Cationic lipids

Abstract

The present invention provides a novel cationic lipid having excellent encapsulation and delivery stability of nucleic acid medicines. Provided is a compound represented by formula (I) or a pharmacologically acceptable salt thereof. (In the formula, R1 is a substituted or unsubstituted formula –(CH2)a-L1-(CH2)b-CH3; R2 is a substituted or unsubstituted C5-C20 alkyl group or a substituted or unsubstituted formula -(CH2)c-L2-(CH2)d-CH3; L1 and L2 are each independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a, b, c, and d are each independently an integer of at least 1, and the total of a and b and the total of c and d are each an integer of 5-25; R3-R7 are each independently a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or the like; R8, R9, and R10 are each a hydrogen atom; the constituent atoms in formula (I) may form a ring; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, or the like; and X is O or S)

Description

[Technical Field]

[0001] This invention relates to a novel cationic lipid. [Background technology]

[0002] Unlike conventional drugs that target proteins, nucleic acid drugs can introduce and suppress sequence-specific target genes both in vivo and in vitro. Because they can promote or suppress the expression of any protein simply by modifying the design of the target sequence, they are attracting attention as next-generation pharmaceuticals that can treat not only common diseases but also genetic and intractable diseases with high unmet medical needs.

[0003] Examples of nucleic acids introduced into the body as nucleic acid drugs include siRNA (small interfering RNA), mRNA (messenger RNA), miRNA (microRNA), shRNA (small hairpin RNA or short hairpin RNA), antisense oligonucleotides, and immunostimulant nucleic acids.

[0004] These nucleic acids, while chemically stable, have drawbacks for therapeutic use because they are easily degraded by nucleases in the body, and they do not easily penetrate cell membranes on their own, resulting in low uptake efficiency into target cells. To overcome these two major problems, research has been conducted for many years on chemical modification of nucleic acids themselves and on drug delivery systems (DDS) to deliver nucleic acids into target cells.

[0005] Examples of DDS include methods that utilize carriers such as cationic liposomes and polymeric micelles. For example, it is known that by encapsulating nucleic acids within microparticles containing cationic lipids, the nucleic acids are protected from degradation in the blood and are enabled to permeate through the lipid-soluble cell membrane. Patent Document 1 describes the following compounds as such cationic lipids. The lipid preparation described in Patent Document 1 is a composition in which therapeutic nucleic acids are encapsulated within microparticles containing the lipid, and the nucleic acids are protected from degradation in serum. The preparation is efficiently delivered throughout the body, and the encapsulated nucleic acids are also efficiently delivered into cells. [Chemical formula]

[0006] In addition, various compounds have been developed as cationic lipids that are expected to be used in nucleic acid pharmaceuticals (Patent Documents 2 to 7 and 9, Non-Patent Documents 1 to 3).

[0007] Patent Document 2 describes the following compounds. [Chemical formula] Patent Document 3 describes the following compounds. [Chemical formula] Patent Documents 4 and Non-Patent Document 1 describe the following compound ALN-319. [Chemical formula] [[ID=3,6]] Patent Document 5 describes the following compound YS-119. [Chemical formula]

[0008] Patent Document 6 describes the following compounds. [Chemical formula] Compound described in Patent Document 7 is as follows. [Chemical Formula] Compound described in Patent Document 9 is as follows. [Chemical Formula] Compound described in Non-Patent Document 2 is as follows. [Chemical Formula] Compound described in Non-Patent Document 3 is as follows. [Chemical Formula] Compound described in Patent Document 8 is described as a lubricant. <00009​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​ International Publication No. 2015 / 005253 [Patent Document 7] International Publication No. 2019 / 235635 [Patent Document 8] Japanese Unexamined Patent Application Publication No. 2003-040847 [Patent Document 9] International Publication No. 2020 / 118041 [Non-Patent Document]

[0010] [Non-Patent Document 1] Molecular Therapy, 2013, vol. 21(8), 1570-1578 [Non-Patent Document 2] Angewandte Chemie, 2012, vol.51(34), 8529-33 [Non-Patent Document 3] International Journal of Pharmaceutics, 2017, vol. 519, 34―43 [Summary of the Invention] [Problems to be Solved by the Invention]

[0011] An object of the present invention is to provide a novel cationic lipid that forms lipid particles. [Means for Solving the Problems]

[0012] As a result of intensive studies, the present inventors have designed and synthesized a novel cationic lipid. It has been found that lipid nanoparticles (LNPs) containing the cationic lipid have excellent properties as pharmaceuticals, such as being able to efficiently encapsulate nucleic acids containing single-stranded or double-stranded polynucleotides such as siRNA and mRNA, and having high stability of the LNPs. It has also been found that the nucleic acids contained in the LNPs suppress the expression of target sequences and promote the expression of target proteins in a plurality of cell lines.

[0013] The present invention specifically relates to the following. (1’) Formula (I):

Chemical formula

[0014] The LNP containing the cationic lipid of the present invention can efficiently encapsulate nucleic acids and stably retain them within the particle. Furthermore, the nucleic acids contained in the LNP can act on target cells. Therefore, the cationic lipid of the present invention can be used as a lipid for nucleic acid delivery into cells. [Modes for carrying out the invention]

[0015] The meanings of the terms used in this specification are explained below. Unless otherwise specified, each term has the same meaning whether used alone or in combination with other terms. The present invention will now be described with reference to embodiments. Throughout this specification, singular expressions should be understood to include the concept of their plural form unless otherwise specified. Therefore, singular articles (for example, "a," "an," and "the" in English) should be understood to include the concept of their plural form unless otherwise specified. Furthermore, unless otherwise specified, terms used herein should be understood to have the meaning commonly used in the art described above. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. In case of any conflict, this specification (including definitions) shall prevail.

[0016] "Alkyl groups" include linear or branched hydrocarbon groups having 1 to 20 carbon atoms. Examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, n-heptyl, isoheptyl, n-octyl, isooctyl, n-nonyl, and n-decyl. R 2 C5-C 20 "Alkyl group" refers to a straight-chain hydrocarbon group having 5 to 20 carbon atoms. Preferably, a straight-chain C5-C 15 Alkyl group, more preferably linear C5-C 10 It is an alkyl group. R 3 ~R 7 The "C1-C6 alkyl group" in R refers to a linear or branched hydrocarbon group having 1 to 6 carbon atoms. Preferably, it is a linear or branched C1-C4 alkyl group, and more preferably, a linear or branched C1-C3 alkyl group. Even more preferably, it is methyl. The substituent group α is "C1-C 10 "Alkyl group" refers to a linear or branched hydrocarbon group having 1 to 10 carbon atoms. Preferably, it is a linear or branched C2-C8 alkyl group. The "C1-C6 alkyl group" in substituent groups β and β2 refers to a linear or branched hydrocarbon group having 1 to 6 carbon atoms. Preferably, it is a linear or branched C1-C3 alkyl group. More preferably, it is methyl.

[0017] "Halogen atoms" include fluorine atoms, chlorine atoms, bromine atoms, and iodine atoms. Fluorine atoms and chlorine atoms are particularly preferred.

[0018] "Halogenated alkyl groups" include linear or branched alkyl groups having 1 to 20 carbon atoms that are substituted with one or more halogens. "Halogenated C1-C" of substituent group α 10 "Alkyl group" is the above "C1-C" which is substituted with one or more halogens. 10This means "alkyl group". Preferably, it is a linear or branched C2-C8 alkyl group substituted with 1 to 10 halogens. The "halogenated C1-C6 alkyl group" in substituent group β and substituent group β2 means the above-mentioned "C1-C6 alkyl group" substituted with one or more halogens. Preferably, it is a linear or branched C1-C3 alkyl group substituted with 1 to 4 halogens.

[0019] The term "alkenyl group" includes linear or branched hydrocarbon groups with 2 to 20 carbon atoms that have one or more double bonds at any position. Examples include vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, prenyl, butadienyl, pentenyl, isopentenyl, pentadienyl, hexenyl, isohexenyl, hexadienyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodecenyl, tridecenyl, tetradecenyl, pentadecenyl, and the like. The substituent group α is "C2-C 10 The term "alkenyl group" refers to a linear or branched alkenyl group having 2 to 10 carbon atoms. Preferably, it is a linear or branched C2-C group having 1 to 4 double bonds. 10 It is an alkenyl group. R 6 and R 7 The "C2-C6 alkenyl group" refers to a linear or branched alkenyl group having 2 to 6 carbon atoms. Preferably, it is a linear or branched C2-C4 alkenyl group having one or two double bonds.

[0020] The term "halogenated alkenyl group" includes linear or branched alkenyl groups having 2 to 20 carbon atoms that are substituted with one or more halogens. "Halogenated C2-C" of substituent group α 10 The "alkenyl group" is the "C2-C" group substituted with one or more halogens. 10 This refers to an "alkenyl group." Preferably, it is a linear or branched C2-C8 alkenyl group substituted with 1 to 10 halogens.

[0021] An "alkynyl group" includes linear or branched hydrocarbon groups with 2 to 20 carbon atoms that have one or more triple bonds at any position. They may also have double bonds at any position. Examples include ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octinyl, noninyl, desynyl, etc. The substituent group α is "C2-C 10 The term "alkynyl group" refers to a linear or branched alkynyl group having 2 to 10 carbon atoms. Preferably, it is a linear or branched C2-C group having one or two triple bonds. 10 It is an alkynyl group. R 6 and R 7 The "C2-C6 alkynyl group" refers to a linear or branched alkynyl group having 2 to 6 carbon atoms. Preferably, it is a linear or branched C2-C4 alkynyl group having one triple bond.

[0022] "Halide-modified alkynyl groups" include linear or branched alkynyl groups having 2 to 20 carbon atoms that are substituted with one or more halogens. "Halogenated C2-C" of substituent group α 10 The "alkynyl group" is the "C2-C" group substituted with one or more halogens. 10 This refers to an "alkynyl group." Preferably, it is a linear or branched C2-C8 alkynyl group substituted with 1 to 10 halogens.

[0023] "Alkoxy" means alkyloxy.

[0024] "Halogenated alkoxy groups" include linear or branched alkoxy groups having 1 to 20 carbon atoms that are substituted with one or more halogens. "Halogenated C1-C" of substituent group α 10 The term "alkoxy group" refers to a linear or branched alkoxy group having 1 to 10 carbon atoms substituted with one or more halogens. Preferably, it is a linear or branched C2-C8 alkoxy group substituted with 1 to 10 halogens.

[0025] The substituent group α is "C1-C 11The "alkanoyl group" is a formyl group or C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C2-C 10 Alkenyl group, halogenated C2-C 10 Alkenyl group, C2-C 10 Alkynyl group or halogenated C2-C 10 This includes carbonyl groups substituted with alkynyl groups. The "C1-C7 alkanoyl group" of substituent group β and substituent group β1 includes a formyl group or a carbonyl group substituted with a C1-C6 alkyl group or a halogenated C1-C6 alkyl group.

[0026] The term "alkoxyalkoxy group" includes linear or branched alkoxy groups having 1 to 20 carbon atoms that are substituted with one or more alkoxy groups. The substituent group α is "C1-C 10 Alkyl C1-C 10 An "alkoxy group" is a C1-C 10 This refers to a linear or branched alkoxy group having 1 to 10 carbon atoms substituted with an alkoxy group. Preferably, 1 to 10 C1-C 10 It is a linear or branched C2-C8 alkoxy group substituted with an alkoxy group.

[0027] "Non-aromatic carbon ring" means a mono-ring or two- or more-ring non-aromatic saturated hydrocarbon ring or non-aromatic unsaturated hydrocarbon ring. Preferably, it means a 3- to 12-member non-aromatic saturated hydrocarbon ring or non-aromatic unsaturated hydrocarbon ring. Furthermore, the term "non-aromatic saturated hydrocarbon ring" also includes rings that form bridged or spiro rings, as described below. [ka] "Non-aromatic unsaturated hydrocarbon ring" refers to a ring that has one or more (preferably 1 to 3) double bonds within a non-aromatic saturated hydrocarbon ring, and also includes rings that form bridges or spiro rings. Examples of monocyclic non-aromatic carbocyclic compounds include cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclononane, cyclodecane, cyclopropene, cyclobutene, cyclopentene, cyclohexene, cycloheptene, and cyclohexadiene.

[0028] The term "non-aromatic carbocyclic group" refers to a group derived from the "non-aromatic carbocyclic group" described above.

[0029] R 3 and R 4 The "C3-C5 non-aromatic carbon ring" formed by this refers to either a C3-C5 cyclic saturated hydrocarbon ring or a C3-C5 cyclic non-aromatic unsaturated hydrocarbon ring. Examples of C3-C5 cyclic saturated hydrocarbon rings include cyclopropane, cyclobutane, and cyclopentane. A C3-C5 cyclic non-aromatic unsaturated hydrocarbon ring refers to a ring in a C3-C5 cyclic saturated hydrocarbon ring that contains one double bond, such as cyclopentene. R 6 or R 7 The term "C3-C7 non-aromatic carbocyclic group" refers to either a C3-C7 cyclic saturated hydrocarbon group or a C3-C7 cyclic non-aromatic unsaturated hydrocarbon group. Examples of C3-C7 cyclic saturated hydrocarbon groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. A C3-C7 cyclic non-aromatic unsaturated hydrocarbon group refers to a cyclic group containing one double bond within a C3-C7 cyclic saturated hydrocarbon group, such as cyclopentenyl and cyclohexenyl.

[0030] A "non-aromatic heterocycle" refers to a monocyclic or bicyclic or multicyclic non-aromatic saturated heterocycle or non-aromatic unsaturated heterocycle having 1 to 3 identical or different heteroatoms arbitrarily selected from O, S, and N(R') within the ring. Preferably, it refers to a 3 to 12-membered non-aromatic heterocycle. Here, R' is a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group. The substituent is selected from substituent group β1. Furthermore, "non-aromatic heterocycles" also include rings that form bridged or spirocycles, as described below. [ka] Examples of monocyclic non-aromatic heterocycles include thiirane, oxirane, aziridine, oxetane, azetidine, oxathiolane, thiazolidin, pyrrolidine, pyrroline, imidazolidine, imidazoline, pyrazolidine, pyrazolone, tetrahydrofuran, and dihydrothiazolyl.

[0031] A "non-aromatic heterocyclic group" refers to a group derived from the "non-aromatic heterocyclic ring" described above. R 3 and R 7 The "non-aromatic heterocycle" formed by R 7 In addition to the nitrogen atom to which it is bonded and X, the ring may or may not contain heteroatoms as ring constituent atoms. R 3 and R 8 The "non-aromatic heterocycle" formed by this may or may not contain heteroatoms other than X. R 5 and R 6 The "non-aromatic heterocycle" formed by R 6 In addition to the nitrogen atom to which it is bonded, it may or may not contain other heteroatoms. R 6 and R 7 The "non-aromatic heterocycle" formed by R 6 and R 7 In addition to the nitrogen atom to which it is bonded, it may or may not contain other heteroatoms. R 7 and R 8 The "non-aromatic heterocycle" formed by R 7 In addition to the nitrogen atom to which it is bonded, it may or may not contain other heteroatoms.

[0032] "Ji (C1-C 10 The two C1-C alkyl carbamoyl groups10 The alkyl groups may be the same or different. The two C1-C6 alkyl groups in the "di-C1-C6 alkylamino group" may be the same or different.

[0033] R 2 "Substitute or non-substitute C5-C" 20 The alkyl group may have any substituted hydrogen atoms that are selected from one or more substituent groups α. It may have 1 to 10 substituted hydrogen atoms, or 1 to 4 substituted hydrogen atoms. "Substituted or unsubstituted C1-C6 alkyl groups," "substituted or unsubstituted C2-C6 alkenyl groups," or "substituted or unsubstituted C2-C6 alkynyl groups" may have any substituted hydrogen atom replaced by a substituent selected from 1 to 4 substituent groups β1. "Substituted or unsubstituted monocyclic C3-C5 non-aromatic carbocyclic groups," "substituted or unsubstituted C3-C7 non-aromatic carbocyclic groups," or "substituted or unsubstituted non-aromatic heterocycles" may have any substituted hydrogen atom replaced by a substituent selected from 1 to 4 substituent groups β2.

