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or its complement, and the nucleic acid sequence conserved in SARS-CoV-2 nucleic acid is a nucleic acid sequence conserved in the ORF1ab gene or nucleocapsid gene of SARS-CoV-2, The forward nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the forward nucleic acid amplification primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), or its complement, or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or its complement, and / or the reverse nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the reverse nucleic acid amplification primer includes the nucleic acid sequence CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), or its complement, or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 5 along its entire length, and / or A method wherein the forward nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement, and the forward nucleic acid amplification primer contains the nucleic acid sequence TAGTTGATGAACCCGTGTCCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or its complement; and the reverse nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement, and the reverse nucleic acid amplification primer contains the nucleic acid sequence CAACACGAACGTCATGATAC (SEQ ID NO: 16), or its complement, or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or its complement.

2. The method according to claim 1, wherein the forward and reverse nucleic acid amplification primers include nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 5, respectively, or along their entire lengths, nucleic acid sequences having at least 95% identity with such sequences.

3. The method according to claim 1, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of TAGTTGATGACCGGTTCCT (SEQ ID NO: 14), or its complement, or a nucleic acid sequence having at least 95% identity with the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or its complement.

4. The process further comprises the steps of reverse transcribing the SARS-CoV-2 RNA of the sample and amplifying the product of the reverse transcription by an isothermal amplification reaction using the forward and reverse nucleic acid amplification primers, wherein the reverse transcription is performed using the reverse nucleic acid amplification primers and / or the nucleic acid of the sample is isolated, and thereafter the SARS-CoV-2 RNA of the sample present in the isolated nucleic acid is... The method according to any one of claims 1 to 3, further comprising the step of reverse transcribing RNA.

5. The method according to any one of claims 1 to 4, further comprising the step of capturing the product of the isothermal amplification reaction by hybridizing the nucleic acid of the product to a nucleic acid capture probe, wherein the capture probe specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement.

6. The method according to any one of claims 1 to 5, further comprising the step of detecting the product of the isothermal amplification reaction by hybridizing the product to a nucleic acid detection probe, wherein the detection probe specifically hybridizes to a SARS-CoV-2 nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids.

7. The method according to any one of claims 1 to 6, comprising amplification using forward and reverse nucleic acid amplification primers, capture of the amplified product using a capture probe, and detection of the amplified product using a detection probe, wherein the amplification primers and the capture and detection probes each include the nucleic acid sequences of SEQ ID NO: 1 (forward primer), SEQ ID NO: 5 (reverse primer), SEQ ID NO: 9 (capture probe), and SEQ ID NO: 12 (detection probe), or nucleic acid sequences having at least 95% identity with such sequences along their entire length.

8. The method according to any one of claims 5 to 7, wherein the capture and / or detection of the product of the isothermal amplification reaction is performed by a chromatographic dipstick assay.

9. The method according to any one of claims 1 to 8, wherein the sample is a biological sample obtained from a subject suspected of being infected with SARS-CoV-2, and / or is an in vitro method.

10. A kit for determining whether a sample contains SARS-CoV-2 nucleic acid, Forward nucleic acid amplification primers and reverse nucleic acid amplification primers for amplifying a template nucleic acid by isothermal amplification reaction, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence or its complement that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids; A nucleic acid capture probe that specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement; and A nucleic acid detection probe that specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement. Including either or both of the following: The forward nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the forward and reverse nucleic acid amplification primers contain, along the respective nucleic acid sequences of SEQ ID NO: 1 (forward) and SEQ ID NO: 5 (reverse), or their entire lengths, nucleic acid sequences that are at least 95% identical to such sequences, or their complements, and / or The kit comprises a forward nucleic acid amplification primer that specifically hybridizes to a nucleic acid sequence conserved in the SARS-CoV-2 nucleocapsid gene or its complement, wherein the forward nucleic acid amplification primer contains the nucleic acid sequence TAGTTGATGAACCCGTGTCCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or its complement; and a reverse nucleic acid amplification primer that specifically hybridizes to a nucleic acid sequence conserved in the SARS-CoV-2 nucleocapsid gene or its complement, wherein the reverse nucleic acid amplification primer contains the nucleic acid sequence CAACACGAACGTCATGATAC (SEQ ID NO: 16), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or its complement.

11. The forward and reverse nucleic acid amplification primers specifically hybridize to the nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the capture probe specifically hybridizes to the nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and / or The kit according to claim 10, wherein the forward and reverse nucleic acid amplification primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement, and the capture probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement.

