Lipid nanoparticles for nucleic acid delivery and related methods of use

By designing cationic lipids with specific hydrocarbon chain structures, oxidative degradation of LNPs is mitigated, enhancing stability and transfection efficacy.

JP7848206B2Active Publication Date: 2026-04-20AKAGERA MEDICINES INC
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
AKAGERA MEDICINES INC
Filing Date
2021-11-24
Publication Date
2026-04-20

AI Technical Summary

Technical Problem

Existing ionized cationic lipids (ICLs) used in lipid nanoparticles (LNPs) for nucleic acid delivery are susceptible to oxidative degradation during storage, compromising their stability and transfection efficacy.

Method used

Engineering cationic lipids with specific hydrocarbon chain structures, such as two carbon-carbon double bonds separated by at least two methylene groups, to enhance stability and maintain high transfection activity.

Benefits of technology

The modified cationic lipids demonstrate a significant reduction in oxidation byproducts, up to 95% compared to standard ICLs, maintaining high transfection efficiency and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007848206000305
    Figure 0007848206000305
  • Figure 0007848206000306
    Figure 0007848206000306
  • Figure 0007848206000307
    Figure 0007848206000307
Patent Text Reader

Abstract

The present disclosure provides an improved composition of ionized lipid nanoparticles for delivering therapeutic nucleic acids to cells. The cationic ionized lipids are engineered to improve stability against oxidative degradation during storage while retaining high intracellular transfection activity or efficacy. These lipids are designed to be biodegradable, thereby improving the tolerability of the nanoparticles formed by them in vivo. In addition, the inclusion of antibody conjugates against cell surface receptors provides highly specific targeting of these nanoparticles to dendritic cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This patent application claims the interests and priority thereto of U.S. Provisional Patent Application No. 63 / 118,534, filed on 25 November 2020, which in whole constitutes part of this specification by reference.

[0002] Sequence listing reference This specification includes the sequence listing submitted with this specification, which includes a file named 191016-010403_ST25.txt, with a size of 7,061 bytes, created on November 24, 2021, the contents of which are incorporated herein by reference.

[0003] field This disclosure relates to cationic ionized lipids and lipid nanoparticles (LNPs). In some embodiments, LNPs comprising one or more cationic ionized lipids are useful for targeting dendritic cells or for delivering nucleic acid compounds for methods using these LNP compositions as vaccines. In some embodiments, the LNPs may comprise bioreducible ionized cationic lipids or unconjugated polyolefinic ionized cationic lipids. [Background technology]

[0004] Lipid nanoparticles (LNPs) are used to deliver therapeutic nucleic acids to cells. For example, LNP pharmaceutical compositions are used in vaccines to deliver mRNA therapeutics. LNP formulations typically contain ionized cationic lipids (ICLs). However, certain ICL compounds are known in the art to be undesirably susceptible to oxidation during storage. Therefore, there is a need for improved ICL compounds that have improved stability against oxidative degradation during storage and, at the same time, provide desirable transfection activity or efficacy in cells when incorporated into LNPs with therapeutic agents such as nucleic acids.

[0005] SNALP compositions are useful for delivering nucleic acid therapeutics for various infectious diseases. Infectious diseases such as tuberculosis, HIV / AIDS, malaria, and COVID-19 pose serious health problems for humans. For example, mycobacteria are the bacterial genus involved in tuberculosis (TB). According to the World Health Organization, TB is one of the top ten causes of death globally and the leading cause of death from a single pathogen. Despite current best efforts, developing effective vaccines for preventing many infectious diseases has presented significant challenges. Novel approaches in identifying individual antigen peptides or combinations of antigen peptides have helped improve vaccine efficiency. Nevertheless, there remains great potential in engineering adjuvants to help efficiently deliver and impart these antigen sequences to specialized antigen-presenting cells such as dendritic cells. mRNA coding of antigen peptides or proteins combined with ionized cationic lipid nanoparticles represents a particularly promising strategy in vaccine development. Safe and effective treatments, including SNALP pharmaceutical compositions (including vaccine compositions), are needed for delivering mRNA for the treatment and prevention of various diseases. [Overview of the project]

[0006] In some embodiments, ionized cationic lipids (ICLs) are provided. Cationic lipids are engineered to improve stability against oxidative degradation during storage while retaining high transfection activity or potency in cells. Aspects of this disclosure are based in part on the discovery that undesirable oxidation and / or degradation of ionized lipids having polyene chains can be mitigated by including two or more methylene groups between a pair of alkynyl double bonds. The lipids disclosed herein comprise at least two carbon-carbon double bonds (olefins) spaced by at least two methylene groups or substituted methylene groups, where the substituted methylene is C(R1)(R2)-, and where R1 and R2 are independently H, alkyl, or halogen. The lipids disclosed herein comprise two symmetric polyene hydrocarbon chains, each having two carbon-carbon double bonds (olefins) on either side of two, three, or four methylene groups. The olefin in the lipid tail separated by at least two methylene groups makes the compounds described herein far less susceptible to oxidation compared to compounds separated by one methylene group, such as DLin-MC3-DMA, and is considered the ultimate standard in ionized cationic lipid design, as stability issues have been reported. In some embodiments, the compounds provided herein show a reduction of over 30%, over 50%, over 75%, over 90%, and over 95% in oxidation byproducts compared to a control LNP. In some embodiments, the compounds provided herein show a reduction of over 30%, over 50%, over 75%, over 90%, and over 95% in oxidation byproducts compared to a control LNP containing DLin-KC2-DMA lipid.

[0007] In some embodiments, ionized cationic lipid compositions are provided. In some embodiments, the ionized cationic lipid may comprise two polyene hydrocarbon chains, each comprising one or two alkenyl double bond moieties. In some embodiments, the ionized cationic lipid may comprise two polyene hydrocarbon chains, each comprising two or more methylene groups between the two alkenyl double bond moieties. In some embodiments, the ionized cationic lipid comprises two C 16 or C 18 It may contain polyene hydrocarbon chains.

[0008] In some embodiments, each of a pair of linear polyenes C, each containing unsaturated linear ethylene, n-propylene, or n-butylene between two adjacent unsaturated alkynyl double bonds in each polyene hydrocarbon chain. 16 or C 18 The present invention provides a liposome composition comprising an ionized cationic lipid having a hydrocarbon chain. In some embodiments, the liposome composition may contain an ionized lipid having a chemical structure consisting of a pair of linear polyunsaturated lipid tails of 16 or 18 carbon atoms covalently bonded to a head group containing a dialkylamino group having a pKa of 6-7, wherein the head group comprises a heterocyclyl or alkyl moiety covalently bonded to the dialkylamino group and optionally further comprises a phosphate group, and each polyunsaturated lipid tail is unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and each lipid tail optionally contains a single acyl group at a terminal covalently bonded to the head group. In some embodiments, each lipid tail is identical and each lipid tail has a total of two olefins separated only by unsubstituted ethylene, n-propyl, or n-butyl. In some embodiments, each lipid tail further comprises an acyl group that combines with the oxygen of the head group to form an ester.

[0009] In some embodiments, the dialkylamino moiety of the head group of the ionizable cationic lipid has a dialkylamino chemical structure of formula (IV-A).

[0010]

Chemical formula

[0011] In some embodiments, the ionizable cationic lipid

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0012] In some embodiments, the ionized cationic lipid further comprises a pair of lipid tails linked to a head group, where each lipid tail comprises a hydrocarbon chain having the chemical structure of formula A or formula B.

[0013] [ka] [Here, in equation A, a is 1, 2, 3 or 4, b is 2, 3 or 4, and c is 3, 4, 5, 6 or 7.]

[0014] [ka] [Here, in equation B, a is 5, 6, or 7, and in equation B, c is 3, 4, or 5.] In some embodiments, b is 4, and the sum of a, b, and c in formula A is 10, 11, 12, or 13. In some embodiments, the ionized cationic lipid is R in the chemical structure shown above. 22 It contains a lipid tail of formula A or formula B. In some embodiments, the ionized cationic lipid contains a lipid tail of formula A, where formula A contains [ka] This is R in the chemical structure shown above. 22 This indicates the position of the linkage. In some embodiments, the ionized cationic lipid includes a lipid tail of formula B, where in formula B [ka] This is R in the chemical structure shown above. 22 This indicates the connection point.

[0015] In some embodiments, the ionized cationic lipid has the chemical structure of formula (IA).

[0016] [ka] [In the formula, a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, c is 3, 4, 5, 6, or 7, the sum of a, b, and c is 10 or 12, q is 1, 2, 3, or 4, R 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with one or more hydroxyls. L is [ka] Here, v is 0 or 1, q is 1, 2 or 3, and q2 is 1 or 2. In some embodiments, in formula IA, when v is 0, q is 1, 2, or 3, and when v is 1, q is 1, 2, 3, or 4.

[0017] In some embodiments, v in formula IA is 0. In some embodiments, v in formula IA is 0 and q is 1, 2, or 3. In some embodiments, v in formula IA is 0 and q is 1 or 2. In some embodiments, the ionized lipid is a cationic lipid selected from the group consisting of compounds 17-19 and 23-25.

[0018] [ka]

[0019] In some embodiments, the ionized lipid is a cationic lipid selected from the group consisting of AKG-UO-1, AKG-UO-2, AKG-UO-4, and AKG-UO-5. In some embodiments, the ionized lipid is AKG-UO-1.

[0020] [ka] In some embodiments, the ionized lipid is AKG-UO-1A.

[0021] [ka] In some embodiments, the ionized lipid is AKG-UO-1B.

[0022] [ka] In some embodiments, the ionized lipid is AKG-UO-2.

[0023] [ka] In some embodiments, the ionized lipid is AKG-UO-4.

[0024] [ka] In some embodiments, the ionized lipid is AKG-UO-4A.

[0025] [ka] In some embodiments, the ionized lipid is AKG-UO-5.

[0026] [ka] In some embodiments, the ionized lipid is AKG-UO-6, AKG-UO-7, AKG-UO-7, AKG-UO-8, AKG-UO-9, or AKG-UO-10.

[0027] [ka] In some embodiments, the ionized lipid includes a head group containing a methylated phosphate moiety. In some embodiments, the ionized lipid has the chemical structure of formula IA [wherein v is 1]. In some embodiments, the ionized lipid has the chemical structure of formula IA [wherein v is 1 and q is 3 or 4]. In some embodiments, the ionized lipid is [ka] It is selected from the group consisting of the following. In some embodiments, the ionized lipid is AKG-UO-3.

[0028] [ka]

[0029] In some embodiments, the ionized lipid has the chemical structure of formula II-A.

[0030] [ka] [In the formula, a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, and c is 4, 5, 6, 7, or 8.] R2 is [ka] And, q is either 1 or 2, R 10 and R 12 Each of these is independently a (C1-C4) alkyl group that is optionally substituted with one or more hydroxyls.

[0031] In some embodiments, the ionized lipid is selected from the group consisting of compounds 1-3 and compounds 5-8.

[0032] [ka]

[0033] In some embodiments, the ionized lipid is selected from the group consisting of compounds 1 to 8.

[0034] [ka]

[0035] In some embodiments, the ionized lipid has the chemical structure of formula II-A.

[0036] [ka] [In the formula, a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, and c is 4, 5, 6, 7, or 8.] R2 is [ka] And, q' is either 1 or 2. R 10 and R 12 Each of these is independently a (C1-C4) alkyl group that is optionally substituted with one or more hydroxyls.

[0037] In some embodiments, the ionized lipid is a compound selected from the group consisting of compounds 9 to 19.

[0038] [ka]

[0039] In some embodiments, the ionized lipid has the chemical structure of formula II-A.

[0040] [ka] [In the formula, a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, and c is 4, 5, 6, 7, or 8.] R2 is [ka] And, L is [ka] Here, v is 0 or 1, q is 1, 2, 3 or 4, q2 is 1 or 2, R 10 and R 12 Each of these is independently a (C1-C4) alkyl group that is optionally substituted with one or more hydroxyls. In some embodiments, in formula II-A, when v is 0, q is 1, 2, or 3, or when v is 1, q is 3 or 4.

[0041] In some embodiments, the lipids are designed to be biodegradable, thus improving the tolerability of the nanoparticles formed therein in vivo.

[0042] In some embodiments, the ionized lipid has the chemical structure of formula II-B.

[0043] [ka] [In the formula, a is 5, 6, or 7, and c is 3, 4, or 5, R2 is [ka] And, q and q' are independently either 1 or 2. R 10 and R 12 These are (C1-C4) alkyl groups that are optionally substituted with hydroxyl groups.

[0044] In some embodiments, the ionized cationic lipid is a compound selected from the group consisting of compounds 29 to 34.

[0045] [ka]

[0046] In some embodiments, the ionized lipid is a bioreducible cationic lipid. In some embodiments, the ionized lipid is a bioreducible cationic lipid containing a sterol chemical structure. In some embodiments, the ionized lipid is of formula (VI-A): [ka] [In the formula, q is 3 or 4, and R3 is [ka] It has the chemical structure of [a] or a pharmaceutically acceptable salt thereof. In some embodiments, the ionized cationic lipid is selected from the group consisting of compounds 35 to 38.

[0047] [ka]

[0048] In some embodiments, the lipid nanoparticle composition comprises lipids and nucleic acids, and the lipid nanoparticles comprise ionized lipids of formula I, II, III, IV or combinations thereof, or pharmaceutically acceptable salts thereof. In some embodiments, the lipid nanoparticle composition comprises lipids and nucleic acids, and the lipid nanoparticles comprise ionized lipids of formula IA, II-A, II-B, IV-A, or VI-A, or combinations thereof, or pharmaceutically acceptable salts thereof. In some embodiments, the lipid nanoparticle composition comprises lipids and nucleic acids, and the lipid nanoparticles comprise ionized lipids comprising polyene hydrocarbon chains of formula A, formula A', formula A'', or formula B or combinations thereof, or pharmaceutically acceptable salts thereof.

[0049] In some embodiments, the Disclosure also provides compositions of lipid nanoparticles (LNPs) for delivering therapeutic nucleic acids to cells. Aspects of the Disclosure are in part based on the discovery that LNP compositions combining various ionized cationic lipids with specific small amounts of phosphatidyl-L-serine, less than 20 mol% of the total lipids in the composition (e.g., 2.5 to 10 mol%), have surprisingly demonstrated highly enhanced targeting of encapsulated nucleic acids.

[0050] In some embodiments, the LNP composition comprises (a) nucleic acids, (b) ionized cationic lipids, (c) sterols (e.g., cholesterol or cholesterol derivatives, or plant sterols such as beta-sitosterol), (d) phospholipids containing phosphatidylserine (e.g., a mixture of phosphatidylserine and DSPC), and (e) complex lipids (e.g., PEG-DMG). In one embodiment, the LNP composition comprises (a) nucleic acids, (b) ionized cationic lipids, (c) sterols (e.g., cholesterol or cholesterol derivatives, or plant sterols such as beta-sitosterol), (d) phospholipids containing phosphatidylserine lipids and additional phospholipids (e.g., DSPC) in a total amount of 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) of the total lipids in the composition, and (e) complex lipids (e.g., PEG-DMG). In one embodiment, the LNP composition comprises (a) nucleic acids, (b) ionized cationic lipids, (c) sterols (e.g., cholesterol or cholesterol derivatives, or plant sterols such as beta-sitosterol), (d) phospholipids comprising phosphatidylserose lipids and additional phospholipids (e.g., DSPC) in a total amount of 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) of the total lipids in the composition, and (e) complex lipids (e.g., PEG-DMG) in a total amount of 0.5 to 4.5 mol% (e.g., 0.5 to 2.5 mol%, 1.5 mol%) of the total lipids in the composition. In one embodiment, the LNP composition comprises (a) nucleic acids, (b) ionized cationic lipids in a total amount of 40 to 65 mol% (e.g., 50 mol%) of the total lipids in the composition, (c) sterols (e.g., cholesterol or cholesterol derivatives, or plant sterols such as beta-sitosterol) in a total amount of 25 to 40 mol% (e.g., 38.5 mol%) of the total lipids in the composition, (d) phospholipids including phosphatidylserose lipids and additional phospholipids (e.g., DSPC) in a total amount of 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) of the total lipids in the composition, and (e) complex lipids (e.g., PEG-DMG) in a total amount of 0.5 to 4.5 mol% (e.g., 0.5 to 2.5 mol%, 1.5 mol%) of the total lipids in the composition.In one embodiment, the LNP composition comprises (a) nucleic acids, (b) ionized cationic lipids in a total amount of 40 to 65 mol% (e.g., 50 mol%) of the total lipids in the composition, (c) sterols (e.g., cholesterol or cholesterol derivatives, or plant sterols such as beta-sitosterol) in a total amount of 25 to 40 mol% (e.g., 38.5 mol%) of the total lipids in the composition, (d) phospholipids in a total amount of 5 to 25 mol% of the total lipids in the composition, comprising phosphatidylseroselipids in a total amount of 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) of the total lipids in the composition, and additional phospholipids (e.g., DSPC) (e.g., 10 mol%) of the total lipids in the composition, and (e) complex lipids (e.g., PEG-DMG) in a total amount of 0.5 to 4.5 mol% (e.g., 0.5 to 2.5 mol%, 1.5 mol%) of the total lipids in the composition.

[0051] In one embodiment, the LNP composition comprises (a) nucleic acid, and (b) a pair of linear polyenes C, each containing unsaturated linear ethylene, n-propylene, or n-butylene between two adjacent unsaturated alkynyl double bonds in each polyene hydrocarbon chain. 16 or C 18(c) an ionized cationic lipid having a hydrocarbon chain, present in the composition in a total amount of 40 to 65 mol% of the total lipids in the composition; (d) a total amount of sterols (e.g., cholesterol) in a total amount of 25 to 40 mol% of the total lipids in the composition; (e) a total amount of phospholipids in a total amount of 5 to 25 mol% of the total lipids in the composition, comprising phosphatidylseroselipids (e.g., phosphatidyl-L-seroselipids) in a total amount of 1 to 10 mol% of the total lipids in the composition and additional phospholipids (e.g., DSPC in a total amount of 10 mol% of the total lipids in the composition); and (e) a total amount of complex lipids (e.g., PEG-DMG) in a total amount of 0.5 to 2.5 mol% of the total lipids in the composition. In one embodiment, the LNP composition comprises (a) mRNA nucleic acid, (b) ionized cationic lipids of formula (IA), formula (II-A), or formula (II-B) with v = 0 in a total amount of 40 to 65 mol% of the total lipids in the composition, (c) cholesterol in a total amount of 25 to 40 mol% of the total lipids in the composition, (d) L-serine phosphatidylserine lipids (e.g., DPPS or DSPS) in a total amount of 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) of the total lipids in the composition, and DSPC in a total amount of 5 to 25 mol% of the total lipids in the composition, and (e) complex lipids (e.g., PEG-DMG) in a total amount of 0.5 to 2.5 mol% of the total lipids in the composition. In one embodiment, the LNP composition comprises (a) mRNA nucleic acid, (b) ionized cationic lipids of formula (IA) when v is 0, in an amount of 40 to 65 mol% of the total lipids in the composition, (c) cholesterol in an amount of 25 to 40 mol% of the total lipids in the composition, (d) L-serine phosphatidylserine lipids (e.g., DPPS or DSPS) in an amount of 3 to 9 mol% of the total lipids in the composition, and DSPC in an amount of 5 to 25 mol% of the total lipids in the composition, and (e) complex lipids (e.g., PEG-DMG) in an amount of 0.5 to 2.5 mol% of the total lipids in the composition.

[0052] In some embodiments, the composition comprises (a) a polyunsaturated ionized cationic lipid and (b) a charged phospholipid phosphatidylserine lipid.

[0053] In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV-A, and (b) an anionic phospholipid targeting moiety selected from the group consisting of DSPS (L isomer), DPPS (L isomer), DMPS (L isomer), DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-DSPE, and N-Suc-DSPE. In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV-A, and (b) an anionic phospholipid targeting moiety of formula VA. In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV-A, and (b) an anionic phospholipid targeting moiety selected from the group consisting of DSPS (L isomer) and DPPS (L isomer).

[0054] In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV and (b) an anionic phospholipid-targeting moiety of formula VA. In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV and (b) an anionic phospholipid-targeting moiety selected from the group consisting of DSPS (L isomer), DPPS (L isomer), DMPS (L isomer), DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-DSPE, and D-Suc-DSPE. In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV and (b) an anionic phospholipid-targeting moiety of formula VA. In some embodiments, the composition comprises (a) an ionized cationic lipid of formula IV-A and (b) an anionic phospholipid-targeting moiety selected from the group consisting of DSPS (L isomer) and DPPS (L isomer).

[0055] In one embodiment, the LNP composition comprises (a) mRNA nucleic acid, (b) ionized cationic lipids selected from the group consisting of AKG-KC2-OA, AKG-KC3-OA, Dlin-KC2-DMA, and Dlin-KC3-DMA in a total amount of 40 to 65 mol% of the total lipids in the composition, (c) cholesterol (or its derivatives) in a total amount of 25 to 40 mol% of the total lipids in the composition, (d) a mixture of two or more phospholipids in a total amount of 5 to 25 mol% of the total lipids in the composition, wherein the phospholipids include L-serine phosphatidylserine lipids (e.g., DPPS or DSPS) in a total amount of 3 to 9 mol% (e.g., 5.0 to 7.5 mol%) of the total lipids in the composition, and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5 to 2.5 mol% of the total lipids in the composition.

[0056] [ka]

[0057] In one embodiment, the nucleic acid lipid nanoparticle (LNP) composition comprises nucleic acid, ionized cationic lipid AKG-UO-1, and (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is mRNA, the PS lipid is (L-serine)DSPS, (L-serine)DPPS, or a mixture thereof, and the LNP composition further comprises cholesterol and a second phospholipid selected from the group consisting of DSPC, DPPC, and DOPC. The LNP composition further comprises 0.5 to 1.5 mol% of PEG-DMG or PEG-DSG based on the total lipid content in the LNP composition.

[0058] In one embodiment, the nucleic acid lipid nanoparticle (LNP) composition comprises nucleic acids, ionized cationic lipids selected from KC2OA, KC2, KC2-01, ALC-0315, and SM102, and (L-serine)PS lipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition has an N / P ratio of 3 to 8 (e.g., a ratio of 5 to 7 or 5).

[0059] In one embodiment, the nucleic acid lipid nanoparticle (LNP) composition comprises nucleic acid, an ionized cationic lipid selected from AKG-UO-6 and AKG-UO-7, and a total amount of (L-serine)PS lipid of 2.5 to 10 mol% of the total lipid content of the LNP composition. In some embodiments, the N / P ratio is 3 to 8 (e.g., 5 to 7 or a ratio of 5 or 7).

[0060] In one embodiment, the nucleic acid lipid nanoparticle (LNP) vaccine composition comprises mRNA nucleic acid having an N / P ratio of 3 to 8, ALC-0315 ionized cationic lipid in a total amount of 46 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0061] In one embodiment, the nucleic acid lipid nanoparticle (LNP) vaccine composition comprises mRNA nucleic acid having an N / P ratio of 3 to 8, Dlin-KC2-DMA ionized cationic lipid in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0062] In one embodiment, the lipid nanoparticle (LNP) vaccine composition comprises mRNA nucleic acid having an N / P ratio of 3 to 8, a total amount of KC3-OA ionized cationic lipid of 40 to 65 mol% of the total lipid content of the LNP composition, a total amount of cholesterol of 25 to 40 mol% of the total lipid content of the LNP composition, a total amount of (L-serine)PS lipid of 2.5 to 10 mol% of the total lipid content of the LNP composition, a total amount of DSPC phospholipid of 5 to 25 mol% of the total lipid content of the LNP composition, and a total amount of PEG-DMG of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0063] In one embodiment, the nucleic acid lipid nanoparticle (LNP) vaccine composition comprises mRNA nucleic acid having an N / P ratio of 3 to 8, ionized cationic lipids in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0064] One aspect of this disclosure relates to the use of (L-serine)PS lipids in LNPs in a total amount of 2.5 to 10 mol% of the total lipid content of an LNP composition for targeting LNPs to dendritic cells. In some embodiments, the LNPs include mRNA. In some embodiments, the LNPs further include cholesterol. In some embodiments, the LNPs further include ICL. In some embodiments, the LNPs further include one or more additional phospholipids, including DSPC. In some embodiments, the LNPs further include complex lipids. In some embodiments, the LNPs include mRNA nucleic acids having an N / P ratio of 3 to 8, ionized cationic lipids (ICLs) in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and complex lipids in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition. [Brief explanation of the drawing]

[0065] [Figure 1] This diagram illustrates the oxidative degradation mechanism of linoleic acid lipid esters containing multiple conjugated unsaturated compounds that are particularly sensitive to oxidation. [Figure 2] This shows the reaction between the reduced C-terminal cysteine ​​of the Fab' antibody fragment and maleimide-terminated poly(ethylene glycol) 2000-derivative distearoylphosphatidylethanolamine. R1 and R2 are stearic acid. The final antibody lipopolymer complex is an intermediate that is subsequently inserted into the lipid outer layer of lipid nanoparticles for active targeting. [Figure 3A]The effect of 0-2.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNP formulated with DLin-KC2-DMA as an ionized cationic lipid. ICL was maintained at 50 mol%, cholesterol at 38.5 mol%, and PEG-DMG at 1.5 mol%, while DSPS content varied. DSPS was added by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours using each formulation at a concentration of 1 ug mRNA / mL. UT samples correspond to cells without LNP addition. Lipofect refers to samples treated with lipofectamine. [Figure 3B] The effect of 0-7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNP formulated with DLin-KC2-DMA as an ionized cationic lipid. ICL was maintained at 50 mol%, cholesterol at 38.5 mol%, and PEG-DMG at 1.5 mol%, while DSPS content varied. DSPS was added by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours using each formulation with a concentration of 1 ug mRNA / mL. UT samples correspond to cells without LNP addition. Lipofect refers to samples treated with lipofectamine. [Figure 3C] The effect of 0-7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNP formulated with DLin-KC2-DMA as an ionized cationic lipid. ICL was maintained at 50 mol%, cholesterol at 38.5 mol%, and PEG-DMG at 1.5 mol%, while DSPS content varied. DSPS was added by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours using each formulation at a concentration of 0.3 ug mRNA / mL. UT samples correspond to cells without LNP addition. [Figure 3D]The effect of 0-7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNP formulated with DLin-KC2-DMA as an ionized cationic lipid. ICL was maintained at 50 mol%, cholesterol at 38.5 mol%, and PEG-DMG at 1.5 mol%, while DSPS content varied. DSPS was added by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours using each formulation at a concentration of 0.1 ug mRNA / mL. UT samples correspond to cells without LNP addition. [Figure 4] Transfection of mouse dendritic cells (MutuDC1940) with various ICLs (KC2, KC2-OA, KC3-OA, and SM-102) and LNPs containing 5 mol% DSPS, as well as comparison with LNPs using Glu-DSPE or Suc-DSPE instead of DSPS. UT samples correspond to cells without LNP addition. [Figure 5] DSPS or DPPS increases mCherry LNP transfection with ICLs containing KC2, KC2-01, KC2-PA, KC3-01, and KC3-OA. UT samples correspond to cells without LNP addition. [Figure 6A] Comparison of various chemical forms of phosphatidylserine and AKG-UO-1-containing LNPs for transfection of mouse dendritic cells. UT samples represent cells without LNP addition. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used at the same dosage level as LNPs, according to the manufacturer's instructions. [Figure 6B] Comparison of DSPS and other negatively charged phospholipids in transfection of mouse dendritic cells with AKG-UO1-containing LNP. UT samples represent cells without LNP. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used at the same dosage level as LNP, according to the manufacturer's instructions. [Figure 7] Effect of DSPS concentration in AUG-UO-1-containing LNP on dendritic cell transfection. UT samples represent cells without LNP treatment. [Figure 8] Effect of PEG-DMG concentration in AUG-UO-1-containing LNPs with and without 5 mol% DSPS on dendritic cell transfection. The Y-axis shows the %PEG used in the composition to which mRNA at concentrations (0.11, 0.33, or 1 μg / mL) is subsequently added to the cells. UT samples correspond to cells without LNP addition. [Figure 9A] Oxidative degradation of lipid suspensions of ICLs (KC2, KC3, and O-11769) having a single methylene group between two olefins and ICLs (KC2-01, KC3-01, and UO-1) having four methylene groups between two olefins. [Figure 9B] Oxidative degradation of liposomes containing O-11769 (ICL having a single methylene group between two olefins) and liposomes containing UO-1 (ICL having four methylene groups between two olefins). [Figure 10A] Effect of N / P on mCherry expression by 1 μg / mL KC2-01-containing LNP in mouse dendritic cells. UT samples correspond to cells without LNP treatment. [Figure 10B] Effect of N / P on mCherry expression by LNP containing 0.33 μg / mL of KC2-01 in mouse dendritic cells. UT samples correspond to cells without LNP treatment. [Figure 11] Transfection efficiency of LNPs containing ionized cationic lipids with and without DSPS (7.5 mol%). UT samples correspond to cells without added LNPs. [Figure 12] Transfection efficiency of LNP formulations containing mCherry mRNA at various concentrations of DOPS (0, 10, and 25 mol%) as a percentage of total lipids) in mouse dendritic cells. [Figure 13A-1]VRN-029 mRNA sequence, and the SARS-CoV-2 spike protein that generates the sequence. [Figure 13A-2] VRN-029 mRNA sequence, and the SARS-CoV-2 spike protein that generates the sequence. [Figure 13B] Effect of PEG-DMG(C14) concentration (mol%) on LNP vaccine immunogenicity. Total anti-spike antibody titer and CD4 response in mice immunized with mRNA-LNP using ionized lipid UO1 with increased 7.5% DSPS and PEG-DPPE mol%. The center graph shows the endpoint antibody titer at day 34. The right graph shows the corresponding CD4 T cell response. [Figure 13C] Effect of PEG-DPPE(C16) concentration (mol%) on LNP vaccine immunogenicity. Total anti-spike antibody titer of mice immunized with mRNA-LNP using ionized lipid UO1 with increased mol% of 7.5% DSPS and PEG-DMG. The center graph shows the endpoint antibody titer at day 34. The mol% of PEG-DPPE had an opposite effect on antibody levels. The graph on the right shows the corresponding CD4 T cell response. [Figure 13D] Total anti-spike antibody titer and CD4 response of mice immunized with mRNA-LNP using ionized lipid KC2OA containing 7.5% DSPS and either PEG-DMG(14C) or PEG-DSG(18C). The graph on the left shows the endpoint antibody titer at day 34. The graph on the right shows the corresponding CD4 T cell response. [Figure 13E] Total anti-spike antibody titer and CD4 response of mice immunized with mRNA-LNP using ionized lipid UO1 containing 7.5% DSPS and either 1.5 mol% PEG-DMG(14C) or PEG-DSG(18C). The graph on the left shows the endpoint antibody titer at day 34. The graph on the right shows the corresponding CD4 T cell response. [Figure 13F]Effect of phosphatidylserine uptake on mRNA-LNP immunogenicity. Total anti-spike antibody titer (A) and spike-specific CD4 T cell response in mice immunized with mRNA-LNP using various ionized lipids and PEG-lipid plus / minus 7.5 mol% DSPS. Antibody data were log-transformed and analyzed using bidirectional ANOVA by Sidac multiple comparison studies. CD4 T cell data were analyzed using the REML mixed-effects model by Sidac multiple comparison studies. [Figure 13G] Effect of phosphatidylserine lipid tail (DPPS vs. DSPS) composition on mRNA-LNP priming of B (Panel A) and T cell (Panel B) responses. Antibody data were logarithmically transformed before analysis. Data were analyzed using one-way ANOVA by turkey multiple comparison studies. [Figure 14A] Comparison of mCherry expression over 24 hours at 1 μg / mL mRNA for KC2-01 LNP, 7.5 mol% DSPS (D isomer) and DSPS (L isomer). [Figure 14B] Comparison of mCherry expression over 24 hours at 0.33 μg / mL mRNA for KC2-01 LNP, 7.5 mol% DSPS (D isomer) and DSPS (L isomer). [Figure 15] Comparison of mCherry expression between KC2 LNPs containing 5 and 7.5 mol% DSPS (L isomer) and LNPs prepared using SM-102 or ALC-0315 (1 μg / mL mRNA, 24 hours). The Y axis represents the mean fluorescence intensity (MFI). The UT sample corresponds to cells without LNP addition. [Figure 16] Comparison of mCherry expression in cells treated with UO1, UO6, and UO7 formulations alone, or with the addition of 7.5 mol% of the D isomer of DSPS (1 μg / mL mRNA, 24 hours). UT samples correspond to cells without LNP addition. [Figure 17]Comparison of mCherry expression in cells treated with UO1, SM102, ALC-0315 formulations alone, or with DSPS added (1 μg / mL mRNA, 24 hours). "Lipo" refers to Lipofectamine MessengerMax (ThermoFisher) used as the LNP at the same dosage level according to the manufacturer's instructions. UT samples represent cells without LNP addition. [Modes for carrying out the invention]

[0066] Both the above summary and the following detailed description are illustrative and explanatory for illustrative purposes only, and should be understood as not limiting the compositions and methods of this disclosure.