[0034] The present invention will be described in detail below. The compound of the present invention is a cationic lipid. The cationic lipid of the present invention is Equation (I): [ka] (In the formula, R 1 The expression is either a substitution or a non-substitution: -(CH2) a -L1-(CH2) b -CH3 is; R 2 C5-C is either substituted or unsubstituted. 20 Alkyl alkyl group, or substituted or unsubstituted formula: -(CH2) c -L2-(CH2) d -CH3 is; L1 and L2 are independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a and b are independent integers greater than or equal to 1, and the sum of a and b is an integer between 5 and 25; c and d are independently integers greater than or equal to 1, and the sum of c and d is an integer between 5 and 25; R 1 The formula is: -(CH2) a -L1-(CH2) b -CH3 and R 2 C5-C 20 Alkyl group and formula: -(CH2) c -L2-(CH2) d Each substituent in -CH3 is independently selected from substituent group α; The substituent group α consists of a halogen atom, an oxo group, a cyano group, a nitro group, a sulfanyl group, a carboxyl group, and a C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C2-C 10 Alkenyl group, halogenated C2-C 10 Alkenyl group, C2-C 10 Alkynyl group, halogenated C2-C 10 Alkynyl group, C1-C 10 Alkoxy group, halogenated C1-C 10 Alkoxy group, C1-C 10 Alkyl sulfanyl group, halogenated C1-C 10 Alkyl sulfanyl group, C1-C 11 Alkanoyl group, C1-C 11 Alkanoyloxy group, C1-C 10 Alkyl C1-C 10 Alkoxy group, C1-C 10 Alkoxycarbonyl group, C1-C 10 Alkylcarbamoyl group, di(C1-C 10 Alkyl)carbamoyl group, C1-C 10 Alkoxycarbonyloxy, C1-C 11 Alkanoyl (C1-C 10 Alkyl)amino, C1-C 10 Alkoxycarbonylamino and C1-C10 This group consists of alkylcarbamoyloxy; R 3 and R 4 Each of these is independently a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; Alternatively, R 3 and R 4 These may together form substituted or unsubstituted C3-C5 non-aromatic carbon rings; R 5 is a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 6 and R 7 Each of these is independently a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C2-C6 alkenyl group, a substituted or unsubstituted C2-C6 alkynyl group, or a substituted or unsubstituted C3-C7 non-aromatic carbocyclic group; R 8 , R 9 and R 10 is a hydrogen atom; Alternatively, R 3 and R 7 These may, together with the atoms to which they are bonded, form substituted or unsubstituted non-aromatic heterocycles; R 3 and R 8 These may, together with the atoms to which they are bonded, form substituted or unsubstituted non-aromatic heterocycles; R 5 and R 6 These may, together with the atoms to which they are bonded, form substituted or unsubstituted non-aromatic heterocycles; R 6 and R 7 These may, together with the atoms to which they are bonded, form substituted or unsubstituted non-aromatic heterocycles; R 8 and R 9 These atoms, together with the atoms to which they are bonded, may form substituted or unsubstituted non-aromatic carbocyclic rings or substituted or unsubstituted non-aromatic heterocyclic rings, in which case k is 1 or 2; R 7 and R8 R 5 and R 6 When these atoms form a ring, they may, together with the atoms to which they bond, form a substituted or unsubstituted non-aromatic heterocycle; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N (R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O) S-, -SC(=O)-, -N(R)S(=O)2-, -OS(=O)2-, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O)2-O-, -S(=O)2-N(R)-, -OP(=O)(-NR)O-, -C(=S)O- or -OC(=S)-; X is either O or S; p, q, s, and k are each independent integers between 0 and 2; r is an integer between 0 and 5; Each R is independently a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 3 ~R 7 and the C1-C6 alkyl group of R and R 6 and R 7 The substituents on the C2-C6 alkenyl group or C2-C6 alkynyl group are independently selected from substituent group β1; The substituent group β1 consists of halogen atoms, oxo groups, hydroxyl groups, cyano groups, sulfanyl groups, amino groups, C1-C6 alkoxy groups, C1-C6 alkylsulfanyl groups, C1-C6 alkylamino groups, diC1-C6 alkylamino groups, and C1-C7 alkanoyl groups; R 3 and R 4 The ring formed by, R 6 and R 7 C3-C7 non-aromatic carbocyclic group, R 3 and R 7 The ring formed by, R 3 and R 8 The ring formed by, R 5 and R 6 The ring formed by, R6 and R 7 The ring formed by, R 7 and R 8 The ring formed by and R 8 and R 9 Each substituent in the ring formed is independently selected from substituent group β2; The substituent group β2 consists of substituent group β1, C1-C6 alkyl groups, and halogenated C1-C6 alkyl groups. It is a compound represented by or a pharmaceutically acceptable salt thereof.

[0035] A characteristic feature of the cationic lipid of the present invention is that, in the chemical structural formula shown by formula (I) above, it has X (where X is O or S), R 1 Substitution or non-substitution formula: -(CH2) a -L1-(CH2) b Points having -CH3 (where the sum of a and b is an integer between 5 and 25, and L1 is -C(=O)O-, -OC(=O)-, or -OC(=O)O-) are examples.

[0036] The following describes preferred embodiments of the cationic lipid of the present invention. R 1 The expression is either a substitution or a non-substitution: -(CH2) a -L1-(CH2) b It is -CH3. One or more arbitrary hydrogen atoms may be substituted by substituents selected from substituent group α. 1 to 10 arbitrary hydrogen atoms may be substituted, or 1 to 4 arbitrary hydrogen atoms may be substituted. L1 is preferably -C(=O)O- or -OC(=O)-. More preferably -C(=O)O-. Preferably, a and b are independent integers between 3 and 15. More preferably, they are independent integers between 5 and 10. Particularly preferably, they are independent integers between 6 and 8. R 1 The formula is: -(CH2) a -L1-(CH2) bThe substituents selected from the substituent group α in -CH3 are preferably halogen atoms, oxo groups, cyano groups, and C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C1-C 11 Alkanoyl group or C1-C 11 It is an alkanoyloxy group. More preferably, a halogen atom, C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C1-C 11 Alkanoyl group or C1-C 11 It is an alkanoyloxy group, particularly preferably C1-C 10 Alkyl alkyl group or C1-C 11 It is an alkanoyloxy group. R 1 Preferably, the formula is a substitution or non-substitution formula:-(CH2) a -C(=O)O-(CH2) b -CH3 or substitution or non-substitution formula:-(CH2) a -OC(=O)-(CH2) b -CH3, where the sum of a and b is an integer between 5 and 25, and a and b are independently integers between 3 and 15. More preferably, a substitution or non-substitutional expression: -(CH2) a -C(=O)O-(CH2) b -CH3, where a and b are independent integers from 5 to 10. Particularly preferred is R 1 C1-C 10 Formula substituted with an alkyl group: -(CH2) a -C(=O)O-(CH2) b -CH3, where a and b are independent integers between 6 and 8.

[0037] R 2 Examples of substitution or non-substitutional expressions: -(CH2) c -L2-(CH2) d -CH3 is preferred. One or more arbitrary hydrogen atoms may be substituted with substituents selected from substituent group α. 1 to 10 arbitrary hydrogen atoms may be substituted, or 1 to 4 arbitrary hydrogen atoms may be substituted. L2 is preferably -C(=O)O- or -OC(=O)-, more preferably -C(=O)O-. c and d are preferably independent integers between 3 and 15. More preferably, they are each independent integers between 5 and 10. Particularly preferably, they are each independent integers between 6 and 8. Formula:-(CH2) c -L2-(CH2) d The substituents in -CH3 are selected from substituent group α, preferably a halogen atom, an oxo group, a cyano group, or a C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C1-C 11 Alkanoyl group or C1-C 11 It is an alkanoyloxy group. More preferably, a halogen atom, C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C1-C 11 Alkanoyl group or C1-C 11 It is an alkanoyloxy group, particularly preferably C1-C 10 Alkyl alkyl group or C1-C 11 It is an alkanoyloxy group. R 2 Preferably, the formula is a substitution or non-substitution formula:-(CH2) c -C(=O)O-(CH2) d -CH3 or substitution or non-substitution formula:-(CH2) c -OC(=O)-(CH2) d -CH3, where the sum of c and d is an integer between 5 and 25, and c and d are independently integers between 3 and 15. More preferably, a substitution or non-substitution formula: -(CH2) c -C(=O)O-(CH2) d -CH3, where c and d are independent integers from 5 to 10. Particularly preferred is C1-C 10 Formula substituted with an alkyl group: -(CH2) c -C(=O)O-(CH2) d -CH3, where c and d are independent integers between 6 and 8.

[0038] In another aspect, R 2 C5-C is either substituted or unsubstituted. 20 It is also preferable that it be an alkyl group. More preferably, a substituted or unsubstituted C5-C 10 It is an alkyl group, and is particularly preferably C5-C 10 It is an alkyl group. C5-C 20 The substituents selected from the group of substituents α in the alkyl group are preferably halogen atoms, oxo groups, cyano groups, and C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C1-C 11 Alkanoyl group or C1-C 11 It is an alkanoyloxy group. More preferably, a halogen atom, C1-C 10 Alkyl alkyl groups, C1-C halogenated groups 10 Alkyl alkyl group, C1-C 11 Alkanoyl group or C1-C 11 It is an alkanoyloxy group, particularly preferably C1-C 10 Alkyl alkyl group or C1-C 11 It is an alkanoyloxy group.

[0039] R 3 The substituent selected from substituent group β or substituent group β1 in the C1-C6 alkyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 3 Preferably, it is a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group. More preferably, it is a hydrogen atom or a C1-C6 alkyl group. Particularly preferably, it is a hydrogen atom or a C1-C3 alkyl group.

[0040] R 4The substituent selected from substituent group β or substituent group β1 in the C1-C6 alkyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 4 Preferably, it is a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group. More preferably, it is a hydrogen atom or a C1-C6 alkyl group. Particularly preferably, it is a hydrogen atom or a C1-C3 alkyl group.

[0041] R 3 and R 4 These may together form a substituted or unsubstituted C3-C5 non-aromatic carbon ring. R 3 and R 4 The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group. The C3-C5 non-aromatic carbon ring is preferably a C3-C5 monocyclic non-aromatic saturated hydrocarbon ring or a non-aromatic unsaturated hydrocarbon ring. More preferably, it is cyclopropane, cyclobutane, or cyclopentane. Specifically, [ka] It is particularly preferably cyclopropane or cyclopentane.

[0042] R 5The substituent selected from substituent group β or substituent group β1 in the C1-C6 alkyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 5 Preferably, it is a hydrogen atom or a substituted or unsubstituted C1-C3 alkyl group. More preferably, it is a hydrogen atom or a C1-C3 alkyl group substituted or unsubstituted with a halogen atom, an oxo group, or a hydroxyl group. Particularly preferred is a hydrogen atom.

[0043] R 6 The substituent selected from substituent group β or substituent group β1 in the C1-C6 alkyl group, C2-C6 alkenyl group, or C2-C6 alkynyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 6 The substituent selected from substituent group β or substituent group β2 in the C3-C7 non-aromatic carbocyclic group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 6 Preferably, this is a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C2-C6 alkenyl group. More preferably, it is a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group. Particularly preferred is a hydrogen atom or a C1-C6 alkyl group.

[0044] R 7The substituent selected from substituent group β or substituent group β1 in the C1-C6 alkyl group, C2-C6 alkenyl group, or C2-C6 alkynyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 7 The substituent selected from substituent group β or substituent group β2 in the C3-C7 non-aromatic carbocyclic group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred is a halogen atom, an oxo group, or a hydroxyl group. R 7 Preferably, this is a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C2-C6 alkenyl group. More preferably, it is a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group. Particularly preferred is a hydrogen atom or a C1-C6 alkyl group.

[0045] R 3 and R 7 The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group. R 3 and R 7 The ring formed is preferably a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 2 to 4 heteroatoms, and more preferably a substituted or unsubstituted 5- to 7-membered monocyclic non-aromatic heterocycle containing 2 heteroatoms. for example, [ka] These are some examples.

[0046] R 3 and R 8 The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group. R 3 and R 8 Preferably, the ring formed is a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms within the ring; more preferably, a substituted or unsubstituted 3- to 6-membered monocyclic non-aromatic heterocycle containing 1 to 3 heteroatoms within the ring; and particularly preferably, a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing 1 heteroatom within the ring. for example, [ka] These are some examples. In the above, it is preferable that q is 0 and X is 0.

[0047] R 5 and R 6 The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group. R 5 and R 6The ring formed is preferably a substituted or unsubstituted 3-8 member non-aromatic heterocycle containing 1-3 heteroatoms, more preferably a substituted or unsubstituted 4-7 member non-aromatic heterocycle containing 1-3 heteroatoms, and even more preferably a substituted or unsubstituted 6 member monocyclic non-aromatic heterocycle or a substituted or unsubstituted bicyclic non-aromatic heterocycle containing 1 or 2 heteroatoms. Examples include the following structures. [ka] Furthermore, in the above, R 5 and R 6 The ring-constituting atoms of the non-aromatic heterocycle formed by may be bonded to each other at any bondable position, or they may be bridged. Specific examples are shown below. [ka]

[0048] R 6 and R 7 The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group. R 6 and R 7 The ring formed is preferably a substituted or unsubstituted 4-7 member non-aromatic heterocycle containing 1-3 heteroatoms, and more preferably a substituted or unsubstituted 6 member monocyclic non-aromatic heterocycle containing 1 or 2 heteroatoms.

[0049] R 8 and R 9The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group. R 8 and R 9 The ring formed is preferably a substituted or unsubstituted 3- to 7-membered non-aromatic carbon ring, or a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, and more preferably a substituted or unsubstituted 6-membered non-aromatic carbon ring, or a substituted or unsubstituted mono-ring 6-membered non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring. 8 and R 9 If they form a ring, k is either 1 or 2. for example, [ka] These are some examples.

[0050] R 7 and R 8 R 5 and R 6 When R forms a ring, it may form a ring. 7 and R 8 The ring formed is preferably a substituted or unsubstituted 4-7 member non-aromatic heterocycle containing 1-3 heteroatoms, and more preferably a substituted or unsubstituted 6 member monocyclic non-aromatic heterocycle containing 1 or 2 heteroatoms. for example, [ka] These are some examples. in particular, [ka] That is the case. Note, R 5 and R 6 The non-aromatic heterocycle formed by is R 5 -C(R 8 )-(CH2) r -N(R 7 )-R 6 It is formed by R 7 and R 8 The non-aromatic heterocycle formed by is R 8 -C(R 5 )-(CH2) r -N(R 6 )-R 7 It is formed by R 5 and R 6 When R forms a ring and 7 and R 8 When a ring is formed, r is preferably 1 to 3, and particularly preferably 2. R 7 and R 8 The substituents selected from substituent group β or substituent group β2 in the ring formed are preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, a C1-C6 alkyl group, or a halogenated C1-C6 alkyl group. More preferably, they are a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferred are a halogen atom, an oxo group, or a hydroxyl group.

[0051] Furthermore, if a ring is formed in one of the combinations shown above, a ring may also be formed in other combinations. For example, R 3 and R 7 When R forms a ring, 5 and R 6 Ya R 8 and R 9 In this case, a ring may be formed. R 3 and R 8 When R forms a ring, 5 and R 6 , R 6 and R 7 In this case, a ring may be formed. R5 and R 6 When R forms a ring, 3 and R 7 , R 3 and R 8 , R 7 and R 8 , R 8 and R 9 In this case, a ring may be formed. R 6 and R 7 When R forms a ring, 3 and R 8 , R 8 and R 9 In this case, a ring may be formed. R 8 and R 9 When R forms a ring, 3 and R 7 , R 5 and R 6 , R 6 and R 7 In this case, a ring may be formed.

[0052] For example, R 5 and R 6 As R forms a ring 8 and R 9 They may form a ring. In this case, k is 1 or 2. for example, [ka] These are some examples. In this case, R 5 and R 6 The ring formed is preferably a 3-7 member non-aromatic heterocycle containing 1-3 heteroatoms, and more preferably a substituted or unsubstituted 4-member non-aromatic heterocycle containing 1 or 2 heteroatoms. In this case, R 8 and R 9Preferably, the ring formed is a substituted or unsubstituted 3- to 7-membered non-aromatic carbon ring, or a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring; more preferably, a substituted or unsubstituted 4- to 6-membered non-aromatic carbon ring, or a substituted or unsubstituted 4- to 6-membered non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring; and even more preferably, a substituted or unsubstituted 4-membered non-aromatic carbon ring.

[0053] Z is preferably -OC(=O)-, -C(=O)O-, or -OC(=O)O-. More preferably -OC(=O)- or -C(=O)O-. Particularly preferably -OC(=O)-.

[0054] p is preferably 0 or 1, and particularly preferably 0.

[0055] q is preferably 0 or 1, and particularly preferably 0.

[0056] r is preferably 1 or 2.

[0057] s is preferably 0 or 1.

[0058] k is preferably 0 or 1, and particularly preferably 0.

[0059] R is preferably a hydrogen atom.