12. The kit according to claim 10 or 11, wherein the forward and reverse nucleic acid amplification primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement.

13. A kit according to any one of claims 10 to 12, comprising forward and reverse nucleic acid amplification primers, each containing the nucleic acid sequence of SEQ ID NO: 1 (forward), SEQ ID NO: 5 (reverse), SEQ ID NO: 9 (capture probe), and SEQ ID NO: 12 (detection probe), or a nucleic acid sequence having at least 95% identity with such sequences along their entire length, as well as capture and detection probes.

14. The kit according to any one of claims 10 to 13, wherein the forward and reverse nucleic acid amplification primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement, and the detection probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement.

15. RNA-dependent DNA polymerase, DNA-dependent DNA polymerase, DNA / RNA double-strand specific ribonuclease, and DNA-dependent RNA polymerase, and / or A swab stick for obtaining nasopharyngeal or pharyngeal swab samples from a subject, and / or A chromatographic inspection strip for capturing and detecting the product of the isothermal amplification reaction, and / or A kit according to any one of claims 10 to 14, further comprising a lysis / binding buffer and an elution buffer for extracting nucleic acids from a biological sample obtained from the subject.

16. A set of primers for amplifying SARS-CoV-2 nucleic acid by isothermal nucleic acid amplification reaction, comprising a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement, and the nucleic acid sequence conserved in SARS-CoV-2 nucleic acid is a nucleic acid sequence conserved in the ORF1ab gene or nucleocapsid gene of SARS-CoV-2, or to its complement. The forward nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the forward nucleic acid amplification primer includes the nucleic acid sequence CTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or its complement, and / or the reverse nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, and the reverse nucleic acid amplification primer includes the nucleic acid sequence: CAATAGTCTGAACAACTGGTGT (SEQ ID NO: 5), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 5 along its entire length, or its complement, and / or A set of primers wherein the forward nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement, and the forward nucleic acid amplification primer contains the nucleic acid sequence TAGTTGATGAACCCGTGTCCCT (SEQ ID NO: 14), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 14 along its entire length, or its complement; and the reverse nucleic acid amplification primer specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement, and the reverse nucleic acid amplification primer contains the nucleic acid sequence CAACACGAACGTCATGATAC (SEQ ID NO: 16), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 16 along its entire length, or its complement.

17. A set of oligonucleotides for amplifying SARS-CoV-2 nucleic acid by isothermal nucleic acid amplification reaction, and for capturing and / or detecting the product of the amplification reaction, A set of primers according to claim 16; A nucleic acid capture probe that specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement; and A nucleic acid detection probe that specifically hybridizes to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid but not in other human coronavirus nucleic acids, or to its complement. A set of oligonucleotides containing either or both of the above.

18. The forward and reverse nucleic acid amplification primers specifically hybridize to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, the capture probe specifically hybridizes to a nucleic acid sequence conserved in the ORF1ab gene of SARS-CoV-2, or its complement, the capture probe contains the nucleic acid of sequence: GAGGACAATAGACAACTACTATTC (SEQ ID NO: 9), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 9 along its entire length, or its complement, and / or the detection probe contains the nucleic acid sequence of GAGGTTCAACCTCCAATTAGAGATTGG (SEQ ID NO: 12), or a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 12 along its entire length, or its complement, and / or A set of oligonucleotides according to claim 17, wherein the forward and reverse nucleic acid amplification primers specifically hybridize to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement; the capture probe specifically hybridizes to a nucleic acid sequence conserved in the nucleocapsid gene of SARS-CoV-2, or its complement; the capture probe comprises the nucleic acid sequence: CTGGTTCTAAAAATCAACCCATTCA (SEQ ID NO: 18), or a nucleic acid sequence having at least 95% identity with the nucleic acid sequence of SEQ ID NO: 18 along its entire length, or its complement; and / or the detection probe comprises the nucleic acid sequence: GAACCTAAAAATGGGGTAGTCTTTGTAG (SEQ ID NO: 19), or a nucleic acid sequence having at least 95% identity with the nucleic acid sequence of SEQ ID NO: 19 along its entire length, or its complement.

19. A kit according to any one of claims 10 to 15, comprising the set of primers according to claim 16, or the set of oligonucleotides according to claim 17 or 18.

20. The method according to any one of claims 1 to 9, using the set of primers according to claim 16, or the set of oligonucleotides according to claim 17 or 18.

Images