[0067] Stabilized nucleic acid lipid particles (SNALPs) are used as vehicles for systemic delivery of mRNA or other nucleic acid therapeutics. SNALP compositions contain cationic lipids such as MC3 or KC2, which include a protonable tertiary amine head group bonded to a pair of linear 18-carbon aliphatic chains (e.g., linoleic acid) containing a pair of carbon-carbon double bonds separated by a single methylene group. However, while the structure of these hydrocarbon chains, each containing a pair of double bonds separated by a single methylene group, confers the desired biological properties of SNALP compositions, this chemical substructure also presents the undesirable problem of increased susceptibility of the compounds to oxidative degradation. For example, Figure 1 illustrates the oxidative degradation mechanism of a lipid ester of linoleic acid containing multiple conjugated unsaturated compounds that are particularly susceptible to oxidation. Novel cationic lipids are needed that are suitable for use in SNALP compositions but with enhanced resistance to oxidative degradation.

[0068] This specification discloses compounds, compositions, and methods related to the treatment of bacterial infections. As used herein, the terms “compound,” “drug,” and “activator” are used without distinction. Some aspects of this disclosure relate to novel ionized lipids or bioreducible ionized lipids. These lipids are cationic (i.e., positively charged) at acidic pH and are encountered intracellularly, for example, after endocytosis or phagocytosis by cells. The same lipids and compositions containing them have a nearly neutral charge when present at pH 7.4. These lipids may also have multiple olefins separated by at least two methylene groups present in their alkyl or acyl groups.

[0069] Some aspects of this disclosure relate to processes for the synthesis of novel ionized lipids.

[0070] Another embodiment relates to a composition comprising lipid nanoparticles containing ionized cationic lipids, wherein the lipid nanoparticles contain nucleic acids. In some embodiments, the nucleic acids are encapsulated within the lipid nanoparticles.

[0071] Other aspects of this disclosure relate to the use of these ionized lipids or lipid nanoparticle compositions containing ionized lipids in vaccines for the prevention of infectious diseases or cancer. In some embodiments, the infectious disease may be a bacterial or viral infection. In some embodiments, the compositions described herein may be used to prevent infections associated with tuberculosis, HIV / AIDS, malaria, or coronavirus-related infections such as COVID-19. In other embodiments, the infections may be influenza, hepatitis B, hepatitis C, dengue fever, human papillomavirus (HPV), norovirus, mumps, measles, meningococcal disease, pneumococcal disease, polio, rotavirus, syncytial virus of the respiratory system (RSV), rubella, herpes zoster / zoster virus, tetanus, or pertussis.

[0072] In some embodiments, the compounds and compositions described herein can facilitate the efficient uptake and transfection of target cells, including tissue macrophages and dendritic cells. As a result, efficient delivery of nucleic acids encoding antigens specific to infectious viruses or bacteria occurs, followed by presentation of said antigens that elicit a desired immune response to protect against the corresponding infection. In some embodiments, the nucleic acid may be a synthetic nucleic acid (e.g., manipulated codon-optimized mRNA) encoding an epitope of a coronavirus such as SARS-CoV, MERS-CoV, or SARS-CoV-2. In some embodiments, the nucleic acid may be a synthetic nucleic acid (e.g., manipulated codon-optimized mRNA) encoding the S-protein (spike protein) or a fragment thereof of a coronavirus such as SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0073] definition For convenience, the specific terms used in this specification, the examples, and the appended claims are summarized here. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure pertains.

[0074] As used herein, the following terms and phrases are intended to have the following meanings:

[0075] The articles "a" and "an" are used to refer to one or more (i.e., at least one) grammatical objects of the article. For example, "an element" means one or more elements.

[0076] As used herein, the terms “comprising” or “comprises” are used in reference to compositions, methods, and their constituent elements, including the inclusion of elements present in a given embodiment but not specifically identified.

[0077] As used herein, the term “essentially from” refers to the elements necessary for a given embodiment. The term allows for the presence of additional elements that do not substantially affect the basis and novel or functional characteristics of that embodiment of the disclosure.

[0078] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding all elements not enumerated in the description of the embodiments.

[0079] As used herein, the term "comprising" includes "consisting of" and "essentially consisting of."

[0080] Whenever "as described above," "as described above," or "above" is used in this description, it refers to any of the disclosures made in the specification on any of the previous pages.

[0081] Whenever the phrases “as stated herein,” “as described herein,” “provided herein,” or “as stated herein,” or “as provided herein” are used in this description, they refer to any disclosure made in the specification on any of the preceding or following pages.

[0082] As used herein, the term “about” means an acceptable variation of 20%, 10%, and 5% of the specified value. In certain embodiments, “about” may mean a variation of + / - 1%, 2%, 3%, 4%, 5%, 10%, or 20%.

[0083] When used herein in relation to a compound or composition, the term “effective amount” means the amount of an active compound (also referred herein as an activator or active drug) sufficient to produce a bactericidal or bacteriostatic effect. In one embodiment, the effective amount is a “therapeutic effective amount” meaning the amount of an active compound sufficient to alleviate the symptoms of a bacterial infection being treated.

[0084] As used herein, the term "subject" (alternatively "patient") refers to an animal, preferably a mammal, most preferably a human, who is undergoing either prophylactic or therapeutic treatment.

[0085] As used herein, the term "administration" or "administering" means all means of introducing a compound or pharmaceutical composition into a subject who needs it, including, but not limited to, oral, intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, inhalation, buccal, ophthalmic, sublingual, vaginal, and rectal. Administration of the compound or composition is preferably parenteral. For example, the compound or composition can preferably be administered intravenously, but currently, as used clinically in the treatment of Mycobacterium avium, it can also be administered intraperitoneally or via inhalation (see Shirley et al., Amikacin Liposome Inhalation Suspension: A Review in Mycobacterium avium Complex Lung Disease. Drugs. 2019 Apr;79(5):555-562).

[0086] As used herein, the terms "treat", "treating", and "treatment" refer to therapeutic or prophylactic measures such as those described herein.

[0087] The term "pharmaceutically acceptable salt" refers to a relatively non-toxic inorganic or organic acid addition salt of a compound of the present disclosure that has the desired pharmacological activity.

[0088] The term "alkyl" means a saturated carbon chain having 1 to 20 carbon atoms, which may be linear, branched, or a combination thereof, unless otherwise specified. Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, sec- and tert-butyl, pentyl, hexyl, heptyl, and octyl. Unless otherwise specified herein, alkyl groups are optionally substituted.

[0089] The term "phosphatidylserine" refers to the L-isomer of serine in the head group, along with any of its acyl chain compositions, unless otherwise specified in a particular example.

[0090] The term “lipid complex” refers to a complex lipid that inhibits the aggregation of lipid particles. Such lipid complexes include, but are not limited to, polysarcosine (see, e.g., WO2021191265A, which is incorporated herein by reference for all purposes), polyamide oligomers (e.g., ATTA-lipid complexes), PEG-lipid complexes (such as PEG coupled with dialkyloxypropyl, PEG coupled with diacylglycerol, PEG coupled with cholesterol, PEG coupled with phosphatidylethanolamine, PEG conjugated with ceramide, etc.) (see, e.g., U.S. Patent No. 5,885,613, which is incorporated herein by reference for all purposes), cationic PEG lipids, and mixtures thereof. PEG can be directly conjugated to lipids or bonded to lipids via a linker moiety. Any linker moiety suitable for coupling PEG to lipids (e.g., including non-ester-containing and ester-containing linker moieties) can be used. In preferred embodiments, a non-ester-containing linker moiety is used.

[0091] The abbreviations for ionized cationic lipids may be truncated in the examples as they appear in the table. For example, AKG-UO-1 or AKG-KC2-01 may be called UO1 or KC2-01.

[0092] The abbreviation UT, used in various studies, refers to an untreated sample.

[0093] The term “lipid nanoparticles” or “LNP” refers to particles having a diameter of approximately 5–500 nm. In some embodiments, lipid nanoparticles contain one or more activators. In some embodiments, lipid nanoparticles contain nucleic acids. In some embodiments, nucleic acids are condensed within a cationic lipid, polymer, or nanoparticle having an outer lipid coating that interacts with polyvalent small molecules and the biological environment. Due to the repulsive forces between phosphate groups, nucleic acids are necessarily rigid polymers and elongated shapes are preferred. In cells, to cope with volume constraints, DNA can pack itself under suitable solution conditions with the help of ions and other molecules. Typically, DNA condensation is defined as the breakdown of an extended DNA strand into compact, systematic particles containing only one or a few molecules. By binding to phosphate groups, cationic lipids can condense DNA by neutralizing the phosphate charge and allowing for dense packing.

[0094] In some embodiments, the activator is encapsulated within the LNP. In some embodiments, the activator may be an anionic compound, and may be, but is not limited to, DNA, RNA, natural and synthetic oligonucleotides (including antisense oligonucleotides, interfering RNA and small interfering RNA), nucleoproteins, peptides, nucleic acids, ribozymes, DNA-containing nucleoproteins, such as as-is or partially deproteinized viral particles (virions), and oligomers and polymers other than DNA (e.g., acidic polysaccharides and glycoproteins). In some embodiments, the activator may be mixed with an adjuvant.

[0095] In LNP vaccine products, the activator is generally contained within the LNP. In some embodiments, the activator includes nucleic acids. Typically, water-soluble nucleic acids are condensed together with cationic lipids or polycationic polymers within the particle, and the particle surface is enriched with neutral lipids or PEG-lipid derivatives. Additional ionized cationic lipids may also be present on the surface, which, by being positively charged, respond to acidification in the environment and promote endosomal escape.

[0096] Ionized lipids may have properties or functions different from LNPs. Due to the pKa of the amino group, lipid molecules can acquire a positive charge under acidic conditions. Under these conditions, lipid molecules can electrostatically bind to the phosphate group of nucleic acids, enabling LNP formation and nucleic acid encapsulation. In some embodiments, the pKa may be low enough to substantially neutralize the surface charge of LNPs in biological fluids such as blood at physiological pH values. High LNP surface charges are associated with toxicity, adhesion, rapid removal from circulation by free macrophages, and hemolytic toxicity (including immunoactivation) (Filion et al Biochim Biophys Acta. 1997 Oct 23;1329(2):345-56).

[0097] In some embodiments, the pKa may be high enough for ionized cationic lipids to take on a positively charged form at acidic endosomal pH values. In this way, cationic lipids can be combined with endogenous endosomal anionic lipids to promote membrane-soluble non-bilayer structures such as the hexahedral HII phase, leading to more efficient intracellular transport. In some embodiments, the pKa is in the range of 6.2–6.5. For example, the pKa may be about 6.2, about 6.3, about 6.4, or about 6.5. The unsaturated tail also contributes to the ability of lipids to take on a non-bilayer structure (Jayaraman et al., Angew Chem Int Ed Engl. 2012 Aug 20;51(34):8529-33).

[0098] Among other properties such as liposome removal and circulating half-life, nucleic acid release from LNP formulations can be modified by the presence of polyethylene glycol and / or sterols (e.g., cholesterol) or other potential additives in the LNPs, as well as the overall chemical structure (including the pKa of any ionized cationic lipids included as part of the formulation).

[0099] The term "bioreducible" refers to compounds that undergo accelerated degradation due to disulfide bond cleavage in a reducing environment. Unlike other nucleic acid therapies such as siRNA, the success of mRNA-based therapies depends on the usefulness of a safe and efficient delivery vehicle that encapsulates the mRNA. mRNA is fragile and requires a protective coating to maintain its activity until it reaches the target site. mRNA-containing LNPs are a promising vaccine option for Covid-19 immunity (Jackson et al., Preliminary Report. N Engl J Med. 2020 Nov 12;383(20):1920-1931). The efficiency and tolerability of LNPs are due to aminolipids, and unlike many biomaterial applications that may require service for weeks or months, functional LNP-mediated delivery of mRNA occurs within hours, eliminating the need for persistent lipids. In fact, this is particularly important in applications requiring long-term administration. It has been demonstrated that LNPs enter cells via endocytosis and accumulate in the endolysosomal compartment. Ionized cationic lipids (ICLs) are susceptible to enzymatic hydrolysis by lipases or hydrolysis induced by the reducing environment of lysosomes in late endosomes / lysosomes, and are capable of complete biodegradation, yet can efficiently deliver mRNA to the cytosol after endocytosis. The extracellular environment is relatively oxidative, while the intracellular environment is reducing, allowing disulfide-bonded molecules to remain intact in the extracellular environment, but to be rapidly reduced upon internalization (Huang et al., Mol Ther. 2005 Mar;11(3):409-17, 2005). Several embodiments provide bioreducible disulfide-bonded ICL molecules (compounds 29-36 (see Table 2)) that are stable in LNP formulations during circulation but undergo cleavage in the reducing environment of lysosomes. Such compounds and compositions can promote the rapid biological disruption of lipids and prevent the accumulation of potentially toxic ICL lipids (as observed in rats with DLin-MC3-DMA (Sabins et al., Mol Ther. 2018 Jun 6;26(6):1509-1519)).

[0100] As used herein, the terms “encapsulated” and “encapsulated” refer to the incorporation of mRNA, DNA, siRNA, or other nucleic acid drugs into or association with lipid nanoparticles. As used herein, the term “encapsulated” refers to complete or partial encapsulation. siRNA can selectively knock down or downregulate the expression of a target gene. For example, siRNA may be selected to silence a gene associated with a particular disease, disorder, or pathological condition when administered to a target requiring it in a nanoparticle composition containing siRNA. siRNA may contain a sequence complementary to the mRNA sequence encoding the target gene or protein.

[0101] The term "mol%" in relation to cholesterol refers to the amount of cholesterol in moles relative to the total amount of cholesterol and non-PEGylated phospholipids expressed as a percentage point. For example, "55 mol% cholesterol" in liposomes containing cholesterol and HSPCs refers to a composition of 55 moles of cholesterol per 45 moles of HSPCs.

[0102] The term "mol%" in relation to PEG-lipids refers to the ratio of molar amounts of PEG-lipids and non-PEGylated phospholipids expressed as a percentage point. For example, "5 mol% PEG-DSPE" in an LNP containing HSPC and PEG-DSPE refers to a composition having 5 moles of PEG-DSPE per 100 moles of HSPC.

[0103] As used herein, the term “pharmaceutically acceptable carrier, diluent or excipient” includes, but is not limited to, any adjuvants, carriers, excipients, flow enhancers, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, humectants, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers approved by the U.S. Food and Drug Administration as acceptable for use in human or animal husbandry.

[0104] Various aspects and embodiments are described in more detail in the following subsections.

[0105] compound This specification provides compounds, compositions, and methods for the treatment or prevention of infectious diseases, including tuberculosis. According to aspects of this disclosure, cationic lipids include compounds having formula I, II, III, or IV, or pharmaceutically acceptable salts thereof. According to aspects of this disclosure, ionized cationic lipids include compounds having one or more chemical substructures selected from the group consisting of formula IV, formula IV-A, formula A, formula A', formula A'', formula A''', and / or formula B. In some aspects of this disclosure, ionized cationic lipids may include compounds having formula I, formula IA, formula I-A', formula I-A'', formula II, formula II-A, formula II-A', formula II-B, formula II-B', formula III, or formula III-A, or pharmaceutically acceptable salts thereof. In some aspects of this disclosure, LNPs may include compounds having formula V or formula VA, or pharmaceutically acceptable salts thereof. In some aspects of this disclosure, LNPs may include compounds having formula VI or formula VI-A, or pharmaceutically acceptable salts thereof. In some embodiments of this disclosure, the LNP may include a compound having formula VII or a pharmaceutically acceptable salt thereof. In some embodiments of this disclosure, the LNP may include a compound having formula VIII or a pharmaceutically acceptable salt thereof. According to embodiments of this disclosure, the cationic lipid includes (a) an ionized cationic lipid selected from compounds of formula I, formula IA, formula I-A', formula I-A'', formula II, formula II-A, formula II-A', formula II-B, formula II-B', formula III, or formula III-A, or a sterol lipid of formula VI-A, or a branched lipid of formula VIII, and (b) a compound having a sterol of formula VI, and optionally further comprising (c) an alkylene glycol lipid of formula VII. In some embodiments, the LNP may further include a phospholipid of formula V or formula VA. In some embodiments, the LNP may further include an anionic phospholipid targeting moiety as shown in Table 3.

[0106] Furthermore, this specification also provides compounds, compositions, and methods for the treatment or prevention of infectious diseases, including tuberculosis. According to aspects of this disclosure, cationic lipids include compounds having formula A or pharmaceutically acceptable salts thereof. In some embodiments, cationic lipids include two fatty acyl groups, such as those in formula II, II, III, or IV.

[0107] This specification discloses compounds of formulas I, II, III, and IV, or pharmaceutically acceptable salts thereof, that are useful in the preparation of vaccines. This specification also discloses compositions comprising cationic lipids of formulas I, II, III, and IV, or pharmaceutically acceptable salts thereof. In some embodiments, the vaccines are used for the prevention of mycobacterium infection. In some embodiments, the vaccine is effective against tuberculosis, non-tuberculous mycobacteria (NTM), non-tuberculous lung disease, leprosy, Mycobacterium avium-intracellulare, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium abscessus, and other infectious diseases, such as coronaviruses (COVID-19, SARS). It can be used for the prevention of CoV2, SARS-CoV, MERS-CoV, diphtheria, Ebola, flu (influenza), hepatitis, Hib disease, HIV / AIDS, HPV (human papillomavirus), malaria, measles, meningococcal disease, mumps, norovirus, epidemic, pneumococcal disease, polio, respiratory syncytial virus (RSV), rotavirus, rubella (measles), herpes zoster (shingles), tetanus (emergency tetanus), pertussis (whithorn cough), and Zika.

[0108] In this specification, compounds, compositions and methods for the treatment or prevention of infectious diseases including tuberculosis are provided. According to aspects of the present disclosure, the cationic lipid comprises a compound having formula I, II, III or IV or a pharmaceutically acceptable salt thereof. In some embodiments, the cationic lipid comprises two fatty acyl groups of formula I, II, III or IV.

[0109] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A.

[0110] [Chemical formula] [where a is 1, 2, 3 or 4, b is 2, 3 or 4, and c is 3, 4, 5, 6 or 7] In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains, where b is 4. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where a, b, and c are totaled 10, 11, 12, or 13. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where a is 4, b is 4, and c is 4 or 5. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where a is 1, 2, or 3, b is 4, and c is 3, 4, 5, 6, or 7. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where a is 5 or 6, b is 2, 3, or 4, and c is 3, 4, 5, 6, or 7. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where a, b, and c total 10, 11, 12, or 13. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where a, b, and c total 12. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where b is 2 and a, b, and c total 12. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where b is 3 and a, b, and c total 12. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A, where b is 4 and a, b, and c total 12. In some embodiments, the ionized lipid may contain two polyunsaturated polyene hydrocarbon chains of formula A.

[0111] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A.

[0112] [ka] [In the formula, a is 1, 2, or 3, b is 2, 3, or 4, and c is 3, 4, 5, 6, or 7] In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains where b is 4. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A' where the sum of a, b, and c is 10, 11, 12, or 13.

[0113] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A''.

[0114] [ka] [In the equation, a is 4, b is 4, and c is either 4 or 5.] In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A'', where the sum of a, b, and c is 12.

[0115] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A'''.

[0116] [ka]

[0117] [In the formula, a is 5 or 6, b is 2, 3 or 4, and c is 3, 4, 5, 6 or 7] In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A''', where the sum of a, b, and c is 10, 11, 12, or 13. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A''', where the sum of a, b, and c is 12. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A''', where b is 2 and the sum of a, b, and c is 12. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A''', where b is 3 and the sum of a, b, and c is 12. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A''', where b is 4 and the sum of a, b, and c is 12. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A'''.

[0118] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula B.

[0119] [ka] [In the formula, a is 5, 6, or 7, and c is 3, 4, or 5.] In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains where b is 4. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula B where the sum of a and c is 9, 10, or 11.

[0120] In some embodiments, the ionized lipid has the chemical structure of formula (IV-A). [ka] or comprising a pharmaceutically acceptable salt thereof, wherein Y is [ka] And n is an integer of 2, 3, or 4, R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A''' or formula B, and R 10 and R 12 Each of these is an independently (C1-C4) alkyl group that is optionally substituted with a hydroxyl group.

[0121] In some embodiments, R in formula (IV-A) 22 R is a polyene hydrocarbon chain of formula A. In some embodiments, R in formula (IV-A) 22 R is a polyene hydrocarbon chain of formula A'. In some embodiments, R in formula (IV-A) 22 R is a polyene hydrocarbon chain of formula A''. In some embodiments, R in formula (IV-A) 22 R is a polyene hydrocarbon chain of formula A'''. In some embodiments, R in formula (IV-A) 22 This is the polyene hydrocarbon chain of formula B.

[0122] In some embodiments, in formula (IV-A), R 10 and R 12 Each of these is independently selected from methyl, ethyl, propyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH. In some embodiments, in formula (IV-A), R 10 and R 12 Each of these is independently methyl. In some embodiments, in formula (IV-A), R 10 and R 12 Each of these is independently ethyl. In some embodiments, in formula (IV-A), R 10 and R 12 At least one of them is an n-propyl that is optionally substituted with a hydroxyl group. In some embodiments, in formula (IV-A), R 10 is methyl, and R 12 R is selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH. In some embodiments, in formula (IV-A), R 10is methyl, and R 12 R is selected from -(CH2)(CH2)OH and -(CH2)2(CH2)OH. In some embodiments, in a compound having the chemical structure of formula (IV-A), R 10 is methyl, and R 12 R is selected from -(CH2)(CH2)OH and -(CH2)2(CH2)OH. In some embodiments, in formula (IV-A), R 10 and R 12 R is independently selected from methyl or ethyl, which are optionally substituted with one or more hydroxyls. In some embodiments, in formula (IV-A), R 10 and R 12 One or both of are -(CH2)(CH2)OH or -(CH2)2(CH2)OH in formula (IV-A). In some embodiments, in formula (IV-A), R 10 is methyl, and R 12 R is methyl or ethyl substituted with hydroxyl. In some embodiments, R in formula (IV-A) 10 One or both of them are methyl, R 12 R is -(CH2)(CH2)OH in formula (IV-A). In some embodiments, R is in formula (IV-A). 10 One or both of them are methyl, R 12 This is -(CH2)2(CH2)OH in formula (IV-A).

[0123] In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'''' or formula B, 10 and R 12Each of these is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A'''', and R 10 and R 12 Each of these is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula B, 10 and R 12 Each of these is an independently (C1-C4) alkyl group that is optionally substituted with a hydroxyl group.

[0124] In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'''' or formula B, 10 and R 12 Each of these is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A'''', and R 10 and R 12 Each of these is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula B, 10 and R 12 Each of these is an independently (C1-C4) alkyl group that is optionally substituted with a hydroxyl group.

[0125] In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'''' or formula B, 10 and R 12 Each of them is independently a (C1-C4) alkyl that is optionally substituted with a hydroxyl group. In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains of formula (IV-A) or a pharmaceutically acceptable salt thereof, where Y is [ka] And n is an integer of 2, 3, or 4, R 22is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A'''', and R 10 and R 12 Each of these is an independently (C1-C4) alkyl group that is optionally substituted with a hydroxyl group.

[0126] In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'''' or formula B, 10 and R 12 Each of these is an independently (C1-C4) alkyl group that is optionally substituted with a hydroxyl group.

[0127] In some embodiments, the ionized lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently bonded to the Y portion of formula (IV-A), where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'''' or formula B, 10 and R 12 Each of these is an independently (C1-C4) alkyl group that is optionally substituted with a hydroxyl group.

[0128] In some embodiments, the ionized lipid is given by formula (IV): [ka] The formula comprises one or more polyunsaturated polyene hydrocarbon chains or pharmaceutically acceptable salts thereof covalently bonded to the Y portion, wherein Y is [ka] and n is an integer of 2, 3 or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A''' or formula B. In some embodiments, the ionizable lipid is of formula (IV): [Chemical formula] contains one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of or a pharmaceutically acceptable salt thereof, wherein Y is [Chemical formula] and n is an integer of 2, 3 or 4, and R 22 is a polyene hydrocarbon chain of formula A. In some embodiments, the ionizable lipid is of formula (IV): [Chemical formula] contains one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of or a pharmaceutically acceptable salt thereof, wherein Y is [Chemical formula] and n is an integer of 2, and R 22 is a polyene hydrocarbon chain of formula A'.

[0129] One aspect of the present disclosure provides a compound of formula I or a pharmaceutically acceptable salt thereof.

[0130] [Chemical formula] [wherein Y is independently a methyl or ethyl group, here, the two fatty acyl groups have 16 to 18 carbons and contain two non-conjugated olefins]]

[0131] Another aspect of the present disclosure provides a composition comprising an ionizable lipid, the lipid nanoparticles comprising the ionizable lipid of formula I or a pharmaceutically acceptable salt thereof.

[0132] [ka] [In the formula, Y is independently a methyl or ethyl group, Here, the two fattyacyl groups contain two olefins, each having a total of 16-18 carbon atoms and separated by 2-4 methylene groups.

[0133] In some embodiments, the two fattyacyl groups have 16 carbon atoms. In some embodiments, the two fattyacyl groups have 17 carbon atoms. In some embodiments, the two fattyacyl groups have 18 carbon atoms.

[0134] In some embodiments, ionized lipids of formula IA or pharmaceutically acceptable salts thereof are provided.

[0135] [ka] [In the formula, a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, c is 3, 4, 5, 6 or 7, the sum of a, b and c is 10 or 12, and L is [ka] And R 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group, where v is 0 or 1, q is 1, 2, 3 or 4, and q2 is 1 or 2. In some embodiments, in the ionized lipid of formula IA, v is 0, q is 1, 2, or 3, and the sum of a, b, and c is 12. In some embodiments, in the ionized lipid of formula IA, v is 1, q is 3 or 4, and the sum of a, b, and c is 12. In some embodiments, in the ionized lipid of formula I-A', R 10 and R 12is independently selected from methyl, ethyl, and propyl, each of which is optionally substituted with a single hydroxyl. In some embodiments, the sum of a, b, and c is 12, and R 10 and R 12 are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0136] In some embodiments, there is provided an ionizable lipid of formula I-A’, or a pharmaceutically acceptable salt thereof.

[0137] [Chemical formula] [where a is 1, 2, or 3, c is 3, 4, 5, 6, or 7, L is [Chemical formula] and Y’ is methyl or ethyl, v is 0 or 1, q is 2, 3, or 4, and q2 is 1 or 2] In some embodiments, in the ionizable lipid of formula I-A’, v is 0, q is 1, 2, or 3, and the sum of a and c is 6 or 8. In some embodiments, in the ionizable lipid of formula I-A’, v is 1, q is 3 or 4, and the sum of a and c is 6 or 8.

[0138] In some embodiments, there is provided an ionizable lipid of formula I-A’’, or a pharmaceutically acceptable salt thereof.

[0139] [Chemical formula] [where a is 4, 5, or 6, b is 2, 3, or 4, c is 3, 4, 5, 6, or 7, L is [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]]

[0140] [[ID=…]] [[ID=…]] [[ID=…]]

[0141] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]] [[ID=…]]

[0142] [[ID=…]] [[ID=…]] [[ID=…]]

[0143] [[ID=…]] [[ID=…]] [[ID=…]]

[0144] [[ID=…]]<…> and R 10 and R 12 It seems there are some parts in the original text that are not fully presented in the provided translation task (the "…" parts). Please check and correct if needed.Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group, where v is 0 or 1, q is 1, 2, 3 or 4, and q2 is 1 or 2. In some embodiments, in the ionized lipid of formula I-A'', v is 0, q is 1, 2, or 3, and the sum of a, b, and c is 12. In some embodiments, in the ionized lipid of formula I-A'', v is 1, q is 3 or 4, and the sum of a, b, and c is 12. In some embodiments, R 10 and R 12 In the ionized lipid of formula I-A'', are independently selected from methyl, ethyl, and propyl, each optionally substituted with a single hydroxyl group. In some embodiments, the sum of a, b, and c is 12, and R 10 and R 12 These are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0140] Another aspect of the present disclosure provides compounds of formula II or pharmaceutically acceptable salts thereof.