[0060] In the compound represented by formula (I), R 1 , R 2 ,L1,L2,a,b,c,d,R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 ,Z,X,p,q,s,k,r,R,R 3 and R 4 The ring formed by, R 3 and R 7The ring formed by, R 3 and R 8 The ring formed by, R 5 and R 6 The ring formed by, R 6 and R 7 The ring formed by, R 7 and R 8 The ring and R that are formed 8 and R 9 Preferred forms of the ring formed are shown below. As for the compound represented by formula (I), all combinations of the specific examples shown below are exemplified. R 1 The expression is either a substitution or a non-substitution: -(CH2) a -L1-(CH2) b -CH3 is one example (hereinafter referred to as A-1). R 1 The substitution formula is: -(CH2) a -L1-(CH2) b -CH3 is one example (hereinafter referred to as A-2). R 1 C1-C 10 Alkyl alkyl group or C2-C 10 Formula substituted with an alkenyl group: -(CH2) a -L1-(CH2) b -CH3 is one example (hereinafter referred to as A-3). R 1 C1-C 10 Formula substituted with an alkyl group: -(CH2) a -L1-(CH2) b -CH3 is one example (hereinafter referred to as A-4). R 1 The non-substitutional expression is: -(CH2) a -L1-(CH2) b -CH3 is one example (hereinafter referred to as A-5). L1 can be -C(=O)O-, -OC(=O)-, or -OC(=O)O- (hereinafter referred to as B-1). L1 can be -C(=O)O- or -OC(=O)- (hereinafter referred to as B-2). L1 can be represented by -C(=O)O- (hereinafter referred to as B-3). L1 can be identified as -OC (=O)- (hereinafter referred to as B-4). a and b are independent integers greater than or equal to 1, and the sum of a and b is an integer between 5 and 25 (hereinafter referred to as C-1). a and b are each independent integers between 3 and 15 (hereinafter referred to as C-2). a and b are each independent integers between 5 and 10 (hereinafter referred to as C-3). a and b are each independent integers between 6 and 9 (hereinafter referred to as C-4). a can be an integer between 6 and 8 (hereinafter referred to as D-1). b can be an integer between 6 and 8 (hereinafter referred to as E-1). 'a' is 6 (hereinafter referred to as D-2). a is 7 (hereinafter referred to as D-3). 'a' is 8 (hereinafter referred to as D-4). For b, 6 is the answer (hereinafter referred to as E-2). b is 7 (hereinafter referred to as E-3). b is 8 (hereinafter referred to as E-4). R 1 The formula is: [ka] (In the formula, a and L1 are equivalent to item (1) above; b1 is an integer greater than or equal to 1, and the sum of a and b1 is an integer between 5 and 25; b2 and b3 are independently non-negative integers, and the sum of a, b2, and b3 is an integer between 4 and 24; b4 is an integer from 0 to 9) and the base can be given by (hereinafter referred to as F-1). R 1 The formula is: [ka] (In the formula, a is an integer between 6 and 8; L1 is -C(=O)O-; b1 is an integer between 5 and 12; b2 is an integer between 0 and 2; b3 is an integer between 3 and 6; The base can be represented by (where b4 is an integer from 1 to 6) (hereinafter referred to as F-2). R 1 The formula is: [ka] (In the formula, a is an integer between 6 and 8; L1 is -C(=O)O-; b1 is 7; b2 is an integer between 0 and 2; b3 is an integer between 3 and 6; b4 is an integer between 3 and 6.) The base can be given by (hereinafter referred to as F-3). R 1 The formula is: [ka] (In the formula, a, L1 and b1 are the same as in item (F-3) above) The group shown is (hereinafter referred to as F-4). R 1 The formula is: [ka] (In the formula, a, L1, b2, b3 and b4 are equivalent to the above item (F-3); The group shown is (hereinafter referred to as F-5) (the sum of b2, b3 and b4 is 8, 9, 10 or 12). R 2 C5-C is either substituted or unsubstituted. 20 Alkyl group or substituted or unsubstituted formula: -(CH2) c -L2-(CH2) d -CH3 is one example (hereinafter referred to as G-1). R 2 C5-C is either substituted or unsubstituted. 20An example is an alkyl group (hereinafter referred to as G-2). R 2 This is the substitution C5-C 20 Alkyl groups are an example (hereinafter referred to as G-3). R 2 C1-C 10 Alkyl alkyl group or C2-C 10 C5-C substituted with an alkenyl group 20 Alkyl groups are examples (hereinafter referred to as G-4). R 2 This is an unsubstituted C5-C 20 Examples include alkyl groups (hereinafter referred to as G-5). R 2 This is an unsubstituted C5-C 10 Alkyl groups are examples (hereinafter referred to as G-6). R 2 This is an unsubstituted C9-C 10 Alkyl alkyl groups are examples (hereinafter referred to as G-7). R 2 Examples include unsubstituted C9 alkyl groups (hereinafter referred to as G-8). R 2 The expression is either a substitution or a non-substitution: -(CH2) c -L2-(CH2) d -CH3 is one example (hereinafter referred to as G-9). R 2 The substitution formula is: -(CH2) c -L2-(CH2) d -CH3 is one example (hereinafter referred to as G-10). R 2 C1-C 10 Alkyl alkyl group or C2-C 10 Formula substituted with an alkenyl group: -(CH2) c -L2-(CH2) d -CH3 is one example (hereinafter referred to as G-11). R 2 C1-C 10 Formula substituted with an alkyl group: -(CH2) c -L2-(CH2) d -CH3 is one example (hereinafter referred to as G-12). R 2The non-substitutional expression is: -(CH2) c -L2-(CH2) d -CH3 is one example (hereinafter referred to as G-13). L2 can be -C(=O)O-, -OC(=O)-, or -OC(=O)O- (hereinafter referred to as H-1). L2 can be -C(=O)O- or -OC(=O)- (hereinafter referred to as H-2). L2 can be represented by -C(=O)O- (hereinafter referred to as H-3). L2 can be represented by -OC(=O)- (hereinafter referred to as H-4). c and d are each independent integers greater than or equal to 1. c and d The sum can be an integer between 5 and 25 (hereinafter referred to as J-1). c and d are each independent integers between 3 and 15 (hereinafter referred to as J-2). c and d are each independent integers between 5 and 10 (hereinafter referred to as J-3). c and d are each independent integers between 6 and 9 (hereinafter referred to as J-4). c can be an integer between 6 and 8 (hereinafter referred to as K-1). d can be an integer between 6 and 8 (hereinafter referred to as L-1). c is 6 (hereinafter referred to as K-2). c is 7 (hereinafter referred to as K-3). c is 8 (hereinafter referred to as K-4). d is 6 (hereinafter referred to as L-2). d is 7 (hereinafter referred to as L-3). d is 8 (hereinafter referred to as L-4). R 2 The formula is: [ka] (In the formula, c and L2 are equivalent to item (1) above; d1 is an integer greater than or equal to 1, and the sum of c and d1 is an integer between 5 and 25; d2 and d3 are independent integers of 0 or greater, and the sum of c, d2, and d3 is an integer between 4 and 24; The base represented by d4 (where d4 is an integer from 0 to 9) is given by (hereinafter referred to as M-1). R 2 The formula is: [ka] (In the formula, c is an integer between 6 and 8; L2 is -C(=O)O-; d1 is an integer between 5 and 12; d2 is an integer between 0 and 2; d3 is an integer between 3 and 6; The base represented by (d4 is an integer from 1 to 6) is M-2 (hereinafter referred to as M-2). R 2 The formula is: [ka] (In the formula, c is an integer between 6 and 8; L2 is -C(=O)O-; d1 is 7; d2 is an integer between 0 and 2; d3 is an integer between 3 and 6; The base represented by (d4 is an integer between 3 and 6) is M-3 (hereinafter referred to as M-3). R 2 The formula is: [ka] (In the formula, c, L2, and d1 are equivalent to the above item (M-3)) The group shown is (hereinafter referred to as M-4). R 2 The formula is: [ka] (In the formula, c, L2, d2, d3 and d4 are equivalent to the above item (M-3); The group shown is (hereinafter referred to as M-5) (where the sum of d2, d3, and d4 is 8, 9, 10, or 12). R 1 and R 2 Each is independent of the formula: [ka] A group selected from these is (hereinafter referred to as N-1). [ka] The formula is: [ka] A group selected from the above is (hereinafter referred to as N-2). [ka] The formula is: [ka] A group can be selected from the following (hereinafter referred to as N-3). [ka] The formula is: [ka] The group selected from these is (hereinafter referred to as N-4). [ka] The formula is: [ka] The following are examples of groups selected from the above (hereinafter referred to as N-5). [ka] The formula is: [ka] The following are examples of groups selected from the above (hereinafter referred to as N-6). R 3 This includes hydrogen atoms or substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as O-1). R 3 This includes hydrogen atoms or unsubstituted C1-C6 alkyl groups (hereinafter referred to as O-2). R 3 This includes hydrogen atoms or unsubstituted C1-C3 alkyl groups (hereinafter referred to as O-3). R 3 A hydrogen atom is an example of this (hereinafter referred to as O-4). R 3 Examples include unsubstituted C1-C3 alkyl groups (hereinafter referred to as O-5). R 4 This includes hydrogen atoms or substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as P-1). R 4 This includes a hydrogen atom or an unsubstituted C1-C6 alkyl group (hereinafter referred to as P-2). R 4 This includes a hydrogen atom or an unsubstituted C1-C3 alkyl group (hereinafter referred to as P-3). R 4 A hydrogen atom is an example of this (hereinafter referred to as P-4). R 4 Examples include unsubstituted C1-C3 alkyl groups (hereinafter referred to as P-5). R 3 and R 4 These elements combine to form a substituted or unsubstituted C3-C5 non-aromatic carbon ring (hereinafter referred to as Q-1). R 3 and R 4 These two groups combine to form an unsubstituted C3-C5 non-aromatic carbon ring (hereinafter referred to as Q-2). R 3 and R 4 These combine to form unsubstituted cyclopropane or cyclopentane (hereinafter referred to as Q-3). R 5 This includes hydrogen atoms or substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as S-1). R 5 This includes hydrogen atoms or unsubstituted C1-C6 alkyl groups (hereinafter referred to as S-2). R 5 A hydrogen atom is an example of this (hereinafter referred to as S-3). R 6 This includes hydrogen atoms, substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted C2-C6 alkenyl groups, substituted or unsubstituted C2-C6 alkynyl groups, or substituted or unsubstituted C3-C7 non-aromatic carbocyclic groups (hereinafter referred to as T-1). R 6 This includes a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C2-C6 alkenyl group (hereinafter referred to as T-2). R 6 This includes hydrogen atoms or substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as T-3). R 6 Examples include substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as T-4). R 6 Examples include unsubstituted C1-C6 alkyl groups (hereinafter referred to as T-5). R 7 This includes hydrogen atoms, substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted C2-C6 alkenyl groups, substituted or unsubstituted C2-C6 alkynyl groups, or substituted or unsubstituted C3-C7 non-aromatic carbocyclic groups (hereinafter referred to as U-1). R 7 This includes hydrogen atoms, substituted or unsubstituted C1-C6 alkyl groups, or substituted or unsubstituted C2-C6 alkenyl groups (hereinafter referred to as U-2). R 7This includes hydrogen atoms or substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as U-3). R 7 Examples include substituted or unsubstituted C1-C6 alkyl groups (hereinafter referred to as U-4). R 7 Examples include C1-C6 alkyl groups substituted with or unsubstituted with hydroxyl groups (hereinafter referred to as U-5). R 7 Examples include unsubstituted C1-C6 alkyl groups (hereinafter referred to as U-6). R 7 An example of this is an unsubstituted methyl group (hereinafter referred to as U-7). R 8 A hydrogen atom is an example of this (hereinafter referred to as V-1). R 9 A hydrogen atom is an example of this (hereinafter referred to as W-1). R 10 A hydrogen atom is an example of this (hereinafter referred to as Y-1). R 3 and R 7 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as Z-1). R 3 and R 7 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 2 to 4 heteroatoms within the ring (hereinafter referred to as Z-2). R 3 and R 7 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 5- to 7-membered monocyclic non-aromatic heterocycle containing two heteroatoms within the ring (hereinafter referred to as Z-3). R 3 and R 7 These atoms, together with the atoms to which they are bonded, form a six-membered monocyclic non-aromatic heterocycle containing two heteroatoms, either alkyl-substituted or unsubstituted (hereinafter referred to as Z-4). R 3 and R 8These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AA-1). R 3 and R 8 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 3- to 6-membered monocyclic non-aromatic heterocycle containing 1 to 3 heteroatoms within the ring (hereinafter referred to as AA-2). R 3 and R 8 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 5- to 6-membered monocyclic non-aromatic heterocycle containing one heteroatom within the ring (hereinafter referred to as AA-3). R 3 and R 8 These atoms, together with the atoms they bond to, form an unsubstituted 5- to 6-membered monocyclic non-aromatic heterocycle containing one heteroatom within the ring (hereinafter referred to as AA-4). R 5 and R 6 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AB-1). R 5 and R 6 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 3-8 member non-aromatic heterocycle containing 1-3 heteroatoms within the ring (hereinafter referred to as AB-2). R 5 and R 6 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 4-7 member non-aromatic heterocycle containing 1-3 heteroatoms within the ring (hereinafter referred to as AB-3). R 5 and R 6 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted six-membered monocyclic non-aromatic heterocycle or a substituted or unsubstituted two-ring non-aromatic heterocycle containing one or two heteroatoms in the ring (hereinafter referred to as AB-4). R 5 and R 6These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 5- or 6-membered monocyclic non-aromatic heterocycle containing one heteroatom within the ring (hereinafter referred to as AB-5). R 5 and R 6 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted six-membered monocyclic non-aromatic heterocycle containing one heteroatom within the ring (hereinafter referred to as AB-6). R 5 and R 6 These atoms, together with the atoms to which they bond, form substituted or unsubstituted piperidine (hereinafter referred to as AB-7). R 5 and R 6 These, together with the atoms to which they are bonded, form C1-C3 alkyl and / or halogen-substituted or unsubstituted piperidines (hereinafter referred to as AB-8). (Assume). R 5 and R 6 These atoms, together with the atoms to which they bond, form a substituted piperidine (hereinafter referred to as AB-9). R 5 and R 6 These atoms, together with the atoms to which they are bonded, form piperidines substituted with C1-C3 alkyl and / or halogen atoms (hereinafter referred to as AB-10). R 5 and R 6 These, together with the atoms to which they bond, form unsubstituted piperidine or unsubstituted pyrrolidine (hereinafter referred to as AB-12). R 5 and R 6 These atoms, together with the atoms to which they bond, form an unsubstituted piperidine (hereinafter referred to as AB-11). R 6 and R 7 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AC-1). R 6 and R 7These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 4-7 member non-aromatic heterocycle containing 1-3 heteroatoms within the ring (hereinafter referred to as AC-2). R 6 and R 7 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted six-membered monocyclic non-aromatic heterocycle containing one or two heteroatoms within the ring (hereinafter referred to as AC-3). R 8 and R 9 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted non-aromatic carbocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring (hereinafter referred to as AD-1). R 8 and R 9 These atoms, together with the atoms to which they bond, form a substituted or unsubstituted 3- to 7-membered non-aromatic carbon ring, or a substituted or unsubstituted 5- to 7-membered non-aromatic heteroring containing 1 to 3 heteroatoms within the ring (hereinafter referred to as AD-2). R 8 and R 9 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted monocyclic 4-6 member non-aromatic carbon ring, or a substituted or unsubstituted monocyclic 4-6 member non-aromatic heterocyclic ring containing one or two heteroatoms (hereinafter referred to as AD-3). R 8 and R 9 These atoms, together with the atoms to which they are bonded, form a substituted or unsubstituted monocyclic 4- to 6-membered non-aromatic carbocyclic ring (hereinafter referred to as AD-4). R 8 and R 9 These atoms, together with the atoms to which they bond, form an unsubstituted monocyclic 4-6 member non-aromatic carbocyclic ring (hereinafter referred to as AD-5). R 7 and R 8 R 5 and R 6 When these atoms form a ring, they combine with the atoms to which they bond to form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AE-1). R 7 and R 8 R5 and R 6 When these atoms form a ring, they combine with the atoms they bond to to form a substituted or unsubstituted 4-7 member non-aromatic heterocycle containing 1-3 heteroatoms within the ring (hereinafter referred to as AE-2). R 7 and R 8 R 5 and R 6 When these atoms form a ring, they combine with the atoms they bond to to form a substituted or unsubstituted six-membered monocyclic non-aromatic heterocycle containing one or two heteroatoms within the ring (hereinafter referred to as AE-3). R 5 and R 6 It forms a 3-7 member non-aromatic heterocycle containing 1-3 heteroatoms within the ring, and simultaneously, R 8 and R 9 This forms a substituted or unsubstituted 3- to 7-membered non-aromatic carbon ring, or a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms within the ring (hereinafter referred to as AF-1). R 5 and R 6 It forms an unsubstituted, four-membered, non-aromatic heterocycle containing one or two heteroatoms within the ring, and simultaneously, R 8 and R 9 This forms an unsubstituted four-membered non-aromatic carbon ring (hereinafter referred to as AF-2). Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)- , -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(= Examples include O)-, -N(R)S(=O)2-, -OS(=O)2-, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O)2-O-, -S(=O)2-N(R)-, -OP(=O)(-NR)O-, -C(=S)O-, or -OC(=S)- (hereinafter referred to as AG-1). Z can be -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)O-, or -N(R)C(=O)- (hereinafter referred to as AG-2). Z can be -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(H)-, -C(=O)N(Me)-, -N(H)C(=O)O-, or -N(H)C(=O)- (hereinafter referred to as AG-3). Z can be -OC(=O)-, -C(=O)O-, or -OC(=O)O- (hereinafter referred to as AG-4). Z can be -OC(=O)- or -C(=O)O- (hereinafter referred to as AG-5). Z can be represented by -OC(=O)- (hereinafter referred to as AG-6). X can be either O or S (hereinafter referred to as AH-1). X is O (hereinafter referred to as AH-2). X is S (hereinafter referred to as AH-3). p can be an integer between 0 and 2 (hereinafter referred to as AI-1). p can be 0 or 1 (hereinafter referred to as AI-2). One possible value for p is 0 (hereinafter referred to as AI-3). p is 1 (hereinafter referred to as AI-4). q can be an integer between 0 and 2 (hereinafter referred to as AJ-1). q can be 0 or 1 (hereinafter referred to as AJ-2). One possible value for q is 0 (hereinafter referred to as AJ-3). q can be 1 (hereinafter referred to as AJ-4). s can be an integer between 0 and 2 (hereinafter referred to as AK-1). s can be 0 or 1 (hereinafter referred to as AK-2). s can be 0 (hereinafter referred to as AK-3). s can be 1 (hereinafter referred to as AK-4). k can be an integer between 0 and 2 (hereinafter referred to as AL-1). k can be 0 or 1 (hereinafter referred to as AL-2). k can be 0 (hereinafter referred to as AL-3). k can be 1 (hereinafter referred to as AL-4). r can be an integer between 0 and 5 (hereinafter referred to as AM-1). r can be an integer between 0 and 3 (hereinafter referred to as AM-2). r can be 1 or 2 (hereinafter referred to as AM-3). r can be 1 (hereinafter referred to as AM-4). r can be 2 (hereinafter referred to as AM-5). Each of the following R components can be independently a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group (hereinafter referred to as AN-1). R can be any hydrogen atom, independently of each other (hereinafter referred to as AN- 2 (Assume).

