DNA-targeting drugs for intracellular organelles with bilayer structures

Abstract

To provide a drug for a pathological condition including mitochondria-related disease by a conjugate of a double-membrane organelle DNA sequence recognizing compound and a double-membrane organelle localizable compound.SOLUTION: The present invention provides a conjugate in which a double-membrane organelle localizable lipophilic cation is attached to linear PI polyamide that specifically binds to a double-membrane organelle DNA sequence, a linear PI polyamide-TPP conjugate targeting the mitochondrial DNA mutation or polymorphism, comprising the conjugate, and a pharmaceutical composition comprising the conjugate.SELECTED DRAWING: None

Description

[Technical Field]

[0001] This invention relates to a complex of low molecular weight compounds targeting bimembrane-structured intracellular organelle DNA. [Background technology]

[0002] Lipid-soluble cations and other substances have been developed as technologies for delivering drugs to bimembrane-structured intracellular organelles such as mitochondria and chloroplasts (Non-Patent Literature 1), and their application to the treatment of mitochondrial-related diseases is being attempted (Patent Literature 2-5). On the other hand, it has been confirmed that mitochondrial DNA gene mutations accumulate not only in mitochondrial diseases but also in lifestyle-related diseases and cancer. It has also been reported that mitochondrial gene transcription can be regulated by targeting mitochondrial DNA sequences (Non-Patent Literature 2), and it has been reported that it may be possible to reduce the number of mitochondria with pathogenic gene sequences by targeting pathogenic mitochondrial DNA sequences with hairpin-shaped pyrrole-imidazole polyamides (PIPs) (Patent Literature 1). However, a method for efficiently inducing physiological activity in cells with mutant mitochondrial DNA has not yet been established.

[0003] Many mitochondrial diseases develop as a result of pathogenic mutations in mitochondrial DNA and an increase in their copy number. It has also been reported that an increase in cells with pathogenic mutations in mitochondrial DNA can lead to the development of various diseases, including lifestyle-related diseases. Furthermore, in cancer cells, many cases have been reported where mutations in mitochondrial DNA are present, and these mutations result in homoplasmy (a state in which all mitochondrial DNA is replaced by the mutated mitochondrial DNA) (Non-patent Literature 3). For these conditions involving pathogenic mutations in mitochondrial DNA, no treatment methods that directly target mitochondrial DNA mutations have been developed.

[0004] The inventors of this invention have diligently pursued research to discover compounds that recognize mutations in mitochondrial DNA, accumulate in mitochondria for extended periods, and exhibit physiological activity in cells with mitochondrial DNA-specific mutations. They discovered that a complex formed by linking a mitochondrial permeable compound with a low-molecular-weight linear DNA subgroove-binding compound via a linking portion exhibits highly efficient physiological activity in cells with specific mitochondrial DNA sequences, leading to the present invention. Furthermore, while it has been reported that lipid-soluble cation complexes may affect plant cells and potentially penetrate chloroplasts (Non-Patent Documents 4 and 5), it had not been clearly demonstrated that a complex of low-molecular-weight compounds targeting bilayer-membrane organelle DNA could actually penetrate into living cells of plant roots and leaves. However, this has now been confirmed, and the potential for application to plants has been revealed. [Prior art documents] [Patent Documents]

[0005] [Patent Document 1] International Publication No. WO2012 / 133896 [Patent Document 2] International Publication No. WO2011 / 150494 [Patent Document 3] Special Publication 2011-501731 [Patent Document 4] Special Publication 2016-523926 [Patent Document 5] International Publication No. CN2008 / 801154230 [Non-patent literature]

[0006] [Non-Patent Document 1] Chem Rev.2017 117(15)10043-10120 [Non-Patent Document 2] J.Am.Chem.Soc.,2017,139(25)8444-8447 [Non-Patent Document 3] Sci Rep.2017 Nov 14;7(1):15535. [Non-Patent Document 4] Plant Physiol.(1983)73,169-174 [Non-Patent Document 5] Mitochondrion(2019)46,164-171 Available online May 01 2018 [Overview of the Initiative] [Problems that the invention aims to solve]

[0007] (Mitochondrial DNA mutation-related lesions) Mitochondria are found in higher organisms, including plants. Human mitochondrial DNA has a B-DNA double helix structure and codes for 37 genes, 13 of which are structural genes that code for subunits of respiratory chain complexes I, III, IV, and V. These genes are involved in activating the respiratory chain, ATP production, and reactive oxygen species production, and mutations in this DNA are associated with various pathological conditions. There are thousands of mitochondria in a single cell, and thousands of copies of mitochondrial DNA exist, often containing DNA mutations. When the copy number exceeds a certain level, mitochondrial dysfunction is induced, leading to diseases such as mitochondrial diseases, aging, lifestyle-related diseases, and cancer. In particular, in cancer, a phenomenon called homoplasmy, in which almost all mitochondrial DNA mutations are present, has been reported. (Mitochondrial target compounds) To treat mitochondrial-related diseases, various compounds targeting mitochondria have been developed, but a fundamental treatment targeting mutated mitochondrial DNA has yet to be developed. For drug delivery to mitochondria, a technology has been developed that uses lipid-soluble cations to deliver compounds using the plasma membrane potential difference and the potential of the mitochondrial bilayer, and it has been reported that these compounds accumulate in the mitochondrial matrix at concentrations 100 to 500 times higher than the treatment concentration. (DNA minor groove binding compound) Among the antibiotics produced by actinomycetes and the like, there are compounds that recognize the minor groove of DNA in a sequence-specific manner. By applying this sequence recognition mechanism, hairpin-type PI polyamides that recognize double-stranded B-DNA have been studied, delivery into the nucleus and mitochondria has been confirmed, binding to nuclear DNA and mitochondrial DNA has been shown, and it has been suggested that they may be used for disease treatment by affecting genomic structure and the like. Although it has been reported that some linear DNA-binding compounds such as hairpin-type PI polyamides and distamycin are delivered not to the nucleus but to mitochondria, it has been reported and confirmed by the inventors that they cannot be stored in the long term and migrate to the ER and Golgi, and cannot exhibit biological activity in mitochondria for a long time (Bioorganic&Medicinal Chemistry Letters 11 (2001)769-772). (Mitochondrial target compound and hairpin-type pyrrole·imidazole polyamide (PIP) complex) It has been reported that a complex of a mitochondria-penetrating peptide (MPP) targeting mitochondria and a mitochondrial DNA-targeting hairpin-type pyrrole·imidazole polyamide compound can be retained in mitochondria and regulate the expression of mitochondrial genes. The inventors also reported a tendency to decrease the copy number of mutant mitochondrial DNA, although it was not statistically significant, by delivering hairpin-type pyrrole·imidazole polyamide (PIP) using the lipophilic cation triphenylphosphonium (TPP). However, hairpin-type PIP has a large molecular weight and a complex synthesis process, and is not necessarily suitable for drug development. [Means for Solving the Problems]

[0008] In the present invention, in order to develop more effective and appropriate drug candidates for mitochondrial DNA mutations, a complex in which a linear sequence-recognizing DNA minor groove-binding compound is combined with a lipophilic cation can reduce the number of synthesis reaction steps and halve the molecular weight compared to a complex with a hairpin-type PI polyamide. Furthermore, it has been found that in cells having mitochondrial DNA mutations, it can induce mitochondrial autophagy (mitophagy), increase the mitochondrial DNA copy number, decrease the mutant mitochondrial DNA copy number, and induce cell death in cells with homoplasmic mutant mitochondrial DNA or a large copy number thereof. From these findings, the present invention has been achieved because it has been clarified that a compound suitable for drug development and capable of effectively obtaining biological activity can be synthesized according to the present invention. Furthermore, it has also been confirmed that there are cells resistant to cell death, and cell death can be induced in these resistant cells by administering an inhibitor of a cell death suppressor. In addition, since delivery into living cells of plant roots and leaves has been confirmed, an effect on organisms having a cell wall such as plants is also expected.

[0009] That is, the present invention is as follows. [1] A complex of a linear DNA-binding compound that specifically binds to the sequence of an organelle DNA having a double membrane structure and an organelle localization compound having a double membrane structure. [2] The complex according to [1], wherein the complex accumulates in mitochondria, which are organelles having a double membrane structure, and specifically changes the function of the organelle having a double membrane structure by the organelle DNA sequence having a double membrane structure. [3] The organelle DNA sequence having a double membrane structure is at least one selected from the group consisting of a mitochondrial or chloroplast DNA sequence, a mitochondrial disease causative mutant DNA sequence, a mitochondrial-related disease mutant DNA sequence, a sequence having a higher copy number in diseased cells containing a mitochondrial DNA polymorphism compared to normal cells, and an organelle DNA sequence having a double membrane structure registered in a gene database. The complex of [1] or [2]. [4] A complex of any of [1] to [3] in which the DNA-binding compound is selected from the group consisting of Bridged Nucleic Acid, Locked Nucleic Acid (LNA), PNA, linear pyrrole-imidazole polyamide (PIP), linear pyrrole-imidazole polyamide (PIP) modifiers, DNA-binding proteins, and DNA-binding protein complexes. [5] A complex of any of [1] to [4] in which the bimembrane-structured intracellular organelle-localized compound is a lipid-soluble cation. [6] A complex of [5] in which the lipid-soluble cation is TPP (triphenylphosphonium). A sequence-specific mitochondrial DNA accumulating compound that recognizes mitochondrial DNA mutations and polymorphisms, comprising any of the complexes [7][1] to [6]. [8] The composite of [1] represented by the following equation (I):

[0010] [ka]

[0011] [X is -CH2-, -NH-, -CO-, -CH2CH2O-, or -O-, Y is -CH- or -N-, R1 is -CH3, -OH, a labeling agent (fluorescent, radioactive, biotin, click chemistry labeling, etc.), or TP (mitochondrial osmotic site, which is a compound localized in intracellular organelles of the bimembrane structure). Each R2 is an independent -CH3, -NH2, a labeled substance, or TP. j ranges from 1 to 6. k ranges from 1 to 2, l is from 1 to 4, m ranges from 0 to 10. n ranges from 0 to 6. [o is between 0 and 6]. [9] The complex described in [8], represented by the following formula (II):

[0012] [ka]

[0013] [X is -CH2-, -NH-, -CO-, -CH2CH2O-, or -O-, Y is -CH- or -N-, R1 is -CH3, -OH, a labeled substance, or TP. R2 is an independent -CH3, -NH2, a labeled substance, or TP.

[10] The complex having a structure represented by the following formula (III) or (IV) [8] or [9]:

[0014] [ka]

[0015] or

[0016] [ka]

[0017] [Y is -CH- or -N-, R1 is -CH3, -OH, a labeled substance, or TP. R2 is independently -CH3, -NH2, a labeled substance, or TP.

[11] The complex having a structure represented by the following formula (XIV) [8] or [9]:

[0018] [ka]

[0019]

[12] The complex having a structure represented by any of the following formulas (XV) to (XXI) [8] or [9]:

[0020] [ka]

[0021] [ka]

[0022] [ka]

[0023] [ka]

[0024] [ka]

[0025] [ka]

[0026] [ka]

[13] The complex having a structure represented by the following formula (XXII) or (XXIII) [8] or [9]:

[0027] [ka]

[0028] [ka] A composition that binds to mitochondrial disease-associated mitochondrial DNA sequences containing any of the complexes

[14] [8] to

[13] . A pharmaceutical composition comprising any of the combinations of

[15] [1]~[6] and [8]~

[13] .

[16] The pharmaceutical composition of

[15] , wherein the pharmaceutical composition is an anticancer agent. A kit containing one of the complexes

[17] [1]~[6] and [8]~

[13] . A research reagent kit containing one of the complexes

[18] [1]~[6] and [8]~

[13] . A therapeutic kit containing one of the following complexes:

[19] , [1] to [6] and [8] to

[13] . A diagnostic kit containing one of the following combinations:

[20] [1]~[6] and [8]~

[13] . A kit comprising a combination of the pharmaceutical composition of

[21]

[15] or

[16] and a cell removal agent.

[22] Pharmaceuticals include Canagliflozin, Canagliflozin, Ipragliflozin, Dapagliflozin, Luseogliflozin, Tofogliflozin, Sergliflozin etabonate, Remogliflozin etabonate、Ertugliflozin、sotagliflozin、Dasatinib、Quercetin、Navitoclax (ABT-263), ABT-737, A1331852, A1155463, 17-(Allylamino)-17-demethoxygeldanamycin, Fisetin, Panobinostat, Azithromycin, Roxithromycin, Piperlongumine, Hyperoside (Quercetin 3-galactoside)、2,3,5-Trichloro-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione, 2,5-Dichloro-3-(1-piperidinyl)-6-[2-(1-piperidinyl)-1,3-thi azol-5-yl]benzo-1,4-quinone、2,5-Dichloro-3-morpholin-4-yl-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione、2,5-Dichloro-3-(phenylamino)-6-( 2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione、2,5-Dichloro-3-(2-morpholin-4-yl-1,3-thiazol-5-yl)-6-piperidin-1-ylcyclohexa-2,5-diene-1,4-di one、Obatoclax、Venetoclax、2,5-dichloro-3-(4-methyl-1-piperazinyl)-6-[2-(1-piper). idinyl)-1,3-thiazol-5-yl]benzo-1,4-quin one is also a slightly larger range of

[21] graphs.

[23] Pharmaceutical compositions of

[15] or

[16] for use in combination with cell removal agents.

[24] The cell-removing agents are Canagliflozin, Canagliflozin, Ipragliflozin, Dapagliflozin, Luseogliflozin, Tofogliflozin, Sergliflozin etabonate, Remogliflozin etabonate, Ertugliflozin, sotagliflozin, Dasatinib, Quercetin, Navitoclax (ABT-263), ABT-737, A1331852, A1155463, 17-(Allylamino)-17-demethoxygeldanamycin, Fisetin, Panobinostat, Azithromycin, Roxithromycine, Piperlongumine, Hyperoside (Quercetin 3-galactoside), 2,3,5-Trichloro-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione, 2,5-Dichloro-3-(1-piperidinyl)-6-[2-(1-piperidinyl)-1,3-thiazol-5-yl]benzo-1,4-quinone, 2,5-Dichloro-3-morpholin-4-yl-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione, 2,5-Dichloro-3-(phenylamino)-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione, 2,5-Dichloro-3-(2-morpholin-4-yl-1,3-thiazol-5-yl)-6-piperidin-1-ylcyclohexa-2,5-diene-1,4-dione, Obatoclax, Venetoclax, 2,5-dichloro-3-(4-methyl-1-piperazinyl)-6-[2-(1-piperidinyl)-1,3-thiazol-5-yl]benzo-1,A pharmaceutical composition

[23] selected from the group consisting of 4-quinone, Nutlin-3, MI-63, and any derivative thereof.

[25] (1) A step of designing a DNA-binding compound to specifically bind to a mitochondrial DNA sequence, (2) A method for producing a complex that is stored in mitochondria and specifically binds to mitochondrial DNA sequences, comprising the step of binding a designed DNA-binding compound with a lipid-soluble cation.

[26] The method for producing

[25] , wherein the mitochondrial DNA sequence is selected from the group consisting of mitochondrial disease-causing mutant DNA sequences, mitochondrial-related disease mutant DNA sequences, sequences in diseased cells including mitochondrial polymorphisms in which the number of DNA copies is greater than in normal cells, and mitochondrial-related molecules registered in a gene database.