[0141] [ka] [In the formula, R is a substituent containing one dialkylamino group of the structure shown above, and the two fattyacyl groups have 16 to 18 carbon atoms and contain two olefins separated by at least two methylene groups.]

[0142] In some embodiments, the two fattyacyl groups have 16 carbon atoms. In some embodiments, the two fattyacyl groups have 17 carbon atoms. In some embodiments, the two fattyacyl groups have 18 carbon atoms.

[0143] Another aspect of the present disclosure provides compounds of formula II-A or pharmaceutically acceptable salts thereof.

[0144] [ka] [In the formula, a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, c is 4, 5, 6, 7 or 8, and R2 is [ka] And q and q' are independently 1 or 2, R 10 and R 12 [These are methyl or ethyl, respectively.] In some embodiments, in the ionized lipid of formula IA, the sum of a, b, and c is 11 or 13. In some embodiments, the ionized lipid of formula IA is characterized by one or more of the following: a is 1, 2, or 3, q ​​is 2, q' is 1, and R 10 or R 12 At least one of them is ethyl. In some embodiments, in the ionized lipid of formula II-A, b is 4. In some embodiments, in the ionized lipid of formula II-A, a is 4, b is 4, and c is 4. In some embodiments, in the ionized lipid of formula II-A, a is 1, b is 4, and c is 8. In some embodiments, in the ionized lipid of formula II-A, a is 2, b is 4, and c is 5.

[0145] Another aspect of the present disclosure provides compounds of formula II-A' or pharmaceutically acceptable salts thereof.

[0146] [ka] [In the formula, a is 1, 2 or 3, b is 2, 3 or 4, c is 4, 5, 6, 7 or 8, and R2 is [ka] And q and q' are independently 1 or 2, R 10 and R 12 [These are methyl or ethyl, respectively.] In some embodiments, in the ionized lipid of formula I-A', the sum of a, b, and c is 11 or 13. In some embodiments, the ionized lipid of formula IA is characterized by one or more of the following: q is 2, q' is 1, and R 10 or R 12 At least one of them is ethyl. In some embodiments, in the ionized lipid of formula II-A', b is 4. In some embodiments, in the ionized lipid of formula II-A', a is 4, b is 4, and c is 4. In some embodiments, in the ionized lipid of formula II-A', a is 1, b is 4, and c is 8. In some embodiments, in the ionized lipid of formula II-A', a is 2, b is 4, and c is 5.

[0147] Another aspect of the present disclosure provides compounds of formula II-B or pharmaceutically acceptable salts thereof.

[0148] [ka] [In the formula, a is 5, 6 or 7, c is 3, 4 or 5, and R2 is [ka] And q and q' are independently 1 or 2, R 10 and R 12 [These are methyl or ethyl, respectively.] In some embodiments, in the ionized lipid of formula IB, the sum of a and c is 9 or 11. In some embodiments, the ionized lipid of formula IB is characterized by one or more of the following: q is 2, q' is 1, and R 10 or R 12 At least one of them is ethyl. In some embodiments, the ionized lipid of formula IB is characterized by one or more of the following: q is 1, q' is 2, and R 10 and R 12Each of these is methyl. In some embodiments, in the ionized lipid of formula II-B, c is 4. In some embodiments, in the ionized lipid of formula II-B, a is 5 or 7 and c is 4. In some embodiments, in the ionized lipid of formula II-B, a is 5 and c is 4. In some embodiments, in the ionized lipid of formula II-B, a is 7 and c is 4.

[0149] Another aspect of the present disclosure provides compounds of formula II-B' or pharmaceutically acceptable salts thereof.

[0150] [ka] [In the formula, a is 5 or 7, c is 3 or 4, and R2 is [ka] And q and q' are independently 1 or 2, R 10 and R 12 Each of these is methyl. In some embodiments, the sum of a and c in the ionized lipid of formula I-B' is 9 or 11. In some embodiments, c is 4 in the ionized lipid of formula I-B'. In some embodiments, a is 5 or 7 and c is 4 in the ionized lipid of formula II-B'. In some embodiments, a is 5 and c is 4 in the ionized lipid of formula II-B. In some embodiments, a is 7 and c is 4 in the ionized lipid of formula II-B'. In some embodiments, a is 5 and c is 3 in the ionized lipid of formula II-B'. In some embodiments, a is 7 and c is 3 in the ionized lipid of formula II-B'.

[0151] Another aspect of this disclosure provides compounds of formula III or pharmaceutically acceptable salts thereof.

[0152] [ka] [In the formula, Y is a methyl or ethyl group, The two fattyacyl groups are disulfide fattyacyl groups that have 16 to 18 carbon atoms and contain a single olefin.

[0153] In some embodiments, the two fattyacyl groups have 16 carbon atoms. In some embodiments, the two fattyacyl groups have 17 carbon atoms. In some embodiments, the two fattyacyl groups have 18 carbon atoms.

[0154] Another aspect of the present disclosure provides compounds of formula III-A or pharmaceutically acceptable salts thereof.

[0155] [ka] [In the formula, a is 5, 6 or 7, c is 3, 4 or 5, q is 2 or 3, R 10 and R 12 [It is methyl or ethyl] In some embodiments, the ionized lipid may include a compound of formula III-A, where a is 5 or 7. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula A, where the sum of a and c is 8, 9, or 10.

[0156] Another aspect of the present disclosure provides compounds of formula III-A' or pharmaceutically acceptable salts thereof.

[0157] [ka] [In the formula, a is 5 or 7, c is 3, 4 or 5, q is 2 or 3, R 10 and R 12 [It is methyl or ethyl] In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains where c is 3. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula III-A' where the sum of a and c is 8 or 10. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula III-A' where q is 2 and the sum of a and c is 8 or 10. In some embodiments, the ionized lipid may include two polyunsaturated polyene hydrocarbon chains of formula III-A' where q is 2 and R 10 and R 12 It may contain two polyunsaturated polyene hydrocarbon chains of formula III-A', where each is methyl and the sum of a and c is 8 or 10. In some embodiments, the ionized lipid is such that q is 2 and R 10 and R 12 It may contain two polyunsaturated polyene hydrocarbon chains of formula III-A', where each of the atoms is methyl and c is 3.

[0158] In some embodiments, the compounds in formulas I-III have a pKa of 6-7. In some embodiments, the lipid nanoparticle composition comprises lipids and nucleic acids, and the lipid nanoparticles comprise the compounds of formulas I, II, and III, combinations thereof, or pharmaceutically acceptable salts thereof.

[0159] In some embodiments, LNP is given by formula (IV): [ka] It comprises an ionized lipid having the structure or a pharmaceutically acceptable salt thereof, where Y is [ka] And each R 22 R is independently an alkyl, alkenyl, alkynyl, or heteroalkyl group, each of which can be optionally selected. B Substituted by, each R Bindependently, n is an alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, and n is an integer from 1 to 10 (including both ends). [ka] The symbol indicates a connection point.

[0160] In some embodiments, Y is [ka] That is the case.

[0161] In some embodiments, the compound of formula IV has a pKa of 6-7.

[0162] In some embodiments, the ionized lipid is given by formula (IV-A): [ka] It comprises one or more polyunsaturated polyene hydrocarbon chains or pharmaceutically acceptable salts thereof, where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'' or formula A'''', 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, R in formula (IV-A) 10 and R 12 These are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0163] In some embodiments, the ionized lipid is given by formula (IV-A); [ka] It comprises one or more polyunsaturated polyene hydrocarbon chains or pharmaceutically acceptable salts thereof, where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'' or formula A''' or formula B, 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, R in formula (IV-A) 10 and R 12 These are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0164] In some embodiments, the ionized lipid is given by formula (IV-A): [ka] It comprises one or more polyunsaturated polyene hydrocarbon chains or pharmaceutically acceptable salts thereof, where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'' or formula A''' or formula B, 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, R in formula (IV-A) 10 and R 12 These are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0165] In some embodiments, the ionized lipid is given by formula (IV-A): [ka] It comprises one or more polyunsaturated polyene hydrocarbon chains or pharmaceutically acceptable salts thereof, where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'' or formula A''' or formula B, 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, R in formula (IV-A) 10 and R 12 These are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0166] In some embodiments, the ionized lipid is given by formula (IV-A): [ka] It comprises one or more polyunsaturated polyene hydrocarbon chains or pharmaceutically acceptable salts thereof, where Y is [ka] And n is an integer of 2, 3, or 4, R 22 R is a polyene hydrocarbon chain of formula A, formula A', formula A'' or formula A''' or formula B, 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group. In some embodiments, R in formula (IV-A) 10 and R 12 These are independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH.

[0167] In some embodiments, the compound has the structure of the compound listed in Table 1 or Table 2.

[0168] Table 1A shows examples of cationic lipids. Table 2 shows examples of bioreducible cationic lipids.

[0169] JPEG0007848206000097.jpg180170

[0170] JPEG0007848206000098.jpg162170

[0171] JPEG0007848206000099.jpg151170

[0172] JPEG0007848206000100.jpg163170

[0173] JPEG0007848206000101.jpg184170

[0174] JPEG0007848206000102.jpg141170

[0175] JPEG0007848206000103.jpg110170

[0176] In some embodiments, ionized lipids encapsulate nucleic acids. In some embodiments, ionized lipids encapsulate nucleic acids in LNP formulations. In some embodiments, the nucleic acid is an siRNA molecule. In some embodiments, the nucleic acid is an mRNA molecule. In some embodiments, the nucleic acid is a DNA molecule.

[0177] In some embodiments, compositions are provided that further include ligands, such as antibody conjugates against cell surface receptors, for targeting lipid nanoparticles to dendritic cells in a highly specific manner. In some embodiments, the composition further includes a target ligand, which is oriented outward from the nanoparticles. In some embodiments, the target ligand is an antibody.

[0178] In some embodiments, the lipid nanoparticles are in an aqueous medium.

[0179] In some embodiments, nucleic acids are encapsulated in lipid nanoparticles with compounds disclosed herein, including compounds of formulas I, II, III, IV or combinations thereof, and the nucleic acids are either RNA or DNA. In some embodiments, nucleic acids are encapsulated in lipid nanoparticles with compounds disclosed herein, including compounds of formulas I, IA, II, II-A, II-B, III, III-A, IV, IV-A, IV-B, V, VA, VI-A, VII, VIII or combinations thereof, and the nucleic acids are either RNA or DNA. In some embodiments, the nucleic acids are mRNA. In some embodiments, the nucleic acids are siRNA. In some embodiments, the nucleic acids are DNA.

[0180] In some embodiments, the lipid nanoparticles comprise a membrane containing phosphatidylcholine and sterols. In some embodiments, the sterols are cholesterol. In some embodiments, the lipid nanoparticles comprise a membrane containing phosphatidylcholine and ionized cationic lipids (ICLs). In some embodiments, the ICLs have a structure of formula I, II, III, or IV, and cholesterol, and the membrane separates the inside of the lipid nanoparticles from the aqueous medium. In some embodiments, the ICLs have the structures shown in Tables 1A and 2. In some embodiments, the ICLs have the structures shown in Table 1B. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine (DSPC) or hydrogenated soybean phosphatidylcholine (HSPC). In some embodiments, the molar ratio of ionized cationic lipids to cholesterol is about 65:35 to 40:60. In some embodiments, the molar ratio of ICLs to cholesterol is about 60:40 to about 45:55.

[0181] In some embodiments, the molar ratio of phosphatidylcholine to cholesterol is approximately 1:5 to approximately 1:2.

[0182] In some embodiments, the film further comprises polymer composite lipids.

[0183] In some embodiments, the lipid nanoparticles contain ICL, DSPC, cholesterol, and polymer complex lipids in a molar ratio of approximately 49.5:10.3:39.6:2.5.

[0184] In some embodiments, the polymer complex lipid is PEG(2000)-dimiristoylglycerol (PEG-DMG) or PEG(molecular weight 2,000)-dimiristoylphosphatidylethanolamine (PEG-DMPE).

[0185] In some embodiments, the percentage of oxidative degradation products of ionized lipids is less than 50% of that of DLin-KC2-DMA or DLin-MC3-DMA control formulations.

[0186] In some embodiments, the composition is a liquid pharmaceutical formulation for parenteral administration.

[0187] In some embodiments, the composition is a liquid pharmaceutical formulation for subcutaneous, intramuscular, or intradermal administration.

[0188] In some embodiments, the composition is in the form of a lyophilized powder, which is subsequently reconstituted with an aqueous medium before administration.

[0189] Other aspects of the present disclosure relate to methods for preventing bacterial or viral infections, comprising administering an effective amount of a composition provided herein to a subject in need to induce an immune response. Some embodiments provide methods for vaccinating a subject in need, comprising administering a composition comprising a nucleic acid encoding an antigen protein.

[0190] In some embodiments, the composition is administered subcutaneously, intramuscularly, or intradermally.

[0191] In some embodiments, the bacterial infection is a Mycobacterium tuberculosis infection. In some embodiments, the bacterial infection is in the form of a nontuberculosis mycobacterium.

[0192] In some embodiments, the viral infection is a coronavirus. In some embodiments, the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0193] In some embodiments, the viral infection is HIV / AIDS.

[0194] In some embodiments, lipid nanoparticles are administered parenterally.

[0195] In some embodiments, the lipid nanoparticle composition is administered as part of a single dose.

[0196] This disclosure features lipid nanoparticles comprising nucleic acids, such as DNA, mRNA, siRNA, antisense oligonucleotides, CRISPR components, such as guide RNA (gRNA or sgRNA) and CRISPR-related endonucleases (Cas proteins), and lipids. Exemplary lipids include ionized cationic lipids (ICLs), phospholipids, sterol lipids, alkylene glycol lipids (e.g., polyethylene glycol lipids), sphingolipids, glycerolipids, glycerophospholipids, prenolic lipids, glycolipids, fatty acids, and polyketides. In some embodiments, the LNP comprises a single type of lipid. In some embodiments, the LNP comprises multiple (e.g., two or more) lipids. The LNP may comprise one or more of ionized cationic lipids, phospholipids, sterols, or alkylene glycol lipids (e.g., polyethylene glycol lipids).

[0197] In one embodiment, the LNP comprises an ionized cationic lipid. As used herein, “ionized cationic lipid,” “ionized lipid,” and “ICL” are used interchangeably. ICL is a lipid comprising an ionized moiety that can have a charge (e.g., a positive charge, e.g., a cationic lipid) under specific conditions (e.g., physiological conditions, e.g., within a specific pH range). The ionized moiety may include an amine, preferably a substituted amine. The ionized lipid may be a cationic lipid or an anionic lipid. In addition to the ionized moiety, the ionized lipid may contain, for example, an alkyl or alkenyl group of a length of more than 6 carbon atoms (e.g., a length of about 8 carbon atoms, 10 carbon atoms, 12 carbon atoms, 14 carbon atoms, 16 carbon atoms, 18 carbon atoms, or 20 or more carbon atoms). Additional ionized lipids that may be included in the LNPs described herein are disclosed in Jayaraman et al. (Angew. Chem. Int. Ed. 51:8529-8533 (2012)), Semple et al. Nature Biotechnol. 28:172-176 (2010)), and U.S. Patents 8,710,200 and 8,754,062, respectively, which constitute part of this specification by reference.

[0198] In some embodiments, LNP is given by formula (IV): [ka] It comprises an ionized lipid having the structure or a pharmaceutically acceptable salt thereof, where Y is [ka] And each R 22 These are independently alkyl, alkenyl, alkynyl, or heteroalkyl, and each of these can be optionally selected as R B Replaced by each R B independently, n is an alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, and n is an integer from 1 to 10 (including both ends). [ka] The symbol indicates a connection point.

[0199] In some embodiments, Y is [ka] That is the case.

[0200] In some embodiments, the LNP comprises an ionized lipid having the structure of formula (IV-A) or a pharmaceutically acceptable salt thereof.

[0201] [ka] [In the formula, R 10 and R 12 Each of them is independently a (C1-C4) alkyl group that is optionally substituted with a hydroxyl group, v is 0 or 1, q1 is 1 or 2, and Y is [ka] And R 22 teeth [ka] And a is 1, 2, 3, 4 or 5, and c is 4, 5, 6, 7 or 8.

[0202] In some embodiments, v of the compound of formula (IV-B) is equal to 0. In some embodiments, v of the compound of formula (IV-B) is equal to 1. In some embodiments, v of the compound of formula (IV-A) is equal to 1 and q1 is equal to 1. In some embodiments, v of the compound of formula (IV-B) is equal to 1 and q1 is equal to 2.

[0203] In some embodiments, the R of the compound of formula (IV-B) 22 In some embodiments, the sum of a and c is 6, 7, 8, or 9. 22In some embodiments, the sum of a and c is 6. 22 In some embodiments, the sum of a and c is 7. 22 The sum of a and c is 9.

[0204] In some embodiments, the R of the compound of formula (IV-B) 22 In this case, v is equal to 0, and the sum of a and c is 6, 7, 8, or 9. In some embodiments, the R of the compound of formula (IV-B) 22 In this case, v is equal to 0, and the sum of a and c is 6. In some embodiments, the R of the compound of formula (IV-B) 22 In this case, v is equal to 0, and the sum of a and c is 7. In some embodiments, the R of the compound of formula (IV-B) 22 In the middle, v is equal to 0, and the sum of a and c is 9.

[0205] In some embodiments, in the compound of formula (IV-B), R 10 and R 12 R is independently selected from methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH. In some embodiments, the R of the compound of formula (IV-B) 22 Medium, R 10 and R 12 Each of the three is methyl, and the sum of a and c is 6, 7, 8, or 9. In some embodiments, the R of the compound of formula (IV-B) 22 Medium, R 10 and R 12 Each of the following is methyl, v is 0, and the sum of a and c is 6, 7, 8, or 9.

[0206] In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] And the sum of a and c is 8. In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] And a is 1 and c is 7. In some embodiments, in the compound of formula (IV-B), v is equal to 0 and R 22 teeth [ka] Therefore, a is 2 and c is 4.

[0207] In some embodiments, in the compound of formula (IV-B), v is equal to 1, and R 22 teeth [ka] In some embodiments, in the compound of formula (IV-B), v is equal to 1, and R 22 teeth [ka] And the sum of a and c is 8. In some embodiments, in the compound of formula (IV-B), v is equal to 1, and R 22 teeth [ka] Therefore, a is 1 and c is 7.

[0208] In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] And the sum of a and c is 7 or 9. In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] And a is 4 and c is 5. In some embodiments, in the compound of formula (IV-B), v is equal to 0 and R 22 teeth [ka] And a is 1 and c is 8. In some embodiments, in the compound of formula (IV-B), v is equal to 0 and R 22 teeth [ka] Therefore, a is 2 and c is 5.

[0209] In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 2 2 is [ka] And the sum of a and c is 7 or 9. In some embodiments, in the compound of formula (IV-B), v is equal to 0, and R 22 teeth [ka] And a is 4 and c is 5. In some embodiments, in the compound of formula (IV-B), v is equal to 0 and R 22 teeth [ka] And a is 1 and c is 8. In some embodiments, in the compound of formula (IV-B), v is equal to 0 and R 22 teeth [ka] Therefore, a is 2 and c is 5.

[0210] LNP may contain ionized lipids at a concentration of, for example, more than about 0.1 mol% of the total lipid content of LNP. In one embodiment, LNP contains ionized lipids at concentrations of, for example, more than about 1 mol%, 2 mol%, 4 mol%, 8 mol%, 20 mol%, 40 mol%, 50 mol%, 60 mol%, and 80 mol% of the total lipid content of LNP. In one embodiment, LNP contains ionized lipids at concentrations of more than about 20 mol%, 40 mol%, or 50 mol%. In one embodiment, LNP contains ionized lipids at concentrations of, for example, more than about 1 mol% to 95 mol% of the total lipid content of LNP. In one embodiment, LNP contains ionized lipids at concentrations of, for example, more than about 2 mol% to 90 mol%, 4 mol% to 80 mol%, 10 mol% to 70 mol%, 20 mol% to 60 mol%, and 40 mol% to 55 mol% of the total lipid content of LNP. In one embodiment, the LNP contains ionized lipids at a concentration of about 20 mol% to about 60 mol%. In another embodiment, the LNP contains ionized lipids at a concentration of about 40 mol% to about 55 mol%.

[0211] In one embodiment, the LNP comprises a phospholipid. The phospholipid is a lipid comprising a phosphate group and at least one alkyl, alkenyl, or heteroalkyl chain. The phospholipid may be natural or unnatural (e.g., synthetic phospholipid). The phospholipid may also comprise amines, amides, esters, carboxyls, choline, hydroxyls, acetals, ethers, carbohydrates, sterols, or glycerols. In some embodiments, the phospholipid may comprise phosphocholine, phosphosphingolipids, or plasmalogens. Exemplary phospholipids include 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), hydrogenated soybean phosphatidylcholine (HSPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1-myristoyl-2-oleoyl-sn-glycero-3-phosphocholine (MOPC), and 1,2- Examples include diarachidonoyl-sn-glycero-3-phosphocholine (DAPC), 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphatidylcholine (PLPC), 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), 1-stearoyl-2-myristoyl-sn-glycero-3-phosphocholine (SMPC), 1-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine (PMPC), bis(monoacylglycerol)phosphate (BMP), L-α-phosphatidylcholine, 1,2-difeptadecanoyl-sn-glycero-3-phosphorylcholine (DHDPC), and 1-stearoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (SAPC).Additional phospholipids that may be included in the LNPs described herein are disclosed in Li, J. et al. (Asian J. Pharm. Sci. 10:81-98 (2015)), which are incorporated herein by reference.

[0212] In some embodiments, LNP is given by formula (V): [ka] The formula comprises a phospholipid having the structure or a pharmaceutically acceptable salt thereof, wherein each R 23 R is independently an alkyl, alkenyl, or heteroalkyl group, and each alkyl, alkenyl, or heteroalkyl group is optionally R C Replaced by each R 25 R is independently hydrogen or alkyl, 24 It is either absent or is hydrogen or alkyl, and each R C is independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, m is an integer from 1 to 4 (including both ends), and u is 2 or 3.

[0213] In some embodiments, each R 23 These are independently alkyl (e.g., C2~C 32 Alkyl, C4~C 28 Alkyl, C8~C 24 Alkyl, C 12 ~C 22 Alkyl, or C 16 ~C 20 It is alkyl. In some embodiments, each R 23 These are independently alkenyls (for example, C2~C 32 Alkyl, C4~C 28 Alkenil, C8~C 24 Alkenil, C 12 ~C 22 Alkenyl, or C 16 ~C 20 In some embodiments, each R is an alkenyl. 23 These are independently heteroalkyl (e.g., C4~C)28 Heteroalkyl, C8~C 24 Heteroalkyl, C 12 ~C 22 Heteroalkyl, C 16 ~C 20 It is a heteroalkyl group. In some embodiments, each R 23 Independently, C 16 ~C 20 It is alkyl. In some embodiments, each R 23 Independently, C 17 It is alkyl. In some embodiments, each R 23 is independently heptadecyl. In some embodiments, each R 23 They are identical. In some embodiments, each R 23 They are different. In some embodiments, each R 23 R is chosen by choice. C It is replaced by R C These are independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl.

[0214] In some embodiments, R 25 One of them is hydrogen. In some embodiments, R 25 One of them is alkyl. In some embodiments, R 25 One of them is methyl. In some embodiments, each R 25 R is independently alkyl. In some embodiments, each R 25 is independently methyl. In some embodiments, each R 25 is independently methyl, and u is 2. In some embodiments, each R 25 is independently methyl, and u is 3.

[0215] In some embodiments, R 24 It does not exist, and the oxygen to which it is bound is negatively charged. In some embodiments, R 24 It is hydrogen.

[0216] In some embodiments, m is an integer between 1 and 10, 1 and 8, 1 and 6, or 1 and 4. In some embodiments, m is 1, 2, 3, or 4. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3.

[0217] In some embodiments, compositions are provided that include targeting moieties for both cationic ionized lipids and anionic phospholipids. In some embodiments, the anionic phospholipid is a composition of formula (VA).

[0218] [ka] [In the formula, a is 14 or 16, and z is an amide, glycol, or amidyl-alkyl-carboxylic acid moiety.] In some embodiments, Z is [ka] The formula is such that m is 2 or 3. In some embodiments, the anionic phospholipid targeting moiety is selected from the group consisting of DSPS (L isomer), DPPS (L isomer), DMPS (L isomer), DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-DSPE, and N-Suc-DSPE.

[0219] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the phospholipid is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). In some embodiments, the phospholipid is 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC). In some embodiments, the phospholipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0220] Uptake of phosphatidylserine LNP (as described herein, for example) comprises the following components: (i) ionized cationic lipids (ICLs) containing a C16 alkyl or C16 alkenyl group or a C18 alkyl or C18 alkenyl group at a concentration of about 1 mol% to about 95 mol% (or any value between these, e.g., about 20 mol% to about 80 mol%); (ii) phospholipids also containing a C16 or C18 alkyl or alkenyl group at a concentration of 0.1 mol% to about 20 mol% (or any value between these, e.g., about 2.5 mol% to about 10 mol%); (iii) about 1 mol% to about 95 mol% (or any value between these, e.g., about 20 mol% to about 80 mol%) (iv) Cholesterol at a concentration of %); (iv) Phosphatidylserine (PS) or phosphatidylglycerol (PG) added to the LNP lipid preparation at a concentration of about 0.5 mol% to about 20 mol%, about 2.5 mol% to about 10 mol%, about 4 mol% to about 8 mol%, or any value in between, of the total lipid content of the LNP; (v) One or more polyethylene glycol (PEG)-2000-containing lipids (e.g., DPG-PEG2000, DPPE-PEG2000, DMPE-PEG2000, DMG-PEG2000) at a concentration of about 0.1 mol% to about 5 mol% (any value in between, e.g., about 1 mol% to about 2.5 mol%). In one embodiment, the LNP comprises two of (i) to (v). In one embodiment, the LNP comprises three of (i) to (v). In one embodiment, the LNP comprises four of (i) to (v). In one embodiment, the LNP includes each of (i) to (v). In some embodiments, the LNP includes (i) and (ii). In some embodiments, the LNP includes (i) and (iii). In some embodiments, the LNP includes (i) and (v). In some embodiments, the LNP includes (ii) and (iii). In some embodiments, the LNP includes (ii) and (v). In some embodiments, the LNP includes (iii) and (iv). In some embodiments, the LNP includes (iii) and (v). In some embodiments, the LNP includes (i), (ii), and (iii). In some embodiments, the LNP includes (i), (ii), and (v).In some embodiments, the LNP includes (ii), (iii), and (v). In some embodiments, the LNP includes (ii), (iii), (iv), and (v). In one embodiment, the LNP consists of or essentially consists of four of (i) to (v). In one embodiment, the LNP consists of or essentially consists of each of (i) to (v). In some embodiments, the LNP consists of or essentially consists of (i) and (ii). In some embodiments, the LNP consists of or essentially consists of (i) and (iii). In some embodiments, the LNP consists of or essentially consists of (i) and (v). In some embodiments, the LNP consists of or essentially consists of (ii) and (iii). In some embodiments, the LNP includes (ii) and (v). In some embodiments, the LNP consists of or essentially consists of (iii) and (iv). In some embodiments, the LNP consists of or essentially consists of (iii) and (v). In some embodiments, the LNP consists of or is essentially derived from (i), (ii), and (iii). In some embodiments, the LNP consists of or is essentially derived from (i), (ii), and (v). In some embodiments, the LNP includes (ii), (iii), and (v). In some embodiments, the LNP consists of or is essentially derived from (ii), (iii), (iv), and (v).

[0221] LNP may contain phospholipids at a concentration of, for example, more than about 0.1 mol% of the total lipid content of LNP. In one embodiment, LNP contains phospholipids at concentrations of, for example, more than about 0.5 mol%, 1 mol%, 1.5 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 8 mol%, 10 mol%, 12 mol%, 15 mol%, 20 mol%, or more than about 50 mol% of the total lipid content of LNP. In one embodiment, LNP contains phospholipids at concentrations of about 1 mol%, 5 mol%, or more than about 10 mol%. In one embodiment, LNP contains phospholipids at concentrations of, for example, more than about 0.1 mol% to 50 mol% of the total lipid content of LNP. In one embodiment, LNP contains phospholipids at concentrations of approximately 0.5 mol% to approximately 40 mol%, approximately 1 mol% to approximately 30 mol%, approximately 5 mol% to approximately 25 mol%, approximately 10 mol% to approximately 20 mol%, approximately 10 mol% to approximately 15 mol%, or approximately 15 mol% to approximately 20 mol% of the total lipid content of LNP. In one embodiment, LNP contains phospholipids at concentrations of approximately 5 mol% to approximately 25 mol%. In one embodiment, LNP contains phospholipids at concentrations of approximately 10 mol% to approximately 20 mol%.

[0222] In one embodiment, the LNP comprises a sterol or ionized sterol molecule. The sterol is a lipid comprising a polycyclic structure and optionally hydroxyl or ether substituents, which may be natural or unnatural (e.g., synthetic sterol). The sterol may contain no double bonds, a single double bond, or multiple double bonds. The sterol may further contain alkyl, alkenyl, halo, ester, ketone, hydroxyl, amine, polyether, carbohydrate, or cyclic moiety. The sterol may further contain a bioreducible disulfide bond between the dialkylamino group and the polycyclic moiety of the molecule (see Table 2, compounds 35-38). An exemplary list of sterols includes cholesterol, dehydroergosterol, ergosterol, campesterol, β-sitosterol, stigmasterol, lanosterol, dihydrolanosterol, desmosterol, brassicasterol, lasosterol, thymosterol, 7-dehydrodesmosterol, avenasterol, campestanol, lupeol, and cycloartenol. In some embodiments, the sterol includes cholesterol, dehydroergosterol, ergosterol, campesterol, β-sitosterol, or stigmasterol. Additional sterols that may be included in the LNPs described herein are disclosed in Fahy, E. et al. (J. Lipid. Res. 46:839-862 (2005)).