[0061] In the compound represented by formula (I), the following embodiments are more preferred. All combinations of embodiments of the specific examples below are illustrated. (i) Equation (Ia): [ka] The compound indicated by or a pharmaceutically acceptable salt thereof. In the formula, R 1 These include (F-2), (F-3), (F-4), or (F-5) above. R 2 These include (M-2), (M-3), (M-4), or (M-5) above. Alternatively, R 1 and R 2 These include (N-1), (N-2), (N-3), (N-4), or (N-5) above. p is one of the above (AI-2), (AI-3), or (AI-4). Z is one of the above (AG-2), (AG-3), (AG-4), (AG-5), or (AG-6). R 3 These include (O-3), (O-4), or (O-5) above. R 4 These include (P-3), (P-4), or (P-5) above. Alternatively, R 3and R 4 The above examples include (Q-2) or (Q-3). q is one of the above (AJ-2), (AJ-3), or (AJ-4). X is one of the above (AH-1), (AH-2), or (AH-3). r can be any of the above (AM-2), (AM-3), (AM-4), or (AM-5). R 5 The above-mentioned (S-2) or (S-3) are examples. R 6 Examples include (T-4) or (T-5) above. Alternatively, R 5 and R 6 Examples include (AB-3), (AB-5), (AB-6), (AB-7), (AB-8), (AB-9), (AB-10), or (AB-11) above. R 7 These include (U-3), (U-4), (U-5), (U-6), or (U-7) as described above. (ii) Equation (Ib): [ka] The compound indicated by or a pharmaceutically acceptable salt thereof. In the formula, R 1 and R 2 These include (N-1), (N-2), (N-3), (N-4), or (N-5) above. p is one of the above (AI-2), (AI-3), or (AI-4). R 3 The above (O-3) is an example. R 4 The above (P-4) is an example. q is exemplified by (AJ-3) above. R 5 The above-mentioned (S-2) or (S-3) are examples. R 6 The above (T-5) is an example. R 7 The above (U-6) is an example. (iii) Formula (Ic): [ka] The compound indicated by or a pharmaceutically acceptable salt thereof. In the formula, R 1 and R 2 These include (N-2), (N-3), (N-4), or (N-5) above. p is one of the above (AI-3) or (AI-4). X is the one mentioned above (AH-3). r can be exemplified by (AM-5) above. R 5 and R 6 Examples include (AB-11) or (AB-12) above. R 7 These include the above (U-5) or (U-7). (iv) Formula (Ic): [ka] The compound indicated by or a pharmaceutically acceptable salt thereof. In the formula, R 1 and R 2 These include (N-2), (N-3), (N-4), or (N-5) above. p is one of the above (AI-3) or (AI-4). X is the one mentioned above (AH-2). r can be exemplified by (AM-5) above. R 5 and R 6 Examples include (AB-11) or (AB-12) above. R 7 These include the above (U-5) or (U-7).

[0062] One or more hydrogen, carbon, and / or other atoms in the compound represented by formula (I) may be substituted with isotopes of hydrogen, carbon, and / or other atoms, respectively. Examples of such isotopes are, 2 H, 3 H,11 C, 13 C, 14 C, 15 N, 18 O, 17 O, 31 P, 32 P, 35 S, 18 F, 123 I and 36 Like Cl, it includes hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine. The compounds represented by formula (I) also include compounds substituted with such isotopes. These isotope-substituted compounds are also useful as pharmaceuticals and include all radiolabeled forms of the compounds represented by formula (I). The present invention also includes a "radiolabeling method" for producing these "radiolabeled forms," ​​which are useful as tools for metabolic pharmacokinetic studies, binding assays, and / or diagnostics.

[0063] Radiolabeled compounds of the compound represented by formula (I) can be prepared by methods well known in the art. For example, tritium-labeled compounds represented by formula (I) can be prepared by introducing tritium into a specific compound represented by formula (I) through a catalytic dehalogenation reaction using tritium. This method involves reacting a appropriately halogenated precursor of the compound represented by formula (I) with tritium gas in the presence or absence of a suitable catalyst, such as Pd / C, or a base. For other suitable methods for preparing tritium-labeled compounds, see "Isotopes in the Physical and Biomedical Sciences, Vol. 1, Labeled Compounds (Part A), Chapter 6 (1987)". 14 C-labeled compounds are 14 It can be prepared by using a raw material containing carbon.

[0064] "Pharmacologically acceptable salts" refer to compounds represented by formula (I) and alkali metals (e.g., lithium, sodium, potassium, etc.) and alkaline earth metals (e.g., calcium, magnesium, barium, etc.). 、Transition metals (e.g., zinc, iron, copper, nickel, cobalt, etc.), aluminum, ammonia, organic bases (e.g., trimethylamine, triethylamine, trioctylamine, diethylamine, dibenzylamine, dicyclohexylamine, N,N'-dibenzylethylenediamine) 、 Ethanolamine, diethanolamine, triethanolamine, meglumine, ethylenediamine, N-benzylphenethylamine, pyridine, picoline, quinoline, morpholine, phenylglycine alkyl ester, N-methylglucamine, guanidine, chloroprocaine salt, procaine, piperazine, tetramethylammonium, hydroxymethylaminomethane, etc.) or salts with amino acids (e.g., glycine, arginine, ornithine, methionine, tyrosine, glutamine, aspartic acid, etc.) or without This refers to a salt with an inorganic acid (e.g., hydrochloric acid, perchloric acid, sulfuric acid, nitric acid, carbonic acid, hydrobromic acid, phosphoric acid, hydrofluoric acid, hydroiodic acid, phosphoric acid, etc.) or an organic acid (e.g., formic acid, acetic acid, propionic acid, trifluoroacetic acid, citric acid, lactic acid, tartaric acid, oxalic acid, maleic acid, fumaric acid, succinic acid, mandelic acid, glutaric acid, malic acid, benzoic acid, phthalic acid, ascorbic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoroacetic acid, trifluoromethanesulfonic acid, etc.). Preferably, it is a salt with an inorganic acid or an organic acid.

[0065] The compound represented by formula (I) according to the present invention can be produced, for example, by the general synthesis method shown below. Extraction, purification, etc., can be carried out using the same procedures as those performed in ordinary organic chemistry experiments. The compounds of the present invention can be synthesized with reference to methods known in the art.

[0066] Compounds represented by formula (I) where Z is -OC(=O)- can be produced, for example, as follows.

[0067] [ka] In the above formula, A is a leaving group (e.g., halogen atom, tosyloxy group, mesyloxy group, etc.); Pro is a protecting group (e.g., tert-butoxycarbonyl group, benzyloxycarbonyl group, etc.); and all other symbols have the same meaning as described above.

[0068] The compound represented by formula (X-2) can be produced by reacting the compound represented by formula (X-1) with a hydrohalic acid or sulfonyl halide. Examples of hydrohalogenated acids include hydrofluoric acid, hydrochloric acid, hydrobromic acid, and hydroiodic acid. Examples of sulfonyl halides include mesyl chloride and tosyl chloride. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 60°C. The reaction time is 1 to 48 hours, preferably 1 to 6 hours. Examples of reaction solvents include tetrahydrofuran, dimethylformamide, dichloromethane, chloroform, toluene, xylene, and neat, which can be used individually or in combination.

[0069] The compound represented by formula (X-3) can be produced by reacting the compound represented by formula (X-2) with the compound represented by formula (X-3-0), either in the presence or absence of a base. Examples of bases include sodium hydride, DIEA, potassium tert-butoxide, lithium hydroxide, potassium hydroxide, sodium hydroxide, and potassium carbonate, and can be used in amounts of 2 to 10 molar equivalents for the compound represented by formula (X-2). The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 80°C. The reaction time is 1 to 24 hours, preferably 1 to 6 hours. Examples of reaction solvents include tetrahydrofuran, dimethylformamide, tert-butanol, and water, which can be used individually or in combination.

[0070] The compound represented by formula (X-5) can be obtained by reacting the compound represented by formula (X-3) with the compound represented by formula (X-4) in the presence or absence of a base, and in the presence or absence of a coupling agent. Examples of bases include triethylamine, DIEA, DMAP, and pyridine, and can be used in amounts of 2 to 20 molar equivalents for the compound indicated by (X-4). Examples of condensing agents include DCC, DIC, EDC, 2-methyl-6-nitrobenzoic anhydride, and thionyl chloride. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 60°C. The reaction time is 1 to 72 hours, preferably 1 to 20 hours. Examples of reaction solvents include dichloromethane, tetrahydrofuran, dioxane, dimethylformamide, N-methylpyrrolidone, and benzene, which can be used individually or in combination.

[0071] The amino protecting group of the compound represented by formula (X-5) is deprotected, and R 6 By introducing this compound, we can obtain the compound shown in formula (I). Deprotection conditions include reacting with an acid such as hydrochloric acid or trifluoroacetic acid, or reacting with hydrogen gas in the presence of a metal catalyst. The reaction temperature is 0°C to 60°C, preferably 10°C to 40°C. The reaction time is 1 to 6 hours, preferably 1 to 2 hours. Examples of reaction solvents include ethyl acetate, dioxane, tetrahydrofuran, dichloromethane, methanol, etc., which can be used individually or in combination. R 6 This can be introduced by forming an iminium cation intermediate in a deprotected compound, for example, using an aldehyde or formaldehyde, and then reducing it. As a reducing agent, sodium borohydride triacetate, sodium borohydride cyanohydride, etc., can be used. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 40°C. The reaction time is 1 to 6 hours, preferably 1 to 2 hours. Examples of reaction solvents include dichloromethane, acetonitrile, and tetrahydrofuran, which can be used individually or in combination.

[0072] [ka] In the above formula, each symbol has the same meaning as described above. The compound represented by formula (I) can be obtained by reacting the compound represented by formula (X-6) with the compound represented by formula (X-4) in the presence or absence of a base, and in the presence or absence of a coupling agent. This process can be carried out in the same manner as the process for obtaining the compound represented by formula (X-5) from the compound represented by formula (X-3) described above.

[0073] [ka] In the above formula, each symbol has the same meaning as described above.

[0074] By reacting the compound represented by formula (X-7) with the compound represented by formula (X-4), in the presence or absence of a base, the compound represented by formula (X-8) can be obtained. This process can be carried out in the same manner as the process described above for obtaining the compound represented by formula (I) from the compound represented by formula (X-6).

[0075] The compound represented by formula (X-8) is reacted with hydrogen gas in the presence of a metal catalyst, followed by R 6 and R 7 By introducing this compound, the compound represented by formula (I) can be obtained. Examples of metal catalysts include palladium-carbon (Pd-C), platinum oxide, rhodium-aluminum oxide, and chlorotris(triphenylphosphine)rhodium(I), which can be used in amounts of 0.01 to 100% by weight relative to the compound represented by formula (X-8). Hydrogen pressure can range from 1 to 50 atmospheres. Cyclohexene, 1,4-cyclohexadiene, formic acid, ammonium formate, etc., can be used as hydrogen sources. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 40°C. The reaction time is 1 to 72 hours, preferably 1 to 8 hours. Examples of reaction solvents include methanol, ethyl acetate, tetrahydrofuran, and dioxane, which can be used individually or in combination. To stabilize the resulting amino compounds, it is desirable to carry out the process under an acidic solution. For example, this can be done by adding a hydrochloric acid-1,4-dioxane solution. The R of the generated amino compound 6 and R 7 The step of introducing to obtain the compound shown in formula (I) involves adding R to the amino deprotected form of the compound shown in formula (X-5) mentioned above. 6 This can be carried out in the same manner as the process of introducing to obtain the compound shown in formula (I).

[0076] [ka] In the above formula, Pro 1 is a benzyl group, etc.; other symbols have the same meaning as above.

[0077] By introducing a protecting group to the compound represented by formula (X-9), either in the presence or absence of a base, the compound represented by formula (X-10) can be obtained. Examples of bases include sodium bicarbonate, cesium carbonate, potassium carbonate, and sodium carbonate, and can be used in amounts of 1 to 10 molar equivalents for the compound represented by formula (X-9). The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 50°C. The reaction time is 1 to 72 hours, preferably 2 to 18 hours. Examples of reaction solvents include DMF, tetrahydrofuran, dioxane, and acetonitrile, which can be used individually or in combination.

[0078] By reacting the compound represented by formula (X-10) with an allyl halide, either in the presence or absence of a base, the compound represented by formula (X-11) can be obtained. The reaction temperature is -78°C to 30°C, preferably -78°C to 0°C. The reaction time is 1 to 8 hours, preferably 1 to 2 hours. Examples of bases include lithium hexamethyldisilazide (LHMDS), LDA, and NaH. Examples of reaction solvents include n-hexane, tetrahydrofuran, and dimethylformamide, which can be used individually or in combination.

[0079] By reacting the compound represented by formula (X-11) with a metal catalyst, the compound represented by formula (X-12) can be obtained. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 30°C and the reflux temperature of the solvent. The reaction time is 1 to 18 hours, preferably 1 to 2 hours. Examples of reaction solvents include benzene, dichloromethane, and toluene, which can be used individually or in combination. Examples of metal catalysts include first-generation Grubbs catalysts, second-generation Grubbs catalysts, and Schrock catalysts.

[0080] By reacting the compound represented by formula (X-12) with hydrogen gas in the presence of a metal catalyst, the compound represented by formula (X-13) can be obtained. Examples of metal catalysts include palladium-carbon (Pd-C), platinum oxide, rhodium-aluminum oxide, and chlorotris(triphenylphosphine)rhodium(I), which can be used in amounts of 0.01 to 100 weight percent relative to the compound represented by formula (X-12). Hydrogen pressure can range from 1 to 50 atmospheres. Cyclohexene, 1,4-cyclohexadiene, formic acid, ammonium formate, etc., can be used as hydrogen sources. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 40°C. The reaction time is 1 to 72 hours, preferably 1 to 8 hours. Examples of reaction solvents include methanol, ethyl acetate, tetrahydrofuran, and dioxane, which can be used individually or in combination.

[0081] The compound represented by formula (I) can be obtained from the compound represented by formula (X-13) using a process similar to the process described above for obtaining the compound represented by formula (I) from the compound represented by formula (X-3).

[0082] [ka] In the above formula, each symbol has the same meaning as described above. By reacting the compound represented by formula (X-11) with hydrogen gas in the presence of a metal catalyst, the compound represented by formula (X-14) can be obtained. This process can be obtained in the same manner as the process for obtaining the compound represented by formula (X-13) from the compound represented by formula (X-12).

[0083] The compound represented by formula (I) can be obtained from the compound represented by formula (X-14) using a process similar to the process described above for obtaining the compound represented by formula (I) from the compound represented by formula (X-3).

[0084] Compounds represented by formula (I), where Z is -C(=O)O-, can be produced, for example, as follows.

[0085] [ka] In the above formula, each symbol has the same meaning as described above. The compound represented by formula (I) can be obtained by reacting the compound represented by formula (X-15) with the compound represented by formula (X-16) in the presence or absence of a base, and in the presence or absence of a coupling agent. This process can be carried out in the same manner as the process for obtaining the compound represented by formula (X-5) from the compound represented by formula (X-3) described above.

[0086] Compounds represented by formula (I), where Z is -N(R)-C(=O)-, can be prepared, for example, as follows.

[0087] [ka] In the above formula, each symbol has the same meaning as described above. By protecting the hydroxyl group of the compound represented by formula (X-4) with a mesyl group, tosyl group, etc., and then reacting it with sodium azide or the like, the compound represented by formula (X-21) can be obtained. By reacting the compound represented by formula (X-21) with hydrogen gas in the presence of a metal catalyst, and subsequently introducing R as needed, the compound represented by formula (X-19) can be obtained. This process can be carried out in the same manner as the process described above for obtaining the compound represented by formula (I) from the compound represented by formula (X-8).