[27] A method for producing the DNA-binding compound according to

[25] or

[26] , wherein the DNA-binding compound is selected from the group consisting of Bridged Nucleic Acid, Locked Nucleic Acid (LNA), PNA, linear pyrrole-imidazole polyamide (PIP), linear pyrrole-imidazole polyamide (PIP) modifiers, DNA-binding proteins, and DNA-binding protein complexes.

[28] A method for producing any of the complexes described in

[25] to

[27] , wherein the bilayer-membrane intracellular organelle localization compound is a compound having a functional group that binds to a specific base sequence of bilayer-membrane intracellular organelle DNA.

[29] A method for producing

[28] in which the compound localized to a bimembrane intracellular organelle is TPP (triphenylphosphonium).

[0029] Furthermore, the present invention is as follows: (1) A complex of a linear DNA-binding compound that specifically binds to the DNA sequence of intracellular organelles with double membrane structures, such as mitochondria, and a lipid-soluble cation. (2) The complex described in (1) for binding to DNA sequences associated with dysfunction of bimembrane intracellular organelles such as mitochondria, and for emitting biological activity to cells that have DNA sequences that bind to bimembrane intracellular organelles. (3) The complex according to (1) or (2), wherein the DNA sequence of a bimembrane intracellular organelle binds to at least one polymorphism or mutation found in mitochondrial diseases such as mitochondrial dysfunction and ROS production, neurological diseases, cardiovascular diseases, diabetes, kidney diseases, muscle diseases, ear, nose, and throat diseases such as hearing loss, ophthalmic diseases such as retinopathy, cancer, and mitochondrial-related diseases registered in a gene database. (4) A complex according to any one of (1) to (3) in which the linear DNA-binding compound is selected from the group consisting of Bridged Nucleic Acid, Locked Nucleic Acid (LNA), PNA, DNA minor groove-binding antibiotic, pyrrole-imidazole polyamide (PIP), pyrrole-imidazole polyamide (PIP) modifier, DNA-binding protein, and DNA-binding protein complex. (5) The complex according to any one of (1) to (4), wherein the lipophilic cation is a compound having a functional group that can be delivered into the mitochondrial matrix using the plasma membrane potential difference and the potential of the mitochondrial bilayer. (6) The composite according to (5), wherein the lipid-soluble cation is TPP. (7) A complex of a linear DNA-binding compound capable of binding to a mitochondrial disease-specific sequence and a lipid-soluble cation, comprising the complex described in any one of (1) to (6). (8) The composite described in (1) and (2), represented by the following formula (V) or (VI).

[0030] [ka]

[0031] or

[0032] [ka]

[0033] A complex of a linear DNA-binding compound capable of binding to mitochondrial disease-specific sequences, including the complex described in (9)(8), and a lipid-soluble cation. (10)(8) A mitochondrial respiratory chain gene containing the complex described above, a complex of a linear DNA-binding compound capable of binding to the sequence and a lipid-soluble cation. (11) A pharmaceutical composition comprising the complex described in any one of (1) to (6) or (8) to (10). (12) The pharmaceutical composition according to (11), wherein the pharmaceutical composition is an anticancer agent. A kit containing one of the complexes described in (13)(1)-(6) or (8)-(10). A research reagent kit containing the complex described in any one of (14)(1)-(6) or (8)-(10). A therapeutic kit containing the complex described in any one of (15)(1)-(6) or (8)-(10). (16)(1) A process for designing linear DNA-binding compounds that specifically bind to DNA sequences of bimembrane intracellular organelles such as mitochondria, (2) A method for producing a complex that specifically binds to DNA sequences of bimembrane intracellular organelles such as mitochondria, comprising the step of binding a designed DNA-binding compound with a lipid-soluble cation. (17) The method of manufacture described in (16), wherein the gene sequence is a mitochondrial disease-causing mutation sequence. (18) The method for producing DNA according to (16) or (17), wherein the DNA-binding compound is selected from the group consisting of Bridged Nucleic Acid, Locked Nucleic Acid (LNA), PNA, pyrrole-imidazole polyamide (PIP), pyrrole-imidazole polyamide (PIP) modifiers, DNA-binding proteins, and DNA-binding protein complexes. (19) A method for producing a compound according to any one of (16) to (18), wherein the lipid-soluble cation is a functional group that can be delivered into intracellular organelles of bilayer structures such as the mitochondrial matrix by utilizing the plasma membrane potential difference and the potential of the mitochondrial bilayer. (20) The method for producing the product according to (19), wherein the lipid-soluble cation is TPP.

[0034] This specification includes the disclosures of Japanese Patent Application No. 2019-053528, which forms the basis of the priority claim of this application. [Effects of the Invention]

[0035] The present invention provides a complex that can bind to the DNA sequence of bilayer-membrane intracellular organelles such as mitochondria and modify the function of such organelles. According to a preferred embodiment of the present invention, the complex can be used as a pharmaceutical composition or as an anti-mitochondrial disease agent, anti-lifestyle disease agent, anticancer agent, anti-aging agent, antibiotic, etc.

[0036] The complex of the present invention is thought to recognize mitochondrial DNA sequences, thereby inducing mitochondrial DNA replication, transcription, mitochondrial autophagy, mitochondrial activation and increase / decrease in mitochondrial DNA copy number through automated control of mitochondrial autophagy, and, in the case of mutant mitochondrial DNA in a homoplasmy or near-homogenesis state, induction of cell death or cellular senescence. These phenomena make it easy to imagine that the complex of the present invention can create various modes that regulate the function of mitochondria and other organelles in eukaryotes, including plants and animals with double-membrane intracellular organelles such as mitochondria, as well as in living cells and experimental systems.

[0037] In short, the present invention provides a technology for delivering small molecule compounds that bind to genomic sequences such as mitochondria to mitochondria, as well as a method for designing and synthesizing the same. By applying this technology, it becomes possible to design and synthesize mitochondrial disease therapeutics that can specifically recognize DNA mutation sequences in pathological or defective mitochondria more easily and sequentially. While existing therapeutics, functional foods, and foods for specified health uses for mitochondrial diseases are limited to symptomatic prevention and treatment, it is easy to predict that the complex according to the present invention will provide a compound that exhibits fundamental preventive and therapeutic effects. Furthermore, it can be applied to cell therapy and normal mitochondrial delivery technology, and a wide range of applications are conceivable, including quality control through the diagnosis and removal of defective mitochondria and defective cells that possess mutated mitochondrial DNA.

[0038] The complex of the present invention induces cell death in cells with a high copy number of mutated mitochondrial DNA. On the other hand, when the proportion of normal mitochondrial DNA to mutated mitochondrial DNA is above a certain level, it gradually reduces the copy number of mutated mitochondrial DNA and simultaneously promotes an increase in the total number and activation of mitochondria, thereby minimizing the impact on cells and the living body. This makes it an ideal therapeutic agent for reducing mutated mitochondrial DNA, enabling the development of a new and groundbreaking therapeutic agent. In the future, it is expected that development research (physical property testing, safety testing, pharmacokinetics, and large-scale synthesis under GMP) will be advanced towards the commencement of clinical trials for the complex of the present invention. Furthermore, it is conceivable that applying the method of the present invention will enable the development of even more groundbreaking therapeutic agents that produce similar or additive / synergistic effects.

[0039] The complex of the present invention induces cell death in cells with a high number of mutant mitochondrial DNA copies, but some cells are resistant to cell death, and senescence-like changes are observed. In recent years, research on senolytic drugs has advanced in anti-aging studies, and attempts have been made to clinically apply inhibitors such as BCL2, BCL-XL, BCL-W, and MDM2, which are effective in inducing cell death in senescent cells. The complex of the present invention can induce senescence-like cells, and it is conceivable that, when used in combination with treatment using senescent drugs, it will exert a synthetic lethal effect that enhances the effect of senescent drugs, thereby enabling the development of further groundbreaking additive therapies.

[0040] The senescent cell removal agent will be discussed later.

[0041] Because the mitochondrial genome of the present invention is small (16,569 base pairs), the DNA minor groove recognition site of the complex can be shortened, and efficacy has been confirmed even with small molecular weight single-chain compounds, and skin permeability has been confirmed. By combining the method of the present invention with transdermal formulation, the administration route can be expanded, and it is conceivable that groundbreaking treatments such as localized lesions, aging treatments, and preventive drugs can be developed by enhancing local therapeutic effects. [Brief explanation of the drawing]

[0042] [Figure 1-1] This figure shows the chemical structure of FITC-labeled hairpin polyamide (CCC0018-FITC) targeting the MELAS mitochondrial DNA A3243G mutation. [Figure 1-2] This figure shows the time-dependent intracellular localization of FITC-labeled hairpin polyamide (CCC0018-FITC) targeting the MELAS mitochondrial DNA A3243G mutation. [Figure 2] This figure shows the mitochondrial localization by the pyripidium indole TPP complex. Figure 2A shows the co-localization of the pyripidium indole TPP complex with mitochondria, and Figure 2B shows the non-co-localization of pyripidium indole with mitochondria. [Figure 3]This figure shows the synthesis scheme of a hairpin-type polyamide and TPP complex (CCC019-TPP) targeting the MELAS mitochondrial DNA A3243G mutation, along with its structure and HPLC and mass spectrometry results. [Figure 4] This figure shows the co-localization of CCC019-TPP with mitochondria. [Figure 5] This figure shows the results of an experiment in which the total mitochondrial DNA copy number increased after administering CCC019-TPP to HeLa(3243G Low) cybrids. Figure 5A shows the results after 48 days, and Figure 5B shows the results after 63 days. [Figure 6] This figure shows the results of an experiment in which CCC019-TPP was administered to HeLa (3243G Low) cells, resulting in an increase in the ratio of normal mitochondrial DNA copy number to mutant mitochondrial copy number. Figure 6A shows the results after 48 days, and Figure 6B shows the results after 63 days. [Figure 7] This figure shows the results of mitophagy (LC3-positive), which indicates mitochondrial autophagy, being induced in HeLa (3243G High) cells and HeEB1 cells after administration of CCC018-TPP. [Figure 8] This figure shows the synthesis scheme of a linear polyamide and TPP complex (CCC020-TPP) targeting the MELAS mitochondrial DNA A3243G mutation, along with its structure and HPLC and mass spectrometry results. [Figure 9] This figure shows the co-localization of CCC020-TPP with mitochondria. [Figure 10] This figure shows the results of a WST assay examining the suppression of cell proliferation by CCC020-TPP administration to HeLamtHeLa cells (Figure 10A), HeLa(3243G Low) cells (Figure 10B), and HeLa(3243G High) cells (Figure 10C), with IC50 values ​​appended. [Figure 11-1] This graph shows the percentage of cells exhibiting nuclear condensation, fragmentation, and cleaved caspase 3 apoptosis in HeLa (3243G High) cells after administration of CCC020-TPP. [Figure 11-2] This figure shows the induction of apoptosis (programmed cell death) in HeLa (3243G High) cells by administration of CCC020-TPP, as observed through nuclear condensation, fragmentation, and staining for cleaved caspase 3. [Figure 12] This figure shows that administration of CCC020-TPP to HeLamtHeLa cells and HeLa(3243G High) cells resulted in significant increases in the expression of p21, a cell cycle inhibitor, in HeLa(3243G High) cells (Figure 12A), increases in the expression of Bax, a pro-apoptosis-related gene (Figure 12B), and decreases in the expression of Mcl1, an anti-apoptosis-related gene (Figure 12C). [Figure 13] This figure shows the structure and HPLC and mass spectrometry results of a linear polyamide and TPP complex (CCC021-TPP) targeting the non-synonymous substitution A14582G polymorphism found in A549 cells. [Figure 14] This figure shows the results of a WST assay examining the suppression of cell proliferation by administering CCC021-TPP to A549 cells (Figure 14A) and PC14 cells (Figure 14B). [Figure 15] This figure shows the results of investigating cell proliferation in A549 cells (Figure 15A) and PC14 cells (Figure 15B) after long-term administration of CCC021-TPP or DMSO. In A549 cells, CCC021-TPP administration significantly suppressed proliferation. [Figure 16] This figure shows the results of examining mitochondrial localization 24 hours after administration of CCC021-TPP using anti-TPP antibody and mitochondrial tracking staining. A shows the results of anti-TPP antibody staining, and B shows the results of mitochondrial tracking staining. [Figure 17] This figure shows the results of an MTT assay demonstrating that CCC021-TPP inhibited the proliferation of A549 cells but did not induce cell death, instead inducing senescent-like morphological changes. A shows the results for A549, B shows the results for PC14, and C shows the IC50 for A549 and PC14. [Figure 18]This figure shows the cell morphology of PC14 cells (A) and A549 cells (B) 5 days after administration of CCC021-TPP. C is a magnified view of the area within B. [Figure 19] This figure shows the results of trypan blue assays of PC14 cells and A549 cells 5 days after administration of CCC021-TPP. [Figure 20] This figure shows the induction of SA-β-Gal (cellular senescence-associated β-galactosidase) expression in A549 cells (A) and PC14 cells (B) after treatment with CCC021-TPP, as indicated by SA-β-Gal staining. [Figure 21] This figure shows the results of counting and quantifying the number of cells stained by SA-β-Gal staining. [Figure 22] This shows the cellular senescence-associated secretion phenomena when A549 cells and PC14 cells are treated with CCC021-TPP. A shows IL-1A secretion, B shows IL-1B secretion, C shows IL-6 secretion, and D shows IL-8 secretion. [Figure 23] This figure shows the induction of mitophagy when A549 cells (A) and PC14 cells (B) are treated with CCC021-TPP. [Figure 24] This figure shows that CCC021-TPP treatment induces specific mitophagy in the mitochondria of A549 cells. [Figure 25] This figure shows a significant enhancement of reactive oxygen species (ROS) production in A549 cells 24 hours after administration of CCC021-TPP. [Figure 26] This figure shows the expression levels of BCL2L1(A), BAX(B), BCL2(C), and BIRC5(D) in CCC021-TPP-treated A549 and PC14 cells. [Figure 27] This figure shows the cell morphology on day 2 and day 4 after treatment with CCC021-TPP alone, ABT-263 alone, and a combination of both. [Figure 28] This figure shows an overview of the skin permeability confirmation experiment method (A) and the administration site to mice (B). [Figure 29]This is a diagram showing the structural formula of single-chain PIP-TPP (CCC149-TPP). [Figure 30] This figure shows the results of HPLC (A) and mass spectrometry (B) of CCC149-TPP. [Figure 31] This figure shows the skin permeability of PIP-TPP. [Figure 32] This figure shows the synthesis method for Dp-Py-Py-TPP. [Figure 33-1] This figure (Part 1) shows eight cyclic compounds from a library of bicyclic compounds. [Figure 33-2] This figure (part 2) shows eight cyclic compounds from a library of bicyclic compounds. [Figure 33-3] This figure (part 3) shows eight cyclic compounds from a library of bicyclic compounds. [Figure 33-4] This figure (part 4) shows eight cyclic compounds from a library of bicyclic compounds. [Figure 33-5] This figure (part 5) shows eight cyclic compounds from a library of bicyclic compounds. [Figure 33-6] This figure (part 6) shows eight cyclic compounds from the library of bicyclic compounds. [Figure 34] This figure shows the structure of the synthesized bicyclic compound CCC102-TPP. [Figure 35] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC102-TPP. [Figure 36] This figure shows the structure of the synthesized tricyclic compound CCC106-TPP. [Figure 37] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC106-TPP. [Figure 38] This figure shows the structure of the synthesized tetracyclic compound CCC114-TPP. [Figure 39] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC114-TPP. [Figure 40] This figure shows the structure of the synthesized five-cyclic compound CCC175-TPP. [Figure 41] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC175-TPP. [Figure 42] This figure shows the structure of the synthesized hexacyclic compound CCC206-TPP. [Figure 43] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC206-TPP. [Figure 44] This figure shows the structure of the synthesized 7-cyclic compound CCC1283-TPP. [Figure 45] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC1283-TPP. [Figure 46] This figure shows the structure of the synthesized 8-cyclic compound CCC1394-TPP. [Figure 47] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) of CCC1394-TPP. [Figure 48] This figure shows the inhibition of proliferation of HeLa cells (A) and C33A (B) by CCC1283-TPP (linear PIP). [Figure 49] This is a diagram showing the structure of the cyclic compound CCC531-TPP. [Figure 50] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) analysis of CCCh531-TPP. [Figure 51] This figure shows the inhibition of proliferation of HeLa cells (A) and C33A (B) by CCCh531-TPP. [Figure 52] This is a diagram showing the structure of the cyclic compound CCCh560-TPP. [Figure 53] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) analysis of CCCh560-TPP. [Figure 54]This figure shows the inhibition of proliferation by CCCh560-TPP in C33A (A), HeLa cells (B), HDF (C), Siha (D), Caski (E), and ME180 (F). [Figure 55-1] This figure shows representative senescent cell removal drugs (Part 1). [Figure 55-2] This figure (part 2) shows representative senescent cell removal drugs. [Figure 55-3] This figure shows representative senescent cell removal drugs (part 3). [Figure 55-4] This figure (part 4) shows representative senescent cell removal drugs. [Figure 55-5] This figure (part 5) shows representative senescent cell removal drugs. [Figure 55-6] This figure shows representative senescent cell removal drugs (part 6). [Figure 55-7] This figure shows representative senescent cell removal drugs (Part 7). [Figure 55-8] This figure (part 8) shows representative senescent cell removal drugs. [Figure 55-9] This figure shows representative senescent cell removal drugs (Part 9). [Figure 55-10] This figure shows representative senescent cell removal drugs (part 10). [Figure 55-11] This figure shows representative senescent cell removal drugs (Part 11). [Figure 56] This figure shows the morphology of cells treated with the BCL-XL inhibitor A1155463 and CCC021-TPP. [Figure 57] This is a diagram showing the structural formula of FITC-CCC105-TPP. [Figure 58] This figure shows the results of high-performance liquid chromatography (A) and mass spectrometry (B) analysis of FITC-CCC105-TPP. [Figure 59] This figure shows the results of a plant cell permeation experiment; A shows FITC fluorescence in the taproot, and B shows the fluorescence image of the root 4 days after germination. [Figure 60]This figure shows the GFP fluorescence induced by H2B (A) and the fluorescence of FITC induced by CCC105-TPP (B) in leaves of Arabidopsis thaliana expressing H2B (histone H2B)-GFP after treatment with FITC-CCC105-TPP. [Modes for carrying out the invention]