[0223] Ionized sterols In some embodiments, LNP is given by formula (VI): [ka] The formula comprises a sterol having the structure or a pharmaceutically acceptable salt thereof, where R 26 is hydrogen, alkyl, heteroalkyl, or -C(O)R D And R 27 is hydrogen, alkyl, or -OR E And R D and R EEach of them is independently hydrogen, alkyl, alkenyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl, and each alkyl, alkenyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with alkyl, halo, or carbonyl, and each [ka] A single bond or a double bond is formed, and each carbon atom involved in the single or double bond is bonded to 0, 1, or 2 hydrogen atoms and has a valence.

[0224] In some embodiments, [ka] One of them is a single bond. In some embodiments, [ka] One of them is a double bond. In some embodiments, [ka] These two are single bonds. In some embodiments, [ka] These two are double bonds. In some embodiments, each [ka] It is a single bond. In some embodiments, each [ka] It is a double bond.

[0225] In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is dehydroergosterol. In some embodiments, the sterol is ergosterol. In some embodiments, the sterol is campesterol. In some embodiments, the sterol is β-sitosterol. In some embodiments, the sterol is stigmasterol. In some embodiments, the sterol is a corticosteroid (e.g., corticosterone, hydrocortisone, cortisone, or aldosterone).

[0226] In some embodiments, LNP is given by formula (VI-A): [ka] The formula comprises a sterol having the structure or a pharmaceutically acceptable salt thereof, where q is 3 or 4, and R3 is [ka] That is the case.

[0227] Another aspect of the present disclosure provides a composition comprising an anionic phospholipid of formula (VA) and a branched ionized lipid of formula (VIII).

[0228] [ka] [wherein d is 2, 3 or 4, e and f are independently 5, 6 or 7, Z1 and Z2 are independently -OC(O)- or -C(O)-O-, R 14 and R 15 Each of these can be independently linear or branched (C 10 ~C 20 )It is alkyl] In some aspects, R in equation VII 14 and R 15 These are, respectively, C 14 or C 16It is a branched alkyl group. In some embodiments, R 14 is C 11 It is a linear alkyl group, R 15 is C 14 or C 16 It is a branched alkyl group. In some embodiments, R in formula VII 14 C 11 It is a linear alkyl group, R 15 is C 14 or C 16 It is a linear alkyl group. In some embodiments, R in formula VII 14 and / or R 15 Each is independent of the others. [ka] And in the formula, g and h are independently 5, 6, or 7. In some embodiments, R in formula VII 14 and R 15 Each is independent of the others. [ka] In the formula, g and h are both the same and are 5, 6 or 7. In some embodiments, R in formula VII 14 is linear C 11 It is alkyl, and R in formula VII 15 teeth [ka] In the formula, g and h are both the same and are 5, 6, or 7.

[0229] In some embodiments, the ionized lipid may be a branched ionized lipid selected from ALC-0315 and SM-102.

[0230] [ka]

[0231] LNP may contain sterols at a concentration of, for example, more than about 0.1 mol% of the total lipid content of LNP. In one embodiment, LNP contains sterols at a concentration of, for example, more than about 0.5 mol%, 1 mol%, 5 mol%, 10 mol%, 15 mol%, 20 mol%, 25 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, 55 mol%, 60 mol%, 65 mol%, or more than about 70 mol% of the total lipid content of LNP. In one embodiment, LNP contains sterols at a concentration of more than about 10 mol%, 15 mol%, 20 mol%, or more than about 25 mol%. In one embodiment, LNP contains sterols at a concentration of, for example, more than about 1 mol% to 95 mol% of the total lipid content of LNP. In one embodiment, LNP contains sterols at concentrations of approximately 5 mol% to approximately 90 mol%, approximately 10 mol% to approximately 85 mol%, approximately 20 mol% to approximately 80 mol%, approximately 20 mol% to approximately 60 mol%, approximately 20 mol% to approximately 50 mol%, or approximately 20 mol% to approximately 40 mol% of the total lipid content of LNP. In one embodiment, LNP contains sterols at concentrations of approximately 20 mol% to approximately 50 mol%. In one embodiment, LNP contains sterols at concentrations of approximately 30 mol% to approximately 60 mol%.

[0232] In some embodiments, the LNP includes an alkylene glycol-containing lipid. The alkylene glycol-containing lipid is a lipid containing at least one alkylene glycol moiety, for example, a methylene glycol or an ethylene glycol moiety. In some embodiments, the alkylene glycol-containing lipid includes polyethylene glycol (PEG). The alkylene glycol-containing lipid may also be a PEG-containing lipid. Polymer complex lipids may include poly(ethylene glycol) conjugated (pegylated) phospholipids (PEG-lipids), such as PEG (molecular weight 2,000) methoxy-poly(ethylene glycol)-1,2-distearoyl-sn-glycerol (PEG-DSG), PEG (molecular weight 2,000) methoxy-poly(ethylene glycol)-1,2-palmitoyl-sn-glycerol (PEG-DPG), PEG (molecular weight 2,000) 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DSPE), or N-palmitoyl-sphingosine-1-{succinyl[methoxy(polyethylene glycol)2000]} (PEG-ceramide). The molecular weight of the PEG portion in the PEG-lipid component can also vary between 500 and 10,000 g / mol, and between 1,500 and 6,000 g / mol, but is preferably about 2,000 MW. Other polymers used for conjugation to lipid anchors may include poly(2-methyl-2-oxazoline) (PMOZ), poly(2-ethyl-2-oxazoline) (PEOZ), poly-N-vinylpyrrolidone (PVP), polyglycerol, poly(hydroxyethyl L-asparagine) (PHEA), and poly(hydroxyethyl L-glutamine) (PHEG).

[0233] The PEG-containing lipid may further contain amines, amides, esters, carboxyls, phosphates, choline, hydroxyls, acetals, ethers, heterocyclic compounds, or carbohydrates. The PEG-containing lipid may, for example, contain, in addition to the PEG moiety, at least one alkyl or alkenyl group having a length of more than six carbon atoms (e.g., a length of more than eight carbons, ten carbons, twelve carbons, fourteen carbons, sixteen carbons, eighteen carbons, or twenty or more carbon atoms). In one embodiment, the PEG-containing lipid contains a PEG moiety having at least 20 PEG monomers, for example, at least 30 PEG monomers, 40 PEG monomers, 45 PEG monomers, 50 PEG monomers, 100 PEG monomers, 200 PEG monomers, 300 PEG monomers, 500 PEG monomers, 1000 PEG monomers, or 2000 PEG monomers. Exemplary PEG-containing lipids include PEG-DMG (e.g., DMG-PEG2k), PEG-c-DMG, PEG-DSG, PEG-DPG, PEG-DSPE, PEG-DMPE, PEG-DPPE, PEG-DOPE, and PEG-DLPE. In some embodiments, the PEG-lipids include PEG-DMG (e.g., DMG-PEG2k), PEG-c-DMG, PEG-DSG, and PEG-DPG. Additional PEG-lipids that may be included in the LNPs described herein are disclosed in Fahy, E. et al. (J. Lipid. Res. 46:839-862 (2005)), which are incorporated herein by reference.

[0234] In some embodiments, LNP is given by formula (VII): [ka] The formula comprises an alkylene glycol-containing lipid having the structure or a pharmaceutically acceptable salt thereof, wherein each R 28 R is independently alkyl, alkenyl, or heteroalkyl, and each can be optionally selected. FSubstituted with, where A is absent or is O, CH2, C(O), or NH, and E is absent or is alkyl or heteroalkyl, and the alkyl or heteroalkyl is optionally substituted with a carbonyl, and each R F z is independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, and z is an integer between 10 and 200 (inclusive).

[0235] In some embodiments, each R 28 R is independently alkyl. In some embodiments, each R 28 In some embodiments, each R is a heteroalkyl. 28 It is, independently, an alkenil.

[0236] In some embodiments, A is O or NH. In some embodiments, A is CH2. In some embodiments, A is a carbonyl group. In some embodiments, A is absent.

[0237] In some embodiments, E is alkyl. In some embodiments, E is heteroalkyl. In some embodiments, both A and E are absent. In some embodiments, A is absent. In some embodiments, E is absent. In some embodiments, either A or E is absent. In some embodiments, both A and E are absent independently.

[0238] In some embodiments, z is an integer between 10 and 200 (e.g., 20 to 180, 20 to 160, 20 to 120, 20 to 100, 40 to 80, 40 to 60, 40 to 50). In some embodiments, z is 45.

[0239] In some embodiments, the PEG-lipid is PEG-DMG (e.g., DMG-PEG2k). In some embodiments, the PEG-lipid is α-(3'-{[1,2-di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polyoxyethylene (PEG-c-DMG). In some embodiments, the PEG-lipid is PEG-DSG. In some embodiments, the PEG-lipid is PEG-DPG.

[0240] LNP may contain, for example, alkylene glycol-containing lipids at a concentration of more than about 0.1 mol% of the total lipid content of LNP. In one embodiment, LNP contains alkylene glycol-containing lipids at concentrations of more than about 0.5 mol%, about 1 mol%, about 1.5 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 8 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 20 mol%, or about 50 mol% of the total lipid content of LNP. In one embodiment, LNP contains alkylene glycol-containing lipids at concentrations of more than about 1 mol%, about 4 mol%, or about 6 mol%. In one embodiment, LNP contains alkylene glycol-containing lipids at concentrations of more than about 0.1 mol% to about 50 mol% of the total lipid content of LNP. In one embodiment, the LNP contains alkylene glycol-containing lipids at concentrations of approximately 0.5 mol% to approximately 40 mol%, approximately 1 mol% to approximately 35 mol%, approximately 1.5 mol% to approximately 30 mol%, approximately 2 mol% to approximately 25 mol%, approximately 2.5 mol% to approximately 20 mol%, approximately 3 mol% to approximately 15 mol%, approximately 3.5 mol% to approximately 10 mol%, or approximately 4 mol% to approximately 9 mol% of the total lipid content of the LNP. In one embodiment, the LNP contains alkylene glycol-containing lipids at concentrations of approximately 4 mol% to 9 mol%.

[0241] In some embodiments, LNP comprises at least two types of lipids. In one embodiment, LNP comprises two of ionized lipids, phospholipids, sterols, and alkylene glycol-containing lipids. In some embodiments, LNP comprises at least three types of lipids. In one embodiment, LNP comprises three of ionized lipids, phospholipids, sterols, and alkylene glycol-containing lipids. In some embodiments, LNP comprises at least four types of lipids. In one embodiment, LNP comprises each of ionized lipids, phospholipids, sterols, and alkylene glycol-containing lipids.

[0242] LNP (for example, as described herein) may contain one or more of the following components: (i) ionized cationic lipids in a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); (ii) phospholipids in a concentration of 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%); (iii) sterols in a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); and (iv) PEG-containing lipids in a concentration of about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%). In one embodiment, LNP contains one of (i) to (iv). In one embodiment, LNP contains two of (i) to (iv). In one embodiment, LNP contains three of (i) to (iv). In one embodiment, LNP contains each of (i) to (iv). In some embodiments, the LNP includes (i) and (ii). In some embodiments, the LNP includes (i) and (iii). In some embodiments, the LNP includes (i) and (iv). In some embodiments, the LNP includes (ii) and (iii). In some embodiments, the LNP includes (ii) and (iv). In some embodiments, the LNP includes (iii) and (iv). In some embodiments, the LNP includes (i), (ii), and (iii). In some embodiments, the LNP includes (i), (ii), and (iv). In some embodiments, the LNP includes (ii), (iii), and (iv).

[0243] LNP (for example, as described herein) may contain one or more of the following components: (i) ionized cationic lipids in a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); (ii) DSPC in a concentration of 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%); (iii) cholesterol in a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); and (iv) DMG-PEG2k in a concentration of about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%). In one embodiment, LNP contains two of (i) to (iv). In one embodiment, LNP contains three of (i) to (iv). In one embodiment, LNP contains each of (i) to (iv). In some embodiments, LNP contains (i) and (ii). In some embodiments, the LNP includes (i) and (iii). In some embodiments, the LNP includes (i) and (iv). In some embodiments, the LNP includes (ii) and (iii). In some embodiments, the LNP includes (ii) and (iv). In some embodiments, the LNP includes (iii) and (iv). In some embodiments, the LNP includes (iii) and (iv). In some embodiments, the LNP includes (i), (ii) and (iii). In some embodiments, the LNP includes (i), (ii) and (iv). In some embodiments, the LNP includes (ii), (iii) and (iv).

[0244] In one embodiment, the LNP has an ionized lipid to phospholipid ratio of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3:2, or 1:1). In one embodiment, the LNP has an ionized lipid to phospholipid ratio of about 15:2. In one embodiment, the LNP has an ionized lipid to phospholipid ratio of about 5:1. In one embodiment, the LNP has an ionized lipid to sterol ratio of about 10:1 to about 1:10 (for example, 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP has a ratio of ionized lipids to alkylene-containing lipids of about 1:10 to about 10:1 (for example, 1:9, 1:8, 7:8, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP has a ratio of phospholipids to alkylene-containing lipids of about 10:1 to about 1:10 (for example, 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP has a sterol-to-alkylene-containing lipid ratio of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:1, 22:1, 20:1, 22:5, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3:2, or 1:1).

[0245] In one embodiment, the LNP (e.g., as described herein) comprises two of the following: ionized lipids, phospholipids, sterols, and alkylene glycol-containing lipids (e.g., PEG-containing lipids). In another embodiment, the LNP (e.g., as described herein) comprises three of the following: ionized lipids, phospholipids, sterols, and alkylene glycol-containing lipids (e.g., PEG-containing lipids). In one embodiment, the LNP (e.g., as described herein) comprises each of the following: ionized lipids, phospholipids, sterols, and alkylene glycol-containing lipids (e.g., PEG-containing lipids).

[0246] In some embodiments, the LNPs described herein have diameters of 5–500 nm, for example, 10–400 nm, 20–350 nm, 25–325 nm, 30–300 nm, 50–250 nm, 60–200 nm, 75–190 nm, 80–180 nm, 100–200 nm, 200–300 nm, and 150–250 nm. The diameter of the LNP can be determined by any method known in the art, for example, dynamic light scattering, transmission electron microscopy (TEM), or scanning electron microscopy (SEM). In some embodiments, the LNPs have diameters of 50–100 nm, 70–100 nm, and 80–100 nm. In one embodiment, the LNP has a diameter of about 90 nm. In some embodiments, the LNPs described herein have a diameter greater than about 30 nm. In some embodiments, the LNP has a diameter of approximately 35 nm, approximately 40 nm, approximately 45 nm, approximately 50 nm, approximately 60 nm, approximately 70 nm, approximately 80 nm, approximately 90 nm, approximately 100 nm, approximately 120 nm, approximately 140 nm, approximately 160 nm, approximately 180 nm, approximately 200 nm, approximately 225 nm, approximately 250 nm, approximately 275 nm, or greater than approximately 300 nm. In one embodiment, the LNP has a diameter greater than approximately 70 nm. In one embodiment, the LNP has a diameter greater than approximately 90 nm. In one embodiment, the LNP has a diameter greater than approximately 180 nm.

[0247] In some embodiments, the LNPs described herein have an average diameter in the range of about 40 nm to about 180 nm. In some embodiments, the LNPs described herein have an average diameter of about 50 nm to about 150 nm. In some embodiments, the LNPs described herein have an average diameter of about 50 nm to about 120 nm. In some embodiments, the LNPs described herein have an average diameter of about 60 nm to about 120 nm. In some embodiments, the LNPs have average diameters of about 40 nm, about 45 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 120 nm, about 140 nm, about 160 nm, and about 180 nm.

[0248] In some embodiments, one or more nanoparticles described herein have a neutral to negative surface charge on average of less than -100mV, for example, less than -90mV, -80mV, -70mV, -60mV, -50mV, -40mV, -30mV, and less than -20mV. In some embodiments, one or more nanoparticles have a neutral to negative surface charge of -100mV to 100mV, -75mV to 0, or -50mV to -10mV.

[0249] In some embodiments, at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the nanoparticles have a neutral to negative surface charge on average of less than -100mv. In some embodiments, one or more nanoparticles have an average surface charge of -20mv to +20, -10mv to +10mv, or -5mv to +5mv at pH 7.4. Neutral-charged LNPs have improved pharmacokinetic and biological performance compared to cationic LNPs.

[0250] Generation of lipid nanoparticles (LNPs) A method for producing LNPs may include mixing a first solution with a second solution. Mixing can be achieved using standard solution mixing techniques such as propeller mixing, vortexing of the solutions, or preferably by microfluidic mixing or highly efficient T-mixing. In some embodiments, the first solution contains one or more lipids and nucleic acids, all of which are solubilized in a water / solvent system. The solvent may be any water-miscible solvent (e.g., ethanol, methanol, isopropanol, acetonitrile, dimethylformamide, dimethyl sulfoxide, dioxane, or tetrahydrofuran). In some embodiments, the first solution contains a small proportion of water or pH-buffered water. The first solution may contain at least 60% by volume of water, for example, at least about 0.05% by volume, 0.1% by volume, 0.5% by volume, 1% by volume, 2% by volume, 3% by volume, 4% by volume, 5% by volume, 10% by volume, 15% by volume, 20% by volume, 25% by volume, 30% by volume, 35% by volume, 40% by volume, 45% by volume, 50% by volume, 55% by volume, or 60% by volume. In one embodiment, the first solution contains about 0.05% to 60% by volume of water, for example, about 0.05% to 50% by volume, about 0.05% to 40% by volume, or about 5% to 20% by volume of water.

[0251] In some embodiments, the first solution comprises a single type of lipid, such as an ionized lipid, phospholipid, sterol, or PEG-containing lipid. In some embodiments, the first solution comprises multiple lipids. In some embodiments, the multiple lipids comprise ionized lipids, phospholipids, sterols, or PEG-containing lipids. In some embodiments, the multiple lipids comprise cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene 2000 (DMG-PEG2k) or α-(3'-{[1,2-di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polyoxyethylene (PEG2000-C-DMG), and ionized lipids. The multiple lipids may be present in any ratio. In one embodiment, the plurality of lipids comprises ionized lipids or sterols, phospholipids, sterols, PEG-containing lipids of the above lipids, or combinations thereof in a specific ratio (for example, the ratio described herein).

[0252] In some embodiments, the second solution is water. In some embodiments, the second solution is an aqueous buffer with a pH of 3 to 6 (e.g., pH of about 3, about 4, about 5, or about 6). The second solution may contain a loading component, such as nucleic acid (e.g., mRNA). The second solution may contain a small proportion of a water-miscible organic solvent. The second solution may contain at least one water-miscible organic solvent up to at least 60% by volume, for example, at least about 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or any volume percentage in between. In one embodiment, the second solution contains about 0.05% to 60% by volume of an organic solvent, for example, about 0.05% to 50% by volume, about 0.05% to 40% by volume, or about 5% to 20% by volume of an organic solvent (e.g., a water-miscible organic solvent). The aqueous buffer solution may be an aqueous solution of citrate buffer. In some embodiments, the aqueous buffer solution is a citrate buffer with a pH of 4 to 6 (e.g., pH of about 4, about 5, or about 6). In one embodiment, the aqueous buffer solution is a citrate buffer with a pH of about 6.

[0253] In some embodiments, the solution containing a mixture of the first and second solutions, which include the LNP suspension, may be diluted. In some embodiments, the pH of the solution containing the mixture of the first and second solutions, which include the LNP suspension, can be adjusted. Dilution of the LNP suspension or adjustment of the pH can be achieved by adding water, acid, base, or aqueous buffer. In some embodiments, the LNP suspension is not diluted or its pH is not adjusted. In some embodiments, both dilution of the LNP suspension and adjustment of the pH are performed.

[0254] In some embodiments, tangential flow filtration (TFF) (e.g., hemodiafiltration) can be used to remove excess reagents, solvents, and unencapsulated nucleic acids from the LNP suspension. Organic solvents (e.g., ethanol) and buffers can also be removed from the LNP suspension by TFF. In some embodiments, the LNP suspension undergoes dialysis but not TFF. In some embodiments, the LNP suspension undergoes TFF but not dialysis. In some embodiments, the LNP suspension undergoes both dialysis and TFF.

[0255] In one embodiment, the Disclosure is characterized by a method comprising treating an LNP sample containing nucleic acids with a fluid containing a detergent (e.g., Triton X-100, or an anionic detergent (but not limited to sodium dodecyl sulfate (SDS)), or a nonionic detergent (but not limited to β-octyl glucoside), or an amphoteric detergent 3-14) for a period of time suitable for releasing encapsulated and / or encapsulated nucleic acids by degrading the lipid layer. In one embodiment, the method further comprises analyzing the sample for the amount of nucleic acids present, absent, and / or released.

[0256] LNP containing ligand Some aspects of this disclosure relate to LNPs comprising a ligand (also referred to herein as a target ligand) having binding specificity to a cell surface antigen, wherein the binding of the ligand to the antigen induces the internalization of the ligand. Some embodiments relate to compositions comprising LNPs comprising the ligand described herein.

[0257] In some embodiments, the target ligand is coupled to a lipid complex. For example, the lipid complex may be a hydrophilic polymer lipid complex such as PEG(2000)-DSPE or PEG(2000)-DSG, but is not limited to these. Coupling can be achieved by various chemicals known in the art (see, e.g., Bioconjugates Techniques (Greg T. Hermanson), 3rd Edition, 2013, Elsevier). In some embodiments, the target ligand is coupled to the lipid complex by a linker. The linker molecule generally contains a hydrophilic polymer chain, such as a lipid domain (phospholipid or sterol) linked to a PEG terminator, and contains a thiol-reactive functional group such as maleimide at the terminator. Linkers containing phosphatidylethanolamine (PE) lipid anchors of various sizes and hydrocarbon chain lengths, and PEG spacers with terminal maleimide or iodoacetate groups are currently commercially available from Avanti Polar Lipids (Alabama, USA) and NOF Corporation (Japan). One commonly used strategy involves coupling the protein to a thiol-reactive lipopolymer linker such as 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000](Mal-PEG-DSPE). Preferably, the protein of interest is manipulated to contain one cysteine ​​at its C-terminus to ensure point conjugation. Alternatively, F(ab)2 or Fab' can be enzymatically produced from IgG by reduction of the disulfide bond using a reducing agent such as dithiothreitol (DTT), mercaptoethylamine, or (tris(2-carboxyethyl)phosphine)TCEP-HCl, which are reactive to the cysteine ​​thiol group for coupling to Mal-PEG-DSPE. The reaction of Mal-PEG-DSPE by reduction of cysteine ​​occurs in an aqueous buffer at pH 5.5 to 7.5, e.g., pH 5.5, 6, 6.5, 7, 7.5, preferably pH 6.0. The reaction typically completes within four hours.A small amount of cysteine ​​or mercaptoethanol is added to react with the unreacted maleimide group and deactivate the coupling reaction. While it is not necessary to remove the non-conjugated protein prior to the subsequent intramembrane insertion step, purifying the complex for storage purposes and enabling more precise characterization is useful. Due to the large size of the lipopolymer micelles (isomolecular weight 850 kDa, Nellis et al., 2005a), size exclusion chromatography (SEC) is a convenient method. Characterization of such protein complexes is achieved by various techniques. For example, purity is determined by SEC, molecular weight by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), protein melting point by differential scanning calorimetry (DSC), isoelectric point by capillary electrophoresis, and target binding affinity is quantified by surface plasmon resonance (BIAcore) and biolayer interferometry (ForteBio).

[0258] Examples of target ligands may include antibodies or antibody fragments against cell surface receptors, including Her2 receptor, epidermal growth factor receptor (EGFR), ephrin A2 receptor, CLEC9A receptor, DEC205 receptor, CLEC4A receptor, XCR1 receptor, CD141 receptor, HLA-DR receptor, transferrin receptor type 1, transferrin receptor type 2, VEGF receptor, PDGF receptor, integrin, NGF receptor, CD19, CD20, CD22, CD33, CD43, CD38, CD56, CD69, prostate-specific membrane antigen (PSMA), or various other cell surface receptors, or glycolipids such as complex carbohydrates, proteoglycans, glycoproteins, and complex carbohydrate N-acetylgalactosamine (GalNAc) ligands that bind to asialoglycoprotein receptor (ASGPR), or small molecule complexes such as folate PEG-DSPE that target folate receptors.

[0259] In one embodiment, the target ligand is an anti-DEC205 antibody. DEC205 (CD205) is a type I cell surface protein primarily expressed by dendritic cells (DCs). It is found in finger-implanting DCs within the T cell region of lymphoid tissue, bone marrow-derived DCs, Langerhans cells, and at low levels on macrophages and T cells, and is significantly upregulated during DC maturation. DEC-205 expression is positively correlated with CD8a expression, both of which are found at high levels on lymphoid DCs and at low levels on bone marrow DCs. DEC-205 is also expressed at moderate levels by B cells and is upregulated during pre-B cell to B cell transition. Recombinant anti-human DEC205 antibodies are commercially available from Creative Biolabs.

[0260] In one embodiment, antigen-specific targeting on LNPs is achieved by co-incubating LNPs with a target ligand-lipid complex to prepare ligand-targeted LNPs. The target ligand-lipid complex may be prepared before preparing the LNPs (see Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):205-20).

[0261] In one embodiment, LNPs are co-incubated with an antibody or fragment-PEG-phospholipid micelle or other ligand complex and heated overnight at 37°C to promote insertion of the antibody complex into the outer membrane of the LNP (Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):221-32). In another embodiment, insertion can be achieved by heating for a shorter time and with increasing temperature, for example, 0.5 to 8 hours at 37°C, or preferably 0.5 to 2 hours at 37°C. Micelle insertion can be stopped by rapidly lowering the temperature by placing the LNPs on ice (they can then be stored in a refrigerator at 4°C). The total amount of lipid complex added may be 0.02% to 2% of the total lipids, or preferably 0.1% to 1%, or preferably 0.1% to 0.5%. The uptake efficiency of antibody-lipid complexes can be measured by SDS-PAGE after LNP dissociation with SDS or other washing agents (compared to a standard curve for the same protein) (Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):205-20). The uptake efficiency of other target ligands can be measured by ultra-high performance liquid chromatography-electrolytic chromatography (UPLC-ELSD) equipped with an evaporative light scattering detector (Gauthier et al., J Mol Sci. 2019 Nov 12;20(22):5669).

[0262] Figure 2 shows the reaction between the reduced C-terminal cysteine ​​of the Fab' antibody fragment and maleimide-terminated poly(ethylene glycol) 2000-derivativeized distearoylphosphatidylethanolamine. R1 and R2 are stearic acid. The final antibody lipopolymer complex is an intermediate that is subsequently inserted into the outer lipid layer of lipid nanoparticles for active targeting.

[0263] LNP targeting can also be achieved by adding lipids to formulations. For example, phosphatidylserine is known to be redistributed to the outer surface of the plasma membrane during apoptosis and is a molecular stimulus for phagocytic cell attraction (Fadok et al. Curr Biol. 2003 Aug 19;13(16):R655-7). Phosphatidylserine (PS) and phosphatidylglycerol (PG) are recognized by dendritic cells and can induce dendritic cell uptake and activation. LNP targeting can also be achieved by adding specific anionic phospholipids to formulations (Table 3). For example, phosphatidylserine is known to be redistributed to the outer surface of the plasma membrane during apoptosis and is a molecular stimulus for phagocytic cell attraction (Fadok et al. Curr Biol. 2003 Aug 19;13(16):R655-7). Phosphatidylserine (PS) and phosphatidylglycerol (PG) can be recognized by dendritic cells and can induce their uptake and activation (Caronni et al., Nat Comm. 2021 April 14;12:2237-2253; Ischihashi et al., PLOS One 2013). Although anionic phospholipids have been previously used in the context of liposomes, their inclusion in lipid nanoparticles containing condensed nucleic acids is unexpected because the anionic head group may compete with the phosphate backbone of mRNA for the binding site of the ionized cationic lipid, may inhibit intracellular escape by altering the surface charge, or may lead to aggregation of LNPs during formation or storage.

[0264] JPEG0007848206000147.jpg195170

[0265] In one embodiment, the anionic target ligand is selected from the group consisting of phosphatidylserine (PS), phosphatidylglycerol (PG), N-glutaryl-phosphatidylethanolamine (N-glu-PE), or N-succinyl-phosphatidylethanolamine (N-Suc-PE). In one embodiment, the anionic phospholipid used is phosphatidylserine. In another embodiment, phosphatidylserine contains the L isomer of serine. In another embodiment, the acyl chain of phosphatidylserine is fully saturated, such as in the case of dimyristoylphosphatidyl-L-serine (DMPS), dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS). In a preferred embodiment, the PS used is the L isomer of either DPPS or DSPS. Phosphatidylserine may also contain asymmetric acyl chain compositions, such as one acyl chain being stearic acid and the other being palmitic acid.

[0266] In one embodiment, PS or PG is added to the LNP lipid preparation at concentrations of approximately 0.1 mol% to approximately 20 mol%, approximately 0.1 mol% to approximately 10 mol%, approximately 0.1 mol% to approximately 5 mol%, approximately 0.5 mol% to approximately 20 mol%, approximately 0.5 mol% to approximately 10 mol%, approximately 0.5 mol% to approximately 5 mol%, approximately 1 mol% to approximately 20 mol%, approximately 1 mol% to approximately 10 mol%, or approximately 1 mol% to approximately 5 mol% of the total lipid content of LNP. In another embodiment, PS is added to the LNP lipid preparation at concentrations of approximately 1 mol% to approximately 20 mol%, approximately 2.5 mol% to approximately 10 mol%, approximately 3 mol% to approximately 9 mol%, or approximately 4 mol% to approximately 8 mol% of the total lipid content of LNP.

[0267] In one embodiment, the PS lipid is included in an LNP composition containing ionized cationic lipids known in the art, including DODAP, AKG-OA-DM2, O-11769, DLin-MC3-DMA, DLin-KC2-DMA, DLin-KC3-DMA, ALC-0315, and SM-102.

[0268] In another embodiment, the PS lipid is included in an LNP composition comprising ICL of formulas I, II, and III, combinations thereof, or pharmaceutically acceptable salts thereof. In yet another embodiment, the PS lipid is included in an LNP composition using an N / P ratio of 3-8, 4-7, or 5-6.