[0088] By reacting the compound represented by formula (X-19) with the compound represented by formula (X-6) in the presence or absence of a base, and in the presence or absence of a coupling agent, the compound represented by formula (I) can be obtained. Examples of bases include triethylamine and DIEA. Examples of condensing agents include HATU, HBTU, COMU® (Sigma-Aldrich Brand Chemicals, etc.), and PyBOP® (EMD Biosciences, Inc., Merck, etc.). The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and 50°C. The reaction time is 1 to 48 hours, preferably 1 to 12 hours. Examples of reaction solvents include dichloromethane, tetrahydrofuran, dioxane, dimethylformamide, and N-methylpyrrolidone, which can be used individually or in combination.

[0089] Compounds represented by formula (I), where Z is -OC(=O)O- or -N(R)-C(=O)O-, can be prepared, for example, as follows.

[0090] [ka] In the above formula, each symbol has the same meaning as described above. By reacting the compound represented by formula (X-17) with 4-nitrophenyl chloroformate or bis(4-nitrophenyl) carbonate in the presence of a base, the compound represented by formula (X-18) can be obtained. Examples of bases include triethylamine, DIEA, and pyridine. The reaction temperature is 0°C to 50°C, preferably 0°C to 30°C. The reaction time is 1 to 24 hours, preferably 1 to 4 hours. Examples of reaction solvents include dichloromethane and dichloroethane, which can be used individually or in combination.

[0091] The compound represented by formula (X-20) can be obtained by reacting the compound represented by formula (X-17) or (X-18) with the compound represented by formula (X-4) or (X-19) in the presence or absence of a base, and in the presence or absence of a coupling agent. Examples of bases include triethylamine, DIEA, DMAP, and pyridine. Examples of condensing agents include triphosgene. The reaction temperature is between 0°C and the reflux temperature of the solvent, preferably between 20°C and the reflux temperature of the solvent. The reaction time is 1 to 48 hours, preferably 1 to 12 hours. Examples of reaction solvents include dichloromethane and dichloroethane, which can be used individually or in combination.

[0092] The amino protecting group of the compound represented by formula (X-20) is deprotected, and R 7 By introducing this compound, we can obtain the compound shown in formula (I). This process can be carried out in the same manner as the process described above for obtaining the compound represented by formula (I) from the compound represented by formula (X-5).

[0093] The present invention contains a pharmaceutical composition comprising the cationic lipid (a compound represented by formula (I) or a pharmaceutically acceptable salt thereof) and nucleic acid (a nucleic acid drug). For example, the pharmaceutical composition of the present invention can be produced using the method shown below.

[0094] The cationic lipid, neutral lipid, sterol, and polyethylene glycol-modified lipid of the present invention are dissolved in a polar organic solvent to obtain a lipid solution. A nucleic acid solution prepared with a buffer solution and the lipid solution are mixed to obtain a nucleic acid-lipid mixed solution. The pharmaceutical composition of the present invention can be synthesized by replacing the polar organic solvent in the polar organic solvent with an aqueous solution such as a buffer solution.

[0095] In the nucleic acid-encapsulated LNP of this embodiment, the content of the cationic lipid of the present invention is preferably 10 mol% to 100 mol%, more preferably 20 mol% to 90 mol%. in Yes, it is. Particularly preferably, it is 40 mol% to 70 mol%.

[0096] Examples of nucleic acids include siRNA, mRNA, miRNA, shRNA, antisense oligonucleotides, immunostimulated oligonucleotides, guide RNA (CRISPR-Cas), ribozymes, and expression vectors. Preferably, siRNA, mRNA, or antisense oligonucleotides are used. More preferably, siRNA or mRNA are used.

[0097] In the LNP of this embodiment, the nucleic acid content is preferably 0.01% to 50% by weight. More preferably, it is 0.1% to 30% by weight. Particularly preferably, it is 1% to 10% by weight.

[0098] Examples of neutral lipids include dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, egg phosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, diarachidoylphosphatidylcholine, dibehenoylphosphatidylcholine, dilignoceroylphosphatidylcholine, dioleoylphosphatidylcholine, sphingomyelin, ceramide, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, phosphatidylethanolamine, and dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate.

[0099] The neutral lipid content in the LNP of this embodiment is preferably 0 mol% to 50 mol%, more preferably 0 mol% to 40 mol%, and particularly preferably 0 mol% to 30 mol%.

[0100] Examples of polyethylene glycol-modified lipids include PEG2000-dimyristylglycerol, PEG2000-dipalmitoylglycerol, PEG2000-distearoylglycerol, PEG5000-dimyristylglycerol, PEG5000-dipalmitoylglycerol, PEG5000-distearoylglycerol, N-[(methoxypoly(ethylene glycol)2000)carbamyl]-1,2-dimyristyloxylpropyl-3-amine, R-3-[(ω-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxylpropyl-3-amine, PEG-diacylglycerol, PEG-dialkyloxypropyl, PEG-phospholipids, and PEG-ceramide.

[0101] The polyethylene glycol-modified lipid content in the LNP of this embodiment is preferably 0 mol% to 30 mol%, more preferably 0 mol% to 20 mol%, and particularly preferably 0 mol% to 10 mol%.

[0102] Examples of sterols include cholesterol, dihydrocholesterol, lanosterol, β-sitosterol, campesterol, stigmasterol, brassicasterol, ergocasterol, fucosterol, and 3β-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol).

[0103] The sterol content in the LNP of this embodiment is 0 mol% to 90 mol%. More preferably, it is 10 mol% to 80 mol%. Particularly preferably, it is 20 mol% to 50 mol%.

[0104] Examples of aqueous solutions containing polar organic solvents include ethanol.

[0105] The combination of lipid compositions in the LNP of this embodiment is not particularly limited, but for example, a combination of the cationic lipid, neutral lipid and sterol of the present invention or a combination of the cationic lipid, neutral lipid, polyethylene glycol-modified lipid and sterol of the present invention is preferred.

[0106] The pharmaceutical composition of the present invention possesses any or all of the following excellent characteristics. a) It has a weak inhibitory effect on CYP enzymes (e.g., CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4, etc.). b) It exhibits good pharmacokinetics, including high bioavailability and moderate clearance. c) High metabolic stability. d) It does not exhibit irreversible inhibitory activity against CYP enzymes (e.g., CYP3A4) within the concentration range of the measurement conditions described herein. e) It does not possess mutagenic properties. f) Low cardiovascular risk. g) High encapsulation rate of nucleic acids. h) The stability of the nucleic acid-encapsulated particles is high. i) High transferability to target organizations. j) The dosage can be reduced. k) By encapsulating APIs with low solubility, solubility can be improved. l) The encapsulated nucleic acid can be efficiently transported to the cytoplasm. m) The amount of constituent lipids remaining in the body is low.

[0107] In the nucleic acids included in the pharmaceutical composition of the present invention, nucleosides and internucleoside bonds may be modified. Nucleic acids that have undergone appropriate modification have one or all of the following characteristics compared to unmodified nucleic acids. a) The nucleic acids included in the pharmaceutical composition of the present invention have high affinity for target genes. b) High resistance to nucleases. c) Pharmacokinetics improve. d) Organizational transferability increases.

[0108] Any method of administration and formulation of the pharmaceutical composition of the present invention can be used, provided that such methods and formulations are known in the art.

[0109] The pharmaceutical composition of the present invention can be administered by various methods depending on whether local or systemic treatment is desired, or the area to be treated. Methods of administration may include, for example, local administration (including direct administration to organs such as eye drops, vaginal, rectal, nasal cavity, transdermal, intra-ear, intraocular, intraventricular, tympanic cavity, or bladder, as well as intratumoral administration), oral administration, or parenteral administration. Parenteral administration methods include intravenous injection or drip infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration by aspiration or inhalation, subdural administration, intraventricular administration, and intrathecal administration. Intravenous injection, subcutaneous administration, or intramuscular injection are preferred.

[0110] When administering the pharmaceutical composition of the present invention topically, formulations such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders can be used. Oral administration compositions include powders, granules, suspensions or solutions dissolved in water or a non-aqueous medium, capsules, powders, tablets, etc. Examples of compositions for parenteral, subdural, or intraventricular administration include sterile aqueous solutions containing buffers, diluents, and other suitable additives.

[0111] The pharmaceutical composition of the present invention can be obtained by mixing an effective amount of various pharmaceutical additives, such as excipients, binders, wetting agents, disintegrants, lubricants, and diluents, as needed, that are suitable for the dosage form. In the case of an injectable preparation, it can be prepared by sterilizing it together with a suitable carrier.

[0112] Excipients include sucrose, trehalose, mannitol, sodium chloride, or amino acids. Examples of binders include methylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gelatin, or polyvinylpyrrolidone. Examples of disintegrants include carboxymethylcellulose, sodium carboxymethylcellulose, starch, sodium alginate, agar powder, or sodium lauryl sulfate. Examples of lubricants include talc, magnesium stearate, or macrogol. Cocoa butter, macrogol, or methylcellulose can be used as the base for the suppositories. Furthermore, when preparing a liquid, emulsion, or suspension injection, commonly used solubilizers, suspending agents, emulsifiers, stabilizers, preservatives, isotonic agents, etc., may be added as appropriate. For oral administration, flavoring agents, fragrances, etc., may be added.

[0113] The administration depends on the severity and response of the condition being treated, and the course of treatment lasts from a few days to several months, or until a cure is achieved or the condition is reduced. A person skilled in the art can determine the optimal dose, method of administration, and frequency of recurrence. For example, the optimal administration schedule for pharmaceutical compositions containing the compounds and siRNAs described herein can be calculated from appropriate biomarkers in a living organism. The optimal dose varies depending on the relative potency of the complex using the present invention, but can generally be calculated based on the effects of in vitro and in vivo animal experiments. For example, given the molecular weight of the nucleic acid drug (derived from its sequence and chemical structure) and the experimentally derived effective dose, the dose, expressed in mg / kg or mg / head, is calculated according to custom.

[0114] The pharmaceutical composition of the present invention can be used in conjunction with an appropriate nucleic acid drug to prevent or treat various diseases in which the nucleic acid drug is expected to be effective, in order to improve the promotion of target protein expression or the suppression of target gene expression of the nucleic acid drug it contains. [Examples]

[0115] The present invention will be described in more detail below with reference to examples and reference examples, but the present invention is not limited thereto.

[0116] The abbreviations used in this specification have the following meanings. Bn: Benzyl Boc:tert-butoxycarbonyl DCC:N,N'-Dicyclohexylcarbodiimide DIC: N,N'-Diisopropylcarbodiimide DIEA: N,N-diisopropylethylamine DMAP: 4-dimethylaminopyridine DMEM: Dulbecco's modified Eagle medium DMF: N,N-dimethylformamide DMG-PEG:1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene DMSO: Dimethyl sulfoxide DSPC: Distearoylphosphatidylcholine EDC: 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide GAPDH: Glyceraldehyde-3-phosphate dehydrogenase Hprt1: Hypoxanthine-guanine phosphoribosyltransferase 1 LHMDS: Lithium bis(trimethylsilyl)amide NMP: N-methylpyrrolidone OVA: Ovalbumin PyBOP: Hexafluorophosphate (benzotriazole-1-yloxy)tripyrrolidinophosphonium SOD1: Cu / Zn Superoxide Dimstase 1 TBAF: Tetrabutylammonium fluoride TBAI: Tetrabutylammonium iodide TBDPS: tert-butyldiphenylsilyl TBS: tert-butyldimethylsilyl TMS: Trimethylsilyl

[0117] NMR analysis of the results obtained in each example was performed at 400 MHz using DMSO-d6 and CDCl3. Note that when presenting NMR data, not all measured peaks may be listed.

[0118] The following conditions were used for the UPLC analysis. (Measurement condition 1) Column: ACQUITY UPLC (registered trademark) BEH C18 (1.7μm, id2.1x50mm) (Waters) Flow rate: 0.8mL / min PDA detection wavelength: 254nm (detection range 210-500nm) Mobile phase: [A] is a 0.1% formic acid aqueous solution, [B] is a 0.1% formic acid acetonitrile solution. Gradient: A linear gradient was applied from 5% to 100% solvent [B] over 3.5 minutes, followed by maintaining 100% solvent [B] for 0.5 minutes. (Measurement condition 2) Column: Xbridge Protein BEH C4 (3.5 μm, id2.1 x 50 mm) (Waters) Flow rate: 0.8mL / min PDA detection wavelength: 254nm (detection range 210-500nm) Mobile phase: [A] is an aqueous solution containing 10 mM ammonium carbonate, [B] is acetonitrile Gradient: A linear gradient was applied from 60% to 100% solvent [B] over 3.5 minutes, and 100% solvent [B] was maintained for 0.5 minutes. (Measurement condition 3) Column: Xbridge Protein BEH C4 (3.5 μm, id2.1 x 50 mm) (Waters) Flow rate: 0.8mL / min PDA detection wavelength: 254nm (detection range 210-500nm) Mobile phase: [A] is an aqueous solution containing 10 mM ammonium carbonate, [B] is acetonitrile Gradient: A linear gradient was applied from 5% to 100% solvent [B] over 3.5 minutes, and 100% solvent [B] was maintained for 0.5 minutes. (Measurement condition 4) Column: ACQUITY UPLC (registered trademark) BEH C18 (1.7μm, id2.1x50mm) (Waters) Flow rate: 0.8mL / min PDA detection wavelength: 254nm (detection range 210-500nm) Mobile phase: [A] is an aqueous solution containing 10 mM ammonium carbonate, [B] is acetonitrile Gradient: A linear gradient was applied from 5% to 100% solvent [B] over 3.5 minutes, and 100% solvent [B] was maintained for 0.5 minutes. In the specification, MS(m / z) refers to the value observed by mass spectrometry.

[0119] Synthesis of the Compound of the Present Invention [Examples]

[0120] Synthesis of compound I-1 [ka]

[0121] Process 1 Compound 1 (3.27 g, 28.2 mmol) was mixed with hydroiodic acid (10.6 mL, 141 mmol) and stirred at 50°C for 2 hours. Water was added to the reaction mixture and extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain Compound 2 (3.56 g, yield 56%). 1 H-NMR(CDCl3)δ:1.07(t, 2H), 1.73 (t, 2H), 3.41 (s, 2H).

[0122] Process 2 To a tetrahydrofuran solution (15 mL) of sodium hydride (531 mg, 13.3 mmol), a tetrahydrofuran solution (3.5 mL) of N-Boc-N-methyl-2-aminoethanol (1.55 g, 4.42 mmol) and compound 2 (1.0 g, 4.42 mmol) were added under ice cooling, and the mixture was stirred at room temperature for 3 hours. Water was added to the reaction mixture, and the organic solvent was removed by distillation under reduced pressure. The resulting aqueous solution was washed with chloroform. Saturated citric acid solution was added to the aqueous layer to adjust the pH to 2, and the mixture was extracted with chloroform. The organic layer was washed with water and dried over anhydrous magnesium sulfate. The solvent was removed by distillation under reduced pressure to obtain compound 3 (672 mg, yield 56%). 1 H-NMR(CDCl3)δ:0.96 (t, 2H), 1.33 (t, 2H), 1.44 (s, 9H), 2.90 (s, 3H), 3.40 (brs, 2H), 3.60 (brs, 4H).

[0123] Process 3 To a 3.5 mL solution of compound 4 (see International Patent Application Publication No. 2016 / 104580, 50 mg, 0.104 mmol) in dichloromethane, compound 3 (28 mg, 0.104 mmol), 2-methyl-6-nitrobenzoic anhydride (107 mg, 0.311 mmol), DIEA (0.11 mL, 0.621 mmol), and DMAP (76 mg, 0.621 mmol) were added, and the mixture was heated under reflux for 5 hours. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, and the mixture was extracted with chloroform. The solvent was removed by distillation under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 5 (54 mg, yield 71%). 1 H-NMR(CDCl3)δ:0.88 (m, 11H), 1.25-1.61 (m, 58H), 2.29 (t, 2H), 2.89 (s, 3H), 3.36 (brs, 2H), 3.56 (brs, 2H), 3.62 (s, 2H), 3.96 (d, 2H), 4.85 (m, 1H). ESI-MS (m / z): 739 (M+1).

[0124] Process 4 Compound 5 (150 mg, 0.203 mmol) was mixed with hydrochloric acid-1,4-dioxane solution (1.52 mL, 6.08 mmol) and stirred at room temperature for 2 hours. The solvent was removed by vacuum distillation. To the resulting residue in dichloromethane solution (3.9 mL), 36% formaldehyde solution (0.05 mL, 0.711 mmol) and sodium triacetoxyborate (301 mg, 1.42 mmol) were added and stirred at room temperature for 1 hour. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture and extracted with chloroform. The solvent was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target product was removed by vacuum distillation, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-1 (93 mg, yield 70%) as a clear oil. 1H-NMR(CDCl3)δ:0.88 (m, 11H), 1.17-1.28 (m, 42H), 1.49 (m, 4H), 1.60 (m, 12H), 2.25-2.31 (m, 8H), 2.49 (t, 2H), 3.56 (t, 2H), 3.62 (s, 2H), 3.97 (d, 2H), 4.85 (m, 1H). ESI-MS (m / z): 653 (M+1). [Examples]

[0125] Synthesis of compound I-2 [ka]

[0126] Process 5 To a 20.9 mL DMF solution of compound 6 (973 mg, 4.17 mmol), Bn bromide (1.04 mL, 8.76 mmol) and sodium bicarbonate (1.12 g, 13.4 mmol) were added under ice cooling and the mixture was stirred for 40 hours. Bn bromide (0.30 mL, 2.53 mmol) and sodium bicarbonate (0.48 g, 5.72 mmol) were added to the reaction mixture and the mixture was stirred at 50°C for 5 hours. Water was added to the reaction mixture and extracted with ethyl acetate. The organic layer was washed with water and the solvent was removed by vacuum distillation. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 7 (1.14 g, yield 85%). 1 H-NMR(CDCl3)δ:1.44 (s, 9H), 2.92 (s, 3H), 3.42 (brs, 2H), 3.66 (brs, 2H), 4.13 (s, 2H), 5.19 (s, 2H), 7.31-7.36 (m, 5H).