[0043] The present invention will be described in detail below.

[0044] This invention provides a complex comprising a DNA-binding compound that binds to a specific sequence of DNA in bilayer-membrane organelles such as mitochondria, and a compound that localizes to bilayer-membrane organelles, as well as a method for designing and synthesizing the same. By acting on the DNA of bilayer-membrane organelles such as mitochondria with this complex, it enables methods for preventing, treating, and diagnosing pathological conditions related to bilayer-membrane organelles such as mitochondria by reducing the copy number of bilayer-membrane organelles with specific sequences that alter the function of the bilayer-membrane organelles, or by inducing cell death due to dysfunction of bilayer-membrane organelles such as mitochondria.

[0045] In addition to mitochondria, chloroplasts and other organelles within cells have a double membrane structure.

[0046] Examples of specific DNA sequences for bilayer-membrane intracellular organelles include mitochondrial DNA sequences, mitochondrial disease-causing mutant DNA sequences, mitochondrial-related disease mutant DNA sequences, sequences with a higher DNA copy number in diseased cells compared to normal cells, including mitochondrial DNA polymorphisms, and bilayer-membrane intracellular organelle DNA sequences registered in gene databases.

[0047] Mitochondrial DNA is inherited from the mother and exists in hundreds to thousands of copies per cell. Because it is localized in the cytoplasmic organelle, where there is no protective mechanism like a nuclear membrane, mutations occur frequently due to internal factors such as reactive oxygen species (ROS) and external factors such as carcinogens and radiation. Furthermore, the thousands of copies of mitochondrial DNA are replicated randomly and unequally distributed to daughter cells according to probability laws. Therefore, when mutant mitochondrial DNA is produced, it can coexist with normal mitochondrial DNA, resulting in a state of heteroplasmy. Consequently, even if the parent cell has both normal and mutant mitochondrial DNA, homoplasmy can occur in daughter cells that divide, where only one type is present. Somatic cells with an increased copy number of defective mitochondria become a factor in the development of various disease conditions in the individual.

[0048] Mitochondrial diseases are primarily diagnosed based on characteristic central nervous system symptoms, affecting various organs of the body, from skeletal muscle and the heart to endocrine glands (http: / / www.nanbyou.or.jp / entry / 335). In MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes) (Nature, 348(6302):651-3, 1990), a representative mitochondrial disease, the A3243G mutation, in which the 3243rd base of the leucine tRNA (MT-TL1) gene encoded in mitochondrial DNA (mtDNA) changes from an adenine residue to a guanine residue, has been identified as the most common variant. This disease, also known as mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes, is the most common of all mitochondrial diseases. Furthermore, the A3243G mutation is also known as a variant that causes mitochondrial diabetes, and it has been reported that approximately 1% of the 7 million Japanese people with diabetes have the A3243G mutation (Nat genet. 1(5):368-71, 1992, N Engl J Med. 330(14):962-8, 1994). The A3243G mutation causes a mutation in the leucine of tRNA, resulting in a deficiency of taurine modification. This leads to a decrease in the function of respiratory chain complex I, resulting in mitochondrial dysfunction (Am J Hum Genet. 49(3):590-9, 1991). In MELAS, taurine has been approved as a drug, and symptoms have been improved with high doses of taurine. However, in mitochondrial diseases, the ratio of normal mtDNA to mutant mtDNA differs between organs, and it is known that this difference in ratio is a determinant of disease severity and symptoms (Proc Natl Acad Sci USA, 88(23):10614-8, 1991). Therefore, the development of treatments that reduce the proportion of mutant mtDNA is expected as a fundamental treatment.

[0049] Furthermore, while the link between cancer and mitochondrial abnormalities remains a subject of ongoing debate, it has been reported that mtDNA mutations in Lewis lung cancer-derived cultured cell lines correlate with cancer metastasis (Science, 320(5876):661-4, 2008). Additionally, it has been reported that administration of ROS inhibitors suppresses diabetes and tumor development in mice with mtDNA abnormalities (Proc Natl Acad Sci USA, 109(26):10528-33, 2012). It is thought that mtDNA with the G13997A mutation derived from highly metastatic A11 cells reduces the activity of respiratory chain complex I, leading to increased ROS production and decreased ATP production, as well as activation of metastasis-related genes Mcl-1 and Hif-1α located in the nucleus, thereby increasing cancer metastasis (Science, 320(5876):661-4, 2008). Furthermore, it has been reported that pathogenic mutations in the ND gene in colorectal cancer and lung cancer patients are correlated with cancer metastasis (Sci Rep. 7(1):15535, 2017). A comparison of the number of mutations suspected to induce impaired mitochondrial respiratory chain complex function between metastatic and non-metastatic primary tumors revealed that primary tumors with metastasis had a significantly higher mtDNA mutation rate and a higher incidence of heteroplasmy than non-metastatic primary tumors (Sci Rep. 7(1):15535, 2017, Oncogene, 36(31):4393-4404, 2017). In addition, homoplasmy was observed in many cases of cancer. From this, it is thought that mtDNA mutations influence the malignancy not only of mitochondrial diseases but also of cancer, and it is suggested that cancer treatment may be possible by targeting mutated mitochondrial DNA.

[0050] DNA-binding compounds that bind to specific sequences of DNA in bimembrane-structured intracellular organelles include pyrrole-imidazole polyamides (also known as PIP or PI polyamides). DNA-binding compounds that bind to specific sequences of DNA in bimembrane-structured intracellular organelles are also called DNA minor groove binding compounds.

[0051] The DNA-binding compound used in this invention, which binds to a specific sequence of DNA in a bilayer-membrane intracellular organelle, is a linear DNA-binding compound.

[0052] The DNA-binding compound used in this invention, which binds to a specific sequence of DNA in a bilayer-membrane intracellular organelle, is also called an mtDNA sequence-recognizing linear PIP compound.

[0053] PIP is an oligomer composed of N-methylpyrrole (Py) and N-methylimidazole (Im), synthesized based on the structures of natural antibiotics such as distamycin and duocalmycin, which are naturally produced by bacteria. It binds to the minor groove of DNA via hydrogen bonds. Base sequence recognition depends on the combination of Py and Im, with Py / Py recognizing A / T or T / A, Py / Im recognizing C / G, and Im / Py recognizing G / C. Therefore, rather than the linear structure common in natural compounds, it is synthesized and used to form a dimer with a hairpin structure that has stronger DNA binding, allowing for base sequence-specific recognition of any double-stranded DNA (Bioorg Med Chem. 9(9):2215-35, 2001). Furthermore, it has been reported that PIP inhibits gene transcription and suppresses gene expression by binding to DNA in a base sequence-specific manner. Distamycin, a linear polyamide, has been reported to localize to mitochondria, the Golgi apparatus, and the ER (Bioorganic & Medicinal Chemistry Letters 11 (2001) 769-772), and it is known that intervention in the mitochondrial genome is possible with hairpin-type PIPs. However, an efficient method for reducing the copy number of mutant mitochondrial DNA and increasing normal mitochondrial DNA has not been developed. Furthermore, a compound that can maintain mitochondrial function during this process, is easy to synthesize, and is more suitable for drug development has not been devised.

[0054] Based on the current problems, we hypothesized that the problem could be solved by synthesizing a complex that delivers and stores low molecular weight DNA supraclution-binding compounds in mitochondria, and we diligently pursued research. This could potentially create a compound that eliminates mitochondria with specific mtDNA sequences and increases normal mitochondria, or a complex compound that induces cell death in cells with many copies of specific mtDNA sequences. Furthermore, it is conceivable that the complex could be easily synthesized, enabling inexpensive production and more efficient delivery to organs, cells, and mitochondria. Based on this novel idea, we attempted to design and synthesize the compounds of the present invention, and confirmed that the number of mutant mtDNA copies, the total number of mtDNA copies, and the induction of cell death were observed in several synthesized complex compounds, which are thought to be due to the recognition of mutant mtDNA. This suggests that these compounds could be drugs that provide a fundamental treatment for mitochondrial-related pathologies.

[0055] Based on the results of the embodiments of the present invention, it is believed that the problem can be solved by using a method to synthesize a complex compound of a sequence-specific mtDNA sequence-recognizing linear polyamide compound and a mitochondrial delivery substance such as a lipid-soluble cation. This could lead to the synthesis of a therapeutic agent that induces mitophagy in mitochondria with a specific DNA sequence, thereby inducing cell death in diseased cells, and potentially providing a fundamental treatment for mitochondrial-related pathological conditions.

[0056] The linear polyamide that recognizes mtDNA sequences, which is a component of the complex of the present invention, is a polyamide designed to recognize sequences including mtDNA polymorphisms and somatic mutant sequences. mtDNA sequences and their polymorphisms and mutant sequences can be obtained from databases such as MITOMAP (A human mitochondrial genome database), GiiB-JST mtSNP (mitochondrial single nucleotide polymorphism), MitoDat (Mendelian Inheritance and the Mitochondrion), COSMIC (the Catalogue Of Somatic Mutations In Cancer), and GOBASE (A database of mitochondrial and chloroplast information), but are not limited to these databases. Recognition of an mtDNA sequence means that the mtDNA sequence-recognizing polyamide binds to the mtDNA (for example, by hydrogen bonding or crosslinking). Examples of mtDNA sequence recognition compounds include, in addition to the pyrrole-imidazole polyamide (PIP) mentioned above, DNA-binding compounds such as peptide nucleic acid (PNA), bridged nucleic acid, locked nucleic acid (LNA), zinc fingers, and their chimeric proteins, as well as guide RNA-protein complexes. Furthermore, modified compounds that maintain or improve their ability to bind to DNA are also included. Examples of PIP modifications include those in which an alkyl chain is extended from the methyl group of N-methylpyrrole or N-methylimidazole in PIP to have an amine, or lysine or arginine with an amino group as a side chain, glutamic acid with a carboxyl group as a side chain, or the aforementioned modifications with molecules such as FITC or biotin, modifications in which the N-terminus of PIP is modified with molecules such as FITC or biotin, and modifications in which the C-terminus is modified with molecules such as isophthalic acid. In a preferred embodiment of the present invention, the present invention includes a component that recognizes the sequence of DNA in a bimembrane intracellular organelle, or in plants, chloroplast DNA.

[0057] Pyrrole-imidazole polyamide (PIP) is a polyamide containing N-methylpyrrole units (Py), N-methylimidazole units (Im), and a linear amino acid derivative moiety, where Py, Im, and the linear amino acid are linked to each other by amide bonds (-C(=O)-NH-) (Trauger et al, Nature, 382, ​​559-61 (1996); White et al, Chem. Biol., 4, 569-78 (1997); and Dervan, Bioorg. Med. Chem., 9, 2215-35 (2001)). PIP forms a dimer, and the two strands containing Py and Im are arranged in parallel, allowing Py and Im pairs between the two strands to bind with high affinity to specific base pairs in DNA when they are in specific combinations (Py / Im pair, Im / Py pair, Py / Py pair, or Im / Im pair). For example, Py / Im pairs can bind to CG base pairs, and Im / Py pairs can bind to GC base pairs. Furthermore, Py / Py pairs can bind to both AT and TA base pairs. To make this dimer formation more stable, when targeting nuclear genomes, a stronger binding is achieved by synthesizing PIP in a fully folded conformation via linear amino acid derivatives, which is widely used (White et al, Chem. Biol., 4, 569-78 (1997); Dervan: Bioorg. Med. Chem., 9, 2215-35 (2001)). However, the formation of this hairpin-shaped folded conformation requires the formation of a larger molecular weight complex, and for DNA in small-genomic, double-membrane intracellular organelles, linear DNA recognition compounds are considered sufficient for sequence recognition. Additionally, PIP may also contain 3-hydroxypyrrole (Hp) or β-alanine. Regarding Hp, the Hp / Py pair can bind to the TA base pair (White et al., Nature, 391, 468-71 (1998)). Furthermore, the N-terminus of PIP may be modified not only with an acetyl group but also with molecules such as FITC or biotin. Regarding β-alanine / β-alanine, it can bind to either the TA base pair or the AT base pair.Therefore, by changing the combination of Py and Im pairs to match the target DNA sequence, a PIP that recognizes the regulatory region of a target gene can be designed. Methods for designing and manufacturing PIPs are publicly known (e.g., Japanese Patent No. 3045706, Japanese Unexamined Patent Publication No. 2001-136974, and International Publication No. WO2013 / 000683).