[0269] In some embodiments, the present invention provides a method for delivering nucleic acids to cells, comprising contacting the cells with a composition comprising a ligand (hereinafter also called a target ligand) having binding specificity to a cell surface antigen, wherein the binding of the ligand to the antigen induces the internalization of the ligand. In some embodiments, the target ligand may be, but is not limited to, an internalizing antibody or its fragment, a small molecule complex, or a complex carbohydrate. In some embodiments, the binding of the target ligand to a specific cell surface antigen induces the internalization of the LNP, and when contacted with and incubated with cells under internalization conditions, the cell-bound target ligand expresses at least 100,000 or at least 1,000,000 antigen molecules.

[0270] JPEG0007848206000148.jpg212170

[0271] JPEG0007848206000149.jpg78170

[0272] composition In some embodiments, the lipid nanoparticle composition comprises lipids and nucleic acids, wherein the lipid nanoparticles comprise compounds of formulas I, II, and III, combinations thereof, or pharmaceutically acceptable salts thereof.

[0273] In some embodiments, the LNP comprises an ionized lipid having the structure of formula (IV).

[0274] In some embodiments, the composition further comprises a pharmaceutical excipient.

[0275] In some embodiments, the lipid nanoparticles are in an aqueous medium.

[0276] In some embodiments, nucleic acids are encapsulated in lipid nanoparticles with compounds of formulas I, II, III, and IV, or combinations thereof, and the nucleic acids are either RNA or DNA. In some embodiments, the nucleic acids are mRNA. In some embodiments, the nucleic acids are siRNA. In some embodiments, the nucleic acids are DNA.

[0277] In some embodiments, the lipid nanoparticles comprise a membrane containing phosphatidylcholine and sterols. In some embodiments, the sterols are cholesterol. In some embodiments, the lipid nanoparticles comprise a membrane containing phosphatidylcholine and ionized cationic lipids (ICLs). In some embodiments, the ICLs have the structure of formula I, II, III, or IV and cholesterol, and the membrane separates the interior of the lipid nanoparticles from the aqueous medium. In some embodiments, the ICLs have the structures shown in Tables 1A and 2. In some embodiments, the ICLs have the structures shown in Table 1B. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine (DSPC) or hydrogenated soybean phosphatidylcholine (HSPC). In some embodiments, the molar ratio of ionized cationic lipids to cholesterol is about 65:35 to 40:60. In some embodiments, the molar ratio of ICLs to cholesterol is about 60:40 to 45:55.

[0278] In some embodiments, the molar ratio of phosphatidylcholine to cholesterol is approximately 1:5 to approximately 1:2.

[0279] In some embodiments, the film further comprises polymer composite lipids.

[0280] In some embodiments, the lipid nanoparticles contain ICL, DSPC, cholesterol, and polymer complex lipids in a molar ratio of approximately 49.5:10.3:39.6:2.5.

[0281] In some embodiments, the polymer complex lipid is PEG(2000)-dimiristoylglycerol (PEG-DMG) or PEG(molecular weight 2000)-dimiristoylphosphatidylethanolamine (PEG-DMPE).

[0282] The compositions of this disclosure may be administered by various routes, for example, intravenously, parenterally, intraperitoneally, or via local routes for systemic delivery. The compositions may be administered to a subject intravenously, subcutaneously, or intraperitoneally. In some embodiments, this disclosure provides methods for in vivo delivery of nucleic acids to a subject.

[0283] In some embodiments, the composition is a liquid pharmaceutical formulation for oral administration.

[0284] In some embodiments, the composition is a liquid pharmaceutical formulation for subcutaneous, intramuscular, or intradermal administration.

[0285] In some embodiments, the composition is in the form of a lyophilized powder, which is subsequently reconstituted in an aqueous medium before administration.

[0286] How to use Targeting of dendritic cells Dendritic cells (DCs) are specialized antigen-presenting cells that play a central role in initiating and regulating adaptive immunity. Due to their powerful antigen (Ag)-presenting ability and their capacity to generate unique T-cell responses, efficient and specific delivery of Ag to DCs is the basis for generating Ag-specific effectors and memory cells against tumors or pathogens.

[0287] Dendritic cells can be generated from human blood monocytes by differentiating monocyte-derived DCs in vitro with the addition of granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-4, and IFN-gamma. Cells in culture exhibit both dendritic and veil-like forms, with the former being attached and the latter suspended. Phenotypically, these are CD1a- / dim, CD11a+, CD11b++, CD11c+, CD14dim / -, CD16a- / dim, CD18+, CD32dim / -, CD33+, CD40+, CD45R0+, CD50+, CD54+, CD64- / dim, CD68+, CD71+, CD80dim, CD86+ / ++, MHC class I++ / , HLA-DR++ / , HLA-DP+, and HLA-DQ (Geiseler et al. Dev Immunol. 1998;6(1-2):25-39).

[0288] Alternatively, a primary human hematopoietic cell line has been developed and is commercially available from Creative Biolabs.

[0289] CD8+ T cells can produce cytokines IL2, IFN-γ, and TNF, which are known to play important roles during Mycobacterium tuberculosis infection. Importantly, CD8+ T cells have Fas-Fas ligand interactions to induce cytolytic function or apoptosis to kill Mycobacterium tuberculosis-infected cells via granule-mediated function (via perforin, granzyme, and granulysin). In humans, CD8+ T cells can produce granulysin, which can directly kill Mycobacterium tuberculosis. Therefore, it is expected that antigen-generating mRNA LNPs delivered to DCs will stimulate a CD8+ T cell response to fight Mycobacterium tuberculosis infection.

[0290] CD8+ T cells can recognize tuberculosis (M. tuberculosis)-specific antigens (as peptides) presented by classical and non-classical MHC molecules. Classically restricted CD8+ T cells have been identified that recognize antigens presented by antigen-presenting cells in the context of classical MHC Ia (HLA-A, B, C) molecules. Non-classically restricted CD8+ T cells include CD8+ T cells that can recognize Mg antigens in the context of MHC I-related molecules (MR1), such as HLA-E molecules (non-MHC Ia), glycolipids associated with group 1 CD1 molecules, and mucosal-related invariant T cells (MAITs). Finally, γδ T cells represent a separate population of CD8 (and CD4) T cells that possess both innate and adaptive functions in response to Mycobacterium tuberculosis infection. While CD8+ T cells have been shown to function directly in response to Mycobacterium tuberculosis infection, they also play a crucial role in modulating many different functions in the overall host immune response, such as interactions to provide optimal CD4 T cell function.

[0291] In one embodiment, LNP may be added to cultured human dendritic cells at an appropriate concentration (e.g., 1-5 μg / mL mRNA). After some time has elapsed for cell uptake and antigen expression, human T cells (HemaCare) can be added, and the cell culture medium can be sampled at various time points for INF-γ using Elisa (R&D Systems, DIF50C). Alternatively, the cells can be analyzed by flow cytometry for the CD8+ marker or intracellular INFγ production (PE anti-human IFN-γ antibody, Biolegend).

[0292] In one embodiment, LNP can be administered to a subject at a dose of 0.01 to 5 mg / kg mRNA via any of the administration routes summarized above. According to some embodiments, a certain proportion of LNP is taken up by DC cells, but most accumulate in the liver and spleen. DC cells can express antigen peptides, process them for MHC I presentation, and migrate to lymph nodes to present them to naive T cells, inducing the education of memory T cells against the antigen.

[0293] In one embodiment, LNPs modified with a target ligand such as anti-DEC205-PEG-DSPE can be administered to subjects at doses of 0.01 to 5 mg / kg mRNA. According to several embodiments, a higher proportion of LNPs may be taken up by DC cells, increasing antigen peptide production compared to untargeted LNPs and enabling more effective vaccination against pathogens. Additional target ligands for dendritic cells include, but are not limited to, CLEC9A, CLEC4A, XCR1, CD141, and HLD-DR. For example, evaluation of CD8+ reactivity to antigens generated in vivo can be achieved by measuring INFγ plasma concentrations using species-specific IFN-gamma Quantikine ELISA Kits (R&D Systems).

[0294] In some embodiments, the LNP composition provides desired pharmacokinetic properties such as an extended blood concentration half-life and stable mRNA encapsulation. The blood concentration half-life can be measured as the percentage of the injected volume (ID) remaining in the blood 6 or 24 hours after intravenous injection into immunocompetent mice. The stability of mRNA encapsulation in plasma over 24 hours can be determined by the change in the mRNA-to-lipid ratio (mRNA / L ratio) after intravenous administration to mice. In some embodiments, the percentage of encapsulated mRNA remaining in the blood is more than 20%, preferably more than 30%, and most preferably more than 40% of the injected volume at 6 hours. The percentage retained in the blood after 24 hours is preferably more than 10%, more preferably more than 20%, of the injected volume.

[0295] This specification discloses methods for preventing mycobacterial infections such as Mycobacterium tuberculosis, or Gram-positive bacteria such as methicillin-resistant Staphylococcus aureus (MRSA). Additional mycobacteria and Gram-positive bacteria include, but are not limited to, Mycobacterium avium complex, Mycobacterium leprae, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium mucogenicum, streptococci, vancomycin-resistant enterococci (VRE), Staphylococcus pneumoniae, Enterococcus faecium, Streptococcus agalactiae, and Streptococcus pneumoniae. This includes *Streptococcus pneumoniae*, *Streptococcus pyogenes* (pyogenic streptococci), *Streptococcus viridans* group, *Listeria monocytogenes*, *Nocardia*, and *Corynebacterium*.

[0296] Administration of a vaccine to induce a second immune response may result in an MHC class II-presenting epitope that can induce a CD4+ helper T cell response against cells expressing an antigen that induces an MHC-presenting epitope. Alternatively, or in addition, administration of a vaccine to induce a second immune response may result in an MHC class I-presenting epitope that can induce a CD8+ T cell response against cells expressing an antigen that induces an MHC-presenting epitope. Furthermore, administration of a vaccine to induce a second immune response may result in one or more epitopes that do not contain one or more neo-epitopes (including known neo-epitopes) and cancer-specific somatic mutations but are expressed by cancer cells, and which preferably induce an immune response against cancer cells, preferably a cancer-specific immune response. In one embodiment, administration of a vaccine to induce a second immune response results in a neo-epitope that is an MHC class II presenting epitope and / or can induce a CD4+ helper T cell response against cells expressing an antigen that induces an MHC presenting epitope, and an epitope that is an MHC class I presenting epitope and / or does not contain cancer-specific somatic mutations and can induce a CD8+ T cell response against cells expressing an antigen that induces an MHC presenting epitope. In one embodiment, the epitope does not contain cancer-specific somatic mutations.

[0297] The terms “cellular immune response,” “cellular response,” “cellular response to antigen,” or synonyms mean a cellular response directed to cells characterized by the presentation of an antigen having class I or class II MHC. The cellular response relates to cells called T cells or T lymphocytes that act as either “helper cells” or “killer cells.” Helper T cells (also referred to as CD4+ T cells) play a central role by modulating the immune response, while killer cells (also referred to as cytotoxic T cells, cytolytic T cells, CD8+ T cells, or CTLSs) kill abnormal cells such as cancer cells and prevent the production of more abnormal cells. In a preferred embodiment, the disclosure requires stimulation of an anti-tuberculosis CTL response to Mycobacterium that expresses one or more expressed antigens, preferably having class I MHC, and presents the expressed antigen.

[0298] As used herein, “antigen” encompasses any substance that induces an immune response. In particular, “antigen” refers to any substance, preferably a peptide or protein, that specifically reacts with an antibody or T lymphocyte (T cell). As used herein, the term “antigen” includes any molecule comprising at least one epitope. Preferably, in the context of this disclosure, an antigen is, optionally, a molecule that induces an immune response (including a cell expressing the antigen), preferably antigen-specific after processing. According to this disclosure, any suitable antigen that is a candidate for an immune response (preferably a cellular immune response) may be used. In the context of embodiments of this disclosure, the antigen is preferably presented by a cell, preferably by an antigen-presenting cell, including abnormal cells, particularly cancer cells, and in the context of MHC molecules, an immune response to the antigen occurs. The antigen is preferably a product corresponding to or derived from a natural antigen. Such natural antigens may include tumor antigens.

[0299] As used herein, “antigen peptide” refers to a portion or fragment of an antigen that can stimulate an immune response, preferably a cellular response, to an antigen or cell characterized by the expression of the antigen, preferably by the presentation of the antigen, such as abnormal cells, particularly cancer cells. Preferably, the antigen peptide can stimulate a cellular response to cells characterized by the presentation of an antigen having class I MHC, preferably by stimulating antigen-responsive cytotoxic T lymphocytes (CTLs). Preferably, the antigen peptide according to this disclosure is an MHC class I and / or class II presenting peptide, or can be processed to produce an MHC class I and / or class II presenting peptide. Preferably, the antigen peptide comprises an amino acid sequence substantially corresponding to the amino acid sequence of the antigen fragment. Preferably, the antigen fragment is an MHC class I and / or class II presenting peptide. Preferably, the antigen peptide according to this disclosure comprises an amino acid sequence substantially corresponding to the amino acid sequence of the fragment and is processed to produce an MHC class I and / or class II presenting peptide derived from the fragment, i.e., the antigen. When the peptide is presented directly, i.e., without processing and especially without cleavage, it has a length suitable for binding to MHC molecules, particularly class I MHC molecules, preferably a length of 7 to 20 amino acids, more preferably a length of 7 to 12 amino acids, more preferably a length of 8 to 11 amino acids, and especially a length of 9 or 10 amino acids.

[0300] The primary types of specialized antigen-presenting cells are dendritic cells, which have the broadest range of antigen presentation, and perhaps the most important antigen-presenting cells, macrophages, B cells, and certain activated epithelial cells. Dendritic cells (DCs) are a population of leukocytes that present antigens to T cells via the MHC class II and I antigen presentation pathways, which are then captured in peripheral tissues. Dendritic cells are potent triggers of the immune response, and it is well known that the activation of these cells is a crucial step in inducing antitumor immunity. For convenience, dendritic cells are classified into “immature” and “mature” cells, which can be used as a simple way to distinguish between two well-characterized phenotypes.

[0301] However, this nomenclature should not be interpreted as excluding all possible intermediate stages of differentiation. Immature dendritic cells are characterized as antigen-presenting cells with high antigen uptake and processing capabilities, correlated with high expression of Fcγ receptors and mannose receptors. The phenotype of maturation is typically characterized by low expression of these markers, while high expression of cell surface molecules is involved in T cell activation, including class I and class II MHCs, adhesion molecules (e.g., CD54 and CD11), and costimulatory molecules (e.g., CD40, CD80, CD86, and 4-1BB). Dendritic cell maturation is referred to as a state of dendritic cell activation, where presentation by immature dendritic cells results in tolerability, whereas antigen-presenting dendritic cells lead to T cell priming. Dendritic cell maturation is primarily triggered by biomolecules with microbial characteristics, detected by innate receptors (bacterial DNA, viral RNA, endotoxins, etc.), inflammatory cytokines (TNF, IL-1, IFN), the ligation reaction of CD40 on the dendritic cell surface by CD40L, and substances released from cells undergoing stress-induced cell death. Dendritic cells can be induced in vitro by culturing myeloid cells with cytokines such as granulocyte-macrophage colony-stimulating factor (GM CSF) and tumor necrosis factor alpha. Non-specialized antigen-presenting cells do not constitutively express MHC class II proteins required for interaction with naive T cells; these are expressed only in response to stimulation of non-specialized antigen-presenting cells by specific cytokines such as IFNγ. "Antigen-presenting cells" can carry MHC class I-presenting peptides by transduction into cells with nucleic acids, preferably mRNA, that encode peptides or polypeptides containing the peptide to be presented, such as nucleic acids encoding the antigen.

[0302] In some embodiments, a pharmaceutical composition comprising a gene delivery vehicle that targets dendritic cells or other antigen-presenting cells can be administered to a patient to result in transfection occurring in vivo. As used herein, “nucleic acid” is deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), more preferably RNA, most preferably in vitro transcribed RNA (IVT RNA) or synthetic RNA. Nucleic acid, according to this disclosure, includes genomic DNA, cDNA, mRNA, molecules produced by recombinant techniques, and chemically synthesized molecules. According to this disclosure, nucleic acid may exist as single-stranded or double-stranded linear or covalently closed cyclic molecules. Nucleic acid can be isolated according to this disclosure. The term “isolated nucleic acid” according to this disclosure means that nucleic acid is (i) amplified in vitro, for example, via polymerase chain reaction (PCR), (ii) produced by recombinant techniques by cloning, (iii) purified, for example, by cleavage and separation by gel electrophoresis, or (iv) synthesized, for example, by chemical synthesis. Nucleic acids can be used for cell introduction, i.e., cell transfection, particularly in the form of RNA which can be prepared by in vitro transcription from a DNA template. Furthermore, RNA can be modified before application by sequence stabilization, capping, and polyadenylation.

[0303] As used herein, the term “RNA” refers to a molecule containing, preferably entirely or substantially composed of, ribonucleotide residues. “Ribonucleotide” refers to a nucleotide having a hydroxyl group at the 2' position of a BD-ribofuranosyl group. The term “RNA” includes double-stranded RNA, single-stranded RNA, isolated RNA (such as partially or entirely purified RNA), essentially pure RNA, synthetic RNA, and RNA produced by recombinant techniques (such as modified RNA that differs from natural RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides). Such alterations may include the addition of non-nucleotide material, for example, at the terminal or within the RNA, or at one or more nucleotides of the RNA. Nucleotides in an RNA molecule may also include non-natural nucleotides or non-standard nucleotides such as chemically synthesized nucleotides or deoxyribonucleotides. These modified RNAs may be referred to as analogs or analogs of natural RNA.

[0304] As used herein, the term “RNA” includes and, more preferably, relates to “mRNA.” The term “mRNA” means “messenger RNA” and, with respect to a “transcript” produced using a DNA template, encodes a peptide or polypeptide. Typically, mRNA includes a 5'-UTR, a protein-coding region, and a 3'-UTR. mRNA has only a limited half-life intracellular and in vitro. In the context of this disclosure, mRNA may be produced by in vitro transcription from a DNA template. In the context of RNA as used herein, the term “modification” includes any modification of RNA that is not naturally present in the RNA. In one embodiment of this disclosure, the RNA used in accordance with this disclosure does not have uncapped 5'-triphosphates. Removal of such uncapped 5'-triphosphates may be achieved by treating the RNA with a phosphatase. The RNA according to this disclosure may have modified ribonucleotides for improved stability and / or reduced cytotoxicity. For example, in one embodiment, in the RNA used in accordance with the disclosure, if cytidine is present, 5-methylcytidine is partially or completely substituted, preferably completely substituted. Alternatively, or in addition, in one embodiment, in the RNA used in accordance with the disclosure, if uridine is present, pseudouridine is partially or completely substituted, preferably completely substituted.

[0305] In one embodiment, the term “modification” refers to generating RNA having a 5-cap or 5'-cap analogue. The term “5-cap” refers to a cap structure present at the 5'-end of an mRNA molecule, generally consisting of a guanosine nucleotide attached to the mRNA via a 5'-5 triphosphate bond not normally seen. In one embodiment, this guanosine is methylated at position 7. The term “conventional 5'-cap” refers to a natural RNA 5'-cap, preferably a 7-methylguanosine cap (m'G). As used herein, the term “5'-cap” includes 5'-cap analogues that are analogous to RNA cap structures and are modified, preferably in vivo and / or intracellularly, to have the ability to stabilize RNA and / or (when bound to RNA) to enhance RNA translation.

[0306] According to this disclosure, the stability and translation efficiency of RNA may be modified as needed. For example, RNA can be stabilized and its translation increased by one or more modifications having a stabilizing effect and / or improved translation efficiency. Such modifications are described, for example, in PCT / EP2006 / 009448, which is incorporated herein by reference. To increase the expression of RNA used in accordance with this disclosure, the coding region, i.e., the sequence encoding the expressed peptide or protein, may be modified without altering the sequence of the expressed peptide or protein, such as increasing the GC content to improve mRNA stability, performing codon optimization, and thus enhancing translation in the cell.

[0307] Aspects of this disclosure relate to a method for preventing a bacterial or viral infection, comprising administering an effective amount of a composition produced herein to a subject in need thereof to induce an immune response.

[0308] Aspects of this disclosure provide a method for vaccinating a subject, comprising administering to the subject a single dose of a composition described herein comprising a nucleic acid (e.g., mRNA) encoding an effective amount of polypeptide for vaccinating the subject. In some embodiments, the nucleic acid is formulated in cationic lipid nanoparticles. In some embodiments, the lipid nanoparticle composition is administered by a single injection.

[0309] In some embodiments, the bacterial infection is Mycobacterium tuberculosis infection.

[0310] In some embodiments, the viral infection is a coronavirus. In some embodiments, the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0311] In some embodiments, the viral infection is HIV / AIDS.

[0312] In some embodiments, lipid nanoparticles are administered parenterally.

[0313] Generally, administration to patients is possible via intradermal injection. However, injection may also be performed intramuscularly into the lymph nodes (Maloy et al. (2001), Proc Natl Acad Sci USA 98:3299-3033). The resulting cells give the target complex, which is recognized by autologous cytotoxic T lymphocytes, which then proliferate.

[0314] In some embodiments, the composition is administered by inhalation. In some embodiments, the composition is formulated as a nasal spray and / or aerosol.

[0315] The actual dosage levels of the active ingredients in the pharmaceutical compositions disclosed herein may vary to obtain an amount of active ingredient effective in achieving a desired therapeutic response for a particular patient, composition, and method of administration, while remaining non-toxic to the patient.

[0316] As used herein in the context of administration, “parenteral” means a method of administration other than intestinal and topical administration, which is usually by injection, and includes, but is not limited to, intravenous, intramuscular, intra-arterial, intra-shearing, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intrathecal, epidural, and intrasternal injections and infusions.

[0317] As used herein, the terms “parenteral administration” and “administered parenterally” typically refer to methods of administration other than intra-intestinal (i.e., via the gastrointestinal tract) and topical administration, by injection or infusion, and include, but are not limited to, intravenous, intramuscular, intra-arterial, intra-shearing, intracapsular, intra-orbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intra-articular, inhalation, subcapsular, subarachnoid, respiratory mucosa, intrathecal, epidural, and intrasternal injections and infusions. Intravenous injections and infusions are often (but not exclusively) used for the administration of liposomal drugs.

[0318] The medication plan can be adjusted to obtain the optimal desired response (e.g., therapeutic response). For example, one or more doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the requirements of the treatment situation.

[0319] In some embodiments, the dose contains 0.01 to 5 mg / kg of nucleic acid. In some embodiments, the dose contains 0.01 to 5 mg / kg of mRNA. In some embodiments, the dose contains 0.01 to 3 mg / kg of nucleic acid. In some embodiments, the dose contains 0.01 to 3 mg / kg of mRNA. In some embodiments, the dose contains 0.01 to 1 mg / kg of nucleic acid. In some embodiments, the dose contains 0.01 to 1 mg / kg of mRNA. In some embodiments, the dose contains 0.01 to 0.5 mg / kg of nucleic acid. In some embodiments, the dose contains 0.01 to 0.5 mg / kg of mRNA. In some embodiments, the dose contains 0.01 to 1 mg / kg of mRNA. In some embodiments, the dose contains 0.01 to 0.1 mg / kg of nucleic acid. In some embodiments, the dose contains 0.01 to 0.05 mg / kg of mRNA. In some embodiments, the dose contains 0.01 to 0.1 mg / kg of nucleic acid. In some embodiments, the dose contains 0.01 to 0.05 mg / kg of mRNA.

[0320] The dosage of LNPs containing the compound and / or its pharmaceutically acceptable salts, or the compound and / or its pharmaceutically acceptable salts, may vary over a wide range and should necessarily be adjusted in each specific case to suit individual conditions and the controlled pathogen.

[0321] Additional Embodiments 1. A compound of formula I or a pharmaceutically acceptable salt thereof.

[0322] 2. The compound of formula II or a pharmaceutically acceptable salt thereof.

[0323] 3. The compound of formula III or a pharmaceutically acceptable salt thereof.

[0324] 4. Compounds of formula IV or pharmaceutically acceptable salts thereof.

[0325] 5. Compounds having the structure shown in Table 1A.

[0326] 6. A bioreducible compound having the structure shown in Table 2.

[0327] 7. A compound having a pKa of 6 to 7, which is any one of the compounds described in Embodiments 1 to 6 above.

[0328] 8. A lipid nanoparticle composition comprising an ionized lipid of formula I or a pharmaceutically acceptable salt thereof, and nucleic acids.

[0329] 9. A lipid nanoparticle composition comprising an ionized lipid of formula II or a pharmaceutically acceptable salt thereof, and nucleic acids.

[0330] 10. A lipid nanoparticle composition comprising an ionized lipid of formula III or a pharmaceutically acceptable salt thereof, and nucleic acids.

[0331] 11. A lipid nanoparticle composition comprising an ionized lipid of formula IV or a pharmaceutically acceptable salt thereof, and nucleic acids.

[0332] 12. A composition according to any one of embodiments 8 to 11 above, wherein an ionized lipid encapsulates a nucleic acid.

[0333] 13. A composition according to any one of embodiments 8 to 11, wherein the nucleic acid is siRNA.

[0334] 14. A composition according to any one of embodiments 8 to 11, wherein the nucleic acid is DNA.

[0335] 15. A composition according to any one of embodiments 8 to 11, wherein the nucleic acid is mRNA.

[0336] 16. Any one of the compositions from Embodiments 8 to 11, further comprising sterols, phosphatidylcholine, or a combination thereof.

[0337] 17. The composition of Embodiment 16, wherein the sterol is cholesterol.

[0338] 18. The composition of Embodiment 17, wherein the molar ratio of ionized lipids to cholesterol is approximately 65:35 to approximately 40:60.

[0339] 19. The composition of Embodiment 17, wherein the molar ratio of ionized lipids to cholesterol is approximately 60:40 to approximately 45:55.

[0340] 20. The composition of Embodiment 17, wherein the molar ratio of phosphatidylcholine to cholesterol is approximately 1:5 to approximately 1:2.

[0341] 21. The composition of Embodiment 17, further comprising polymer composite lipids.

[0342] 22. The composition of Embodiment 21, wherein the polymer complex lipid comprises PEG(2000)-dimiristoylglycerol (PEG-DMG) or PEG(molecular weight 2,000)-dimiristoylphosphatidylethanolamine (PEG-DMPE).

[0343] 23. Any one of the compositions from Embodiments 8 to 11, further comprising a target ligand, wherein the target ligand is oriented outward of the nanoparticles.

[0344] 24. The composition of Embodiment 23, wherein the target ligand is an antibody.

[0345] 25. A liquid pharmaceutical formulation, one of the compositions according to Embodiments 8 to 11.

[0346] 26. Any one of Embodiments 8 to 11, wherein the percentage of oxidative degradation products in the case of ionized lipids is less than 50% of the oxidative degradation products in the case of DLin-KC2-DMA or DLin-MC3-DMA control formulations.

[0347] 27. A method for preventing a bacterial or viral infection, comprising administering an effective amount of any one of the compositions and pharmaceutical excipients of Embodiments 9 to 26 to a subject in need thereof, wherein the administration induces an immune response.

[0348] 28. The method of Embodiment 27, wherein the composition is administered subcutaneously, intramuscularly, or intradermally.

[0349] 29. The method of Embodiment 27, wherein the bacterial infection is Mycobacterium tuberculosis infection.

[0350] 30. The method of Embodiment 27, wherein the viral infection is SARS-CoV, MERS-CoV, or SARS-CoV-2 infection.

[0351] 31. The method of Embodiment 27, wherein the viral infection is HIV infection.

[0352] 32. The method of Embodiment 27, wherein the infection is of a non-tuberculous form.

[0353] 33. A lipid nanoparticle (LNP) composition comprising an ionized lipid having a chemical structure consisting of a pair of linear polyunsaturated lipid tails of 16 or 18 carbon atoms covalently bonded to a head group containing a dialkylamino group with a pKa of 6 to 7, The head group comprises a heterocyclyl or alkyl moiety covalently bonded to a dialkylamino group, and optionally further comprises a phosphate group. A composition in which each polyunsaturated lipid tail is unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and optionally comprises a single acyl group at a terminal covalently bonded to a head group.

[0354] 34. The composition of Embodiment 33, wherein each lipid tail is identical, and each lipid tail has a total of two olefins separated only by unsubstituted ethylene, n-propyl, or n-butyl.

[0355] 35. The composition of Embodiment 34, wherein each lipid tail further comprises an acyl group that combines with the oxygen of the head group to form an ester.

[0356] 36. Each lipid tail is given by formula A: [ka] [wherein equation A, a is 1, 2, 3 or 4, b is 2, 3 or 4, and c is 3, 4, 5, 6 or 7 in equation A] or equation B: [ka] A composition of Embodiment 34 having the chemical structure [wherein formula B, a is 5, 6 or 7, and in formula B, c is 3, 4 or 5].

[0357] 37. The composition of embodiment 36, wherein b is 4.

[0358] 38. Ionized lipids, [ka] The formula includes a chemical structure selected from the group consisting of R, where R 22 This is the first end of the lipid tail. [ka] The composition according to claim 36, wherein the head group is bonded to the dialkylamino portion of the head group.

[0359] 39. The dialkylamino portion of the head group is of formula (IV-A): [ka] It has the chemical structure, in formula (IV-A), n is 2, 3 or 4, and in formula (IV-A), R 10 and R 12 Each of these is independently selected from alkyl groups chosen from the group consisting of methyl, ethyl, and propyl, and R 10 and R 12 The composition of Embodiment 38, wherein the alkyl group is optionally substituted with one or more hydroxyls.

[0360] 40. R in equation (IV-A) 10 and R 12The composition of Embodiment 39, wherein each is independently methyl, ethyl, -(CH2)(CH2)OH, or -(CH2)2(CH2)OH.

[0361] 41. Ionized lipids are given by formula (IA): [ka] It has the chemical structure, where a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, c is 3, 4, 5, 6 or 7, and the sum of a, b and c is 10 or 12, R 10 and R 12 Each of them is independently a (C1-C4) alkyl group substituted with one or more hydroxyls by arbitrary selection, and L is [ka] The composition of Embodiment 33, wherein v is 0 or 1 and q2 is 1 or 2.

[0362] 42. The composition of claim 41, wherein v is 0.

[0363] 43. The composition of claim 41, wherein v is 1.