[0127] Process 6 To a tetrahydrofuran solution (11.5 mL) of compound 7 (371 mg, 1.15 mmol), allyl iodide (2.1 mL, 22.9 mmol) and LHMDS-tetrahydrofuran solution (2.29 mL, 2.29 mmol) were added at -78°C and the mixture was stirred for 1 hour. LHMDS-tetrahydrofuran solution (1.15 mL, 1.15 mmol) was added to the reaction mixture and the mixture was stirred for 1 hour. Saturated ammonium chloride aqueous solution was added to the reaction mixture and extracted with ethyl acetate. The organic layer was removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 8 (197 mg, yield 43%). 1 H-NMR(CDCl3)δ:1.44 (s, 9H), 2.55 (m, 4H), 2.89 (s, 3H), 3.36 (brs, 2H), 3.54 (brs, 2H), 5.05 (m, 4H), 5.14 (s, 2H), 5.69 (m, 2H), 7.31-7.36 (m, 5H). ESI-MS (m / z): 404 (M+1).

[0128] Process 7 To a 2.4 mL solution of compound 8 (96 mg, 0.24 mmol) in dichloromethane, 10.1 mg, 0.012 mmol of Grubbs catalyst (registered trademark) second generation (Sigma-Aldrich Brand Chemicals) was added, and the mixture was heated under reflux for 2 hours. The reaction mixture was removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 9 (85 mg, 95% yield). 1 H-NMR(CDCl3)δ:1.44 (s, 9H), 2.61 (s, 1H), 2.65 (s, 1H), 2.86-2.92 (m, 5H), 3.33 (brs, 2H), 3.49 (brs, 2H), 5.20 (s, 2H), 5.64 (s, 2H), 7.31-7.36 (m, 5H). ESI-MS (m / z): 376 (M+1).

[0129] Process 8 To a 4.5 mL ethyl acetate solution of compound 9 (85 mg, 0.23 mmol), Pd-C (12.1 mg, 0.011 mmol) was added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 3 hours. The reaction mixture was filtered through Celite® (Kanto Chemical). The solvent was removed by distillation under reduced pressure to obtain compound 10 (58 mg, yield 89%). ESI-MS (m / z): 288 (M+1).

[0130] Process 9 Compound 10 was used instead of compound 3 in step 3, and compound I-2 (148 mg, total yield 81%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.88 (m, 9H), 1.20-1.35 (m, 41H), 1.50-1.65 (m, 13H), 1.65-1.80 (m, 4H), 1.90-2.05 (m, 4H), 2.25-2.31 (m, 8H), 2.52 (t, 2H), 3.47 (t, 2H), 3.97 (d, 2H), 4.91 (m, 1H). ESI-MS (m / z): 667 (M+1). [Examples]

[0131] Synthesis of compound I-3 [ka]

[0132] Step 10 To a 42 mL dichloromethane solution of compound 11 (see International Patent Application Publication No. 2017 / 222016, 10.7 g, 21.0 mmol), imidazole (3.00 g, 44.0 mmol) and TBS chloride (3.47 g, 23.1 mmol) were added, and the mixture was stirred at room temperature for 1.5 hours. Ethyl acetate was added to the reaction mixture, and the mixture was sequentially washed with 2 mol / L hydrochloric acid, water, saturated sodium bicarbonate aqueous solution, and saturated sodium chloride aqueous solution. The organic layer was dried over anhydrous magnesium sulfate. The solvent was removed by distillation under reduced pressure to obtain compound 12 (13.2 g, 100% yield). 1 H-NMR(CDCl3)δ:0.00 (s, 3H), 0.02 (s, 3H), 0.88 (s, 9H), 1.17-1.38 (m, 21H), 1.64 (t, 4H), 2.35 (t, 4H), 3.44 (d, 2H), 5.11 (s, 4H), 7.30-7.38 (m, 10H). ESI-MS (m / z): 625 (M+1).

[0133] Step 11 To a tetrahydrofuran solution (41 mL) of compound 12 (12.9 g, 20.6 mmol), Pd-C (1.10 g, 1.03 mmol) was added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 6 hours. The reaction mixture was filtered through Celite, and the solvent was removed by distillation under reduced pressure. To a dichloromethane solution (21 mL) of the resulting residue, 2-butyl-1-octanol (4.6 mL, 20.6 mmol), 2-methyl-6-nitrobenzoic anhydride (10.6 g, 30.9 mmol), DIEA (10.8 mL, 61.8 mmol), and DMAP (252 mg, 2.06 mmol) were added, and the mixture was stirred at room temperature for 17 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was washed with water. The solvent was removed by reduced pressure distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 13 (2.52 g, yield 31%). 1 H-NMR(CDCl3)δ:0.00 (s, 3H), 0.02 (s, 3H), 0.87 (m, 21H), 1.17-1.39 (m, 55H), 1.63 (m, 6H), 2.29 (t, 4H), 3.45 (d, 2H), 3.97 (d, 4H). ESI-MS (m / z): 782 (M+1).

[0134] Step 12 To a tetrahydrofuran solution (16 mL) of compound 13 (2.52 g, 3.23 mmol), acetic acid (1.84 mL, 32.3 mmol) and TBAF-tetrahydrofuran solution (12.9 mL, 12.9 mmol) were added, and the mixture was stirred at room temperature for 17 hours. Ethyl acetate was added to the reaction mixture, and the mixture was sequentially washed with saturated sodium bicarbonate aqueous solution and water. The organic layer was removed by distillation under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 14 (1.87 g, yield 87%). 1 H-NMR(CDCl3)δ: 0.88 (m, 12H), 1.11-1.44 (m, 55H), 1.62 (m, 6H), 2.30 (t, 4H), 3.53 (t, 2H), 3.97 (d, 4H). ESI-MS (m / z): 668 (M+1).

[0135] Step 13 Compound 14 was used instead of compound 4 in step 3, and compound I-3 (105 mg, total yield 56%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ: 0.88 (m, 14H), 1.22-1.27 (m, 55H), 1.61 (m, 6H), 2.25-2.31 (m, 10H), 2.50 (t, 2H), 3.56 (t, 2H), 3.61 (s, 2H), 3.96 (m, 6H). ESI-MS (m / z): 837 (M+1). [Examples]

[0136] Synthesis of compound I-4 [ka]

[0137] Step 14 To a 1.9 mL solution of compound 15 (300 mg, 0.95 mmol) in dichloromethane, 2-butyl-1-octanol (0.64 mL, 2.86 mmol), 2-methyl-6-nitrobenzoic anhydride (985 mg, 2.86 mmol), DIEA (1.3 mL, 7.63 mmol), and DMAP (23 mg, 0.19 mmol) were added, and the mixture was stirred at room temperature for 6 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was washed with water. The solvent was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was removed by vacuum distillation. To a 9.6 mL solution of the resulting residue in 50% tetrahydrofuran-methanol, sodium borohydride (72 mg, 1.91 mmol) was added, and the mixture was stirred at 0°C for 2 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was removed by reduced pressure distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 16 (530 mg, yield 85%). 1 H-NMR(CDCl3)δ:0.88 (m, 12H), 1.27-1.31 (m, 46H), 1.37-1.42 (m, 6H), 1.61 (m, 6H), 2.30 (t, 4H), 3.57 (brs, 1H), 3.97 (d, 4H). ESI-MS (m / z): 654 (M+1).

[0138] Step 15 Compound 16 was used instead of compound 4 in step 3, and compound I-4 (131 mg, total yield 69%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ: 0.88 (m, 14H), 1.19-1.28 (m, 50H), 1.49 (m, 4H), 1.59 (m, 6H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 3.58 (t, 2H), 3.62 (s, 2H), 3.96 (d, 4H), 4.84 (m, 1H). ESI-MS (m / z): 823 (M+1). [Examples]

[0139] Synthesis of compound I-5 [ka]

[0140] Process 16 Compound 17 (485 mg, 75% yield) was obtained by using 7-tridecanol instead of 2-butyl-1-octanol in step 14, in the same manner as in step 14. 1 H-NMR(CDCl3)δ:0.88 (m, 12H), 1.20-1.35 (m, 49H), 1.35-1.53 ​​(m, 14H), 1.62 (m, 4H), 2.28 (t, 4H), 3.58 (brs, 1H), 4.87 (m, 2H). ESI-MS (m / z): 682 (M+1).

[0141] Process 17 To a 1.2 mL NMP solution of compound 17 (160 mg, 0.235 mmol), compound 18 (67 mg, 0.352 mmol), 2-methyl-6-nitrobenzoic anhydride (162 mg, 0.470 mmol), DIEA (0.16 mL, 0.940 mmol), and DMAP (5.7 mg, 0.047 mmol) were added, and the mixture was stirred at room temperature for 18 hours. Compound 18 (33 mg, 0.176 mmol), 2-methyl-6-nitrobenzoic anhydride (81 mg, 0.235 mmol), and DIEA (0.08 mL, 0.470 mmol) were added, and the mixture was stirred at room temperature for 3 hours. Saturated aqueous sodium bicarbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent in the fraction containing the target substance was removed by reduced pressure distillation, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-5 (86 mg, yield 43%) as a clear oil. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.35 (m, 49H), 1.45-1.70 (m, 25H), 2.03 (m, 4H), 2.27 (m, 7H), 2.79 (d, 3H), 3.23 (s, 2H), 4.86 (m, 3H). ESI-MS (m / z): 853 (M+1). [Examples]

[0142] Synthesis of compound I-6 [ka]

[0143] Process 18 Compound 20 (3.24 g, 100% yield) was obtained by using compound 19 instead of compound 2 in step 2, in the same manner as in step 2. 1 H-NMR(CDCl3)δ: 1.44 (m, 12H), 2.92 (s, 3H), 3.38 (brs, 2H), 3.63 (brs, 2H), 4.03 (q, 1H).

[0144] Process 19 Compound 21 (0.541 g) was obtained as a colorless, transparent oil by using 3-pentyl-1-octanol instead of 2-butyl-1-octanol in step 14, in the same manner as in step 14. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.25-1.63 (m, 63H), 2.26 (t, 4H), 3.57 (brs, 1H), 4.06 (t, 4H). ESI-MS (m / z): 682 (M+1).

[0145] Process 20 Compound I-6 (460 mg, total yield 75%) was obtained as a clear oil in the same manner as in steps 3 and 4, using compound 21 instead of compound 4 and compound 20 instead of compound 3. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.35 (m, 48H), 1.41 (d, 5H), 1.50-1.65 (m, 23H), 2.27 (m, 10H), 2.54 (t, 2H), 3.46 (m, 1H), 3.68 (m, 1H), 3.96 (q, 1H), 4.08 (t, 4H), 4.92 (m, 1H). ESI-MS (m / z): 825 (M+1). [Examples]

[0146] Synthesis of compound I-7 [ka]

[0147] Process 21 Compound 22 (1.44 g, 82% yield) was obtained in the same manner as in step 14, using 3-hexyl-1-nonanol instead of 2-butyl-1-octanol. 1 H-NMR(CDCl3)δ:0.88 (m, 12H), 1.20-1.50 (m, 66H), 1.52-1.68 (m, 10H), 2.28 (t, 4H), 3.57 (brs, 1H), 4.08 (t, 4H).

[0148] Process 22 Compound 22 was used instead of compound 21 in step 20, and compound I-7 (351 mg, total yield 59%) was obtained as a clear oil in the same manner as in step 20. 1 H-NMR(CDCl3)δ: 0.88 (t, 14H), 1.20-1.45 (m, 66H), 1.48-1.66 (m, 15H), 2.27 (m, 10H), 2.53 (t, 2H), 3.46 (m, 1H), 3.69 (m, 1H), 3.96 (q, 1H), 4.08 (t, 4H), 4.91 (m, 1H). [Examples]

[0149] Synthesis of compound I-8 [ka]

[0150] Process 23 Compound 21 was used instead of compound 17 in step 17, and compound I-8 (539 mg, yield 86%) was obtained as a clear oil in the same manner as in step 17. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.42 (m, 52H), 1.48-1.68 (m, 22H), 2.00 (m, 4H), 2.28 (m, 7H), 2.79 (brs, 3H), 3.23 (s, 2H), 4.08 (t, 4H), 4.88 (m, 1H). ESI-MS (m / z): 853 (M+1). [Examples]

[0151] Synthesis of compound I-9 [ka]

[0152] Process 24 Compound 23 (856 mg, yield 16%) was obtained in the same manner as in Step 2, using 2,2-dimethyl-3-iodopropionic acid instead of compound 2 in Step 2, and 2-azidoethanol instead of N-Boc-N-methyl-2-aminoethanol. 1 H-NMR(CDCl3)δ: 1.24 (s, 6H), 3.35 (t, 2H), 3.52 (s, 2H), 3.66 (t, 2H). ESI-MS (m / z): 188 (M+H).

[0153] Process 25 Compound 24 (188 mg, yield 89%) was obtained by using compound 21 instead of compound 4 in step 3 and compound 23 instead of compound 3, in the same manner as in step 3. 1 H-NMR(CDCl3)δ: 0.88 (t, 14H), 1.15-1.42 (m, 61H), 1.48-1.65 (m, 23H), 2.27 (t, 4H), 3.31 (t, 2H), 3.49 (s, 2H), 3.61 (t, 2H), 4.08 (t, 4H), 4.85 (m, 1H). ESI-MS (m / z): 868 (M+18).

[0154] Process 26 To a tetrahydrofuran solution (5.4 mL) of compound 24 (188 mg, 0.22 mmol), Pd-C (235 mg, 0.22 mmol) and a 1,4-dioxane hydrochloride solution (0.28 mL, 1.11 mmol) were added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 3 hours. The reaction mixture was filtered through Celite, and the solvent was removed by vacuum distillation. To the resulting tetrahydrofuran solution (5.4 mL), 36% formaldehyde solution (0.09 mL, 1.11 mmol) and sodium triacetoxyborate (469 mg, 2.21 mmol) were added, and the mixture was stirred at room temperature for 1 hour. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with chloroform. The solvent was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent in the fraction containing the target substance was removed by reduced pressure distillation, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-9 (71 mg, yield 38%) as a clear oil. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.17 (s, 6H), 1.20-1.45 (m, 51H), 1.45-1.65 (m, 42H), 2.27 (m, 10H), 2.48 (t, 2H), 3.42 (s, 2H), 3.52 (t, 2H), 4.08 (t, 4H), 4.84 (m, 1H). ESI-MS (m / z): 853 (M+1). [Examples]

[0155] Synthesis of compound I-10 [ka]

[0156] Process 27 Compound 25 was used instead of compound 18 in step 17, and compound I-10 (162 mg, yield 67%) was obtained as a clear oil in the same manner as in step 17. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.25-1.35 (m, 50H), 1.45-1.55 (m, 12H), 1.55-1.65 (m, 8H), 2.27 (m, 10H), 2.48 (t, 2H), 2.58 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 4.86 (m, 3H). [Examples]

[0157] Synthesis of compound I-11 [ka]

[0158] Process 28 Compound 21 was used instead of compound 4 in step 3, and compound I-11 (123 mg, total yield 61%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ: 0.88 (t, 14H), 1.19-1.35 (m, 50H), 1.35-1.65 (m, 28H), 2.28 (m, 10H), 2.49 (t, 2H), 3.56 (t, 2H), 3.62 (s, 2H), 4.08 (t, 4H), 4.84 (m, 1H). ESI-MS (m / z): 851 (M+1). [Examples]

[0159] Synthesis of compound I-12 [ka]

[0160] Process 29 Compound 26 was used instead of compound 18 in step 17, and compound I-12 (169 mg, yield 87%) was obtained as a clear oil in the same manner as in step 17. 1H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.26-1.29 (m, 45H), 1.50-1.74 (m, 21H), 1.90-1.95 (m, 2H), 2.08-2.13 (m, 2H), 2.25-2.29 (m, 7H), 2.70-2.74 (m, 2H), 3.38-3.44 (m, 1H), 4.08 (s, 2H), 4.79-4.97 (m, 3H). ESI-MS (m / z): 837 (M+1). [Examples]

[0161] Synthesis of compound I-13 [ka]

[0162] Process 30 Compound 4 (497 mg, 1.0 mmol), DMAP (277 mg, 2.26 mmol), and EDC (217 mg, 1.13 mmol) were added to a 1.3 mL dichloromethane solution of Compound 6, and the mixture was stirred at room temperature for 10 hours. Silica gel was added to the reaction mixture, and the solvent was removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain Compound 27 (601 mg, yield 84%). 1H-NMR(CDCl3)δ:0.88 (m, 9H), 1.28-1.43 (m, 41H), 1.45-1.61 (m, 23H), 2.30 (t, 2H), 2.93 (s, 3H), 3.44 (brs, 2H), 3.66 (brs, 2H), 3.97 (d, 2H), 4.06 (s, 2H), 4.95 (m, 1H). ESI-MS (m / z): 699 (M+H).