[0058] Bridged Nucleic Acid (LNA), also known as Locked Nucleic Acid (LNA), can be synthesized as 2',4'-BNA (Ethylene-Bridged Nucleic Acids) by linking the 2' oxygen atom and 4' carbon atom of RNA with a methylene chain, or 2',4'-ENA (Ethylene-Bridged Nucleic Acids) by linking the 2' oxygen atom and 4' carbon atom of RNA with an ethylene chain. LNA is also available from Proligo.

[0059] In other words, the DNA-binding compound of the complex of the present invention is selected from the group consisting of Bridged Nucleic Acid, Locked Nucleic Acid (LNA), PNA, pyrrole-imidazole polyamide (PIP), pyrrole-imidazole polyamide (PIP) modifiers, DNA-binding proteins, and DNA-binding protein complexes.

[0060] Various lipid-soluble cations can localize to bilayer-membrane intracellular organelles and can be used as delivery compounds to those organelles. In other words, the delivery substance that localizes to bilayer-membrane intracellular organelles and can be used in this patent for the complex of the present invention contains lipid-soluble cations. Examples of lipid-soluble cations include TPP (triphenylphosphonium), alkyltriphenylphosphonium cations, rhodamine, cyanine cations, cationic peptides, guanidinium, triethylammonium, pyridinium, 3-phenylsulfonylfuroxan, F16,2,3-dimethylbenzothiazo-lium iodide, rhodamine 19, rhodamine 123, and DQA.

[0061] Among these, TPP (triphenylphosphonium) is preferably used as the lipid-soluble cation. TPP is highly stable, and complexes containing TPP have already been applied clinically and their safety has been confirmed (Adv Ther. 2016 Jan;33(1):96-115.). It has been demonstrated that TPP is taken up from extracellular to cytoplasm at a concentration of 5 to 10 times the treatment concentration by plasma membrane potential difference, and can be further accumulated in the mitochondrial matrix at a concentration of 100 to 500 times the treatment concentration by mitochondrial membrane potential. Since TPP directly passes through the lipid bilayer, it is distributed to mitochondria without requiring a specific uptake system. Furthermore, TPP has been reported to deliver various substances, including vitamin E and peptides, to mitochondria (Proc Natl Acad Sci USA, 100(9):5407-12, 2003). Thus, TPP is a mitochondrial delivery substance that has advantages in drug development in the present invention and can be said to be a preferred embodiment in the present invention. The structure of TPP is shown below.

[0062] [ka]

[0063] In plants, it has also been reported that the lipid-soluble cation TPP and its derivative SkQ1 are delivered to chloroplasts (Biochemistry (Mosc). 2015 Apr;80(4):417-23. doi: 10.1134 / S0006297915040045.). Therefore, it is thought that the compounds of the present invention can interfere with DNA sequences in a DNA-specific manner in mitochondria and chloroplasts, which are bimembrane intracellular organelles, and induce various biological activities.

[0064] Substances that are localized to bilayer-membrane intracellular organelles penetrate into bilayer-membrane intracellular organelles such as mitochondria, and are therefore also called bilayer-membrane intracellular organelle penetration sites (mitochondrial penetration sites).

[0065] Because PIP can recognize gene sequences, for example, as shown in Figures 1 and 8, it is possible to design hairpin or linear structures targeting the A3243G mutation in MELAS and synthesize PIP compounds. Furthermore, complexes with TPP, a lipid-soluble cation, can be designed and synthesized to ensure long-term storage in mitochondria. The A3243G mutation in MELAS is the most frequent mutation in mitochondrial diseases, but it has also been reported to be involved in diabetes and cancer. In addition, even with mtDNA polymorphisms that may not be directly related to the onset of disease, if the mtDNA with the polymorphism and the pathogenic mutation coexist, it is possible to design PIPs targeting the mtDNA polymorphism sequence and synthesize complex compounds targeting the A14582G polymorphism in mtDNA, as shown in Figure 13. It is thought that even with complexes targeting this polymorphism, the pathogenic mtDNA can be targeted, and it will be possible to design and synthesize therapeutic agents that do not affect normal mitochondria with different sequences of the same polymorphism.

[0066] The complex of the present invention can be synthesized by binding the above-mentioned polyamide with the substance localized to the above-mentioned bilayer-structured intracellular organelle. The "binding" may be direct or via a linker. The linker is not particularly limited as long as it does not interfere with the action of the alkylating agent and does not interfere with the recognition of the DNA sequence of the bilayer-structured intracellular organelle. Examples include amide bonds, phosphodisulfide bonds, ester bonds, coordination bonds, ether bonds, etc.

[0067] Furthermore, the composite of the present invention may contain a labeled substance.

[0068] Examples of the complexes of the present invention include the compounds shown in the following formulas (I) to (III).

[0069] [ka]

[0070] [X is -CH2-, -NH-, -CO-, -CH2CH2O-, or -O-, Y is -CH- or -N-, R1 is -CH3, -OH, a labeling agent (fluorescent, radioactive, biotin, click chemistry labeling, etc.), or TP (mitochondrial osmotic site, which is a compound localized in intracellular organelles of the bimembrane structure). Each R2 is an independent -CH3, -NH2, a labeled substance, or TP. j ranges from 1 to 6. k ranges from 1 to 2, l is from 1 to 4, m ranges from 0 to 10. n ranges from 0 to 6. [o is between 0 and 6].

[0071] Compounds described in (I) having the following formula (II)

[0072] [ka]

[0073] [X is -CH2-, -NH-, -CO-, -CH2CH2O-, or -O-, Y is -CH- or -N-, R1 is -CH3, -OH, a labeled substance, or TP. R2 is an independent -CH3, -NH2, labeled substance, or TP.

[0074] The compound described above comprises the structure shown in formula (III) or (IV) below, as described in (I) or (II).

[0075] [ka]

[0076] or

[0077] [ka]

[0078] [Y is -CH- or -N-, R1 is -CH3, -OH, a labeled substance, or TP. R2 is an independent -CH3, -NH2, a labeled substance, or TP.

[0079] The complex of the DNA-binding compound of the present invention with a substance localized to bimembrane intracellular organelles can modify the DNA of bimembrane intracellular organelles. The DNA-binding compound targets DNA sequences such as mitochondria, recognizes mitochondrial mutations and polymorphisms, and exhibits biological activity such as inducing mitophagy in mitochondria. In other words, it can target pathological conditions such as the aforementioned mitochondrial-related diseases.

[0080] The composite of the present invention may also contain carriers and additives in addition to the composite of the present invention, depending on the intended use. Examples of such carriers and additives include water, acetic acid, organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymer, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, acacia gum, casein, agar, polyethylene glycol, diglycerin, glycerin, propylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, and surfactants. The amount of the composite of the present invention used can be appropriately adjusted depending on the intended use.

[0081] The following are examples of the complex of the present invention. This complex is a complex in which pyrrole-imidazole polyamide (TPP) is linked via a terminal β-linker. The complex represented by the following formula (V) is called CCC020-TPP. The structural formula is C 66 H 80 N 16 It is represented as O9P and has a molecular weight of 1272.42. The complex represented by formula (VI) below is called CCC021-TPP. The structural formula is C 68 H 82 N 14 It is represented as O9P and has a molecular weight of 1272.44.

[0082] [ka]

[0083] [ka]

[0084] Furthermore, single-chain compounds with low molecular weight (single-chain PIP-TPP) can also be used. An example of a single-chain compound is CCC149-TPP, whose structural formula is shown in Figure 29 and formula (XIV). Single-chain compounds with low molecular weight exhibit skin permeability, making them suitable for transdermal formulation.

[0085] The library of compounds of the present invention is shown in Figures 33-1 to 33-6. The library compounds can be synthesized by the method described in Figure 32. Figures 33-1 to 33-6 show 2-cyclic to 8-cyclic compounds. Four compounds can be synthesized from the 2-cyclic compound, eight compounds from the 3-cyclic compound, 16 compounds can be synthesized from each of the four 4-cyclic compounds by inserting β-alanine from the 4-cyclic compound, 32 compounds can be synthesized from each of the four 5-cyclic compounds by inserting β-alanine from the 5-cyclic compound. 64 compounds can be synthesized from each of the 6-cyclic compounds by inserting one or more β-alanine molecules. The same applies to the 7-cyclic compounds; 128 compounds can be synthesized from each of the assumed compounds containing one β-alanine molecule. The same applies to the 8-cyclic compounds; 256 compounds can be synthesized from each of the assumed compounds containing one or more β-alanine molecules.

[0086] 9 or more cyclic compounds can be synthesized in the same manner.

[0087] Among the compounds in these libraries, the following can be exemplified as the complexes of the present invention: 2. Cyclic compound CCC102-TPP (structure shown in Figure 34 and Formula XV), 3. Cyclic compound CCC106-TPP (structure shown in Figure 36 and Formula XVI), 4. Cyclic compound CCC114-TPP (structure shown in Figure 38 and Formula XVII), 5. Cyclic compound CCC175-TPP (structure shown in Figure 40 and Formula XVIII), 6. Cyclic compound CCC206-TPP (structure shown in Figure 42 and Formula XIX), 7. Cyclic compound CCC1283-TPP (structure shown in Figure 44 and Formula XX), and 8. Cyclic compound CCC1394-TPP (structure shown in Figure 46 and Formula XXI).

[0088] Furthermore, examples of the complexes of the present invention include the 10-cyclic compound CCCh531-TPP, whose structure is shown in Figure 49 and Formula XXII, and the 10-cyclic compound CCCh560-TPP, whose structure is shown in Figure 52 and Formula XXIII.

[0089] The complex of the present invention recognizes mitochondrial DNA mutations and polymorphisms and accumulates in mitochondria in a sequence-specific manner; therefore, it can be used as a sequence-specific mitochondrial accumulation compound that recognizes mitochondrial DNA mutations and polymorphisms.

[0090] The complex of the present invention induces cell death in cells with a high number of mutant mitochondrial DNA copies. On the other hand, it induces cellular senescence in cells resistant to cell death. By using the complex of the present invention in combination with a senescent cell scavenging agent, a synthetic lethal effect can be achieved that enhances the effect of the senescent cell scavenging agent. Therefore, the present invention also includes combination pharmaceuticals of the complex of the present invention and a senescent cell scavenging agent, for example, a combination kit of the complex of the present invention and a cell scavenging agent. Furthermore, the present invention includes the complex of the present invention for use in combination with a senescent cell scavenging agent.

[0091] Examples of senescent cell removal agents include anti-apoptotic BCL family inhibitors and MDM2 inhibitors, whose structures and chemical formulas are shown in Figures 55-1 to 55-11: Canagliflozin, Canagliflozin, Ipragliflozin, Dapagliflozin, Luseogliflozin, Tofogliflozin, Sergliflozin etabonate, Remogliflozin etabonate, Ertugliflozin, sotagliflozin, Dasatinib, Quercetin, Navitoclax (ABT-263), ABT-737, A1331852, A1155463, 17-(Allylamino)-17-demethoxygeldanamycin, Fisetin, Panobinostat, Azithromycin, Roxithromycine, Piperlongumine, and Hyperoside (Quercetin). 3-galactoside), 2,3,5-Trichloro-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione, 2,5-Dichloro-3-(1-piperidinyl)-6-[2-(1-pi cyclohexa-2,5-diene-1,4-dio ne, 2,5-Dichloro-3-(phenylamino)-6-(2-piperidin-1-yl-1,3-thiazol-5-yl)cyclohexa-2,5-diene-1,4-dione, 2,5-Dichloro-3-(2-morpholin-4-yl-1,3-thia zol-5-yl)-6-piperidin-1-ylcyclohexa-2,5-diene-1,4-dione, Obatoclax, Venetoclax, 2,5-dichloro-3-(4-methyl-1-piperazinyl)-6-[2-(1-piperidinyl)-1,Examples include 3-thiazol-5-yl]benzo-1,4-quinone, Nutlin-3, MI-63, UBX0101, UBX1967, and their derivatives. In addition, senescent cell scavenging agents described in U.S. Patent Nos. 10550378, 10517866, 10519197, 10478432, 10426788, 1041354, 10378002, 1032807, and 10195213 can be used.

[0092] The pharmaceutical composition of the present invention is a composition comprising the above-mentioned complex. The composition binds to mitochondrial disease-related mtDNA sequences. By administering the pharmaceutical composition into the body, various diseases can be treated and prevented. The pharmaceutical composition of the present invention can target diseases in all organisms, including plants, that utilize double-stranded DNA, a double-membrane intracellular organelle, for biological control, particularly mammals (e.g., humans, rats, rabbits, sheep, pigs, cattle, cattle, dogs, monkeys, etc.). The target diseases of the pharmaceutical composition of the present invention include diseases involving mtDNA mutations, such as mitochondrial diseases, cancer, cardiovascular diseases, neurological / psychiatric diseases, muscle diseases, kidney diseases, liver diseases, lifestyle-related diseases, sleep disorders, diseases with strong local symptoms in the dermatological, ophthalmic, or otolaryngological fields, as well as infectious diseases, allergic diseases, diseases involving cellular senescence, aging, and digestive diseases. Among the target diseases, mitochondrial diseases include chronic progressive extraocular palsy syndrome, red rag fiber myoclonus epilepsy syndrome, mitochondrial encephalomyopathy, lactic acidosis, and stroke-like syndrome (MELAS), and Leigh encephalopathy. Examples of cancers include skin cancer (malignant melanoma, basal cell carcinoma, etc.), brain tumors, head and neck cancers, esophageal cancer, tongue cancer, lung cancer, breast cancer, pancreatic cancer, stomach cancer, cancer of the small intestine or duodenum, colorectal cancer (colon cancer, rectal cancer), bladder cancer, kidney cancer, liver cancer, prostate cancer, uterine cancer, ovarian cancer, thyroid cancer, gallbladder cancer, pharyngeal cancer, sarcomas (e.g., osteosarcoma, chondrosarcoma, Kaposi's sarcoma, myosarcoma, angiosarcoma, fibrosarcoma, etc.), leukemia (e.g., chronic myeloid leukemia (CML), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL) and acute lymphoblastic leukemia (ALL), lymphoma, multiple myeloma (MM), etc.), pediatric solid tumors (brain tumors, neuroblastoma, hepatoblastoma, nephroblastoma, Ewing's sarcoma, etc.), retinoblastoma, and melanoma. Lifestyle-related diseases are not limited to any particular category and include, for example, hypertension and diabetes. Diseases and infections with strong local symptoms in the fields of dermatology, ophthalmology, or otolaryngology include, for example, hearing loss, psoriasis, chronic dermatitis, sinusitis, glaucoma, and retinal degeneration. Allergic diseases include, for example, atopic dermatitis and hay fever. Diseases involving cellular senescence include, for example, wrinkles, sagging skin, and pigmentation.Neurological / psychiatric disorders include, for example, seizures, myoclonus, ataxia, stroke-like symptoms, intellectual disability, migraines, psychiatric symptoms, dystonia, myelopathy, bipolar disorder, Parkinson's disease, and dementia. Muscle disorders include muscle weakness, easy fatigability, hyperCKemia, and myopathy. Cardiovascular disorders include conduction disorders, Wolff-Parkinson-White (WPW) syndrome, cardiomyopathy, and pulmonary hypertension. Renal disorders include Fanconi syndrome, tubular dysfunction, glomerular lesions, and myoglobinuria. Liver disorders include liver dysfunction and liver failure.