[0364] 44. Ionized lipids, formula II-A: [ka] It has the following chemical structure, where a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, c is 4, 5, 6, 7 or 8, and R2 is [ka] And q and q' are independently 1 or 2, R 10 and R 12 The composition of Embodiment 33, wherein each of these is an (C1-C4) alkyl group optionally substituted with a hydroxyl group.

[0365] 45. Ionized lipids, formula II-A: [ka] It has the following chemical structure, where a is 5, 6, or 7, c is 3, 4, or 5, and R2 is [ka] And q and q' are independently 1 or 2, R 10 and R 12 The composition of Embodiment 33, wherein each of these is an (C1-C4) alkyl group optionally substituted with a hydroxyl group. [Examples]

[0366] While this disclosure has been described in relation to specific embodiments and many details have been provided for illustrative purposes, it will be apparent to those skilled in the art that this disclosure includes additional embodiments and that some of the details described herein may be significantly altered without departing from this disclosure. This disclosure includes such additional embodiments, modifications, and equivalents. In particular, this disclosure includes any combination of various exemplary components and examples of features, terminology, or elements.

[0367] Unless otherwise explicitly specified, the isomer form of the phosphatidylserine lipid used in the examples is phosphatidyl-L-serine.

[0368] Specific examples are provided below to illustrate various embodiments of the embodiments disclosed herein. Those skilled in the art will see that the various embodiments disclosed herein are not limited to these specific exemplary examples.

[0369] [Example 1A] Synthesis of ionized lipids Scheme 1: Synthesis of acid intermediates for AKG-UO-3 from AKG-UO-1

[0370] [ka]

[0371] The following acid intermediates, (6Z,12Z)-6,12-octadecadienoic acid and (6Z,12Z)-6,12-hexadecadienoic acid, were prepared by conventional synthesis. (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)(AKG-UO-1,O-11956) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)(AKG-UO-1A,O-11955) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-12401) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-12402) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0372] [ka] Experimental Procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0373] [ka] 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) was dissolved in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol), to which 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) was added at 0°C. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran 4

[0374] [ka] To a solution of 1,7-octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphoramide (16 mL, 90.8 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (18 mL, 45.4 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 22.7 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove the tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 9 g of crude oil. The crude oil was purified by chromatography on silica using 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) as a clear oil. 1H NMR (300 MHz, d6.DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2.16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Typical Procedure for Alkyne Alkylation Synthesis of 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran7

[0375] [ka] To a solution of 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, 103.4 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (41.3 mL, 103.4 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 1-iodopropane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 9 g of crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane to obtain 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1.55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran8

[0376] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H), 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1.53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Typical procedure for reducing alkynes to alkenes using "P-2Ni" Synthesis of 2-(((6Z,12Z)-Hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran9

[0377] [ka] To a solution of sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL), nickel(II) acetate tetrahydrate (3.22 g, 12.98 mmol) was added at 0°C under a hydrogen blanket. Upon completion of the addition, the reaction mixture was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (3.7 mL, 65.6 mmol) and a solution of 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) were added. The reaction mixture was stirred at room temperature under a hydrogen balloon for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered on Celite, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oily substance was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as the eluent to obtain 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, yield 78%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1.57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62.43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98, 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran10

[0378] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1.56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26.01, 25.59, 22.67, 19.78, 14.18. Typical procedure for the deprotection of tetrahydropyranyl ether (THP) Synthesis of (6Z,12Z)-Hexadeca-6,12-diene-1-ol-11

[0379] [ka] To a solution of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL), p-toluenesulfonic acid monohydrate (300 mg, 1.58 mmol) was added at room temperature. The resulting solution was stirred at room temperature for 3 hours and then quenched with water. The mixture was extracted with ethyl acetate (2 × 50 mL). The combined organic matter was washed with water, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane to obtain (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-Diene-1-All12

[0380] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Typical procedure for the oxidation of alcohols to carboxylic acids using Jones reagents Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0381] [ka] A mixture of (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 10.5 mmol) and Jones' reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0°C for 2 hours. The mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organic matter was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 20% ​​ethyl acetate in n-hexane as the eluent to obtain (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-Dienoic Acid 14

[0382] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16

[0383] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethane-1-ol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was mixed with p-toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (140 mg, 1.14 mmol) at 0°C, and the reaction was stirred overnight at room temperature. The mixture was diluted with CH2Cl2 (500 mL) and washed with saturated NH4Cl, water, and brine. The organic layer was dehydrated with anhydrous Na2SO4. The solvent was evaporated, and the crude residue was used in the next step without purification (43.8 g, 85%). 1H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Typical procedure for dialkylamine substitution Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 19

[0384] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 17 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated, and the crude residue was diluted with CH2Cl2 (500 mL) and washed with saturated NaHCO3, water, and brine. The organic layer was dehydrated with anhydrous Na2SO4. The solvent was evaporated, and the crude residue was purified by flash chromatography (100% to 10% MeOH in CH2Cl2 containing SiO2:CH2Cl2=1%NH4OH) to obtain a colorless oily product 19 (2.1 g, 37%). 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H). MS (APCI + ): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 20

[0385] [ka] 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI+): 202.2 (M+1) Typical procedure for ketal hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0386] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) was mixed with 1N HCl aqueous solution (17 mL, 17.3 mmol), and the reaction was heated at 80°C for 45 minutes. TLC (Rf=0.1, 10% MeOH in CH2Cl2 containing 1% NH4OH) indicated that the reaction was complete. After concentrating the reaction mixture, the crude residue was dissolved in water (5 mL) and freeze-dried overnight. A viscous syrup-like product 21 (2.1 g, quantitative) was obtained as the HCl salt. 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m, 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI+): 134.1 (M+1) (S)-4-(diethylamino)butane-1,2-diol hydrochloride 22

[0387] [ka] 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m, 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI+): 162.1 (M+1) Typical procedure for diesterification Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)AKG-UO-1(O-11956)

[0388] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added dropwise to a solution of (6Z,12Z)-octadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / DMF (15 mL, 25 mL) at 0°C. The reaction mixture was warmed to room temperature and stirred for 1 hour. After 1 hour, the reaction mixture was concentrated to dryness under vacuum. The residue was redissolved in dichloromethane (10 mL) and added to a mixture of N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4-dimethylaminopyridine (317 mg, 2.6 mmol), and (S)-4-(dimethylamino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol). The resulting solution was stirred for 24 hours. After 24 hours, the reaction mixture was cooled to 0°C and quenched with water (10 mL). The reaction mixture was extracted with dichloromethane (2 × 100 mL), and the organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 2% methanol in dichloromethane as the eluent to obtain (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO-1 (0.12 g, 30%) as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)AKG-UO-1A(O-11955)

[0389] [ka] 1H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12.1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1.19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI+): 686.6 (M+1) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate)AKG-UO-4(O-12401)

[0390] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI+): 602.5 (M+1) Synthesis of (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate)AKG-UO-4A(O-12402)

[0391] [ka] 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1.31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS(APCI+):630.5(M+1), the reaction includes i) the initial Wittig reaction of triphenylphosphonium ylide prepared from 5-bromopentanol and the corresponding aldehyde, ii) conversion of the terminal alcohol to a bromide by mesylation and substitution, iii) repetition of the sequence of ylide synthesis and Wittig reaction, and finally iv) periodic acid oxidation of the terminal alcohol. The resulting acid intermediate was used in the synthesis of AKG-UO-4 from AKG-UO-1 below. Scheme 2: Synthesis of acid intermediates for AKG-UO-5

[0392] [ka] The acid intermediate (9Z,15Z)-9,15-octadecadienoic acid used in the synthesis of AKG-UO-5 was prepared by the general synthesis shown in Scheme 2, which comprises i) alkylation of silyl-protected 10-hydroxy-1-decine using (5Z)-1-bromo-5-octene, ii) catalytic hydrogenation from alkyne to cis-alkene, iii) removal of silyl protection on alcohol, and finally iv) oxidation from terminal alcohol to the desired acid. Scheme 3 Synthesis of acid intermediates for AKG-BDG-01 and AKG-BDG-02

[0393] [ka] The synthesis of the two disulfate intermediates used in the synthesis of AKG-BDG-1 and AKG-BDG-2 is shown below. Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0394] [ka] Experimental Procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0395] [ka] 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) was dissolved in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol), to which 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) was added at 0°C. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(dodeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran 4a

[0396] [ka] To a solution of 1,6-heptadiyne 3a (5 g, 54.3 mmol) and hexamethylphosphoramide (19 mL, 108 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (21.7 mL, 54.3 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (6.8 g, 27.1 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-(dodeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 58%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.57-4.56 (m, 1H), 3.96-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.50-3.41 (m, 1H), 3.39-3.34 (m, 1H), 2.29-2.25 (m, 4H), 2.15-2.12 (m, 2H), 1.95-1.94 (t, J = 5.8 Hz, 1H), 1.73-1.43 (m, 14H). Synthesis of 2-(octadeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran 6a

[0397] [ka] To a solution of 2-(dodeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 15.64 mmol) and hexamethylphosphoramide (11 mL, 62.6 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (12.5 mL, 31.3 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 1-iodohexane 5a (9.5 mL, 62.6 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane to obtain 2-(octadeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 57%) as a clear oil. 1H NMR (300 MHz, CDCl3): 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.51-3.47 (m, 1H), 3.41-3.34 (m, 1H), 2.26-2.21 (m, 6H), 2.14-2.12 (m, 6H), 1.66-1.26 (m, 18H), 0.93-0.85 (t, J = 6.5 Hz, 3H). Synthesis of 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran 7a

[0398] [ka] To a solution of sodium borohydride (0.27 g, 14.8 mmol) in ethanol (50 mL), nickel(II) acetate tetrahydrate (1.55 g, 6.25 mmol) was added under a hydrogen blanket at 0°C. Upon completion of the addition, the reaction mixture was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (1.8 mL, 26.8 mmol) and a solution of 2-(octadeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 8.93 mmol) in ethanol (10 mL) were added. The reaction mixture was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered on Celite, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oily substance was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as the eluent to obtain 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran, 7a (2.86 g, yield 92%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.4-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.49 (m, 1H), 3.41-3.36 (m, 1H), 2.06-1.99 (m, 6H), 1.83-1.67 (m, 2H), 1.59-1.51 (m, 6H),1.48-1.32 (m, 16H), 0.92-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-diene-1-ol 8a

[0399] [ka] The procedure was described above. 1HNMR (300 MHz, CDCl3): 5.37-5.33 (m, 4H), 3.65-3.61 (m, 1H), 2.06-1.99 (m, 6H), 1.56-1.41 (m, 4H), 1.38-1.27 (m, 14H), 0.88-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dienoic acid 9a

[0400] [ka] The procedure was described above. 1H NMR (300 MHz, CDCl3): 5.38-5.33 (m, 4H), 2.37-2.33 (t, J = 5.6 Hz, 2H), 2.06-1.99 (m, 6H), 1.67-1.59 (m, 2H), 1.41-1.25 (m, 14H), 0.89-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0401] [ka] The procedure was described above. 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.06 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.28 (m, 6H), 2.20 (s, 6H), 2.03-2.01 (m, 16H), 1.74-1.64 (m, 2H), 1.62-1.60 (m, 6H), 1.38-1.27 (m, 22H), 0.89-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) The general synthesis of the acid intermediate for AKG-BDG-1 includes i) synthesis of 4-mercaptobutyric acid from 4-bromobutyric acid, ii) preparation of 4-(2-pyridinyldisulfanyl)butanoic acid by reaction of 4-mercaptobutyric acid with DPS, iii) catalytic hydrogenation of 3-decine-1-ol to cis-alkene, iv) tosylation of primary alcohol, v) preparation of terminal thiol by substitution of tosyl group using thiourea, and finally vi) preparation of disulfide containing the acid intermediate by coupling of terminal thiol using 4-(2-pyridinyldisulfanyl)butanoic acid prepared in step ii above. Following a similar synthetic sequence starting with 3-dodecine-1-ol, a second acid intermediate used in the synthesis of AKG-BDG-2 was obtained. Scheme 4: Synthesis of AKG-UO-1, AKG-UO-4, AKG-UO-5, AKG-BDG-1, and AKG-BDG-2

[0402] [ka] The general synthesis of the lipids AKG-UO-1, AKG-UO-4, AKG-UO-5, AKG-BDG-1, and AKG-BDG-2 shown in Scheme 4 involves the following steps: i) tosylation of a primary alcohol of a commercially available chiral dioxolane, ii) preparation of a tertiary amine by substitution of a tosyl group using dimethylamine, iii) acid-catalyzed deprotection of the diol, and finally iv) esterification of the diol using the corresponding acid intermediate synthesized according to Schemes 1-3. AKG-UO-2 is prepared according to a similar synthetic sequence using different dioxolanes and corresponding acid intermediates as starting materials, as shown in Scheme 5 below. Scheme 5: Synthesis of AKG-UO-2

[0403] [ka] The general synthesis of trialkyl phosphates containing the lipid AKG-UO-3 shown in Scheme 6 comprises the following steps: i) preparation of the corresponding dialkyl chlorophosphite by reaction of a commercially available chiral dioxolane primary alcohol with methyl dichlorophosphite; ii) preparation of the corresponding trialkyl phosphite by chloride substitution in the dialkyl chlorophosphite by treatment with 3-bromopropanol; iii) acid-catalyzed deprotection of the diol; iv) esterification of the diol using the corresponding acid intermediate synthesized according to Scheme 1; and finally v) preparation of the tertiary amine by bromine group substitution using dimethylamine. Scheme 6: Synthesis of AKG-UO-3

[0404] [ka] Alternatively, acid intermediates having two methylene groups between double bond positions in the hydrocarbon chain can be synthesized as described in Caballeira et al., Chem. Phys. Lipids, vol. 100, pp. 33-40, 1999, or as described by D'yakonov et al. (D'yakonov et al., Med. Chem. Res., 2016, vol. 25, pp. 30-39; D'yakonov et al., Chem. Commun. 2013, vol. 49, pp. 8401-8403; D'yakonov et al., 2020, Phytochem. Rev.). (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)(AKG-UO-1,O-11956) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)(AKG-UO-1A,O-11955) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-12401) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-12402) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0405] [ka] Experimental Procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0406] [ka] 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) was dissolved in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol), to which 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) was added at 0°C. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran 4

[0407] [ka] To a solution of 1,7-octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphoramide (16 mL, 90.8 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (18 mL, 45.4 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 22.7 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove the tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 9 g of crude oil. The crude oil was purified by chromatography on silica using 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) as a clear oil. 1H NMR (300 MHz, d6.DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2.16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Typical Procedure for Alkyne Alkylation Synthesis of 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran7

[0408] [ka] To a solution of 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, 103.4 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (41.3 mL, 103.4 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 1-iodopropane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 9 g of crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane to obtain 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1.55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran8

[0409] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H), 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1.53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Typical procedure for reducing alkynes to alkenes using "P-2 Ni" Synthesis of 2-(((6Z,12Z)-Hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran9

[0410] [ka] To a solution of sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL), nickel(II) acetate tetrahydrate (3.22 g, 12.98 mmol) was added at 0°C under a hydrogen blanket. Upon completion of the addition, the reaction mixture was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (3.7 mL, 65.6 mmol) and a solution of 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) were added. The reaction mixture was stirred at room temperature under a hydrogen balloon for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered on Celite, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oily substance was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as the eluent to obtain 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, yield 78%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1.57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62.43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98, 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran10

[0411] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1.56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26.01, 25.59, 22.67, 19.78, 14.18. Typical procedure for the deprotection of tetrahydropyranyl ether (THP) Synthesis of (6Z,12Z)-Hexadeca-6,12-diene-1-ol-11

[0412] [ka] To a solution of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL), p-toluenesulfonic acid monohydrate (300 mg, 1.58 mmol) was added at room temperature. The resulting solution was stirred at room temperature for 3 hours and then quenched with water. The mixture was extracted with ethyl acetate (2 × 50 mL). The combined organic matter was washed with water, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane to obtain (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-Diene-1-All12

[0413] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Typical procedure for the oxidation of alcohols to carboxylic acids using Jones reagents Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0414] [ka] A mixture of (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 10.5 mmol) and Jones' reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0°C for 2 hours. The mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organic matter was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 20% ​​ethyl acetate in n-hexane as the eluent to obtain (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-Dienoic Acid 14

[0415] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16

[0416] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethane-1-ol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was mixed with p-toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (140 mg, 1.14 mmol) at 0°C, and the reaction was stirred overnight at room temperature. The mixture was diluted with CH2Cl2 (500 mL) and washed with saturated NH4Cl, water, and brine. The organic layer was dehydrated with anhydrous Na2SO4. The solvent was evaporated, and the crude residue was used in the next step without purification (43.8 g, 85%). 1H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Typical procedure for dialkylamine substitution Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 19

[0417] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 17 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated, and the crude residue was diluted with CH2Cl2 (500 mL) and washed with saturated NaHCO3, water, and brine. The organic layer was dehydrated with anhydrous Na2SO4. The solvent was evaporated, and the crude residue was purified by flash chromatography (100% to 10% MeOH in CH2Cl2 containing SiO2:CH2Cl2=1%NH4OH) to obtain a colorless oily product 19 (2.1 g, 37%). 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H). MS (APCI+): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 20

[0418] [ka] 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI+): 202.2 (M+1) Typical procedure for ketal hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0419] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) was mixed with 1N HCl aqueous solution (17 mL, 17.3 mmol), and the reaction was heated at 80°C for 45 minutes. TLC (Rf=0.1, 10% MeOH in CH2Cl2 containing 1% NH4OH) indicated that the reaction was complete. After concentrating the reaction mixture, the crude residue was dissolved in water (5 mL) and freeze-dried overnight. A viscous syrup-like product 21 (2.1 g, quantitative) was obtained as the HCl salt. 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m, 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI+): 134.1 (M+1) (S)-4-(diethylamino)butane-1,2-diol hydrochloride 22

[0420] [ka] 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m, 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI+): 162.1 (M+1) Typical procedure for diesterification Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)AKG-UO-1(O-11956)

[0421] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added dropwise to a solution of (6Z,12Z)-octadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / DMF (15 mL, 25 mL) at 0°C. The reaction mixture was warmed to room temperature and stirred for 1 hour. After 1 hour, the reaction mixture was concentrated to dryness under vacuum. The residue was redissolved in dichloromethane (10 mL) and added to a mixture of N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4-dimethylaminopyridine (317 mg, 2.6 mmol), and (S)-4-(dimethylamino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol). The resulting solution was stirred for 24 hours. After 24 hours, the reaction mixture was cooled to 0°C and quenched with water (10 mL). The reaction mixture was extracted with dichloromethane (2 × 100 mL), and the organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 2% methanol in dichloromethane as the eluent to obtain (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO-1 (0.12 g, 30%) as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)AKG-UO-1A(O-11955)

[0422] [ka] 1H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12.1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1.19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI+): 686.6 (M+1) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate)AKG-UO-4(O-12401)

[0423] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI+): 602.5 (M+1) Synthesis of (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate)AKG-UO-4A(O-12402)

[0424] [ka] 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1.31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS(APCI+):630.5(M+1) and finally v) Preparation of tertiary amines by substitution of bromide groups using dimethylamine. Scheme 7: Synthesis of AKG-UO-3

[0425] [ka] Alternatively, acid intermediates having two methylene groups between double bond positions in the hydrocarbon chain can be synthesized as described in Caballeira et al., Chem. Phys. Lipids, vol. 100, pp. 33-40, 1999, or as described by D'yakonov et al. (D'yakonov et al., Med. Chem. Res., 2016, vol. 25, pp. 30-39; D'yakonov et al., Chem. Commun. 2013, vol. 49, pp. 8401-8403; D'yakonov et al., 2020, Phytochem. Rev.).

[0426] [Example 1B] Synthesis of ionized lipids (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)(AKG-UO-1,O-11956) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)(AKG-UO-1A,O-11955) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-12401) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-12402) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0427] [ka] Experimental Procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0428] [ka] 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) was dissolved in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol), to which 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) was added at 0°C. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran 4

[0429] [ka] To a solution of 1,7-octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphoramide (16 mL, 90.8 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (18 mL, 45.4 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 22.7 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove the tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 9 g of crude oil. The crude oil was purified by chromatography on silica using 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) as a clear oil. 1 1H NMR (300 MHz, d 6. DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2.16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Typical Procedure for Alkyne Alkylation Synthesis of 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran7

[0430] [ka] To a solution of 2-(trideca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, 103.4 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (41.3 mL, 103.4 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 1-iodopropane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 9 g of crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane to obtain 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 72%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1.55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran8

[0431] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H), 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1.53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Typical procedure for reducing alkynes to alkenes using "P-2 Ni" Synthesis of 2-(((6Z,12Z)-Hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran9

[0432] [ka] To a solution of sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL), nickel(II) acetate tetrahydrate (3.22 g, 12.98 mmol) was added at 0°C under a hydrogen blanket. Upon completion of the addition, the reaction mixture was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (3.7 mL, 65.6 mmol) and a solution of 2-(hexadeca-6,12-diyne-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) were added. The reaction mixture was stirred at room temperature under a hydrogen balloon for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered on Celite, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oily substance was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as the eluent to obtain 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, yield 78%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1.57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 Hz, 3H). 13 C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62.43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98, 19.78, 13.91. 2-(((6Z,12Z)-オクタデカ-6,12-ジエン-1-イル)オキシ)テトラヒドロ-2H-ピラン10

[0433]

change

[0434] [ka] To a solution of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL), p-toluenesulfonic acid monohydrate (300 mg, 1.58 mmol) was added at room temperature. The resulting solution was stirred at room temperature for 3 hours and then quenched with water. The mixture was extracted with ethyl acetate (2 × 50 mL). The combined organic matter was washed with water, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane to obtain (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 72%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-Diene-1-All12

[0435] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Typical procedure for the oxidation of alcohols to carboxylic acids using Jones reagents Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0436] [ka] A mixture of (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 10.5 mmol) and Jones' reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0°C for 2 hours. The mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organic matter was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 20% ​​ethyl acetate in n-hexane as the eluent to obtain (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-Dienoic Acid 14

[0437] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16

[0438] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethane-1-ol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was mixed with p-toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (140 mg, 1.14 mmol) at 0°C, and the reaction was stirred overnight at room temperature. The mixture was diluted with CH2Cl2 (500 mL) and washed with saturated NH4Cl, water, and brine. The organic layer was dehydrated with anhydrous Na2SO4. The solvent was evaporated, and the crude residue was used in the next step without purification (43.8 g, 85%). 1 H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Typical procedure for dialkylamine substitution Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 19

[0439] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 17 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated, and the crude residue was diluted with CH2Cl2 (500 mL) and washed with saturated NaHCO3, water, and brine. The organic layer was dehydrated with anhydrous Na2SO4. The solvent was evaporated, and the crude residue was purified by flash chromatography (100% to 10% MeOH in CH2Cl2 containing SiO2:CH2Cl2=1%NH4OH) to obtain a colorless oily product 19 (2.1 g, 37%). 1 H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H). MS (APCI + ): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 20

[0440] [ka] 1 H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI + ): 202.2 (M+1) Typical procedure for ketal hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0441] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) was mixed with 1N HCl aqueous solution (17 mL, 17.3 mmol), and the reaction was heated at 80°C for 45 minutes. TLC (Rf=0.1, 10% MeOH in CH2Cl2 containing 1% NH4OH) indicated that the reaction was complete. After concentrating the reaction mixture, the crude residue was dissolved in water (5 mL) and freeze-dried overnight. A viscous syrup-like product 21 (2.1 g, quantitative) was obtained as the HCl salt. 1 H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m, 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI + ): 134.1 (M+1) (S)-4-(diethylamino)butane-1,2-diol hydrochloride 22

[0442] [ka] 1 H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m, 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI + ): 162.1 (M+1) Typical procedure for diesterification Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)AKG-UO-1(O-11956)

[0443] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added dropwise to a solution of (6Z,12Z)-octadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / DMF (15 mL, 25 μL) at 0°C. The reaction mixture was warmed to room temperature and stirred for 1 hour. After 1 hour, the reaction mixture was concentrated to dryness under vacuum. The residue was redissolved in dichloromethane (10 mL) and added to a mixture of N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4-dimethylaminopyridine (317 mg, 2.6 mmol), and (S)-4-(dimethylamino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol). The resulting solution was stirred for 24 hours. After 24 hours, the reaction mixture was cooled to 0°C and quenched with water (10 mL). The reaction mixture was extracted with dichloromethane (2 × 100 mL), and the organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 2% methanol in dichloromethane as the eluent to obtain (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO-1 (0.12 g, 30%) as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI + ): 658.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate)AKG-UO-1A(O-11955)

[0444] [ka] 1 H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12.1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1.19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI + ): 686.6 (M+1) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate)AKG-UO-4(O-12401)

[0445] [ka] 1 H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI + ): 602.5 (M+1) Synthesis of (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate)AKG-UO-4A(O-12402)

[0446] [ka] 1 H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1.31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS (APCI + ): 630.5 (M+1) Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0447] [ka] Experimental Procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0448] [ka] 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) was dissolved in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol), to which 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) was added at 0°C. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(dodeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran 4a

[0449] [ka] To a solution of 1,6-heptadiyne 3a (5 g, 54.3 mmol) and hexamethylphosphoramide (19 mL, 108 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (21.7 mL, 54.3 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (6.8 g, 27.1 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain 2-(dodeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 58%) as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.57-4.56 (m, 1H), 3.96-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.50-3.41 (m, 1H), 3.39-3.34 (m, 1H), 2.29-2.25 (m, 4H), 2.15-2.12 (m, 2H), 1.95-1.94 (t, J = 5.8 Hz, 1H), 1.73-1.43 (m, 14H). Synthesis of 2-(octadeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran 6a

[0450] [ka] To a solution of 2-(dodeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 15.64 mmol) and hexamethylphosphoramide (11 mL, 62.6 mmol) in tetrahydrofuran (100 mL), [2.5 M n-butyllithium in n-hexane] (12.5 mL, 31.3 mmol) was added dropwise at -78 °C. After the addition was complete, the solution was stirred at -78 °C for 1 hour, and then warmed to -20 °C for another 1 hour. The resulting solution was cooled again to -78 °C, at which point a solution of 1-iodohexane 5a (9.5 mL, 62.6 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was cooled to 0 °C and quenched with water (100 mL). The reaction mixture was then concentrated under vacuum to remove tetrahydrofuran, and then diluted with n-hexane. The organic matter was washed with water and brine (2 × 100 mL). The organic layer was dehydrated with magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane to obtain 2-(octadeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 57%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.51-3.47 (m, 1H), 3.41-3.34 (m, 1H), 2.26-2.21 (m, 6H), 2.14-2.12 (m, 6H), 1.66-1.26 (m, 18H), 0.93-0.85 (t, J = 6.5 Hz, 3H). Synthesis of 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran 7a

[0451] [ka] To a solution of sodium borohydride (0.27 g, 14.8 mmol) in ethanol (50 mL), nickel(II) acetate tetrahydrate (1.55 g, 6.25 mmol) was added at 0°C under a hydrogen blanket. Upon completion of the addition, the reaction mixture was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (1.8 mL, 26.8 mmol) and a solution of 2-(octadeca-6,11-diyne-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 8.93 mmol) in ethanol (10 mL) were added. The reaction mixture was stirred at room temperature under a hydrogen balloon for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered on Celite, and the filtrate was concentrated under vacuum to obtain 4 g of crude oil. The crude oily substance was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as the eluent to obtain 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran, 7a (2.86 g, yield 92%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.4-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.49 (m, 1H), 3.41-3.36 (m, 1H), 2.06-1.99 (m, 6H), 1.83-1.67 (m, 2H), 1.59-1.51 (m, 6H),1.48-1.32 (m, 16H), 0.92-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-diene-1-ol 8a

[0452] [ka] The procedure was described above. 1H NMR (300 MHz, CDCl3): 5.37-5.33 (m, 4H), 3.65-3.61 (m, 1H), 2.06-1.99 (m, 6H), 1.56-1.41 (m, 4H), 1.38-1.27 (m, 14H), 0.88-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dienoic acid 9a

[0453] [ka] The procedure was described above. 1 H NMR (300 MHz, CDCl3): 5.38-5.33 (m, 4H), 2.37-2.33 (t, J = 5.6 Hz, 2H), 2.06-1.99 (m, 6H), 1.67-1.59 (m, 2H), 1.41-1.25 (m, 14H), 0.89-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate)(AKG-UO-1a)

[0454] [ka] The procedure was described above. 1 H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.06 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.28 (m, 6H), 2.20 (s, 6H), 2.03-2.01 (m, 16H), 1.74-1.64 (m, 2H), 1.62-1.60 (m, 6H), 1.38-1.27 (m, 22H), 0.89-0.85 (m, 6H). MS (APCI +): 658.5 (M+1)

[0455] [Example 1C] Synthesis of the KC-01 series of ionized lipids Synthesis of 2-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-01, O-12095) 3-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropane-1-amine(AKG-KC3-01, O-12096)

[0456] [ka] Synthesis of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2

[0457] [ka] (6Z,12Z)-octadeca-6,12-dien-1-ol, 1 (3.6 g, 13.7 mmol) was dissolved in dichloromethane (50 mL) and methanesulfonyl chloride (1.26 mL, 16.4 mmol) and triethylamine (3.6 mL, 20.5 mmol) were added at 0°C. The resulting solution was warmed to room temperature and stirred for 2 hours. The mixture was quenched with water and extracted with dichloromethane (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, and then filtered. The filtrate was concentrated under vacuum to obtain a crude oil. The obtained oil was dissolved in diethyl ether (50 mL) and added to a stirred slurry of magnesium bromide ethyl etherate (7 g, 27.4 mmol) in diethyl ether (50 mL) at 0°C. The mixture was warmed to room temperature and stirred for 2 hours. The reaction mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, and subsequently filtered. The filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-10% ethyl acetate in n-hexane as the eluent to obtain (6Z,12Z)-1-bromooctadeca-6,12-diene, 3 (2.9 g, 8.89 mmol, 65%) as a yellow oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.42-3.37 (t, J = 7.5 Hz, 2H), 2.04-1.97 (m, 8H), 1.83-1.83 (m, 2H), 1.37-1.28 (m, 14H), 0.90-0.86 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraene-19-ol,3