[0163] Process 31 Compound 27 was used instead of compound 5 in step 4, and compound I-13 (250 mg, 95% yield) was obtained as a clear oil in the same manner as in step 4. 1 H-NMR(CDCl3)δ:0.88 (m, 9H), 1.26 (m, 39H), 1.59 (m, 21H), 2.27-2.31 (m, 8H), 2.56 (t, 2H), 3.65 (t, 2H), 3.96 (d, 2H), 4.09 (s, 2H), 4.95 (t, 1H). ESI-MS (m / z): 613 (M+H). [Examples]

[0164] Synthesis of compound I-14 [ka]

[0165] Process 32 Compound I-14 (21 mg, yield 13%) was obtained as a clear oil in the same manner as in step 17, using compound 4 instead of compound 17 and compound 28 instead of compound 18. 1H-NMR(CDCl3)δ: 0.88 (t, 9H), 1.25-1.28 (m, 43H), 1.42-1.58 (m, 54H), 1.85 (t, 6H), 2.29 (t, 2H), 3.36 (s, 2H), 3.41 (t, 6H), 3.97 (d, 2H), 4.02 (s, 2H), 4.94 (m, 1H). ESI-MS (m / z): 665 (M+H). [Examples]

[0166] Synthesis of compound I-15 [ka]

[0167] Process 33 Compound 29 (2.52 g) was obtained by using 3-pentyl-1-octanol instead of 2-butyl-1-octanol in step 11, in the same manner as in steps 11 and 12. 1 H-NMR(CDCl3)δ: 0.87 (m, 12H), 1.26-1.63 (m, 64H), 2.26 (t, 4H), 3.53 (brs, 2H), 4.06 (t, 4H). ESI-MS (m / z): 696 (M+1).

[0168] Process 34 Compound 29 was used instead of compound 21 in step 25, and compound I-15 (100 mg, total yield 33%) was obtained as a clear oil in the same manner as in steps 25 and 26. 1 H-NMR(CDCl3)δ: 0.88 (t, 14H), 1.18 (s, 6H), 1.25-1.42 (m, 56H), 1.57 (m, 26H), 2.26 (m, 10H), 2.48 (t, 2H), 3.43 (s, 2H), 3.53 (t, 2H), 3.96 (d, 2H), 4.08 (t, 4H). ESI-MS (m / z): 867 (M+H). [Examples]

[0169] Synthesis of compound I-16 [ka]

[0170] Process 35 Compound I-16 (115 mg, total yield 60%) was obtained as a clear oil in the same manner as in step 17, using compound 16 instead of compound 17 and compound 26 instead of compound 18. 1 H-NMR(CDCl3)δ: 0.88 (m, 14H), 1.28 (m, 40H), 1.51-1.71 (m, 12H), 1.91 (m, 2H), 2.11 (m, 2H), 2.29 (m, 7H), 2.70 (m, 2H), 3.41 (m, 1H), 3.96 (d, 4H), 4.08 (s, 2H), 4.94 (t, 1H). ESI-MS (m / z): 809 (M+1). [Examples]

[0171] Synthesis of compound I-17 [ka]

[0172] Process 36 Compound 4 was used instead of compound 21 in step 25, and compound I-17 (20 mg, total yield 9%) was obtained as a clear oil in the same manner as in steps 25 and 26. 1 H-NMR(CDCl3)δ: 0.88 (t, 9H), 1.17 (s, 6H), 1.25-1.28 (m, 40H), 1.49-1.61 (m, 23H), 2.26 (s, 6H), 2.29 (t, 2H), 2.48 (t, 2H), 3.42 (s, 2H), 3.53 (t, 2H), 3.96 (d, 2H), 4.84 (t, 1H). ESI-MS (m / z): 655 (M+H). [Examples]

[0173] Synthesis of compound I-18 [ka]

[0174] Process 37 Compound 30 was obtained in the same manner as in step 17, using compound 11 instead of compound 17 and compound 25 instead of compound 18. Subsequently, compound I-18 (120 mg, total yield 57%) was obtained as a clear oil in the same manner as in step 11, using compound 30 instead of compound 12 and 1-hexanol instead of 2-butyl-1-octanol. 1 H-NMR(CDCl3)δ: 0.89 (t, 6H), 1.22-1.40 (m, 33H), 1.55-1.65 (m, 18H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.06 (t, 4H). ESI-MS (m / z): 643 (M+1). [Examples]

[0175] Synthesis of compound I-19 [ka]

[0176] Process 38 Compound I-19 (111 mg, 50% total yield) was obtained as a clear oil in the same manner as in step 37, using 7-tridecanol instead of 1-hexanol. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.35 (m, 51H), 1.45-1.65 (m, 15H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.87 (m, 2H). ESI-MS (m / z): 839 (M+1). [Examples]

[0177] Synthesis of compound I-20 [ka]

[0178] Process 39 Compound I-20 (116 mg, total yield 51%) was obtained as a clear oil in the same manner as in step 37, using 2-ethyl-1-hexanol instead of 1-hexanol. 1 H-NMR(CDCl3)δ: 0.89 (t, 12H), 1.20-1.40 (m, 36H), 1.51-1.67 (m, 9H), 2.25-2.32 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (m, 6H). ESI-MS (m / z): 699 (M+1). [Examples]

[0179] Synthesis of compound I-21 [ka]

[0180] Process 40 A tetrahydrofuran solution (60 mL) of copper bromide (735 mg, 5.12 mmol) and lithium chloride (434 mg, 10.2 mmol) was stirred at room temperature for 5 minutes. Methyl trans-2-octenoate (8.0 g, 51.2 mmol) and TMS chloride (7.2 mL, 56.3 mmol) were added to the reaction mixture under ice cooling and stirred for 15 minutes. Hexylmagnesium bromide-tetrahydrofuran solution (77 mL, 77 mmol) was added dropwise under ice cooling and stirred for 2 hours. Saturated ammonium chloride solution and water were added to the reaction mixture and extracted with diethyl ether. The organic layer was washed with saturated sodium chloride aqueous solution and then dried over anhydrous magnesium sulfate. The solvent was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 31 (9.80 g, yield 79%). 1 H-NMR(CDCl3)δ: 0.88 (t, 6H), 1.26 (brs, 19H), 1.84 (brs, 1H), 2.23 (d, 2H), 3.66 (s, 3H).

[0181] Process 41 To a tetrahydrofuran solution (100 mL) of lithium aluminum hydride (3.07 g, 81 mmol), a tetrahydrofuran solution (27 mL) of compound 31 (9.80 g, 40.4 mmol) was added dropwise, and the mixture was heated under reflux for 3 hours. Sodium sulfate decahydrate was added under ice cooling, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered, and the filtrate was removed by distillation under reduced pressure. Diethyl ether was added to the resulting residue, and the aqueous layer was removed. The organic layer was dried over anhydrous magnesium sulfate. The solvent was removed by distillation under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 32 (8.26 g, yield 95%). 1 H-NMR(CDCl3)δ: 0.88 (t, 6H), 1.12 (t, 1H), 1.26 (brs, 18H), 1.41 (brs, 1H), 1.53 (m, 2H), 3.66 (m, 2H).

[0182] Process 42 Compound 32 was used instead of 1-hexanol in step 37, and compound I-21 (137 mg, total yield 54%) was obtained as a clear oil in the same manner as in step 37. 1 H-NMR(CDCl3)δ: 0.89 (t, 12H), 1.20-1.45 (m, 58H), 1.54-1.66 (m, 11H), 2.25-2.32 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.55 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.08 (t, 4H). ESI-MS (m / z): 867 (M+1). [Examples]

[0183] Synthesis of compound I-22 [ka]

[0184] Process 43 Compound I-22 (134 mg, total yield 54%) was obtained as a clear oil in the same manner as in step 37, using 1-tridecanol instead of 1-hexanol. 1 H-NMR(CDCl3)δ: 0.88 (t, 6H), 1.20-1.35 (m, 59H), 1.55-1.65 (m, 12H), 2.25-2.31 (m, 10H), 2.48 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.05 (t, 4H). ESI-MS (m / z): 839 (M+1). [Examples]

[0185] Synthesis of compound I-23 [ka]

[0186] Process 44 Compound I-23 (183 mg, 66% yield) was obtained as a clear oil in the same manner as in step 17, using compound 25 instead of compound 18 and compound 14 instead of compound 17. 1 H-NMR(CDCl3)δ: 0.88 (m, 12H), 1.20-1.35 (m, 53H), 1.55-1.65 (m, 16H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (m, 6H). ESI-MS (m / z): 811 (M+1). [Examples]

[0187] Synthesis of compound I-24 [ka]

[0188] Process 45 Compound 29 was used instead of compound 4 in step 3, and compound I-24 (102 mg, total yield 55%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ: 0.88 (m, 14H), 1.20-1.45 (m, 57H), 1.52-1.65 (m, 15H), 2.25-2.31 (m, 10H), 2.50 (t, 2H), 3.56 (t, 2H), 3.61 (s, 2H), 3.95 (d, 2H), 4.08 (t, 4H). ESI-MS (m / z): 865 (M+1). [Examples]

[0189] Synthesis of compound I-25 [ka]

[0190] Process 46 Compound 14 was used instead of compound 21 in step 25, and compound I-25 (46 mg, total yield 37%) was obtained as a clear oil in the same manner as in steps 25 and 26. 1 H-NMR(CDCl3)δ: 0.88 (m, 12H), 1.18 (s, 6H), 1.20-1.35 (m, 54H), 1.52-1.65 (m, 24H), 2.25-2.31 (m, 10H), 2.48 (t, 2H), 3.42 (s, 2H), 3.53 (t, 2H), 3.97 (m, 6H). ESI-MS (m / z): 839 (M+1). [Examples]

[0191] Synthesis of compound I-26 [ka]

[0192] Process 47 Compound 33 (50 mg, 64% yield) was obtained by using compound 8 instead of compound 9 in step 8, in the same manner as in step 8. ESI-MS (m / z): 318 (M+1).

[0193] Process 48 Compound 33 was used instead of compound 3 in step 3, and I-26 (54 mg, total yield 50%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.89 (m, 15H), 1.20-1.40 (m, 45H), 1.45-1.65 (m, 17H), 1.65-1.80 (m, 4H), 2.25-2.31 (m, 8H), 2.53 (t, 2H), 3.44 (t, 2H), 3.97 (d, 2H), 4.88 (m, 1H). ESI-MS (m / z): 697 (M+1). [Examples]

[0194] Synthesis of compound I-27 [ka]

[0195] Process 49 Compound 34 (29 mg, 4% yield) was obtained by using 4-bromobutyric acid instead of compound 2 in step 2, in the same manner as in step 2. ESI-MS (m / z): 262 (M+1).

[0196] Process 50 Compound 34 was used instead of compound 3 in step 3, and compound I-27 (40 mg, total yield 57%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.88 (m, 9H), 1.20-1.35 (m, 40H), 1.45-1.65 (m, 13H), 1.90 (m, 2H), 2.25-2.31 (m, 8H), 2.37 (t, 2H), 2.49 (t, 2H), 3.46 (t, 2H), 3.51 (t, 2H), 3.97 (d, 2H), 4.86 (m, 1H). ESI-MS (m / z): 641 (M+1). [Examples]

[0197] Synthesis of compound I-28 [ka]

[0198] Process 51 Compound 35 (247 mg, 69% yield) was obtained in the same manner as in Step 2, using 2-bromoacetic acid instead of compound 2 in Step 2, and N-Boc-3-methylamino-1-propanol instead of N-Boc-N-methyl-2-aminoethanol. ESI-MS (m / z): 248 (M+1).

[0199] Process 52 Compound 35 was used instead of compound 3 in step 3, and compound I-28 (99 mg, total yield 76%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.88 (m, 9H), 1.20-1.35 (m, 41H), 1.45-1.65 (m, 17H), 1.80 (m, 2H), 2.23 (s, 6H), 2.29 (t, 2H), 2.38 (t, 2H), 3.58 (t, 2H), 3.97 (d, 2H), 4.05 (s, 2H), 4.95 (m, 1H). ESI-MS (m / z): 627 (M+1). [Examples]

[0200] Synthesis of compound I-29 [ka]

[0201] Process 53 Compound 36 (see International Patent Application Publication No. 2019 / 131580) was used instead of compound 4 in step 3, and compound I-29 (87 mg, total yield 66%) was obtained as a clear oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.88 (m, 11H), 1.20-1.45 (m, 49H), 1.50-1.65 (m, 10H), 2.25-2.31 (m, 8H), 2.50 (t, 2H), 3.56 (t, 2H), 3.61 (s, 2H), 3.96 (d, 2H), 4.08 (t, 2H). ESI-MS (m / z): 695 (M+1). [Examples]

[0202] Synthesis of compound I-30 [ka]

[0203] Process 54 To a 15 mL solution of compound 26 (434 mg, 2.07 mmol) in dichloromethane, 0.12 mL of DMF was added and cooled to 0°C. Oxalyl chloride (0.163 mL, 0.622 mmol) was added and the mixture was heated under reflux for 90 minutes. The reaction mixture was removed by distillation under reduced pressure, and dichloromethane (1 mL) was added to the resulting residue. This solution was added to a 50 mL solution of compound 4 (500 mg, 1.04 mmol) in dichloromethane (0.43 mL) and triethylamine (0.43 mL) under ice cooling and stirred overnight. An aqueous sodium bicarbonate solution was added to the reaction mixture and extracted with ethyl acetate. The solvent was removed by distillation under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-30 (250 mg, yield 38%) as a colorless, transparent oil. 1 H-NMR(CDCl3)δ:0.88 (m, 9H), 1.25-1.74 (m, 49H), 1.91-1.93 (m, 2H), 2.10 (t, 2H), 2.26 (s, 3H), 2.29 (t, 2H), 2.70 (m, 2H), 3.41 (m, 1H), 3.96 (d, 2H), 4.08 (s, 2H), 4.95 (m, 1H). ESI-MS(m / z): 639 (M+1). [Examples]

[0204] Synthesis of compound I-31 [ka]

[0205] Process 55 A 60 mL ethyl acetate solution of 2-(propylamino)ethane-1-ol (9 g, 87 mmol) was cooled on ice, and a 60 mL ethyl acetate solution of di-tert-butyl dicarbonate (17.1 g, 79 mmol) was added dropwise. The mixture was stirred overnight at room temperature. Water was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and filtered. The solvent was removed by distillation under reduced pressure to obtain compound 37 (15.6 g) as a colorless, transparent oil. Compound 38 (4.9 g, a mixture with compound 37) was obtained in the same manner as in step 2, using compound 37 (4.39 g) instead of N-Boc-N-methyl-2-aminoethanol and 2-bromoacetic acid instead of compound 2. Compound 39 (0.875g) was obtained by using compound 38 instead of compound 3 in step 3, in the same manner as in step 3. 1 H-NMR(CDCl3)δ:0.86 (m, 12H), 1.25-1.63 (m, 58H), 2.27 (t, 2H), 3.19 (t, 2H), 3.41 (brs, 2H), 3.65 (brs, 2H), 3.96 (d, 2H), 4.06 (s, 2H), 4.93 (m, 1H). ESI-MS (m / z): 727 (M+1).