[0093] The preferred target diseases of the pharmaceutical composition of the present invention include all pathological conditions and diseases involving double-stranded DNA, which are intracellular organelles with a double membrane structure. This also includes all diseases originating from mitochondrial-related diseases. The pharmaceutical composition of the present invention acts more effectively on cells with a high proportion of mitochondrial DNA copy numbers containing the target sequence, promoting mitophagy and normalizing or killing disease-causing cells by reducing mitochondria containing the target sequence, or, in certain cells, inducing a cell death mechanism due to mitochondrial dysfunction, thereby enabling the treatment and prevention of diseases.

[0094] The pharmaceutical compositions of the present invention may be in either oral or parenteral dosage forms. These dosage forms can be formulated according to conventional methods and may contain pharmaceutically acceptable carriers and additives. Examples of such carriers and additives include water, acetic acid, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymer, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, acacia gum, casein, agar, polyethylene glycol, diglycerin, glycerin, propylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, and pharmaceutically acceptable surfactants.

[0095] The above additives are selected individually or in appropriate combinations from among them, depending on the dosage form of the pharmaceutical composition of the present invention. For oral administration, the dosage form can be tablets, capsules, granules, powders, liquids, syrups, topical preparations such as sprays, ointments, eye drops, or other suitable dosage forms. For parenteral administration, injectable dosage forms are used. In the case of injectable dosage forms, for example, they can be administered systemically or locally by intravenous injection (such as drip infusion), subcutaneous injection, intraperitoneal injection, or intratumor injection.

[0096] For example, when used as an injectable formulation, the pharmaceutical composition of the present invention can be dissolved in a solvent (e.g., physiological saline, buffer solution, glucose solution, 0.1% acetic acid, polyoxyethylene hydrogenated castor oil, etc.), and an appropriate additive (e.g., human serum albumin, PEG, mannose-modified dendrimer, cyclodextrin conjugate) can be added to this solution. Alternatively, it may be freeze-dried to form a dosage form that dissolves before use. Examples of excipients for freeze-drying include sugar alcohols and sugars such as mannitol and glucose, and polymerized polysaccharides such as dextran.

[0097] For example, when used as a transdermal formulation, the pharmaceutical composition of the present invention can be dissolved in a solvent (e.g., white petrolatum, liquid paraffin, isopropyl myristate, beeswax, lanolin, stearic acid, stearyl alcohol, cetanol, glycerin, propylene glycol, 1,3-butylene glycol, ethanol, isopropanol, etc.), and a suitable additive (glyceryl monostearate, sorbitan monostearate, polyoxyethylene hydrogenated castor oil 60, polysorbate 60, methyl parahydroxybenzoate, propyl parahydroxybenzoate, phenoxyethanol, thymol, sodium bisulfite, ascorbic acid, tocopherol, dibutylhydroxytoluene, sodium edetate hydrate, benzotriazole, citric acid hydrate, sodium citrate hydrate, lactic acid, diisopropanolamine, acetic acid, sodium acetate hydrate, laurocaprum, pyrothiodecane, etc.) can be added to this mixture.

[0098] The dosage of the pharmaceutical composition or compound of the present invention varies depending on age, sex, symptoms, route of administration, frequency of administration, and dosage form. For example, for an adult (60 kg), the dosage is 0.01 to 1000 mg per day, preferably 0.1 to 100 mg, and more preferably 1 to 30 mg. The method of administration is appropriately selected depending on the patient's age and symptoms. Administration may be, for example, once every few days, or divided into one or two to four doses per day.

[0099] The pharmaceutical composition of the present invention can be used as an anticancer agent. The target cancer types include, but are not limited to, colorectal cancer, pancreatic cancer, colorectal cancer, thyroid cancer, lung cancer, cervical cancer, endometrial cancer, myelodysplastic syndrome, adenoma of the thyroid and colon, neuroblastoma, etc. The target cancers and the cells constituting the cancer and its surrounding microenvironment are cancers that have a specific mtDNA sequence different from that of normal cells, or cancers that also have normal cells but whose mtDNA copy number has increased predominantly due to the polymorphic sequence, and the cells constituting the cancer and its surrounding microenvironment. The anticancer agent of the present invention may also contain carriers and compositions depending on the intended use, similar to the pharmaceutical composition described above.

[0100] The present invention also includes kits, which, in addition to the compounds of the present invention, include pharmaceutically acceptable carriers and additives, reagents, auxiliaries, dedicated containers, other necessary accessories, instructions, etc. The kits of the present invention can also be used as cancer treatment kits, cell therapy kits, bilayer cell organelle introduction therapy kits, diagnostic kits, and research reagent kits. [Examples]

[0101] The present invention will be described in more detail below with reference to examples. However, the present invention is not limited to these examples. (Example 1) Double-stranded DNA, a double-membrane intracellular organelle, is found in eukaryotes, including humans, animals, and plants, in organelles such as mitochondria and chloroplasts. It is deeply involved in energy production in these organisms, including respiration and photosynthesis, and is also involved in the production of substances with physiological and pathological effects, such as reactive oxygen species. Furthermore, because it is DNA located in the cytoplasm, outside the nuclear membrane, it is more susceptible to damage and accumulates new mutations compared to nuclear DNA. As we age, mutations accumulate, leading to a state called "heteroplasmy" in adult somatic cells, where mutant and normal mtDNA coexist. Moreover, when the ratio of mutant mtDNA exceeds a certain level, mitochondrial function declines, causing mitochondrial diseases. It is also known that mtDNA mutations are not limited to mitochondrial diseases but can also cause acquired lifestyle-related diseases such as diabetes and cancer. In this example, PIP-TPPs (CCC020-TPP and CCC021-TPP) that recognize mutant mtDNA sequences or mtDNA polymorphism sequences were synthesized by condensing a lipophilic cation, TPP, with a linear pyrrole-imidazole polyamide that recognizes mtDNA base sequences and binds to the DNA minor groove. The biological activity of this compound and the hairpin-type PIP-TPP complex of formula (VII) below (referred to as CCC018-TPP) was investigated in cells containing the target mtDNA sequence. Experiments were conducted to confirm mitochondrial sustained localization, mitochondrial DNA copy number analysis, expression analysis of related genes, confirmation of mitochondrial autophagy, induction of cell death in cells containing mutant mitochondria, confirmation of programmed cell death, synthetic lethal induction, skin permeability, and plant living cell permeability. Furthermore, various PIPs were synthesized, and complexes with TPP were synthesized and successfully compiled into a library. Experiments were conducted to induce cell proliferation inhibition in cancer cells with target sequences in mitochondrial DNA using library compounds that can target mitochondrial mutations in gynecological cancer cells (CCC130-TPP and CCC531-TPP) and those that target mitochondrial DNA polymorphisms (CCC560-TPP).

[0102] To investigate changes in mitochondrial mutant DNA copy number, we first created ρ0 cells lacking mtDNA from HeLa cells, a human cervical cancer cell line. By fusing these cells with platelets containing A3243G mutant mtDNA from MELAS patients, we introduced mutant mitochondrial DNA in different proportions, resulting in 3243G Low cells (cells containing 55% HeLamt3243 mutant mtDNA) and 3243G High cells (cells containing 82% HeLamt3243 mutant mtDNA). We also created HeEB1 (HeLamtHeLa) cells by fusing these cells with non-mutant mitochondrial DNA from wild-type HeLa cells. Cells were cultured at 37°C under 5% CO2 using Dulbecco's Modified Eagle's Medium (DMEM D5796: Sigma-Aldrich) containing 10% Fetal Bovine Serum (FBS: Gibco, USA), 1% Penicillin-Streptomycin (Gibco), 0.1 mg / ml Sodium pyruvate (Sigma-Aldrich, USA), and 50 mg / ml Uridine (Sigma-Aldrich).

[0103] Compound CCC018 is a hairpin-type PIP targeting the A3243G mutant sequence GGGCCCT in mitochondrial DNA, which is the causative mutation for MELAS, a type of mitochondrial disease, and mitochondrial diabetes. It was synthesized according to the description in International Publication No. WO2012 / 133896. It was expected that CCC019 would bind to mitochondrial DNA and induce a decrease in the copy number of mutant mitochondria. However, the experiment described in International Publication No. WO2012 / 133896 could not be reproduced.

[0104] [ka]

[0105] As shown in these results and in (Bioorganic & Medicinal Chemistry Letters 11 (2001) 769-772), DNA minor groove binding compounds are predicted to localize to mitochondria and bind to mtDNA. However, it is thought that they migrate to the Golgi apparatus and smooth endoplasmic reticulum, and then move into the extracellular efflux system, such as the formation of secretory vesicles, secretory granules, lysosomes, and endosomes, thus preventing the sustained maintenance of effective binding to mtDNA.

[0106] To confirm this, CCC018-FITC was synthesized by fluorescently labeling CCC018 (Figure 1-1). Mitochondria were then fused with platelets containing the A3243G mutation mtDNA derived from MELAS patients to introduce mutant mtDNA in different proportions. In 3243G High cells (cells containing 82% HeLamt3243 mutant mtDNA) cultured in this cell, fluorescence localization experiments were conducted, observing the fluorescence of mitochondria using red fluorescence with a mitotracker and CCC018-FITC using green fluorescence.

[0107] 3243G High cells were placed in a 35mm glass base dish (IWAKI, Ikuoka) in a 1x10⁻¹⁶ arrangement. 5 Cells were seeded in a cell / dish ratio and cultured for 24 hours before being treated with CCC018-FITC to a final concentration of 1 μM. After 24 and 48 hours, the culture medium was removed, and a culture medium containing MitoTracker® Red CMXRos (Life Technologies, USA) was added to a concentration of 50 nM. After 10 minutes, the culture medium was replaced with fresh medium and observed using a confocal laser microscope SP8 (Leica, Germany).

[0108] As shown in Figure 1-2, similar to the literature (Bioorganic & Medicinal Chemistry Letters 11 (2001) 769-772), co-localization of some mitochondrial red and green fluorescence was observed 24 hours after CCC018-FITC administration. However, after 48 hours, co-localization of green fluorescence with mitochondria was not observed, and fluorescence patterns suggesting migration to the Golgi apparatus and cut surface endoplasmic reticulum were confirmed. From this, it was considered that hairpin-type PIP has limited localization to mitochondria and cannot efficiently reduce mutant mitochondria.

[0109] To address the above problems, we hypothesized that mitochondrial localization could be improved by condensing a lipid-soluble cation, which has been reported to be localized to mitochondria, with a hairpin-type PIP. Therefore, we purchased (4-Carboxybutyl)triphenylphosphonium Bromide (TPP, Sigma-Aldrich) and confirmed its mitochondrial localization. We observed the intracellular localization of Pyridinium-Indole derivative-TPP (formula (VIII) below), in which TPP was attached to a pyridium group using indole as a linker, and, for comparison, Pyridinium-Indole derivative without TPP (formula (IX) below), at 2 hours and 48 hours after the above treatment. As shown in Figure 2, Pyridinium-Indole derivative-TPP co-localized with mitochondria, and this co-localization was observed even at 48 hours. However, co-localization with mitochondria was not observed for Pyridinium-Indole derivative without TPP.

[0110] [ka]

[0111] [ka]

[0112] Based on the above, a hairpin-type PIP targeting the A3243G mutant sequence CCTGCCA of mtDNA, a PIP-TPP compound obtained by condensing TPP with CCC019, and CCC019-TPP (the following formula (X)) were synthesized as shown in Figure 3. Similar to CCC018, CCC019 recognizes the A3243G mutant sequence, but is a compound with improved synthesis efficiency by reducing the continuous binding of imidazole groups.

[0113]

Chemical formula

[0114] The intracellular localization of CCC018-TPP was examined as follows. The mtDNA mutant cell lines 3243G Low (HeLa mt3243 mutant mitochondria DNA-containing cells at 55%) and 3243G High cells were seeded in a 35 mm glass base dish (IWAKI) at a density of 2×10 4 cells / dish. After culturing for 24 hours, 3243G Low cells were treated with CCC018-TPP at a final concentration of 500 nM, and 3243G High cells were treated at a final concentration of 100 nM. The 3243G Low cells were subcultured at 2×10 4The cells were re-spun to form cells / dishes, and treated with fresh culture medium containing CCC018-TPP for 14 days. 3243G High cells were treated for 3 days without changing the culture medium. After CCC018-TPP treatment, cells were fixed in 4% Paraformaldehyde (PFA) / PBS at room temperature for 30 minutes. After fixation, the cells were washed with PBS and blocked in 10% FBS / 0.1% TritonX100 / TBS ​​(TBST) for 10 minutes. TBS is a mixture of 150 μM sodium chloride and 20 μM Tris (pH 7.4). After blocking, the primary antibody diluted in TBST was reacted overnight at 4°C. The primary antibodies used were rabbit anti-TPP antibody (donated by Dr. M. Murphy, University of Cambridge, UK) diluted 1:500 and mouse anti-Cytochrome C antibody (Thermo Fisher Scientific, USA) diluted 1:500. After the reaction with the primary antibodies was complete, the samples were washed three times with TBS and reacted for 15 minutes with secondary antibodies diluted with TBST: Goat anti-Rabbit Oregon Green 488 (Invitrogen, USA) diluted 1:1000 and Goat anti-Mouse Alexa Fluor 647 (Invitrogen) diluted 1:1000. After the reaction with the secondary antibodies was complete, the samples were washed three times with TBS, mounted in DABCO / PVA mounting medium (Sigma-Aldrich), and observed with a confocal laser microscope SP8 (Leica).

[0115] When CCC018-TPP was administered to two types of cells carrying the 3243G mutation, co-localization with CytC in the mitochondrial inner membrane was observed in 3243G High cells 3 days after CCC018-TPP administration, and also in 3243G Low cells with a small number of mutant mitochondria 14 days after CCC018-TPP administration (Figure 4). This confirmed that CCC018-TPP is delivered to mitochondria and retained there for a long period.

[0116] To analyze the change in total mitochondrial DNA copy number after CCC019-TPP treatment, the following PCR quantitative experiment was performed.

[0117] 3243G Low cells were placed in a 35mm dish (Falcon, USA) in a 2x10⁶ arrangement. 4 Cells were seeded to a density of cells / well and cultured for 24 hours before being treated with CCC019-TPP to final concentrations of 1 μM and 5 μM. The culture medium was changed every two days, and CCC019-TPP was continuously administered. After 48 and 63 days, DNA was extracted using the Allprep DNA / RNA Mini Kit (QIAGEN, Germany) according to the instructions. After extraction, the DNA yield was measured using NANODROP 2000c (Thermo Fisher Scientific). DNA samples were prepared, and PCR reactions and analyses were performed. The primers and reaction conditions used are shown below. COII Forward primer: ACA CAT TCG AAG AAC CCG TAT (Sequence ID 1) Reverse primer: TTT AGT TGG GGC ATT TCA CTG (Sequence ID 2) • β actin (internal control) Forward primer: TGA CGG GGT CAC CCA CAC TGT GCC CAT CTA (Sequence ID 3) Reverse primer: CTA GAA GCA TTT GCG GTG GAC GAT GGA GGG (Sequence ID 4) The reaction conditions are as follows: COII (20 cycles) Initial denaturation 94℃ 1 minute Denaturation: 94℃ for 30 seconds Annealing 53℃ 30 seconds Extension 72℃ 1 minute Final extension 72℃ 1 minute • β-actin (25 cycles) Initial denaturation 96℃ 5 minutes Denaturation: 96℃ for 30 seconds Annealing 59℃ 30 seconds Extension 72℃ 30 seconds Final extension 72℃ 5 minutes After the PCR reaction was complete, the PCR products were subjected to electrophoresis on a 2% agarose gel, stained with ethidium bromide, and the bands of the PCR products were detected. Band quantification was then performed using analysis software (Image J).