[0458] [ka] A solution of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2 (2 g, 6.08 mmol) in ether (10 mL) was added to a mixture of magnesium shavings (162 mg, 6.69 mmol) and iodine in ether (2 mL) under argon at room temperature. The mixture was stirred at room temperature for 90 minutes (the magnesium shavings were consumed), at which point ethyl formate (0.24 mL, 3.04 mmol) was added. After stirring at room temperature for 1 hour, the reaction was quenched with 1 N HCl solution. The mixture was extracted with ethyl acetate (2 × 100 mL), and the combined organic matter was washed with water followed by brine. The organic matter was dried under magnesium sulfate, filtered, and the filtrate was concentrated under vacuum to obtain a crude oil. The obtained oil was dissolved in ethanol (10 mL) and added to a solution of potassium hydroxide (260 mg) in water (3 mL). After stirring for 12 hours, the pH of the mixture was adjusted to 4 with 2 N HCl. The aqueous solution was extracted with dichloromethane (2×) and combined. The organic matter was washed with brine, then dried under magnesium sulfate and filtered. The filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified on silica using 10-30% ethyl acetate in n-hexane as an eluent to obtain (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol,3 (0.29 g, 0.55 mmol, 18%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.57 (bs, 1H), 3.33-3.32, (m, 2H), 2.13-1.97 (m, 16H), 1.36-1.29 (m, 34H), 0.90-0.86 (t, J = 6.6 Hz, 6H). (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 synthesis

[0459] [ka] (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol, 3 (0.29 g, 0.55 mmol) and sodium carbonate (3 mg, 0.03 mmol) were mixed in dichloromethane, to which pyridinium chlorochromate (236 mg, 1.1 mmol) was added at 0°C. The mixture was heated to room temperature and stirred for 1 hour. After 1 hour, silica gel (1 g) was added to the reaction, and the mixture was filtered. The filtrate was concentrated, and the resulting oily substance was purified on silica using 10-20% ethyl acetate in n-hexane as an eluent to obtain (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.12 g, 0.23 mmol, 42%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.36-3.32, (m, 1H), 2.40-2.35 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.58-1.54 (m, 4H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolane-4-yl)ethane-1-ol, 7

[0460] [ka] A mixture of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.12 g, 0.23 mmol), (4S)-(+)-4-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolane 5 (0.20 g, 1.38 mmol), and pyridinium p-toluenesulfonate (9 mg) in toluene (10 mL) was heated under positive nitrogen pressure and reflux. After 12 hours, the mixture was concentrated under vacuum to obtain a crude oily substance. The obtained crude oily substance was purified by chromatography on silica using 20-40% ethyl acetate in n-hexane as the eluent to obtain 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)ethane-1-ol, 7 (0.11 g, 0.17 mmol, 77%) as a clear oily substance. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 4.25-4.20 (m, 1H), 4.10-4.06 (m, 1H), 3.82-3.77 (m, 1H), 3.54-3.49 (m, 1H), 2.23-2.19 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.84-1.78 (m, 2H), 1.62-1.51 (m, 6H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of 3-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)propane-1-ol, 8

[0461] [ka] A mixture of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.50 g, 0.95 mmol), (S)-(3)-(2,2-dimethyl-1,3-dioxolan-4-yl)propanol 6 (0.76 g, 4.75 mmol), and pyridinium p-toluenesulfonate (36 mg) in toluene (10 mL) was heated under positive nitrogen pressure and reflux. After 12 hours, the mixture was concentrated under vacuum to obtain a crude oily substance. The obtained crude oily substance was purified by chromatography on silica using 20-40% ethyl acetate in n-hexane as the eluent to obtain 3-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 8 (0.48 g, 0.76 mmol, 80%) as a clear oily substance. 1 H NMR (300 MHz, CDCl3): 5.34-5.29 (m, 8H), 4.06-4.02 (m, 2H), 3.67-3.47 (m, 2H), 3.45-3.43 (m, 1H), 2.12-2.01 (m, 16H), 1.65-1.62 (m, 8H), 1.34-1.29 (m, 32H), 0.89-0.85 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-01, O-12095)

[0462] [ka] To a solution of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)ethane-1-ol, 7 (0.49 g, 0.79 mmol) in dichloromethane (10 mL), methanesulfonyl chloride (73 μL, 0.95 mmol) and triethylamine (0.26 mL, 1.2 mmol) were added at 0°C. The solution was warmed to room temperature and stirred for an additional hour. The reaction mixture was quenched with water and extracted with dichloromethane (2 × 100 mL). The organic matter was washed with brine, then dehydrated with magnesium sulfate, and filtered. The filtrate was concentrated under vacuum to obtain a crude oil. A solution of 2 M dimethylamine (10 mL) was added to the obtained crude oil and stirred for 24 hours. The mixture was then quenched with water and extracted with dichloromethane (2 × 100 mL). The combined organic matter was washed with brine, then dehydrated with magnesium sulfate, and then filtered. The filtrate was concentrated under vacuum to obtain a crude oil. The crude oil was purified using chromatography on silica with 5-100% ethyl acetate in n-hexane as the eluent to obtain 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-01, O-12095) (206 mg, 0.32 mmol, 41%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.32 (m, 8H), 4.08-4.03 (m, 2H), 3.47 (t, J = 6.8 Hz, 1H), 2.36-2.27 (m, 2H), 2.21 (s, 6H), 2.01-1.99 (m, 16H), 1.88-1.77 (m, 2H), 1.68-1.53 ​​(m, 6H), 1.42-1.19 (m, 34H), 0.96-0.86 (t, J = 3.7 Hz, 6H). C 43 H 79 MS (APCI) of NO2: 642.6 Synthesis of 3-((S)-2,2-di((6Z,12Z)-octadeca-6-12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropane-1-amine, AKG-KC3-01, O-12096

[0463] [ka] The procedure was described above. 3-((S)-2,2-di((6Z,12Z)-octadeca-6-12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-01, O-12096) (255 mg, 0.39 mmol, 51%) as a transparent oily substance. 1 H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 8H), 4.06-4.02 (m, 2H), 3.48-3.44 (m, 1H), 2.35-2.30 (m, 2H), 2.25 (s, 6H), 2.01-1.98 (m, 16H), 1.70-1.51 (m, 12H), 1.35-1.25 (m, 32H), 0.90-0.85 (t, J = 6.6 Hz, 6H). C 44 H 81 MS (APCI) of NO2: 656.6 Synthesis of 2-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-OA, O-11880) 2-((S)-2,2-di((Z)-hexadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine(AKG-KC2-PA, O-11879) 3-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropane-1-amine(AKG-KC3-OA,O-11957)

[0464] [ka] Experimental procedure (refer to the synthesis of AKG-KC2-01 described above) (Z)-1-bromooctadeca-9-ene3 synthesis

[0465] [ka] The procedure was described above. (Z)-1-bromooctadeca-9-ene (6.4g, 19.33 mmol) as a transparent oily substance. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.41 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 22H), 0.87 (t, J = 6.6 Hz, 3H). (Z)-16-bromohexadeca-7-en4

[0466] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.42 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 18H), 0.89 (t, J = 6.6 Hz, 3H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-diene-19-ol-5

[0467] [ka] The procedure was described above. (9Z,28Z)-heptatriaconta-9,28-dien-19-ol as a solid (1.2g, 2.25 mmol, 47%). 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1.42-1.26 (m, 53H), 0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-Tritriaconta-7,26-Diene-17-All6

[0468] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1.42-1.26 (m, 45H), 0.89 (t, J = 6.6 Hz, 6H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-diene-19-one 7

[0469] [ka] The procedure was described above. (9Z,28Z)-heptatriaconta-9,28-dien-19-one as a transparent oily substance (0.89 g, 1.67 mmol, 74%). 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 52H), 0.90-0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-tritriaconta-7,26-diene-17-on8

[0470] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 44H), 0.90-0.89 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolane-4-yl)ethane-1-ol-9

[0471] [ka] The procedure was described above. 2-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)ethane-1-ol as a transparent oily substance (0.39 g, 0.63 mmol, 74%). 1 H NMR (300 MHz, CDCl3): 5.36-5.28 (m, 4H), 4.22-4.10 (m, 1H), 4.08-4.05 (m, 1H), 3.82-3.79 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.24-2.21 (m, 1H), 2.01-1.99 (m, 8H), 1.81-1.80 (m, 2H), 1.59-1.54 (m, 6H), 1.34-1.26 (m, 45H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-hexadeca-9-ene-1-yl)-1,3-dioxolan-4-yl)ethane-1-ol, 10

[0472] [ka] The procedure was described above. 2-((S)-2,2-di((Z)-hexadeca-9-en-1-yl)-1,3-dioxolan-4-yl)ethane-1-ol as a transparent oily substance (1.02 g, 1.65 mmol, 51%). 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 4.23-4.10 (m, 1H), 4.07-4.05 (m, 1H), 3.82-3.79 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.24-2.12 (m, 1H), 2.01-1.97 (m, 8H), 1.84-1.78 (m, 2H), 1.57-1.55 (m, 8H), 1.34-1.29 (m, 35H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 3-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)propane-1-ol, 11

[0473] [ka] The procedure was described above. 3-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol as a transparent oily substance (0.41 g, 0.65 mmol, 76%). 1 H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 4H), 4.06-4.03 (m, 2H), 3.71-3.67 (m, 2H), 3.47-3.46 (m, 1H), 2.01-1.99 (m, 10H), 1.66-1.59 (m, 4H), 1.56-1.54 (m, 6H), 1.34-1.26 (m, 44H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-OA, O-11880)

[0474] [ka] The procedure was described above. 2-((S)-2,2-di((Z)-hexadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-OA, O-11880) (200 mg, 0.31 mmol, 49%) as a transparent oily substance. 1 H NMR (300 MHz, CDCl3): 5.38-5.28 (m, 4H), 4.08-4.01 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.39-2.24 (m, 2H), 2.21 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.68-1.52 (m, 6H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). C 43 H 83 MS (APCI) of NO2: 646.7 Synthesis of 2-((S)-2,2-di((Z)-hexadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-PA, O-11879)

[0475] [ka] The procedure was described above. 2-((S)-2,2-di((Z)-hexadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethane-1-amine (AKG-KC2-PA, O-11879) (195 mg, 0.33 mmol, 18%) as a transparent oily substance. 1H NMR (300 MHz, CDCl3): 5.35-5.28 (m, 4H), 4.08-4.02 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.38-2.27 (m, 2H), 2.20 (s, 6H), 2.01-1.99 (m, 8H), 1.97-1.80 (m, 2H), 1.77-1.52 (m, 6H), 1.34-1.29 (m, 38H), 0.87 (t, J = 6.3 Hz, 6H). C 39 H 75 MS (APCI) of NO2: 590.6 Synthesis of 3-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropane-1-amine (AKG-KC3-OA, O-11957)

[0476] [ka] The procedure was described above. 3-((S)-2,2-di((Z)-octadeca-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA, O-11957) (160 mg, 0.24 mmol, 37%) as a transparent oily substance. 1 H NMR (300 MHz, CDCl3): 5.39-5.28 (m, 4H), 4.06-4.01 (m, 2H), 3.44 (t, J = 6.8 Hz, 1H), 2.26 (t, J = 6.8 Hz, 2H), 2.20 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.60-1.43 (m, 8H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). C 44 H 85 MS (APCI) of NO2: 660.6

[0477] [Example 2] In vitro analysis of cytotoxicity in human hepatocytes or cancer cells LNPs can be tested in vitro with a series of 10 dilutions to determine their IC50 in human hepatocytes / liver (HepG2; ATCC#HB8065) ​​cells. Since these formulations are generally considered non-toxic, a positive control of lipofectamine® 3000 (ThermoFisher#L3000015) compound mRNA (2 μL reagent / 1 μg mRNA) is included in all tests. The mRNAs used are CleanCap FLuc, EGFP, or MCherry reporter gene mRNA (5 moU; Trilink#L-7202, #L-7201, or #L-7203). Data are recorded from overall cell viability curves and calculations of actual IC50 values ​​for each compound.

[0478] Adherent cells are grown to approximately 80% confluence. The cells are trypsinized by adding 0.25% trypsin-EDTA (Gibco #25200-072), followed by cell sedimentation, and then dispersing the cells with 5 mL of growth medium (MEM medium; Corning #10010CM). Cell density is determined using a hemocytometer. Growth medium (MEM medium containing 10% FBS; Corning #35015CV) is added to the cells to adjust them to an appropriate concentration. Then, 200 μL of cells (5,000 cells / well) are added to a 96-well clear flat-bottom plate (Costar #9804) and incubated in a humidified incubator at 37°C with 5% CO2 for 24 hours.

[0479] Serial dilutions of the LNP formulations were prepared using growth medium as the solvent. These compounds were produced as sterile aqueous solutions with a concentration of 1 mg / mL mRNA. Each LNP stock was warmed to room temperature to prepare the dilutions. These were further diluted fourfold in growth medium to obtain the highest mRNA concentration tested, 250 ug / mL.

[0480] LNPs were added to the wells by aspirating and removing the old medium and replacing it with 200 μL of LNP-containing medium, diluting each LNP sequentially in a 1:3 ratio from its initial concentration of 250 μg / mL. The plates were incubated in a humidified incubator at 37°C with 5% CO2 for 72 hours. At the end of the LNP incubation period, the medium in each well was replaced with 100 μL of 1X PrestoBlue Cell Viability reagent (ThermoFisher catalog #A13261). The plates were incubated in a humidified incubator at 37°C with 5% CO2 for 30 minutes to 2 hours. Reads were taken at 30, 60, and 120 minutes. Fluorescence was read at excitation at 560 nm and emission at 590 nm using a SpectraMax M5 plate reader (Molecular Devices). Background was corrected by subtracting the RFU of a control (background control well) containing only culture medium from all sample readings. The percentage of cytotoxicity is calculated using the following formula: %Cytotoxicity=[(RFU 培地 -RFU 処置 ) / RFU 培地 ] × 100% IC50 was determined using GraphPad Prism with the following formula: Y=100 / (1+10^((LogIC50-X)*HillSlope)))

[0481] The cytotoxicity of a Lipofectamine® 3000 (ThermoFisher #L3000015) complex mRNA (2 μL reagent / 1 μg mRNA) positive control may be 5 to 100 times more toxic than the compounds disclosed herein in some embodiments. This indicates that the disclosed compounds are less toxic than commercially available transfection reagents in in vitro hepatocyte cytotoxicity analysis. In some embodiments, the compounds described herein form LNPs in vivo with lower toxicity than commercially available transfection reagents.

[0482] [Example 3] Determination of the pKa of ionized lipids The pKa of ionized cationic lipids can be calculated by several methods. This is sometimes difficult with lipids because the membrane structure and adjacent lipids within the membrane can affect the dissociation characteristics of the amino group, potentially leading to inaccurate values. In this case, in-situ measurement, where the apparent pKa of the ionized lipid is measured while the lipid is in its intended environment, is ideal as part of a LNP (Large-Nutrition Polypeptide) (Jayaraman 2012, Sabins 2018).

[0483] For each LNP formulation, the pKa value of the aminolipid is determined by measuring the fluorescence of 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS) during titration from pH 3 to 12. TNS is an anionic molecule that does not fluoresce in solution but increases in fluorescence when interacting with a positive lipid membrane, a property that has traditionally been used to investigate the surface charge of membranes. A master buffer stock (10 mM sodium phosphate, 10 mM sodium borate, 10 mM sodium citrate, 150 mM sodium chloride) is prepared to create buffers at various pH values ​​for determining apparent pKa. Approximately 20 specific buffers at various pH values ​​from about 3 to 12 are prepared from the master buffer stock using 1 M sodium hydroxide and 1 M hydrochloric acid. 300 mM 6-(p-toluidino)-2-naphthalenesulfonic acid sodium salt (TNS reagent) solubilized in dimethyl sulfoxide (DMSO) is used as the stock. LNPs are prepared and purified to obtain a buffer at the desired pH with a final mRNA concentration of 0.04 mg / mL. Using a 96-well plate, the mRNA-containing LNPs are pre-inserted with the desired buffer and then added to achieve a final mRNA concentration of 0.7 μg / mL. TNS is added to each well to achieve a DMSO concentration of 1% (v / v). After mixing, the fluorescence of the TNS in each well is measured (Ex / Em = 331 nm / 445 nm), and sigmoidal best fit analysis is applied to the fluorescence data. The pKa is determined as the pH at which the full width at half maximum fluorescence intensity is obtained. The apparent pKas measured for compounds 1-36 are in the range of pH 6.0-7.0.

[0484] [Example 4] Measurement of LNP uptake by cells Cellular uptake of LNPs is measured by fluorescence imaging and / or fluorescence quantification. Many suitable fluorescence tracers are available, such as 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI), 3,3'-dilinoleyloxacarbocyanine perchlorate (DiO), 1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine perchlorate (DiD), and iodized 1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine (DiR) (Thermo). These lipids emit slight fluorescence in water but show high fluorescence when incorporated into lipid membranes, such as those present in LNPs. It is important that the selected lipids are photostability and have a high extinction coefficient.

[0485] LNPs containing these types of lipids are visualized under a fluorescence microscope. In one method, the LNP lipid preparation contains a fluorescent lipid tracer such as 1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine-5,5'-disulfonic acid (DiI5-DS) at 0.1–0.5 mol% of the total lipids. The target cells are grown in a suitable cell culture dish such as a 24-well plate (Corning). The cells are seeded the day before the uptake study at 50% confluence and grown overnight under appropriate conditions, e.g., 37°C, 5% CO2, and 90–100% humidity. LNPs are added to the cell culture medium at 0.1–100 ug / mL mRNA and allowed to interact with the cells for a certain period of time (4–24 hours). The cells are then washed three times with the medium to remove uninternalized LNPs and observed. The cells are observed using a microscope with fluorescence detection capability. Using untreated cells as a background control, the relative range of LNP cell uptake is determined from the fluorescence intensity signal obtained from the cells. Alternatively, quantitative measurement of fluorescent cell lipids can be achieved by pelleting the cells, solubilizing them with a washing agent such as Triton-X100, and quantifying the fluorescence by spectrofluorometer or quantifying the fluorescent lipid tracer by HPLC.

[0486] Quantification of fluorescently labeled mRNA can be achieved in a similar manner. For example, both dye-labeled high-sensitivity green fluorescent protein (EGFP) and firefly luciferase (FLuc) mRNAs are transcribed in a 1:3 ratio of cyanine 5-UTP:5-methoxy-UTP and are currently available from Trilink Biotechnologies. Cyanine 5 has an excitation maximum at 650 nm and an emission maximum at 670 nm. mRNA obtained by substitution in this ratio is readily visualized and can still be translated in cell culture. Intracellular transport of mRNA by the above method can be visualized by capturing the fluorescently labeled mRNA.

[0487] Intracellular LNP uptake can be achieved through endogenous methods such as ApoE-mediated uptake, or exogenous methods such as active targeting. LNP systems containing ionized cationic lipids have been found to utilize a "spontaneous" targeting process, adsorbing apolipoprotein E (ApoE) in the blood (Cullis et al. 2017) and then being actively taken up into hepatocytes by numerous receptors containing ApoE-binding ligands (Williams et al. 2010). By using non-overlapping fluorophores, it is possible to independently track the intracellular distribution and organelle accumulation dynamics of mRNA and LNPs.

[0488] mRNA cell expression levels can be quantified using reporter systems such as EGFP, FLuc, or mCherry, available from Trilink Biotechnologies. In one embodiment, EGFP mRNA is encapsulated in LNPs and added to target cells at a concentration of 0.1–100 ug / mL mRNA. After 4–24 hours, the medium may be replaced to wash away non-internalized LNPs from the cells. At 24 hours, the GFP signal is quantified by fluorescence microscopy or flow cytometry. This method allows for the differentiation of a panel of LNP formulations based on reporter protein expression levels.

[0489] [Example 5] Transfection Selection Index The transfection selectivity index (TSI) is calculated to determine the relative transfection efficiency within mammalian cells (compared to the relative toxicity within the same cell). The selectivity index was calculated using the following formula: TSI=EF 哺乳類 / I C 50、哺乳類

[0490] In the formula, EF 哺乳類 IC is the transfection efficiency expressed in terms of protein (ng) / million cells, and 50、哺乳類 This relates to the cell viability of the same formulation when converted to a half-width inhibitory concentration.

[0491] LNPs using the compounds described herein (1-36) have a TSI 50% higher than LNPs made using the same LNP except that which was made using the control molecule DLin-MC3-DMA as the ICL.

[0492] [Example 6] Analysis of lipid peroxidation reaction The degree of oxidation can be determined using a forced decomposition assay in which LNP samples are treated with 3% H2O2 at 25°C and lipid oxidation products are sampled on days 0, 1, 3, and 5 (Blessy et al. (2014) Journal of Pharmaceutical Analysis 4, 159-165). The oxidation reaction can be inactivated by adding 0.1 M butylated hydroxytoluene (BHT) in ethanol, and the samples can be frozen and stored at -80°C until measurement. The lipid oxidation products can be measured using a 2-thiobarbituric acid (TBA) reactivity assay (Gutteridge (1982) FEBS Letters 150, 454-458) to detect malondialdehyde (MDA), the final product of the lipid peroxidation reaction, or by detection using an HPLC assay with evaporative light scattering detection (ELSD) or charged aerosol detection (CAD). The impurity structures of lipid oxidation and isomerization can be assigned based on known prior literature and are expected to be mixtures of isomers.

[0493] In general, in this field, lipids with multiple unsaturated acyl chains are known to be sensitive to oxidation (see Reis and Spickett (2012) Biochim Biophys Acta 1818, 2374-2387).

[0494] Compounds 1-36 described herein are presumed to be less vulnerable to oxidative damage or degradation compared to control LNPs containing DLin-KC2-DMA lipids or control LNPs containing DLin-MC3-DMA. In some embodiments, the compounds provided herein produce more than 30%, 50%, 75%, 90%, and 95% fewer oxidative byproducts compared to control LNPs.

[0495] [Example 7] Preparation of ligand-targeted LNPs Antibody ligands in the form of antibody Fab' fragments or single-stranded Fv fragments that result in the specific uptake of LNPs into target cells such as immune cells are prepared by any method known in the art (for example, described in Drummond et al., U.S. Patent Application No. 20180271998; Zhou et al., U.S. Patent No. 10,406,225; Marks et al., U.S. Patent No. 8,974,792, which are part of this specification by reference). To result in the coupling of the ligand to LNPs, the ligand is constructed by a C-terminal sequence having cysteine ​​residues (e.g., CAA or GGSGGC). The ligand is expressed in bacterial or eukaryotic cells and isolated from cell clumps or growth media using standard methods such as protein affinity chromatography or metal chelation chromatography. To activate the thiol group of the terminal cysteine ​​residue, the ligand is incubated for 1 hour in 10 mM citrate buffer (pH 6.0-6.2) containing 140 mM NaCl in the presence of 15 mM cysteine, and purified by gel chromatography using 10 mM citrate buffer (pH 6.0-6.2) containing 140 mM NaCl as the eluent on a Sephadex G-25 or similar column. The protein concentration in the purified cysteine-activated ligand solution is determined by UV spectrophotometry at 280 nm. 1-10 mg / mL of the antibody ligand in the specified buffer is mixed with an aqueous solution of a maleimide-terminated PEG-DSPE derivative (mal-PEG(2000)-DSPE, catalog number 880126, Avanti Polar Lipids, Alabama, USA, or Sunbright® DSPE-020MA, NOF Corporation, Japan) in a protein / lipid molar ratio of 4:1. If a long distance between the LNP surface and the ligand moiety is desired, Mal-PEG lipids with PEG spacers of molecular weight 3,400 (Sunbright® DSPE-034MA) or 5,000 (Sunbright® DSPE-050MA), available from NOF Corporation, can be used.The solution is incubated at ambient temperature for 2 hours, adjusted to 0.5 mM cysteine ​​to block unreacted maleimide groups, and the micelle ligand-PEG-DSPE complex is purified by gel chromatography on Ultrogel AcA34 (when ligand is Fab) or Ultrogel AcA44 (when ligand is scFv) using 144 mM NaCl buffered with 10 mM HEPES (pH 7.0-7.4) as the eluent. The conjugated protein is quantified by UV spectrophotometry, and its purity is determined by SDS gel electrophoresis.

[0496] The ligand is attached to the surface of the LNP by one of the following methods.

[0497] Method 1 Pre-formed LNPs (obtained as described in Hope et al. US10,653,780, which are incorporated herein by reference) are mixed with a micelle solution of ligand-PEG-DSPE complexes in HEPES buffered saline (10 mM HEPES, 140 mM NaCl, pH 7.0–7.2) to achieve ligands with a ligand / lipid ratio in the range of 5–100 (typically 15–30) per LNP particle. The mixture is incubated with slow stirring for 2 hours at 37–40°C or overnight at 2–8°C, during which time the complexes are incorporated into the outer lipid layer of the LNPs. The ligand-complexed LNPs are purified from unincorporated ligand-PEG-DSPE by gel chromatography on Sepharose CL-2B or CL-4B (hydrophilic size exclusion media of the same fractional molecular weight can also be used), and the LNP fraction appears around the point where the void volume is collected. The amount of ligand conjugated to the particles is determined by SDS gel electrophoresis using Coomassie blue or fluorescent staining and a ligand standard substance run simultaneously.

[0498] Method 2: A solution of the ligand-PEG-DSPE complex in 10 mM sodium citrate buffer (pH 4.0) also containing the nucleic acid components of the LNP is mixed with an ethanol solution of the LNP lipid to a final ethanol concentration of 40 vol% as described in Semple et al., U.S. Patent No. 8,021,686, which is incorporated herein by reference. Alternatively, the LNP preparation protocol of Hope et al., U.S. Patent No. 10,653,780 (which is incorporated herein by reference) is used. The amount of ligand-PEG-DSPE is 0.1 to 1 mol% of the lipid. The mixture is dialyzed against HEPES buffered saline (10 mM HEPES, 140 mM NaCl, pH 7.0) to remove the ethanol. The ligand-PEG-DSPE is incorporated into the resulting LNP. All residual ligand-PEG-DSPE is removed by gel chromatography using Sepharose CL-4B or CL-2B and HEPES buffered saline as the eluent, or by buffer exchange of HEPES buffered saline by tangential flow filtration on a polysulfone membrane (flat or hollow fiber cartridge) with a fractional molecular weight of 500 kD.

[0499] Method 3: Mal-PEG-DSPE is combined with pre-formed LNPs in citrate-buffered saline (10 mM sodium citrate buffer (pH 6.0-6.2), 140 mM NaCl) in an amount of 0.1-1 mol% relative to the LNP lipid, using the same method as for ligand-PEG-DSPE in Method 1. The LNPs, along with the incorporated mal-PEG-DSPE, are purified from the unincorporated mal-PEG-DSPE by gel chromatography on Sepharose CL-4B in the same buffer, and incubated with thiol-activated antibody ligands (5-100 ligands per LNP particle) for 2-24 hours. The resulting ligand-conjugated LNPs are then purified from the unconjugated ligands by Sepharose CL-4B gel chromatography using HEPES-buffered saline (pH 7.0) as an eluent.

[0500] Method 4: Mal-PEG-DSPE is incorporated into 0.1-1 mol% of LNP lipids using the same method as for ligand-PEG-DSPE in Method 2. The resulting Mal-PEG-conjugated LNPs are incubated with a thiol-activating ligand and purified as described in Method 3.

[0501] Method 5 follows the protocol of Method 4, but differs in that a maleimide complex lipid without a PEG spacer (mal-DSPE, Coatsome® FE-808MA3, NOF Corporation, Japan) is added to the lipid solution instead of mal-PEG-DSPE. The resulting maleimide-LNP is then coupled to a thiol-activating ligand as in Method 3.

[0502] Method 6: A small molecule ligand (e.g., mannose) is conjugated to an LNP by Method 1 or 2, in which mannose-PEG-DSPE (Biochempeg Scientific, Massachusetts, USA, catalog number 12169) replaces the antibody ligand-PEG-DSPE.

[0503] [Example 8] Determination of the optimal ligand density for ligand-targeted LNPs Prepare an LNP panel with increased ligand density within a given range (2 to 200 ligands per LNP particle or 5 to 100 ligands per LNP particle) using one of the methods of Example 7. Fluorescently label the LNPs by incorporating fluorescently labeled lipids or fluorescently labeled nucleic acids as described in Example 4. Test the labeled ligand-coupled LNPs for cellular uptake according to Example 4 to determine the ligand content corresponding to the maximum ligand-specific cellular uptake of the LNPs. The intracellular function of the nucleic acid (e.g., mRNA expression) can be used as the analytical output (Example 4), in which case the presence of detectable labels for lipids or nucleic acids is not required.

[0504] [Example 9] Preparation of lipid nanoparticles (LNPs) mRNA modified with 5-methoxyuridine (5moU) and encoding mCherry (catalog #L-7203) was obtained from Trilink Biotechnologies (San Diego, California). All uridine nucleosides were replaced with N1-methyl-psoiduridine. To generate mRNA, a synthetic gene encoding the mRNA sequence was cloned into a DNA plasmid. The synthetic gene consisted of an RNA promoter, a 5' untranslated region, the mCherry protein-coding sequence, a 3' untranslated region, and a poly(A)tail region of approximately 120 As. The open reading frame sequence of mCherry mRNA from TriLink (catalog #L-7203) is SEQ ID NO: 1: AUGGUGAGCAAGGGCGAGGAGGACAACAUGGCCAUCAUCAAGGAGUUCAUGCGGUUCAAGGUGCACAUGGAGGGCAGCGUGAACGGCCACGAGUUCGAGAUCGAGGGCGAGGGCGAGGCCGGCCCUACGAGGGCACCCAGACCGCCAAGCUGAAGGUGACCAAGGGCGGCCCCCUGCCC UUCGCCUGGGACAUCCUGAGCCCCAGUUCAUGUACGGCAGCAAGGCCUACGUGAAGCACCCCGCCGACAUCCCGGACUACCUGAAGCUGAGCUUCCCCGAGGGCUUCAAGUGGGAGCGGGUGAUGAACUUCGAGGACGGCGGCGUGGACCGUGACCCAGGACAGCAGCCUGCAGGAC GGCGAGUUCAUCUACAAGGUGAAGCUGCGGGGCACCAACUUCCCCAGCGACGGCCCCGUGAUGCAGAAGAAGACCAUGGGCUGGGAGGCCAGCAGCGAGCGGAUGUACCCCGAGGACGGCGCCCUGAAGGGCGAGAUCAAGCAGCGGCUGAAGCUGAAGGACGGCGGCCACUACGACGCC GAGGUGAAGACCACCUACAAGGCCAAGAAGCCCGUGCAGCUGCCCGGCGCCUACAACGUGAACAUCAAGCUGGACAUCACCAGCCACAACGAGGACUACACCAUCGUGGAGCAGUACGAGCGGGCCGAGGGCCGGCACAGCACCGGCGGCAUGGACGAGCUGUACAAGAGCGGCAACUGA It corresponds to this.