[0118] To estimate the total copy number of mtDNA in 3243G Low cells treated with CCC019-TPP for 48 and 63 days, PCR was performed on the COII gene, which constitutes mitochondrial respiratory chain complex IV. The results showed a tendency for the total copy number of mtDNA to increase in a CCC019-TPP concentration-dependent manner in both experiments (48 and 63 days of treatment) (Figure 5).

[0119] To analyze the changes in the ratio of normal and mutant mtDNA due to CCC019-TPP treatment, PCR-RFLP analysis was performed as follows.

[0120] 3243G Low cells in 2 × 10⁶ cells on a 35mm dish (Falcon). 4 Cells were seeded to a density of cells / well and cultured for 24 hours before being treated with CCC019-TPP to final concentrations of 1 μM and 5 μM. The culture medium was changed every two days, and CCC019-TPP was continuously administered. After 48 and 63 days, DNA was extracted using the Allprep DNA / RNA Mini Kit (QIAGEN) according to the instructions. After extraction, the DNA yield was measured using NANO DROP 2000 (Trademark) (Thermo Fisher Scientific). DNA samples were prepared and PCR reactions were performed. The primers and reaction conditions used are shown below. · mt3243 Forward primer: TTC ACA AAG CGC CTT CCC CCG T (Sequence ID 5) Reverse primer: GCG ATG GTG AGA GCT AAG GTC GG (Sequence ID 6) The reaction conditions are as follows: (25 cycles) Initial denaturation 95℃ 5 minutes Denaturation: 95℃ for 30 seconds Annealing 57℃ 30 seconds Extension 72℃ 30 seconds Final extension 72℃ 5 minutes PCR products were analyzed by restriction enzyme digestion with ApaI as follows. PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN) according to the instructions. After purification, DNA yield was measured using NANODROP 2000c (Thermo Fisher Scientific). After measurement, the reaction product amplified with PCR System 9700 (Applied Biosystems, USA) GeneAmp® was subjected to restriction enzyme digestion with ApaI at 37°C for 5 hours. After the reaction was complete, 15 ng of the sample was subjected to electrophoresis on a 2% agarose gel, stained with ethidium bromide, and the PCR product bands were detected. Band quantification was performed using analysis software (Image J).

[0121] To investigate the changes in the ratio of normal and mutant mtDNA, PCR-RFLP was performed using DNA extracted from 3243G Low cells treated with CCC019-TPP for 48 and 63 days. The results showed a CCC019-TPP concentration-dependent trend of increasing wild-type mitochondrial DNA and decreasing mutant mitochondrial DNA in both experiments (Figure 6).

[0122] To investigate whether the reduction of mutant mtDNA by PIP-TPP is due to mitochondrial autophagy, the following experiment was performed: 2 × 10⁶ mtDNA mutant cell line 3243G High cells were placed in a 35mm glass base dish (IWAKI). 4Cells were seeded in a cell / dish ratio and cultured for 24 hours before being treated to a final concentration of 100 nM. 52 hours after treatment, the cells were fixed in 4% Paraformaldehyde (PFA) / PBS at room temperature for 30 minutes. After fixation, the cells were washed with PBS and blocked in 10% FBS / 0.1% TritonX100 / TBS ​​(TBST) for 10 minutes. TBS is a mixture of 150 μM sodium chloride and 20 μM Tris (pH 7.4). After blocking, the primary antibody diluted in TBST was reacted overnight at 4°C. The primary antibodies used were rabbit anti-LC3 antibody (cell signaling) diluted 1:200 and mouse anti-Cytochrome C antibody (Thermo Fisher Scientific, USA) diluted 1:500. After the reaction with the primary antibodies was complete, the samples were washed three times with TBS and reacted for 15 minutes with secondary antibodies diluted with TBST: Goat anti rabbit oregon green 488 (Invitrogen) diluted 1:1000 and Goat anti Mouse Alexa Fluor 647 (Invitrogen) diluted 1:1000. After the reaction with the secondary antibodies was complete, the samples were washed three times with TBS, mounted with DABCO / PVA mounting medium (Sigma-Aldrich), and observed with a confocal laser microscope SP8 (Leica).

[0123] As shown in Figure 7, CytC causes mitochondria to fluoresce red and LC3, a marker of autophagy, to fluoresce green. However, in PIP-treated cells, while autophagy is observed sporadically in the cytoplasm, there is no co-localization with mitochondrial fluorescence. In contrast, in cells treated with PIP-TPP, strong yellow to orange fluorescence is observed in the cytoplasm due to the co-localization of red and green, clearly indicating co-localization of mitochondria and autophagy. This suggests that PIP-TPP treatment induces mitophagy, the process by which mitochondria are consumed.

[0124] Hairpin-shaped PIPs have a large molecular weight of around 1700, and the solid-phase synthesis involves many coupling reaction steps, leading to yield problems. On the other hand, the mitochondrial genome in mammals, including humans, is a single circular structure of about 16.5 kb, which is extremely small compared to the human genome in the nucleus. Therefore, it is questionable whether it is necessary to synthesize hairpin-shaped PIPs, which are MGBs with a hairpin structure to improve DNA binding sequence specificity. Furthermore, MGBs produced by fungi such as actinomycetes are often linear, and they are antibiotics that target the genomes of fungi similar to the mitochondrial genome or fungal plasmids, so it is thought that they can obtain biological activity even in a linear form. If they are linear, the molecular weight will be small, the synthesis steps will be few, and it is thought that they can be used to discover drugs that are inexpensive and have excellent pharmacokinetics. Therefore, we devised a method for modifying the mitochondrial genome using a complex of linear PIP and lipid-soluble cations in the present invention, and conducted the following experiments to determine the mitochondrial DNA sequence-specific biological activity effect of linear PIP-TPP.

[0125] Compound CCC020, represented by formula (XI) below, is a linear PIP that, like CCC018, targets the A3243G mutant sequence GGGCCC of mitochondrial DNA, which is a causative mutation of MELAS, a type of mitochondrial disease, and mitochondrial diabetes. It is expected to effectively induce a reduction in the copy number of mutant mitochondria by binding to the 3243G mutant sequence of mitochondrial DNA and forming a complex with TPP.

[0126] [ka]

[0127] Synthesis of CCC020-TPP: 20 mg of β-alanine-Nova-PEG-wang resin (Merck), a solid-phase resin, was weighed into eight Libra Tubes for solid-phase synthesis. These were then placed in an automated peptide synthesizer PSSM-8 (Shimadzu Corporation), and 1 ml of NMP was added to each tube for 1 hour of swelling. Next, 2.0 g of HCTU (Peptide Institute) and 16.8 ml of super-dehydrated NMP (wako) were added to a 50 ml tube and thoroughly dissolved to prepare an HCTU solution. Next, 36.2 mg of Fmoc-Py-COOH (Wako Pure Chemical Industries) was weighed into 24 2.0 ml round-bottom Eppendorf tubes, 36.3 mg of Fmoc-Im-COOH (Wako) into 8 tubes, and 31.4 mg of N-β-Fmoc-β-alanine (Merck) into 16 tubes. 300 μl of HCTU solution was added to each tube, and the mixture was completely dissolved by sonication for 30 minutes. The Eppendorf tubes were then placed in the PSSM-8 according to the A14582G sequence (resin-Py-Py-β-ImPy-Py-β). Next, NMP was aspirated and removed from the Libra tubes placed in the PSSM-8, and the deprotection, condensation, and acetyl capping reactions were repeated according to the PSSM-8 synthesis program. Each reaction per tube was performed as follows. The deprotection reaction was carried out for 10 minutes by adding 1 ml of 30% piperidine (Wako Pure Chemical Industries) / NMP solution, and after the reaction, the mixture was washed 5 times with 0.9 ml of NMP. For the condensation reaction, 40 μl of DIEA was added to 300 μl of the reaction solution to dissolve it, and N 2The reaction was carried out by bubbling for 30 minutes, followed by washing five times with 0.9 ml of NMP. Acetyl capping was performed by adding 0.9 ml of 30% acetic anhydride (Wako Pure Chemical Industries) / NMP and reacting for 10 minutes, followed by washing five times with 0.9 ml of NMP. This reaction was repeated according to the sequence of A14582G, and after the final condensation of β-alanine was completed, Fmoc was deprotected with 0.9 ml of 30% piperidine / NMP solution, washed five times with 0.9 ml of NMP, and then all the resin was collected in a 15 ml tube. Next, 354.4 mg of (4-Carboxybutyl)triphenyl-phasphonium Bromide (TPP, Sigma-Aldrich) and 153.4 mg of 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide Hydrochloride (EDC·HCl, Merck) were weighed into a 50 ml tube, dissolved in 2.4 ml of super-dehydrated NMP, and the entire solution was added to the tube containing the resin. Then, 300 μl of N,N-diisopropylethylamine (DIEA) was added and the mixture was shaken overnight. After the reaction, the resin was collected by suction filtration and washed 10 times with excess NMP. After washing, the resin was transferred to four 1.5 ml Eppendorf tubes with screw caps, 0.5 ml each of N,N-dimethyl-1,3-propane diamine (Dp, Wako Pure Chemical Industries) and NMP were added, and the mixture was stirred on a heat block with a shaker at 65°C for 2 hours to remove the target compound from the resin. After the reaction, the reaction solution was collected by suction filtration and purified by HPLC (flow rate 10 ml / min, 0.1% AcOH / H2O-CH3CN, 0-100%, 20 min linear gradient, wavelength 310 nm). The target fraction was collected, concentrated using an evaporator, and mass spectrometry was performed using LC / MS2020 (Shimadzu Corporation) ([M+1]). + =1271.5). Finally, the product was powdered using a freeze-dryer to obtain the final product, CCC033-TPP of the following formula (XII), as a white powder (Figure 8).

[0128] [ka]

[0129] To investigate the intracellular localization of CCC020-TPP, the following experiment was performed: 2 × 10⁶ mtDNA mutant cell line 3243G High cells were placed in a 35mm glass base dish (IWAKI). 4 Cells were seeded in a cell / dish ratio and cultured for 24 hours. After treatment with CCC033-TPP to a final concentration of 25 μM, the cells were fixed in 4% Paraformaldehyde (PFA) / PBS at room temperature for 30 minutes 24 hours after CCC020-TPP treatment. After fixation, the cells were washed with PBS and blocked for 10 minutes with 10% FBS / 0.1% TritonX100 / TBS ​​(TBST). TBS is a mixed solution of 150 μM sodium chloride and 20 μM Tris (pH 7.4). After blocking, the primary antibody diluted with TBST was reacted overnight at 4°C. The primary antibodies used were rabbit anti-TPP antibody (donated by Dr. M. Murphy, University of Cambridge, UK) diluted 1:500 and mouse anti-Cytochrome C antibody (Thermo Fisher Scientific, USA) diluted 1:500. After the reaction with the primary antibodies was complete, the samples were washed three times with TBS and reacted for 15 minutes with secondary antibodies diluted with TBST: Goat anti-Rabbit Oregon Green 488 (Invitrogen, USA) diluted 1:1000 and Goat anti-Mouse Alexa Fluor 647 (Invitrogen) diluted 1:1000. After the reaction with the secondary antibodies was complete, the samples were washed three times with TBS, mounted in DABCO / PVA mounting medium (Sigma-Aldrich), and observed with a confocal laser microscope SP8 (Leica).

[0130] As shown in Figure 9, mitochondria were indicated by the red fluorescence of CytC, CCC020-TPP by a greenish tint, and a strong yellowish tint due to colocalization was observed, indicating that CCC020-TPP is localized to mitochondria.

[0131] The inhibitory effect of CCC020-TPP on the proliferation of cells with the mitochondrial A3243G mutation was evaluated by WST assay. Both mitochondrial DNA mutant cell lines and normal cell lines were sampled in 1 × 10⁶ well plates (Thermo Fisher Scientific). 3 Cells were seeded to a cell / well ratio and cultured for 24 hours. Afterwards, they were treated with CCC020-TPP at final concentrations of 0, 0.1, 1, 10, 20, and 50 μM. After a further 5 days of culture, cell morphology was observed using an IX71 optical microscope (OLYMPUS, Tokyo). Subsequently, cell viability was calculated using a Cell Counting Kit-8 (DOJINDO, Kumamoto) according to the instructions. As a control, DMSO (Wako) was added to the cells at a final concentration of 1%.

[0132] Furthermore, IC50 was calculated using the following formula. IC50=10(LOG(A / B)×(50-C) / (D-C)+LOG(B)) A: The higher of the two concentrations that surrounds a 50% cell viability rate. B: The lower of the concentrations that are on the other side of a 50% cell viability rate. C: Inhibition rate at lower concentrations, with the cell viability at 50%. D: Inhibition rate at higher concentrations, around 50% cell viability. WST assays were performed to examine the effects of CCC020-TPP on cell proliferation. The results showed that cell proliferation was not suppressed in HeEB1 cells without the mutant mtDNA, while a significant inhibitory effect on cell proliferation was observed in 3243G Low and 3243G High cells that possessed the mutant mtDNA (Figure 10).

[0133] To confirm that the inhibition of cell proliferation by CCC020-TPP induces cell death, 3243G High cells were placed in 5 × 10⁶ cells on a 35mm glass base dish (IWAKI). 4Cells were seeded in a cell / dish ratio and cultured for 24 hours before being treated with CCC020-TPP to a final concentration of 25 μM. Further addition of CCC020-TPP was followed by 5 days of culture, after which each cell was fixed in 4% PFA / PBS at room temperature for 30 minutes. After fixation, the cells were washed with PBS and blocked for 1 hour with TBST containing 5% normal goat serum. After blocking, the cells were reacted for 1 hour with primary anti-rabbit anti-Cleaved Caspase-3 antibody (cells treated for 5 days: Cell Signaling Technology) diluted in TBST at a ratio of 1:200.

[0134] When 3243G High cells were treated with CCC020-TPP and then stained with DAPI after 5 days, nuclear fragmentation was observed in approximately 60% of the cells (Figure 11-1). Next, when 3243G High cells were treated with CCC020-TPP and then stained with anti-Cleaved Caspase-3 antibody after 5 days, approximately half of the cells were found to be Cleaved Caspase-3 positive after CCC020-TPP treatment, confirming that apoptosis had occurred (Figure 11-2).

[0135] To elucidate the mechanism of cell proliferation inhibition by CCC020-TPP administration, mRNA expression analysis was performed at the mRNA level using Real-time PCR as follows: 5 × 10⁶ mtDNA mutant cell lines (3243G High) were placed in a 6 cm dish (Falcon). 5 cells / dish, normal cell line (HeEB1) 1 × 10 5Cells were seeded in a cell / dish ratio and cultured for 24 hours before being treated with CCC020-TPP to a final concentration of 25 μM. After a further 3 days of culture, RNA was extracted using the RNeasy Plus Mini Kit (QIAGEN) according to the instructions. After extraction, the RNA yield was measured using NANO DROP 2000 (Trademark) (Thermo Fisher Scientific). For the RNA reverse transcription reaction, 500 ng of RNA per sample was reverse transcribed using SuperScript VILO Master Mix (Invitrogen) to synthesize cDNA. The synthesized cDNA was diluted 5-fold with ultrapure water.

[0136] Real-time PCR was performed using Power SYBR Green Master Mix (Applied Biosystems) for cDNA sample preparation, PCR reaction, and analysis. The primers and reaction conditions used are shown below. BAX Forward primer: CTG AGC AGA TCA TGA AGA CA (Sequence ID 7) Reverse primer: AGT TTG CTG GCA AAG TAG AA (SEQ ID NO: 8) • p21 Forward primer: GCA CTC AGA GGA GGC GCC ATG TCA (SEQ ID NO: 9) Reverse primer: GGA CGA GAC GAC GTC CCC TGT C (Sequence ID 10) ·MCL1 Forward primer: GCT TGC TTG TTA CAC ACA CAG GTC (SEQ ID NO: 11) Reverse primer: GCA GAA CAA TCA GCA ATT TCA AGG (SEQ ID NO: 12) GAPDH (Internal Control) Forward primer: CGA CCA CTT TGT CAA GCT CA (Sequence ID 13) Reverse primer: AGG GGT CTA CAT GGC AAC TG (SEQ ID NO: 14) The PCR reaction conditions are as follows: Holding stage: 50℃ for 2 minutes → 95℃ for 10 minutes Cycling stage 95℃ 15 seconds → 60℃ 1 minute (40 cycles) Melt Curve stage 95℃ 15 seconds → 60℃ 1 minute → 95℃ 15 seconds → 60℃ 15 seconds Regarding cell cycle arrest and apoptosis-related genes in CCC020-TPP-treated cells, HeEB1 cells and 3243G High cells were treated with CCC020-TPP, and real-time PCR was performed on RNA extracted after 3 days. The results showed that in 3243G High cells with mtDNA mutations, the expression of both P21 (a cell cycle arrest-related gene) and BAX (a pro-apoptosis-related gene) was significantly increased, while the expression of MCL1 (an anti-apoptosis-related gene) was significantly decreased. In contrast, no changes in expression were observed in HeEB1 cells without mtDNA mutations (Figure 12). This suggests that CCC020-TPP induces apoptosis in 3243G High cells.

[0137] Furthermore, when the morphology of CCC020-TPP-treated cells was observed under a light microscope, no morphological changes were observed in HeEB1 cells and 3243G Low cells, whereas cells that appeared to be undergoing significant apoptosis were observed in 3243G High cells.

[0138] These findings confirm that CCC020-TPP co-localizes to mitochondria, induces apoptosis more strongly in cells with many 3243G mutations than in cells with few 3243G mutations, and does not induce cell death in cells without the mutation.

[0139] It has been reported that normal mitochondria have polymorphisms, and that these polymorphisms may accumulate in some diseases. Therefore, we decided to examine whether mitochondrial polymorphisms can be recognized and cell death induced in cells in which polymorphisms present in healthy individuals accumulate, as in the above-described examples. The A549 cells of lung cancer have the polymorphism of mtDNA A14582G. CCC021-TPP of the following formula (XIII) was synthesized by the method described in "Synthesis of CCC020-TPP" above (Figure 13).

[0140] [Chemical Formula]

[0141] The growth inhibitory effect of CCC021-TPP on cells with the A14582G mtDNA mutation was evaluated by WST assay. Both the mitochondrial DNA mutant cell line A549 and the PC14 cell line without the mutation were seeded in a 96-well plate (Thermo Fisher Scientific) at 1×10 3 cells / well, and after culturing for 24 hours, they were treated with CCC021-TPP to a final concentration of 0, 1, 5, 10, 20, 25, 50, 100 μM. After further culturing for 4 days, the cell morphology was observed with an optical microscope IX71 (OLYMPUS, Tokyo). Then, using a Cell counting kit-8 (DOJINDO, Kumamoto), the cell viability was calculated according to the instruction manual. As a control, DMSO (Wako) was added to the cells at a final concentration of 1%.

[0142] Also, the IC50 was calculated using the following formula. IC50 = 10(LOG(A / B)×(50 - C) / (D - C)+LOG(B)) A: The higher concentration sandwiching 50% cell viability B: The lower concentration sandwiching 50% cell viability C: Inhibition rate at the lower concentration sandwiching 50% cell viability D: Inhibition rate at the higher concentration sandwiching 50% cell viability WST assays were performed to investigate the effects of CCC021-TPP on cell proliferation. In PC14 cells without the mutant mtDNA, cell proliferation was suppressed and no IC50 could be calculated. However, in A549 cells with the mutation, cell death was induced, and the IC50 was 78.89 μM (Figure 14).

[0143] Cell proliferation inhibition was observed for an even longer period using the aforementioned A549 and PC14 cells. The culture conditions described above (1 × 10⁶ for both the mtDNA mutant cell line A549 and the non-mutant PC14 cell line) were used. 3 The cells were seeded to a cell / well ratio, cultured for 24 hours, and then treated with CCC021-TPP to a final concentration of 20 μM. The cells were observed for 8 days and the number of cells was counted.

[0144] As shown in Figure 15, in A549, CCC0021-TPP treatment resulted in a significantly lower cell count and significant inhibition of proliferation. However, in PC14, no significant difference in cell count was observed, and no inhibitory effect on cell proliferation was observed. From this, it was concluded that CCC0021-TPP predominantly induces cell death in cancer cell lines possessing the target mitochondrial DNA sequence, but does not induce significant cell death in cancer cell lines lacking the target mitochondrial DNA sequence, suggesting that it induces cancer cell death specifically in mitochondrial mutant sequences. (Example 2) Synthetic lethal experiment Prior to the experiment, the localization of CCC021-TPP to mitochondria in cultured cell lines A549 and PC14 was investigated by immunostaining using MitoTrackerRED and an anti-TPP antibody. 5 × 10⁶ A549 cells were placed in a 35mm glass base dish (IWAKI, Ikuoka). 3 cells / dish, PC14 cells 1 × 10 4Cells were seeded in a cell / dish ratio and cultured for 24 hours before being treated with CCC021-TPP to a final concentration of 20 μM. After another 24 hours, the culture medium was removed, and DMEM culture medium containing MitoTracker® Red CMXRos (Life Technologies, USA) was added to a concentration of 100 nM. After 30 minutes, the cells were washed twice with PBS, fixed with 4% PFA for 30 minutes, then replaced with PBS and stored at 4°C. Immunoantibody staining was performed using the method described in Example 1, and the cells were observed with a confocal laser microscope SP8 (Leica, Germany). As a result, it was found that TPP and MitoTrackerRED co-localized, and that CCC021-TPP was stored in the mitochondria (Figure 16). A549 and PC14 were each placed in 96-well plates in 5 × 10⁶ units. 2 Cells were seeded one by one into 16 wells and cultured for 24 hours. Then, two wells were treated with CCC021-TPP at concentrations of 0, 1, 2, 5, 10, 25, and 50 μM. After 5 days, the CytoSelect™ MTT Cell Proliferation Assay (CosmoBio) was used, and after a 2-hour reaction at room temperature, the absorbance at 590 nm was measured using SPECTRAFLUOR Plus (TECAN) to perform a second cell proliferation trial. As a result, as shown in the MTT assay results in Figure 17, the IC50 of A549 was 7.97 μM, and the IC50 of PC14 could not be calculated (Figure 17). Furthermore, after CCC021-TPP administration, A549 cells became enlarged, their shape distorted, and they exhibited a characteristic cellular morphology that is considered to be senescent, with numerous vacuoles inside the cells (Figure 18). After 7 days, the change in the number of viable cells in A549 and PC14 cells was measured by trypan blue staining to investigate cell viability. The trypan blue assay revealed that CCC021-TPP did not affect the viability of either A549 or PC14 cells (Figure 19). This suggests that CCC021-TPP did not exhibit cell-killing ability, but rather affected cell proliferation in A549 cells. In other words, CCC021-TPP suppressed A549 cell proliferation, but there was no change in the number of viable cells, and no induction of cell death was observed, although it suggested the possibility of inducing cellular senescence.

[0145] To investigate whether cellular senescence was induced, the activity of the senescence marker β-galactosidase was assessed using SPiDER-β-Gal (DOINDO) in A549 and PC14 cells after administration of CCC021-TPP. After seeding 1000 cells in a 35mm dish and culturing for 24 hours, CCC021-TPP was administered to a final concentration of 20 μM and cultured for 5 days. After washing twice with Hanks' Balanced Salt Solution (HBSS) (pH 7.3), the cells were treated with 500 μL of 4% paraformaldehyde at room temperature for 3 minutes, washed twice again with HBSS, treated with 500 μL of SPiDER-β-Gal Working Solution at 37°C for 30 minutes, washed once with HBSS, and observed with an SP8 confocal microscope.

[0146] As a result, in A549 cells administered with CCC021-TPP, blue staining indicating increased β-galactosidase activity was observed using SA-β-Gal staining (Figure 20). Figure 21 shows a bar graph quantifying the number of cells stained by SA-β-Gal staining.

[0147] In senescent cells, the expression of inflammation-related genes, such as inflammatory cytokines, increases. This is known to induce a phenomenon called SASP (Senescence-associated secretory phenotype). To investigate whether this phenomenon is induced in A549 cells, cells were harvested 5 days after CCC021-TPP treatment using RT-qPCR, as in Example 1. RNA extraction, RNA reverse transcription, cDNA synthesis, and RT-qPCR were then performed in A549 and PC14 cells to examine the expression of inflammatory cytokines (IL-1A, IL-1B, IL-6, IL-8), as in Example 1. The primers used for amplification of each gene are shown below. qPCR was performed using the Applied Biosystems® 7500 real-time PCR system. Amplification was carried out under the following conditions: Holding stage at 50°C for 2 min → 95°C for 10 min, Cycling stage at 95°C for 15 seconds → 60°C for 1 min for 40 cycles. Melt curve stage at 95°C for 15 seconds → 60°C for 1 min → 95°C for 15 seconds → 60°C for 15 seconds. Dissociation curve analysis after amplification was performed, and reaction specificity was confirmed by the absence of primer dimer byproducts in the PCR product.

[0148] IL-1A Forward 5' CATTGGCGTTTGAGTCAGCA 3' (Sequence ID 15) Reverse 5' CATGGAGTGGGCCATAGCTT 3' (Sequence ID 16) IL-1B Forward 5' CAGAAGTACCTGAGCTCGCC 3' (Sequence ID 17) Reverse 5' AGATTCGTAGCTGGATGCCG 3' (Sequence No. 18) IL-6 Forward 5' GTTGTGCAAGGGTCTGGTTT 3' (Sequence ID 19) Reverse 5' GGATGGTGTCTCTTGCAGGA 3' (Sequence No. 20) IL-8 Forward 5' ATGACTTCCAAGCTGGCCGT 3' (Sequence ID 21) Reverse 5' TCCTTGGCAAAACTGCACCT 3' (Sequence ID 22) In A549 cells, the expression of IL-1A and IL-8 was significantly elevated, and IL-6 also showed an increasing trend. Based on these qPCR results, it was suggested that SASP was induced by CCC021-TPP (Figure 22).

[0149] It is thought that the cause of cellular senescence was that the mutant mitochondria induced mitochondrial-specific autophagy (mitophagy) upon administration of CCC021-TPP. This is thought to have led to excessive production of reactive oxygen species, which in turn contributed to the induction of cellular senescence. Therefore, autophagy in A549 cells was confirmed after treatment with 20 μM CCC021-TPP for 4 days by immunofluorescence staining with anti-LC3 antibody and cytochrome C antibody, as in Example 1.

[0150] Administration of CCC021-TPP resulted in stronger fluorescence mediated by anti-LC3 antibody in A549 cells compared to PC14 cells. The intracellular localization of the fluorescence mediated by anti-LC3 antibody was confirmed to be consistent with that of the fluorescence mediated by cytochrome C antibody. The co-localization of autophagy markers and mitochondrial markers was observed, suggesting that mitophagy was induced in A549 cells. (Figure 23) Furthermore, to confirm that LC3 localizes to mitochondria via mitophagy, A549 cells were transfected with a GFP-LC3 complex protein, GFP-LC3, using a pCMX-SAH / Y145F-LC3B-GFP expression vector, and it was investigated whether the exogenous LC3 protein accumulated in the autophagy region. 5x10 4Cells were seeded and cultured for 24 hours. Then, 10 μg of vector DNA (7.5 μL of P3000 reagent) and 20 μL of Lipofectamine® 3000 (ThermoFisher) were added to 500 μL of OptiMEM, left at room temperature for 5 minutes, and transfection was performed. After 24 hours of culture, 1000 subcultured cells were seeded and cultured in 20 μM CCC021-TPP for 4 days, and confirmed by fluorescence observation with MitoTracker Red.

[0151] The green fluorescence of the GFP-LC3 complex protein co-localized with the red fluorescence of MitoTracker Red in CCC021-TPP-treated cells, confirming the accumulation of exogenous LC3 in mitochondria and suggesting that specific mitophagy occurs in mitochondria (Figure 24).

[0152] To confirm the induction of reactive oxygen species (ROS) production by mitophagy, the production of ROS induced by MitoSOX Red (invitrogen) was observed using fluorescence microscopy. (A549, PC14 cells, 10 cells) 4 After seeding and culturing for 10 hours, the cells were treated with 10 μM CCC021-TPP for 24 hours, washed with PBS, and then treated with 13 μL of DMSO dissolved in MitoSOX Red, diluted with PBS to a final concentration of 5 μM, at 37°C for 10 minutes. After washing with PBS, the cells were observed using an SP8 confocal microscope.

[0153] Administration of CCC021-TPP showed little to no promotion of ROS production in PC14 cells, but excessive ROS production was induced in the cytoplasm of A549 cells (Figure 25).

[0154] Since cell senescence was confirmed in A549 cells by the administration of CCC021-TPP, it was considered that the activation of BCL2, BCL-XL, BCL-W, MDM2, etc., which are the suppression mechanisms of cell death (apoptosis) in senescent cells, occurred. Therefore, regarding the maintenance of senescent cells by avoiding apoptosis, the expression changes of anti-apoptotic factors BCL-XL, BCL2, Survivin and pro-apoptotic factor BAX by CCC021-TPP treatment were examined by RT-qPCR. Five days after CCC021-TPP treatment, cells were collected as described above, RNA extraction, RNA reverse transcription, cDNA synthesis, and RT-qPCR were performed in the same manner as in Example 1, and the expression of apoptosis-related factors (BCL-XL, BCL2, Survivin, BAX) was examined in A549 cells and PC14 cells. The primers used for the amplification of each gene are shown below. qPCR was performed using the Applied Biosystems (registered trademark) 7500 Real-Time PCR System. After the Holding stage of 50°C for 2 min → 95°C for 10 min, amplification was carried out under the conditions of the Cycling stage of 95°C for 15 sec → 60°C for 1 min for 40 cycles, and dissociation curve analysis after amplification was performed in the Melt curve stage of 95°C for 15 sec → 60°C for 1 min → 95°C for 15 sec → 60°C for 15 sec to confirm the reaction specificity by the absence of primer dimer by-products, etc. in the PCR product.