[0505] Stock solutions for each lipid were prepared. Ionized lipids were weighed into 4 mL glass vials (Thermo B7999-2) and dissolved in ethanol (Sigma-Aldrich 200 standard strength, RNase-free) to a final concentration of 10 mM. Other lipids such as DSPS, cholesterol, and PEG-DMG were weighed and dissolved in ethanol to a concentration of 1 mM. DSPS was dissolved in 1 mM methanol (Sulpelco, Omnisolve) and gently heated to 70°C to complete dissolution.

[0506] Lipid mixtures for each individual LNP were prepared by adding the desired volume of each lipid stock solution to a new bottle and adding ethanol as needed to achieve a final volume of 1.2 mL. For example, an LNP preparation with an N / P ratio of 5, AKG-UO-1 / DSPC / DSPS / Chol / PEG-DMG (50 / 2.5 / 7.5 / 38.5 / 1.5 mol%), contained 1500 nmol of AKG-UO-1, 75 nmol of DSPC, 225 nmol of DSPS, 1155 nmol of Chol, and 45 nmol of PEG-DMG for every 100 μg of mRNA used.

[0507] An mRNA solution was prepared by thawing a frozen mRNA (mCherry mRNA, Trilink) vial and diluting the mRNA in 6.25 mM sodium acetate (pH 5.0) to a final concentration of 0.033 mg / mL. A NanoAssemblr Benchtop microfluidic device (Precision Nanosystems) was used to prepare LNPs. If the LNPs contained DSPS, a heating block accessory set to 70°C was used; otherwise, the LNPs were mixed at room temperature. 3 mL of mRNA solution was filled into a 3 mL disposable syringe (BD309656), and 1 mL of lipid mixture was filled into a 1 mL syringe (BD309659). These syringes were placed in the NanoAssemblr heating block for 4 minutes and then mixed. LNP formation was achieved by pumping a liquid stream of 3:1 water:alcohol volume ratio through a disposable microfluidic cassette at a mixing rate of 6 mL / min. After mixing, 3.6 mL of the LNP mixture was collected, and the first 0.35 mL of the mixture and the last 0.05 mL of the mixture were discarded. Ethanol was removed by buffer exchange using SpectraPor dialysis tubes (12-14 k MWCO) in PBS (Cytivia, SH30256.01), or by continuous concentration and dilution using an Aminon Ultra-4 centrifugal concentrator.

[0508] LNPs were typically replaced with PBS at pH 7.4, then with 15 mM Tris (pH 7.4) 20% sucrose, concentrated to 20–50 ug / mL mRNA, filtered by bacterial filtration (Thermo Nalgene 0.2um #720-1320), frozen by immersion in liquid nitrogen for 5 minutes, and stored long-term at -20°C.

[0509] [Example 10] Characterization of LNP A. Determination of mRNA concentration and relative encapsulation efficiency using fluorescent dyes. Materials: RiboGreen reagent (Thermo #11491), lidded 3x96 well plate, PBS, dissociation buffer (PBS with 10% DMSO and 1% (wt / wt) Zwittergent 3-14 (Sigma-Aldrich #693017)), mRNA, general pipette tips & repeater pipette tips 1. 5 mL of 2 μg / mL mRNA stock was prepared in DPBS or PBS. 2. Diluted standard substances were prepared in a single well of a 96-well plate (Plate A) as follows.

[0510] JPEG0007848206000265.jpg561703. Using various wells on plate A, the samples were diluted to fall within the range of the standard curve (one well required per sample). For example, the approximate mRNA concentration in the sample should be about 30 ug / mL, and a 20-fold dilution was performed (dilution factor). (20 uL of sample was added to 380 μL of PBS in one well). No lid was used on plate A. The samples were mixed by gently adding and removing them with a pipette. Example of Plate A

[0511] JPEG0007848206000266.jpg641704. Furthermore, plates B and C of two additional plates were used. Using a multichannel pipette, 60 μL of each standard 2 was pipetted into each well (2-part set), and then sampled into three wells (3-part set). Examples of plates B and C

[0512] JPEG0007848206000267.jpg651705. The number of wells used in each plate was counted, and 4 was added to this number. In plate B, PBS was prepared using RiboGreen diluted 1:100. For example, in a 40-well plate, 44 was used as the number. 44 × 60 μL = 2.64 mL of RiboGreen solution was required, and therefore it is estimated that 2.61 mL of PBS containing 26.4 μL of RiboGreen would be needed. 6. In plate C, 2.61 mL of dissociation buffer and 26.4 μL of RiboGreen were pipetteed in. 7. Using a 60 μL repeater pipette set, PBS + RiboGreen was added to each well of plate B, and 60 μL of dissociation buffer + RiboGreen was added to plate C. Both plates B and C were mixed for 1 minute using an orbital mixer (120 rpm). Plate B was left in the dark for 15 minutes. Plate C was incubated in the dark at 37°C for 10 minutes, followed by 5 minutes at room temperature. 8. Both plates were read alternately using excitation at 465 nm and emission at 530 nm. 9. Using a standard curve, the slope and intercept were calculated, and the mRNA concentrations of the samples on plates B and C were calculated by extrapolation (mean and standard deviation). 10. The percentage (%EE) of encapsulation efficiency using [mRNA]plate B / [mRNA]plate C × 100 was calculated. 11. The total [mRNA] content was calculated using plate C × dilution factor. B. LNP particle size 1. 30 μL of LNPs were mixed with 1.5 mL of PBS in a polystyrene cuvette (Sarstedt, #67.754), and their size was analyzed using ZetaSizer Pro (Malvern) with ZS Xplorer software (version 1.4.0.105). Z-mean size and polydispersity index values ​​were recorded. Typically, LNP size measurements were performed after LNP mixing, buffer exchange, and bacterial filtration. C. LNP zeta potential 1. 30 μL of LNP was mixed with 1.5 mL of PBS and injected into disposable frilled capillary cells (Malvern Nanoseries DTS1070). Zeta potentials were measured on a ZetaSizer Pro at 25°C.

[0513] [Example 11] Determination of transfection efficiency of LNPs in mouse dendritic cells using mCherry mRNA A. Cell proliferation, transfection, harvesting, and staining protocols 1. MutuDC1940 cells (ABM) were grown in T75 flasks according to the supplier's instructions. If necessary, these cells were seeded into 24-well plates at 180,000 cells / well per day prior to transfection. 2. 1 μg of LNP in 1 mL of medium was added to each well in three sets, and after 24 hours, the cells were washed once with DPBS (VWR02-0119-1000). 3. Next, 0.2 mL of DPBS (plus 5 mM EDTA (pH 7.4)) was added to promote separation. 4. The cells were left at 37°C for 3 minutes until they were separated. 5. 0.5 mL of DPBS was added to each well, and the liquid was transferred to a flow cytometry tube (Falcon 5 mL #352054). 6. The tube was centrifuged at 1100 rpm for 3-5 minutes, and the liquid was discarded. 7. 100 μL of Zombie Violet (Biolegend) (diluted 1:500 in PBS) was added to each tube. 8. Gently tap the tube to resuspend the cells, and leave it at room temperature in the dark for 15 minutes. 9. Add 0.5 mL of (PBS:DPBS=1:1 with 4% paraformaldehyde) to the cells, gently tap the cells to resuspend them, and place them on ice for 30 minutes. Then add another 2 mL of PBS. 10. The cells were pelleted as described above, resuspended in 0.5 mL of DPBS containing 5% BSA, and kept in the refrigerator until needed. B. Cell analysis 1. Cell suspensions were analyzed by an Attune NxT flow cytometer using VL1 and YL2 for viability / death and mCherry fluorescence signals, respectively. Gating analysis was performed using FloJo software.

[0514] [Example 12] Effect of DSPS on the transfection efficiency of dendritic cells using LNPs containing KC2 as an ionized cationic lipid The objective of this study was to investigate the effect of phosphatidylserine targeting on transfection efficiency in mouse dendritic cells using DSPS. LNPs were prepared as described in Example 9, characterized for particle size and zeta potential as described in Example 10, and evaluated for transfection efficiency in mouse dendritic cells as described in Example 11. All LNPs had a constant DLin-KC2-DMA with an N / P ratio of 5 and 50 mol% of total lipids. PS lipids varied from 0 to 2.5 mol%, DSPC phospholipids varied from 0 to 7.5 mol% (the total mol% of DSPC and DSPS was constant at 10 mol%), and cholesterol was constant at 38.5 mol% (total mol% of total lipids). The particle size, polydispersity index (PDI), and encapsulation efficiency of all formulations are shown in Tables 5 and 6 below.

[0515] JPEG0007848206000268.jpg45170

[0516] JPEG0007848206000269.jpg51170

[0517] Initial sets of DLin-KC2-DMA-containing LNPs and various phosphatidylserines in the form of 0–2.5 mol% DSPS showed some transfection with 0 mol% or 0.5 mol% DSPS, but showed an 18-fold increase when introduced with 2.5 mol% DSPS (Figure 3A). A second series of LNPs prepared with 0–7.5 mol% DSPS was evaluated at 0.1, 0.3, and 1 μg / mL mRNA concentrations (Figures 3B, 3C, and 3D). Transfection efficiency increased with increasing DSPS mol% above 2.5 mol%, with maximum values ​​of 7.5 mol% at 1 μg / mL mRNA and 5 mol% at both 0.1 and 0.3 μg / mL mRNA. These data demonstrate that the inclusion of phosphatidyl-L-serine can dramatically increase the transfection efficiency of mRNA-containing LNPs, with maximum uptake occurring at 5–7.5 mol% of DSPS (as a percentage of total lipids).

[0518] [Example 13] Effects of ICL and anionic phospholipid target ligands on mRNA transfection of dendritic cells The purpose of this study was to determine whether other anionic phospholipids can enhance the transfection efficiency of LNPs, and to confirm how LNPs prepared with various ICL and PS targeting are thought to transfect dendritic cells. LNPs were prepared as described in Example 9, their particle size and zeta potential were characterized as described in Example 10, and their transfection efficiency in mouse dendritic cells was evaluated as described in Example 11. The LNPs had a constant N / P ratio of 5 and various ICLs (DLin-KC2-DMA, KC2-OA, KC3-OA, or SM-102) at 50 mol% of total lipids, while PS lipids were maintained at a constant 5 mol%, DSPC at 5 mol%, and cholesterol at a constant 38.5 mol% (total mol% of total lipids). The particle size, PDI, and encapsulation efficiency of all formulations are shown in Table 7 below.

[0519] JPEG0007848206000270.jpg70170

[0520] The transfection results are shown in Figure 4, demonstrating high transfection rates with LNPs prepared using three different KC-based ICLs (KC2, KC2-OA, and KC3-OA), as well as the branched ICL SM-102. All formulations, including those prepared with alternative anionic phospholipids (Suc-DSPE or Glu-DSPE), exhibited high encapsulation efficiency and particle size less than 100 nm. The data demonstrate that DSPS (L-serine) yields the same high levels of mRNA transfection despite the possibility of substitution with either N-glutaryl-distearoylphosphatidylethanolamine (Glu-DSPE) or N-succinyl-distearoylphosphatidylethanolamine (Suc-DSPE), both containing two negative charges, and both containing the same distearoyl (C18:0) fully saturated acyl chain. These studies also clearly demonstrate that the addition of DSPS can result in high transfection efficiency for other ionized cationic lipids, including those with a single unsaturated acyl chain (KC2-OA or KC3-OA) and those containing branched ICLs such as SM-102. For example, the addition of DSPS to SM-102-containing LNPs resulted in a 22-fold increase in mCherry expression.

[0521] [Example 14] Dependence of PS targeting on ICL and PS structure The purpose of this study was to compare PS-targeted LNPs with KC2 and KC3 ionized cationic lipids of various acyl chain compositions. KC2 lipids with a dimethylaminoethyl head group structure were compared with KC3 lipids containing a dimethylaminopropyl derivatized head group. The LNPs contained various ICLs (KC2, KC2-01, KC2-OA, KC2-PA, KC3-OA, and KC3-01) as ICLs with an N / P ratio of 5 and 50 mol%, as well as a constant 1.5 mol% of PEG-DMG. The cholesterol content was maintained at a constant 38.5 mol%, and the DSPC content fluctuated inversely to the mol% of DSPS, either 0 or 5 mol% (all lipid concentrations were used as mol% of total lipids). Transfection efficiency was evaluated in mouse dendritic cells as described in Example 11.

[0522] JPEG0007848206000271.jpg107170

[0523] The transfection results are shown in Figure 5, clearly demonstrating the positive effect of PS targeting on multiple KC-type ICLs. This specification shows that ICLs containing both unsaturated C16 and C18 ICLs can be targeted with phosphatidyl-L-serine, resulting in high transfection rates in dendritic cells. The highest transfection rates were observed with PS and PC, with 5 mol% DPPC and 5 mol% DSPS. The acyl chains do not match. This was generated when the composition was combined with C16ICL(KC2-PA).

[0524] [Example 15] Effect of phosphatidylserine structure on the transfection efficiency of LNP The purpose of this study was to investigate the effect of various anionic phospholipid structures on transfection efficiency in dendritic cells. LNPs were prepared as described in Example 9, their particle size and zeta potential were characterized as described in Example 10, and their transfection efficiency in mouse dendritic cells was evaluated as described in Example 11. All LNPs had a constant AKG-UO-1 with an N / P ratio of 5 and 50 mol% of total lipids. The anionic lipids varied in opposition to DSPC phospholipids depending on the formulation, and cholesterol remained constant at 38.5 mol% except for LNPs with 20 mol% DSPS (all in mol% of total lipids). In the case of samples containing up to 10% phosphatidylserine, the phosphatidylcholine composition decreased by 10 mol% accordingly. For example, LNPs with 5 mol% DSPS contained 5 mol% DSPS and 5 mol% DSPC, while those containing 10 mol% DSPS did not contain DSPC. However, in the case of a sample containing 20 mol% DSPS, DSPC was not present in the formulation, and the mol% of cholesterol decreased by 10 mol% to 28.5 mol%.

[0525] The encapsulation efficiency of all formulations was 84-90%, indicating that mRNA was encapsulated in LNPs with high efficiency.

[0526] JPEG0007848206000272.jpg123170

[0527] Figure 6A evaluates the effects of various phosphatidylserine chemical forms and demonstrates the importance of saturation, acyl chain length, and serine stereochemistry for LNP transfection activity in mouse dendritic cells. phosphatidylserine analogs (DOPS) possessing oleic acid acyl chains or (D-serine) stereochemistry instead of L-serine induced transfection activity in LNPs comparable to that of LNPs prepared without any phosphatidylserine. However, LNPs prepared using PS containing serine L-isomers and saturated acyl chains exhibited significantly better transfection into dendritic cells compared to LNPs without any PS. Among the saturated series, those with C16 (DPPS) or C18 (DSPS) showed the highest activity, while those with C14 (DMPS) still showed lower activity, albeit with some improvement compared to dendritic cells treated with LNPs without any PS. In Figure 6B, the effects of other anionic phospholipids were evaluated using DSPG-containing formulations (5 or 7.5 mol%) that showed activity similar to the background, and N-glutaryl- or N-succinyl-distearoylphosphatidylethanolamine (Glu-DSPE or Suc-DSPE), which showed a milder 3-5-fold enhancement of activity when included in these AKG-UO-1-containing LNPs. This example shows that LNPs prepared with saturated phosphatidyl-L-serine transfect dendritic cells significantly better than those containing unsaturated dioleoylphosphatidyl-L-serine (DOPS) or the D isomer of DSPS. LNPs containing the L isomers of DSPS and DPPS showed the highest levels of transfection compared to other forms of PS, anionic N-glutaryl or N-succinyl DSPE analogs, or distearoylphosphatidylglycerol (DSPG) (either 5 or 7.5 mol%).

[0528] [Example 16] Optimization of DSPS density on AKG-UO-1-containing LNP The purpose of this study was to investigate the effect of DSPS density on the transfection efficiency of LNPs. LNPs were prepared as described in Example 9. The LNPs contained an N / P ratio of 5 and 0-20 mol% AKG-UO-1 as ICL in DSPS, as well as a constant 1.5 mol% PEG-DMG. The cholesterol content was maintained at a constant 38.5 mol%, while the DSPC content fluctuated inversely to the 0-10 mol% of DSPS (all lipid concentrations were used as mol% of total lipids). In a 20 mol% DSPS preparation, no DSPC was present, and the cholesterol content decreased by a total of 10 mol% (from 38.5 mol% to 28.5 mol%). Transfection efficiency was evaluated in mouse dendritic cells as described in Example 11.

[0529] JPEG0007848206000273.jpg84170

[0530] Figure 7 shows the dependence of LNP compositions on DSPS concentration in the case of LNPs containing AKG-UO-1. This study suggests that the presence of DSPS in the formulation enables high levels of dendritic cell transfection with 2.5–10 mol% DSPS and apparent peaks of approximately 5–7.5 mol% DSPS in the case of LNPs containing AKG-UO-1.

[0531] [Example 17] Effect of PEG on the transfection efficiency of AKG-UO-1-containing LNP The purpose of this study was to investigate the effect of PEG-lipid density on the transfection efficiency of untargeted LNPs and phosphatidyl-L-serine-targeted LNPs. LNPs were prepared as described in Example 9. The LNPs contained AKG-UO-1 as ICL with an N / P ratio of 5, either 0 or 5 mol% of DSPS, and 0.5–4.5 mol% of PEG-DMG. The cholesterol content was maintained at a constant 38.5 mol%, and the DSPS content was 10 mol% in formulations without DSPS and 5 mol% in formulations with 5 mol% DSPS. With PEG-DMG content exceeding 1.5 mol%, the total cholesterol content decreased by the amount of added PEG-DMG; for example, with a PEG-DMG content of 3.5 mol%, the cholesterol content decreased from 38.5 mol% to 36.5 mol%. Particles containing 0.5% PEG-DMG showed a negative zeta potential at pH 7.4 and a significant shift to a positive zeta potential at pH 5. LNPs containing 1.5–3.5 mol% PEG-DMG were essentially neutral at pH 7.

[0532] JPEG0007848206000274.jpg86170

[0533] Figure 8 shows the effect of PEG-DMG on dendritic cell transfection with DSPS-targeted LNPs containing AKG-UO-1 ICL. Formulations with 0.5% PEG-DMG showed 6-7 times higher transfection efficiency in the presence of 5% DSPS than those observed with 1.5-2.5% PEG-DMG. Transfection with 1.5% and 2.5% PEG-DMG was similar, but dramatically decreased with 3.5 mol% and 4.5 mol% PEG-DMG. The ratio of targeted to untargeted transfection varied at each PEG density, being 12-fold for 0.5% PEG, 7-fold for 1.5% PEG, 37-fold for 2.5% PEG, and less than 5-fold for 3.5% and 4.5% PEG, which is thought to be due to high PEG shielding of the PS-targeted portion. This combination of data indicates that the optimal PEG density range is 0.5–2.5% PEG-DMG, with the lower end of the range being optimal for overall transfection efficiency and 2.5% being optimal for target specificity.

[0534] [Example 18] Oxidation stability of ICL The purpose of this study was to compare ...

Claims

1. A lipid nanoparticle (LNP) composition, nucleic acids and, Sterols and The LNP composition comprises one or more phospholipids containing a total amount of (L-serine)phosphatidylserine (PS) lipids in an amount of 1.25 to 10 mol% of the total lipid content, Complex lipids, An ionized lipid having a chemical structure consisting of a pair of linear polyunsaturated lipid tails covalently bonded to a head group, wherein the head group contains a dialkylamino group, The head group comprises a heterocyclyl or alkyl moiety covalently bonded to the dialkylamino group, and optionally further comprises a phosphate group. Each polyunsaturated lipid tail is unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and optionally contains a single acyl group at the end of the lipid tail covalently bonded to the head group. a. The dialkylamino portion of the head group has the chemical structure of formula (IV-A) 【Chemistry 1】 [In the formula, In equation (IV-A), n is 2, 3, or 4. R in equation (IV-A) 10 and R 12 Each is independently selected from alkyl groups chosen from the group consisting of methyl, ethyl, and propyl, R 10 and R 12 The alkyl group in the compound is optionally substituted with one or more hydroxyls. The ionized lipid has a chemical structure in which the acyl group of each lipid tail is covalently bonded to a portion of the distal head group from the dialkylamino moiety of formula (IV-A). 【Chemistry 2】 It further includes, 【Transformation 3】 This indicates a connection to formula IV-A within the head base, and R 22 This represents a portion of each lipid tail covalently bonded to the acyl group, and formula A: 【Chemistry 4】 Formula A It has the following chemical structure, in formula A, 【Transformation 5】 Formulas A and R within each lipid tail are 22 This shows the connection with, a is 4, 1, 2, or 3. b is 4, 2, or 3. c is 4, 3, 5, 6, or 7. However, the sum of a, b, and c in equation A is 12, 10, 11, or 13. Optionally, R in formula (IV-A) 10 and R 12 are each independently methyl, ethyl, -(CH 2 )(CH 2 )OH, or -(CH 2 ) 2 (CH 2 )OH, and Optionally, b is 4, and R in equation (IV-A) 10 and R 12 Each of them is methyl; or b. The ionized lipid is of formula (I-A) 【Transformation 6】 Formula IA [In the formula, a is 4, 1, 2, 3, 5 or 6, b is 4, 3, or 2. c is 4, 3, 5, 6, or 7. The sum of a, b, and c is 12 or 10. q is 1, 2, 3, or 4. R 10 and R 12 Each of them is independently and optionally substituted with one or more hydroxyls (C 1 ~C 4 ) is alkyl, L is 【Transformation 7】 [where v is 0 or 1, and q2 is 2 or 1] It has the following chemical structure: Selectively, an ionized lipid where v is 0 and q is 1, 2, or 3. An LNP composition containing the following:

2. Each lipid tail is identical, and each lipid tail has a total of two olefins separated only by unsubstituted ethylene, n-propyl, or n-butyl. The composition according to claim 1, wherein each lipid tail optionally further comprises an acyl group that bonds to the oxygen of the head group to form an ester, and the composition has a total of 16 or 18 carbon atoms including the acyl group.

3. a. The dialkylamino portion of the head group has the chemical structure of formula (IV-A) 【Transformation 8】 [In the formula, In equation (IV-A), n is 2, 3, or 4. R in equation (IV-A) 10 and R 12 Each is independently selected from alkyl groups chosen from the group consisting of methyl, ethyl, and propyl, R 10 and R 12 The alkyl group in the compound is optionally substituted with one or more hydroxyls. b. A chemical structure in which the ionized lipid includes the acyl group of each lipid tail covalently bonded to a portion of the distal head group from the dialkylamino moiety of formula (IV-A). 【Chemistry 9】 It further includes, 【Chemistry 10】 This indicates a connection to formula IV-A within the head base, and R 22 This represents a portion of each lipid tail covalently bonded to the acyl group, and formula A: 【Chemistry 11】 Formula A It has the following chemical structure, in formula A, 【Chemistry 12】 Formulas A and R within each lipid tail are 22 This shows the connection with, a is 4, 1, 2, or 3. b is 4, 2, or 3. c is 4, 3, 5, 6, or 7. However, the sum of a, b, and c in equation A is 12, 10, 11, or 13. Optionally, R in equation (IV-A) 10 and R 12 However, each is independent of methyl, ethyl, and -(CH 2 ) (CH 2 )OH, or -(CH 2 ) 2 (CH 2 ) OH, Optionally, b is 4, and R in equation (IV-A) 10 and R 12 The composition according to claim 2, wherein each of them is methyl.

4. The aforementioned ionized lipid is given by formula (I-A) 【Chemistry 13】 [In the formula, a is 4, 1, 2, 3, 5 or 6, b is 4, 3, or 2. c is 4, 3, 5, 6, or 7. The sum of a, b, and c is 12 or 10. q is 1, 2, 3, or 4. R 10 and R 12 Each of them is independently and optionally substituted with one or more hydroxyls (C 1 ~C 4 ) is alkyl, L is 【Chemistry 14】 [where v is 0 or 1, and q2 is 2 or 1] It has the following chemical structure: The composition according to claim 1, wherein v is optionally 0 and q is 1, 2, or 3.

5. The ionized lipids are AKG-UO-1, AKG-UO-1A, AKG-UO-1B, AKG-UO-2, AKG-UO-4, AKG-UO-4A, AKG-UO-5, AKG-UO-6, AKG-UO-7, AKG-UO-8, AKG-UO-9, and AKG-UO-10: 【Chemical Engineering 15A】 【Chemical 15B】 A composition according to claim 4, selected from the group consisting of the following.

6. a. The nucleic acid, b. The ionized lipids, c. The sterols which are cholesterol, d. One or more phospholipids comprising the phosphatidylserine (PS) lipid, wherein (i) one or more phospholipids selected from the group consisting of DSPC, HSPC, DPPC, eggSM, and DOPC, and (ii) one or more phospholipids consisting of PS lipids selected from the group consisting of DPPS, DSPS, and DOPS. e. Complex lipids A composition according to any one of claims 1 to 5, comprising:

7. The one or more phospholipids mentioned above a. DSPC, and b. One or more PS lipids selected from the group consisting of (L-serine)DPPS and (L-serine)DSPS. It consists of, The composition contains a total amount of PS lipids of 2.5 to 10 mol% of the total lipids in the composition, The composition according to claim 6, wherein the composite lipid optionally contains PEG.

8. The ionized lipids are 【Chemistry 16】 A composition according to claim 1, selected from the group consisting of the following.

9. a. nucleic acid, b. An ionized cationic lipid according to any one of claims 1 to 5 or 8, in an amount of 40 to 65 mol% of the total lipid content of the LNP composition. c. Sterols in a total amount of 25 to 45 mol% of the total lipid content of the LNP composition. d. The LNP composition contains an anionic phospholipid targeting moiety in a total amount of 2.5 to 10 mol% of the total lipid content, and one or more phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition. e. A nucleic acid lipid nanoparticle (LNP) composition according to any one of claims 1 to 8, further comprising, optionally, a total amount of complex lipids in an amount of 0.5 to 2.5 mol% of the total lipid content of the LNP composition.

10. The nucleic acid is mRNA, Selectively, the sterol is cholesterol. The composition according to claim 9, wherein, optionally, one or more of the phospholipids consist of DSPC and L-serine PS.

11. The LNP composition contains a total amount of PS of 5.0 to 7.5 mol% of the total lipids in the composition. Optionally, the composite lipid may contain PEG. Optionally, the composite lipid is PEG-DMG, The composition according to claim 10, wherein the LNP composition optionally contains a total amount of complex lipids of 0.5 to 1.5 mol% of the total lipid content of the LNP composition, or the LNP composition contains a total amount of complex lipids of less than 1 mol% of the total lipid content of the LNP composition.

12. a. The nucleic acid is mRNA, b. The total amount of the ionized cationic lipids is 45 to 55 mol% of the total lipid content of the LNP composition. c. Sterols are cholesterol in a total amount of 35 to 45 mol% of the total lipid content of the LNP composition. d. The total amount of phospholipids is 7 to 15 mol% of the total lipid content of the LNP composition. e. The one or more phospholipids include DSPC, and the PS lipid is one or more lipids selected from the group consisting of DPPS and the L-serine form of DSPS. f. The composition according to claim 9, wherein the total amount of the PS lipids is 3 to 9 mol% of the total lipid content of the LNP composition.

13. The composition according to claim 12, wherein the PS lipid is contained in a total amount selected from 1.25 mol%, 2.5 mol%, 5 mol%, 7.5 mol%, and 10 mol% of the total lipid content of the LNP composition.

14. (A) The LNP composition is a. nucleic acid, b. Ionized cationic lipids in a total amount of 50 mol% of the total lipid content of the LNP composition, c. Cholesterol in a total amount of 38.5 mol% of the total lipid content of the LNP composition. d. One or more phospholipids comprising 3 to 9 mol% of the total lipid content of the LNP composition, and comprising 3 to 9 mol% of the total lipid content of the LNP composition, wherein the phospholipid comprises one or more phospholipids selected from the group consisting of DSPC, HSPC, eggSM, DPPC, and DOPC, and the PS lipid comprises one or more L-serolelipids selected from the group consisting of DPPS and DSPS, and e. PEG-containing lipids in a total amount of 0.5 to 1.5 mol% of the total lipid content of the LNP composition. A composition containing, or (B) The LNP composition comprises one or more phospholipids including at least two (L-serine)PS lipids with differing acyl chain lengths, wherein the PS lipids are optionally DPPC and DSPS, and optionally the DPPC and DSPS are present in the LNP in a total amount of 5 mol% of the total lipid content of the LNP composition. The nucleic acid lipid nanoparticle (LNP) composition according to claim 9.

15. The composition according to any one of claims 9 to 14, wherein the nucleic acid is mRNA encoding the SARS-CoV-2 spike protein.

16. The composition is a. mRNA nucleic acids with an N / P ratio of 3 to 8. b. Ionized cationic lipids in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition. c. A total amount of cholesterol of 25 to 40 mol% of the total lipid content of the LNP composition. d. (L-serine)PS lipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition. e. DSPC phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and f. PEG-DMG in an amount of 0 to 2.5 mol% of the total lipid content of the LNP composition. An LNP vaccine composition containing The composition according to claim 9, wherein the nucleic acid is optionally the mRNA of SEQ ID NO:

2.

17. The one or more phospholipids mentioned above a. HSPC, and b. One or more PS lipids selected from the group consisting of (L-serine)DPPS and (L-serine)DSPS. It consists of, Optionally, the composition contains a total amount of PS lipids of 2.5 to 10 mol% of the total lipids in the composition. The composition according to claim 1, wherein the composite lipid optionally contains PEG.

Citation Information

Patent Citations

  • Phospholipids with unsaturated alkyl and acyl chains

    JP2002522442A

  • Liposome preparation having high-content cationic lipid compound and use thereof

    US20190380963A1