[0155] BCL-XL Forward 5‘ CGGTACCGGCGGGCATTCAG 3’(SEQ ID NO: 23) Reverse 5‘ CGGCTCTCGGCTGCTGCATT 3’(SEQ ID NO: 24) BAX Forward 5‘ CTGAGCAGATCATGAAGACA 3’(SEQ ID NO: 25) Reverse 5‘ AGTTTGCTGGCAAAGTAGAA 3’(SEQ ID NO: 26) BCL2 Forward 5' CTTTGAGTTCGGTGGGGTCA 3' (Sequence ID 27) Reverse 5' GGGCCGTACAGTTCCACAAA 3' (Sequence No. 28) Survivin Forward 5' GGACCACCGCATCTCTACAT 3' (Sequence ID 29) Reverse 5' GTTCCTCTATGGGGTCGTCA 3' (Sequence No. 30) In the apoptosis inhibition pathway, BCL-2 and BCL-XL act upstream, and Survivin acts downstream. In A549 cells treated with CCC021-TPP, the expression of BCL-XL, an upstream anti-apoptotic factor, was found to be elevated (Figure 26). This suggests that it inhibits the transition to apoptosis. However, an increase in BAX, an apoptosis-promoting factor, and a decrease in downstream Survivin were also observed, suggesting that there may be a state where the induction and inhibition of cell death are in opposition to each other.

[0156] Since the suppression of cell death in cellular senescence of A549 cells was thought to be due to the BCL pathway, it was hypothesized that cells whose cellular senescence was induced by CCC021-TPP could be induced into apoptosis by co-administering ABT-263 (Cayman Chemical), a senolytic drug that removes senescent cells and inhibits the BCL pathway. Therefore, we observed the cells under a light microscope to see if cell death could be induced in senescent cells by combining CCC021-TPP treatment with ABT-263, a BCL2 and BCL-XL inhibitor, and observed changes in cell morphology. 500 A549 cells were seeded in a 96-well plate and cultured for 24 hours. Then, cells were observed under a light microscope at different time intervals after administration of no treatment, 20 μM CCC021-TPP, and 10 μM ABT-263, both individually and in combination, and cell morphology was photographed on days 2 and 4.

[0157] No apoptotic cells were detected in DMSO control cells, cells treated with ABT-263 only, or cells treated with CCC021-TPP only. However, in A549 cells treated with a combination of CCC021-TPP and ABT-263, cells that clearly underwent apoptosis were already observed 2 days after administration, and even more significantly 4 days later (Figure 27).

[0158] We confirmed that the suppression of cell death in cellular senescence of A549 cells is thought to be due to the BCL pathway using BCL2 and BCL-XL specific inhibitors, and investigated which BCL pathway inhibitors, when combined, can induce apoptosis (programmed cell death) in senescent A549 cells. After seeding 500 A549 cells in a 96-well plate and culturing for 24 hours, changes in cell morphology were photographed using a light microscope after 4 days of treatment with no DMSO, treatment with 20 μM CCC021-TPP and 10 μM of the BCL2 inhibitor ABT-199 (compound 33, Venetoclax, in Figure 55-10), treatment with 10 μM of the BCL-XL inhibitor A1155463 (compound 16, in Figure 55-6), and treatment with the same concentration of CCC021-TPP combined with the same concentration of ABT-199 or A1155463.

[0159] In the DMSO control, CCC021-TPP, ABT-199, A1155463, and combination therapy with ABT-199 and CCC021-TPP, no signs of cell death were observed 4 days later. However, in the combination therapy with A1155463 and CCC021-TPP, a significant increase in apoptotic cells (indicated by arrows) and cells exhibiting a flat, large, senescent-like morphology was observed (Figure 56). (Example 3) Skin permeability confirmation experiment Non-inbred ICR mice were purchased from Oriental Yeast, and single-chain PIP-TPP (CCC149-TPP) with a molecular weight of 1274.7 was used for administration experiments to the backs of the mice. The back skin of 5-week-old ICR mice was shaved, and after confirming that the hair cycle had not yet begun, at 6 weeks of age, DMSO without PIP-TPP was applied to four locations on the back, as shown in Figure 28, at a dose of 30 mg / cm². 2PIP-TPP solutions were applied to mice that had been adjusted to the following conditions (DMSO solution, 95% DMSO / 5% Laurocapram (transdermal absorption enhancer) solution, and 95% DMSO / 5% Laurocapram solution 24 hours after stratum corneum removal). After 18 hours, the mice were euthanized, and skin tissue was obtained. After fixing with 4% paraformaldehyde, paraffin blocks were prepared, and immunohistochemical staining with anti-TPP antibody and simultaneous nuclear staining with DAPI staining were performed to verify the skin permeability of drugs into the skin and subcutaneous tissue.

[0160] Figure 29 shows the structural formula of single-chain PIP-TPP (CCC149-TPP). Figure 30 shows the results of HPLC and mass spectrometry of CCC149-TPP. As shown in Figure 31, no staining with anti-TPP antibody was observed with DMSO alone, but CCC149-TPP was present in skin basement membrane cells, and when a transdermal absorption enhancer was used, TPP staining was observed around the cell nuclei in the subcutaneous tissue. Further staining to the subcutaneous tissue and muscle layer was observed more clearly by removing the stratum corneum and using a transdermal absorption enhancer. From this, it was confirmed that PIP-TPP exhibits skin permeability, suggesting that it may be possible to develop a transdermal formulation of this treatment.

[0161] [ka]

[0162] (Example 4) Library creation and synthesis As an example of library compound synthesis, the synthesis method for Dp-Py-Py-TPP is shown in Figure 32.

[0163] Compound 1 in Figure 32 was synthesized by solid-phase synthesis, similar to Example 1, by adding Boc-protected β-alanine to the N-terminus of two or more heterocyclic compounds extended from a solid-phase resin via β-alanine. Compound 2 in Figure 32 was then synthesized by treating the C-terminus to become a carboxylic acid. After isolating compound 2, it was reacted with N,N-dimethyl-1,3-propanediamine as a condensing agent to synthesize compound 3 in Figure 32. Subsequently, the protecting group at the N-terminus was removed to obtain compound 4 in Figure 32. This compound was then reacted with (3-Carboxypropyl)triphenylphosphonium (TPP) as a condensing agent to obtain the target compound 5 in Figure 32, which was purified by HPLC.

[0164] Figure 33 shows the library compounds and eight cyclic compounds derived from the two-cyclic compounds. Four compounds can be synthesized from the two-cyclic compounds, eight compounds from the three-cyclic compounds, 16 compounds can be synthesized from each of the four four-cyclic compounds by inserting β-alanine from the four-cyclic compounds, 32 compounds can be synthesized from each of the four five-cyclic compounds by inserting β-alanine from the five-cyclic compounds, 64 compounds can be synthesized from each of the six-cyclic compounds by inserting one or more β-alanine molecules. The same applies to the seven-cyclic compounds, with 128 compounds being synthesized from each of the assumed compounds containing one β-alanine molecule. The same applies to the eight-cyclic compounds, with 256 compounds being synthesized from each of the assumed compounds containing one or more β-alanine molecules.

[0165] 9 or more cyclic compounds can be synthesized in the same manner.

[0166] Examples of compound synthesis and analysis are shown below.

[0167] Figure 34 shows the structure of the synthesized bicyclic compound CCC102-TPP.

[0168] Figure 35 shows the results of high-performance liquid chromatography and mass spectrometry of CCC102-TPP.

[0169] Figure 36 shows the structure of the synthesized tricyclic compound CCC106-TPP.

[0170] Figure 37 shows the results of high-performance liquid chromatography and mass spectrometry of CCC106-TPP.

[0171] Figure 38 shows the structure of the synthesized tetracyclic compound CCC114-TPP.

[0172] Figure 39 shows the results of high-performance liquid chromatography and mass spectrometry of CCC114-TPP.

[0173] Figure 40 shows the structure of the synthesized pentacyclic compound CCC175-TPP.

[0174] Figure 41 shows the results of high-performance liquid chromatography and mass spectrometry of CCC175-TPP.

[0175] Figure 42 shows the structure of the synthesized hexacyclic compound CCC206-TPP.

[0176] Figure 43 shows the results of high-performance liquid chromatography and mass spectrometry of CCC206-TPP.

[0177] Figure 44 shows the structure of the synthesized 7-cyclic compound CCC1283-TPP.

[0178] Figure 45 shows the results of high-performance liquid chromatography and mass spectrometry of CCC1283-TPP.

[0179] Figure 46 shows the structure of the synthesized 8-cyclic compound CCC1394-TPP.

[0180] Figure 47 shows the results of high-performance liquid chromatography and mass spectrometry of CCC1394-TPP.

[0181] [ka]

[0182] [ka]

[0183] [ka]

[0184] [ka]

[0185] [ka]

[0186] [ka]

[0187] [ka]

[0188] (Example 5) Inhibition of tumor cell proliferation by library compound Examples of the linear heptacyclic compound CCC1283-TPP are shown in Figures 44 and 45.

[0189] This compound can recognize the T4216C mutation in the mitochondrial ND1 gene, and the cervical cancer cell line C33A possesses this mutation. A cell proliferation assay was performed using the same cervical cancer cell line with wild-type HeLa cells in the same manner as in Example 1. 1000 cells were seeded in a 96-well plate, and CCC1283-TPP was administered at concentrations of 0.5, 1, 5, 10, and 20 μM. A WST assay was performed 5 days later.

[0190] As shown in Figure 48, CCC1283-TPP (linear PIP) did not suppress the proliferation of HeLa cells, but a tendency towards proliferation suppression was observed in C33A.

[0191] Examples of the cyclic compound CCCh531-TPP are shown. This compound can recognize the T4216C mutation in the mitochondrial ND1 gene, and the cervical cancer cell line C33A possesses this mutation. A cell proliferation assay was performed using the same cervical cancer cell line against wild-type HeLa cells in the same manner as described in Example 1. 1000 cells were seeded in a 96-well plate, and CCCh531-TPP was administered at concentrations of 0.5, 1, 5, 10, and 20 μM. A WST assay was performed 5 days later.

[0192] Figure 49 shows the structure of the cyclic compound CCC531-TPP.

[0193] Figure 50 shows the results of high-performance liquid chromatography and mass spectrometry analysis of CCCh531-TPP.

[0194] As shown in Figure 51, CCCh531-TPP (hairpin type) showed strong inhibition of proliferation in C33A cells, with an IC50 of 11.82 μM in HeLa cells and an IC50 of 3.34 μM in C33A cells.

[0195] [ka]

[0196] Regarding CCCh560-TPP, a cyclic structural compound targeting the A8860G polymorphism of the mitochondrial gene ATP6, which is found in the human population rather than acquired mitochondrial mutations in somatic cells, we investigated whether cell proliferation inhibition was observed after 5 days of treatment with the compound targeting mitochondrial DNA polymorphism in cancer cell lines C33A, HeLa, Siha, Caski, ME180, and human non-tumor skin-derived fibroblast (HDF) cells, which possess this polymorphism homoplasmically. A cell proliferation assay was performed in the same manner as described in Example 1. 1000 cells were seeded in a 96-well plate, and CCCh560-TPP was administered at concentrations of 0.5, 1, 5, 10, and 20 μM. A WST assay was performed after 5 days.

[0197] Figure 52 shows the structure of the cyclic compound CCCh560-TPP.

[0198] Figure 53 shows the results of high-performance liquid chromatography and mass spectrometry analysis of CCCh560-TPP.

[0199] As shown in Figure 54, CCCh560-TPP showed a tendency to suppress proliferation in human non-tumor cells (HDF - human dermal fibroblasts), but its IC50 could not be calculated. However, in tumor cell lines C33A, Hela, Siha, Caski, and ME180, significantly stronger proliferation suppression was observed in tumor cells, with IC50 values ​​of 1.65, 7.75, 12.6, 5.5, and 3.24 μM, respectively.

[0200] [ka]

[0201] (Example 6) Plant cell permeation experiment It has been reported that TPP, a lipid-soluble cation, and its complexes permeate into chloroplasts and yeast, affecting plants (Non-Patent Documents 4 and 5), but it has not been clarified that the complex of DNA recognition compounds and TPP is delivered into living plant cells. We investigated the permeability into living plant cells using CCC105-TPP labeled with FITC fluorescent dye in the roots and leaves of *Thaliana thaliana*.

[0202] Figure 57 shows the structural formula of FITC-CCC105-TPP.

[0203] Figure 58 shows the results of high-performance liquid chromatography and mass spectrometry analysis of FITC-CCC105-TPP.

[0204] The taproots of Arabidopsis thaliana Col-0 were cut, cultured for 3 hours in 0.05% MES (pH 5.7) 1 / 2 MS medium with 700 nM FITC-CCC105-TPP (final DMSO concentration 0.1%), washed twice with MiliQ water, and observed under a fluorescence microscope. Roots 4 days after germination were cultured for 3 hours in 1 / 2 MS medium with 700 nM FITC-CCC105-TPP (final DMSO concentration 0.1%), washed twice with MiliQ water, and observed under a fluorescence microscope in the same manner.

[0205] Figure 59A shows FITC fluorescence in the taproot. Spherical nuclei (dashed arrows) with strong fluorescence intensity were observed within the taproot cells, and fluorescence was also observed in the cytoplasm (solid arrows). Figure 59B shows the fluorescence image of a root 4 days after germination. Regions showing fluorescence in the intracellular nucleus (dashed arrows) and cytoplasm (solid arrows) were observed.

[0206] Leaves of 2-week-old H2B (histone H2B)-GFP expressing Arabidopsis thaliana were cut, treated with 700 nM FITC-CCC105-TPP (DMSO final concentration 0.1%) in 1 / 2 MS medium for 16 hours, washed twice with MiliQ water, and observed under a fluorescence microscope.

[0207] Figure 60A shows GFP fluorescence induced by H2B in the leaf nucleus. Figure 60B shows FITC fluorescence induced by CCC105-TPP in the leaf nucleus.

[0208] Since it has been confirmed that FITC-CCC105-TPP can penetrate into the nucleus and cytoplasm within cells in plants with cell walls, it is expected to be effective in plants and other organisms with cell walls. [Industrial applicability]

[0209] The complex of the present invention recognizes the sequence of DNA in bimembrane intracellular organelles, promotes mitochondrial autophagy, induces a decrease in the copy number of mutant mitochondria and cell death in cells containing mutant mitochondria, and can be used as an active ingredient in pharmaceutical compositions for mitochondrial-related diseases and the like.

[0210] Sequence IDs 1-30 Primers All publications, patents, and patent applications cited herein shall be incorporated herein by direct reference.

Claims

1. A complex having the structure represented by the following formula (IV) or (III). 【Chemistry 1】 【Chemistry 2】 (Y is -CH- or -N-, R 1 The base is represented by the following equation, 【Transformation 3】 R 2 ha-CH 3 or a hydrogen atom, n is 0.

2. A therapeutic method for diseases caused by mitochondrial DNA mutations, comprising the complex described in claim 1. Pharmaceutical composition.

3. A complex containing the complex described in claim 1, for mitochondrial diseases, cancer, neurological disorders and mental illnesses A pharmaceutical composition for the treatment of diseases selected by patients.

Images