[0206] Process 56 Compound 39 (0.875 g, 1.21 mmol) was mixed with hydrochloric acid-1,4-dioxane solution (8.4 mL, 33.6 mmol) and stirred at room temperature for 30 minutes. The solvent was removed by distillation under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-31 (0.61 g, yield 80%) as a slightly colored oil. 1 H-NMR(CDCl3)δ:0.88-0.94 (m, 12H), 1.25-1.61 (m, 50H), 2.27 (t, 2H), 2.57 (t, 2H), 2.83 (m, 2H), 3.66(brs, 2H), 3.96 (d, 2H), 4.08 (s, 2H), 4.94 (m, 1H). ESI-MS (m / z): 627 (M+1). [Examples]

[0207] Synthesis of compound I-32 [ka]

[0208] Process 57 To a 2.1 mL solution of compound I-31 (0.143 g, 0.228 mmol) in dichloromethane, 0.061 mL of 36% formaldehyde solution and 0.335 g of sodium triacetoxyborate were added, and the mixture was stirred at room temperature for 3 hours. 0.335 g of sodium triacetoxyborate and a solution of 1,4-dioxane hydrochloride were added, and the mixture was stirred for 1 hour. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The solvent was removed by reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-32 (115 mg, yield 79%) as a colorless, transparent oil. 1 H-NMR(CDCl3)δ:0.86 (m, 12H), 1.25-1.61 (m, 49H), 2.28 (s, 3H), 2.29-2.37 (m, 4H), 2.60 (t, 2H), 3.63 (t, 2H), 3.96 (d, 2H), 4.09 (s, 2H), 4.92 (m, 1H). ESI-MS (m / z): 641 (M+1). [Examples]

[0209] Synthesis of compound I-33 [ka]

[0210] Process 58 To a 2.1 mL solution of compound I-31 (0.154 g, 0.246 mmol) in dichloromethane, one drop of hydrochloric acid-1,4-dioxane solution, propionaldehyde (0.058 mL), and sodium triacetoxyborate (0.335 g) were added, and the mixture was stirred at room temperature for 3 hours. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, and it was extracted with ethyl acetate. The solvent was removed by distillation under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-33 (108 mg, yield 66%) as a colorless, transparent oil. 1 H-NMR(CDCl3)δ:0.85-0.89 (m, 15H), 1.25-1.63 (m, 51H), 2.27 (t, 2H), 2.41 (t, 4H), 2.68 (t, 2H), 3.59 (t, 2H), 3.96 (d, 2H), 4.09 (s, 2H), 4.93 (m, 1H). ESI-MS (m / z): 669 (M+1). [Examples]

[0211] Synthesis of compound I-34 [ka]

[0212] Process 59 Compound 40 was obtained by using 2-bromobutanoic acid instead of compound 2 in step 2, in the same manner as in step 2. Subsequently, compound 40 was used instead of compound 3 in step 3, and compound I-34 (144 mg) was obtained as a colorless, transparent oil in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.82 (m, 9H), 0.95 (t, 3H), 1.25-1.60 (m, 47H), 1.69 (m, 2H), 2.27 (s, 6H), 2.29 (t, 2H), 2.53 (t, 2H), 3.41 (m, 1H), 3.67 (m, 1H), 3.75 (m, 1H), 3.96 (d, 2H), 4.90 (m, 1H). ESI-MS (m / z): 641 (M+1). [Examples]

[0213] Synthesis of compound I-35 [ka]

[0214] Process 60 To a solution of compound 32 (1.65 g, 7.68 mmol) in tetrahydrofuran (22 mL), compound 41 (see International Patent Application Publication No. 2016 / 104580, 2 g, 6.4 mmol), triphenylphosphine (2.01 g, 7.68 mmol), and bis(2-methoxyethyl) azodicarboxylate (2.1 g, 8.96 mmol) were added and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture and extracted with ethyl acetate. The solvent was removed by distillation under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate / chloroform) to obtain compound 42 (2.71 g, yield 83%). 1 H-NMR(CDCl3)δ:0.83 (m, 9H), 1.25-1.62 (m, 47H), 2.26 (t, 2H), 2.35 (t, 4H), 4.06 (t, 2H). ESI-MS (m / z): 510 (M+1).

[0215] Process 61 To a 50% tetrahydrofuran-methanol solution (27 mL) of compound 42 (2.71 g, 5.33 mmol), sodium borohydride (0.4 g, 10.7 mmol) was added under ice cooling and the mixture was stirred for 40 minutes. Acetone and saturated aqueous ammonia chloride were added to the reaction mixture and extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and filtered. The solvent was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was removed by vacuum distillation. Subsequently, compound I-35 (0.537 g, total yield 84%) was obtained as a colorless, transparent oil in the same manner as in step 17, using compound 25 instead of compound 18 and the resulting residue instead of compound 17. 1 H-NMR(CDCl3)δ:0.87 (m, 9H), 1.26-1.62 (m, 51H), 2.25-2.29 (m, 8H), 2.41 (t, 2H), 2.56 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 4.06 (t, 2H), 4.85 (m, 1H). ESI-MS (m / z): 654 (M+1). [Examples]

[0216] Synthesis of compound I-36 [ka]

[0217] Process 62 Compound 43 (1.6 g, 64% yield) was obtained in the same manner as in step 60, using 2-propylheptanol instead of compound 32. 1 H-NMR(CDCl3)δ:0.86-0.91 (m, 9H), 1.26-1.63 (m, 39H), 2.27 (t, 2H), 2.36 (t, 4H), 3.96 (d, 2H). ESI-MS (m / z): 453 (M+1).

[0218] Process 63 Compound I-36 was obtained as a colorless, transparent oil (0.314 g, total yield 72%) in the same manner as in step 61, using compound 43 instead of compound 42. 1 H-NMR(CDCl3)δ:0.86 (m, 9H), 1.25-1.65 (m, 43H), 2.25-2.31 (m, 8H), 2.47 (t, 2H), 2.56 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 3.96 (d, 2H), 4.85 (m, 1H). ESI-MS (m / z): 598 (M+1). [Examples]

[0219] Synthesis of compound I-37 [ka]

[0220] Process 64 Compound I-37 (0.276 g, yield 71%) was obtained as a colorless, transparent oil by using compound 44 instead of compound 18 in step 17 and compound 4 instead of compound 17, in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.87 (m, 9H), 1.25-1.62 (m, 50H), 2.27-2.31 (m, 8H), 2.53 (t, 2H), 3.43 (m, 1H), 3.65 (m, 1H), 3.93 (m, 3H), 4.90 (m, 1H). ESI-MS (m / z): 627 (M+1). [Examples]

[0221] Synthesis of compound I-38 [ka]

[0222] Process 65 Compound 29 was used instead of compound 17 in step 17, and compound I-38 (0.219 g, yield 44%) was obtained as a colorless, transparent oil in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.87 (m, 12H), 1.25-1.68 (m, 65H), 1.96 (brs, 4H), 2.26-2.30 (m, 7H), 2.78 (brs, 3H), 3.25 (s, 2H), 4.02 (d, 2H), 4.06 (t, 4H). ESI-MS (m / z): 867 (M+1). [Examples]

[0223] Synthesis of compound I-39 [ka]

[0224] Process 66 Compound I-39 (0.186 g, yield 51%) was obtained as a colorless, transparent oil in the same manner as in step 17, using compound 44 instead of compound 18 and compound 29 instead of compound 17. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.25-1.68 (m, 66H), 2.26-2.30 (m, 10H), 2.52 (t, 2H), 3.45 (m, 1H), 3.66 (m, 1H), 3.96-4.06 (m, 7H). ESI-MS (m / z): 839 (M+1) [Examples]

[0225] Synthesis of compound I-40 [ka]

[0226] Process 67 Compound I-40 (0.373 g, yield 77%) was obtained as a slightly colored transparent oil by using compound 25 instead of compound 18 in step 17 and compound 29 instead of compound 17, in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.25-1.64 (m, 63H), 2.25-2.30 (m, 10H), 2.47 (t, 2H), 2.58 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 3.97 (d, 2H), 4.06 (t, 4H). ESI-MS (m / z): 839 (M+1) [Examples]

[0227] Synthesis of compound I-41 [ka]

[0228] Process 68 Compound I-41 (0.232 g, 64% yield) was obtained as a colorless, transparent oil in the same manner as in step 17, using compound 45 instead of compound 18 and compound 29 instead of compound 17. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.18-1.64 (m, 66H), 2.28 (dd, 1H), 2.25-2.30 (m, 10H), 2.51 (dd, 1H), 3.66 (m, 1H), 4.03 (d, 2H), 4.06 (t, 4H), 4.17 (m, 2H). ESI-MS (m / z): 839 (M+1) [Examples]

[0229] Synthesis of compound I-42 [ka]

[0230] Process 69 Compound 46 (1.69 g, total yield 23%) was obtained by using 7-tridecanol instead of 2-butyl-1-octanol in step 11, in the same manner as in steps 11 and 12. 1 H-NMR(CDCl3)δ: 0.88 (t, 14H), 1.20-1.35 (m, 56H), 1.40-1.65 (m, 21H), 2.27 (t, 4H), 3.53 (t, 2H), 4.87 (m, 2H). ESI-MS (m / z): 696 (M+1).

[0231] Process 70 Compound I-42 (0.046 g, yield 32%) was obtained as a colorless, transparent oil in the same manner as in step 17, using compound 45 instead of compound 18 and compound 46 instead of compound 17. 1 H-NMR(CDCl3)δ:0.86 (t, 12H), 1.18-1.63 (m, 68H), 2.19 (dd, 1H), 2.25-2.29 (m, 10H), 2.49 (dd, 1H), 3.66 (m, 1H), 4.00 (d, 2H), 4.13 (m, 2H), 4.84 (m, 2H). ESI-MS (m / z): 839 (M+1) [Examples]

[0232] Synthesis of compound I-43 [ka]

[0233] Process 71 Compound 16 was used instead of compound 17 in step 17, and compound I-43 (0.084 g, yield 67%) was obtained as a colorless, transparent oil in the same manner as in step 17. 1H-NMR(CDCl3)δ:0.87 (t, 12H), 1.27-1.68 (m, 60H), 1.96-2.05 (br., 4H), 2.26-2.31 (m, 7H), 2.78 (brs, 3H), 3.22 (s, 2H), 3.96 (d, 4H), 4.85 (m, 1H). ESI-MS (m / z): 825 (M+1) [Examples]

[0234] Synthesis of compound I-44 [ka]

[0235] Process 72 Compound 22 was used instead of compound 17 in step 17, and compound I-44 (0.271 g, yield 55%) was obtained as a colorless, transparent oil in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.25-1.68 (m, 72H), 1.96-2.05 (br., 4H), 2.26-2.30 (m, 7H), 2.78 (brs, 3H), 3.23 (s, 2H), 4.06 (t, 4H), 4.85 (m, 1H). ESI-MS (m / z): 909 (M+1) [Examples]

[0236] Synthesis of compound I-45 [ka]

[0237] Process 73 Compound 47 (1.46 g, total yield 81%) was obtained in the same manner as in step 14, using 2-hexyl-1-octanol instead of 2-butyl-1-octanol. 1H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.50 (m, 65H), 1.55-1.70 (m, 8H), 2.30 (t, 4H), 3.57 (brs, 1H), 3.97 (d, 4H).

[0238] Process 74 Compound 47 was used instead of compound 17 in step 17, and compound I-45 (0.518 g, yield 83%) was obtained as a slightly colored transparent oil in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.81 (t, 12H), 1.27-1.64 (m, 68H), 1.96-2.06 (brs, 4H), 2.26-2.31 (m, 7H), 2.79 (brs, 3H), 3.23 (s, 2H), 4.06 (d, 4H), 4.85 (m, 1H). ESI-MS (m / z): 882 (M+1) [Examples]

[0239] Synthesis of compound I-46 [ka]

[0240] Process 75 Compound I-46 (0.488g) was obtained as a colorless, transparent oil by using compound 20 instead of compound 3 in step 3 and compound 4 instead of compound 4, in the same manner as in steps 3 and 4. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.27-1.61 (m, 69H), 2.27-2.31 (m, 10H), 2.52 (t, 2H), 3.45 (m, 1H), 3.67 (m, 1H), 3.96 (m, 5H), 4.91 (m, 1H). ESI-MS (m / z): 854 (M+1) [Examples]

[0241] Synthesis of compound I-47 [ka]

[0242] Process 76 Compound 16 was used instead of compound 21 in step 25, and compound I-47 (80 mg) was obtained as a colorless, transparent oil in the same manner as in steps 25 and 26. 1 H-NMR(CDCl3)δ:0.87 (m, 12H), 1.17 (s, 6H), 1.27-1.60 (m, 58H), 2.25-2.31 (m, 10H), 2.46 (t, 2H), 3.42 (s, 2H), 3.51 (t, 2H), 3.95 (d, 4H), 4.81 (m, 1H). ESI-MS (m / z): 825 (M+1) [Examples]

[0243] Synthesis of compound I-48 [ka]

[0244] Process 77 Compound I-48 (0.172 g, yield 85%) was obtained as a colorless, transparent oil in the same manner as in step 17, using compound 45 instead of compound 18 and compound 21 instead of compound 17. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.18 (d, 3H), 1.25-1.62 (m, 62H), 2.19 (dd, 1H), 2.26-2.29 (m, 10H), 2.50 (dd, 1H), 3.66 (m, 1H), 4.06 (t, 4H), 4.11 (m, 2H), 4.91 (m, 1H). ESI-MS (m / z): 825 (M+1) [Examples]

[0245] Synthesis of compound I-49 [ka]

[0246] Step 78 Synthesis of Compound I-49 Compound I-49 (0.042 g, 60% yield) was obtained as a colorless, transparent oil in the same manner as in step 17, using compound 25 instead of compound 18 and compound 21 instead of compound 17. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.25-1.62(m, 62H), 2.25-2.29 (m, 10H), 2.42 (t, 2H), 2.56 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 4.06 (t, 4H), 4.84 (m, 1H). ESI-MS (m / z): 825 (M+1) [Examples]

[0247] Synthesis of compound I-50 [ka]

[0248] Step 79 Synthesis of Compound I-50 Compound 45 was used instead of compound 18 in step 17, and compound I-50 (0.128 g, yield 88%) was obtained as a colorless, transparent oil in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.86 (t, 12H), 1.18 (d, 3H), 1.26-1.62 (m, 64H), 2.19 (dd, 1H), 2.26-2.29 (m, 10H), 2.49 (dd, 1H), 3.66 (m, 1H), 4.13 (m, 2H), 4.83 (m, 2H), 4.91 (m, 1H). ESI-MS (m / z): 825 (M+1) [Examples]

[0249] Synthesis of compound I-51 [ka]

[0250] Step 80 Synthesis of Compound I-51 Compound I-51 (0.406 g, yield 80%) was obtained as a slightly colored transparent oil by using compound 25 instead of compound 18 in step 17 and compound 36 instead of compound 17, in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.87 (m, 9H), 1.25-1.62 (m, 52H), 2.25-2.30 (m, 8H), 2.47 (t, 2H), 2.58 (t, 2H), 3.53 (t, 2H), 3.71 (t, 2H), 3.98 (d, 2H), 4.06 (t, 2H). ESI-MS (m / z): 668 (M+1). [Examples]

[0251] Synthesis of compound I-52 [ka]

[0252] Step 81 Synthesis of Compound I-52 Compound I-52 (52.5 mg, yield 41%) was obtained by using compound 25 instead of compound 18 in step 17, and compound 4 instead of compound 17, in the same manner as in step 17. 1H-NMR(CDCl3)δ:0.86-0.91 (m, 9H), 1.18-1.35 (m, 42H), 1.45-1.55 (m, 4H), 1.55-1.66 (m, 1H), 2.25 (s, 6H), 2.29 (t, 2H), 2.48 (t, 2H), 2.58 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.97 (d, 2H), 4.88 (m, 1H). ESI-MS (m / z): 627 (M+1). [Examples]

[0253] Synthesis of compound I-53 [ka]

[0254] Step 82 Synthesis of Compound I-53 Compound I-53 (139.8 mg, 52% yield) was obtained by using compound 4 instead of compound 17 in step 17, in the same manner as in step 17. 1 H-NMR(CDCl3)δ:0.84-0.93 (m, 9H), 1.20-1.37 (m, 42H), 1.46-1.56 (m, 4H), 1.56-1.69 (m, 3H), 1.93-2.08 (m, 4H), 2.26 (s, 3H), 2.29 (t, 2H), 2.73-2.84 (m, 3H), 3.23 (s, 2H), 3.97 (d, 2H), 4.89 (m, 1H). ESI-MS (m / z): 655 (M+1). [Examples]

[0255] Synthesis of compound I-54 [ka] Step 83 Synthesis of Compound I-54 Compound I-54 (74.3 mg, total yield 14%) was obtained by using compound 45 instead of compound 18 in step 17 and compound 4 instead of compound 17, in the same manner as in step 17. 1H-NMR(CDCl3)δ:0.83-0.94 (m, 9H), 1.19 (d, 3H), 1.21-1.36 (m, 42H), 1.47-1.56 (m, 4H), 1.56-1.66 (m, 1H), 2.18-2.32 (m, 9H), 2.48-2.55 (m, 1H), 3.65-3.75 (m, 1H), 3.97 (d, 2H), 4.10-4.22 (m, 2H), 4.94 (m, 1H) ESI-MS (m / z): 627 (M+1). [Examples]

[0256] Synthesis of compound I-55 [ka] Process 84 Compound I-55 (188 mg, 76% yield) was obtained as a clear oil in the same manner as in step 17, using compound 21 instead of compound 17 and compound 26 instead of compound 18. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.42 (m, 53H), 1.48-1.75 (m, 32H), 1.92 (m, 2H), 2.10 (m, 2H), 2.28 (m, 7H), 2.70 (brs, 2H), 3.41 (m, 1H), 4.08 (t, 6H), 4.94 (m, 1H). ESI-MS (m / z): 837 (M+1). [Examples]

[0257] Synthesis of compound I-56 [ka] Process 85 Compound I-56 (162 mg, 81% yield) was obtained as a clear oil in the same manner as in step 17, using compound 29 instead of compound 17 and compound 26 instead of compound 18. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.45 (m, 59H), 1.50-1.75 (m, 34H), 1.92 (m, 2H), 2.10 (m, 2H), 2.28 (m, 7H), 2.70 (brs, 2H), 3.42 (m, 1H), 4.08 (m, 8H). ESI-MS (m / z): 851 (M+1). [Examples]

[0258] Synthesis of compound I-80 [ka] Step 86 Synthesis of Compound 48 To a 3.7 mL solution of compound 21 (510 mg, 0.75 mmol) in dichloromethane, methanesulfonyl chloride (0.070 mL, 0.898 mmol) and triethylamine (0.125 mL, 0.898 mmol) were added under ice cooling and the mixture was stirred for 2 hours. Methanesulfonyl chloride (0.023 mL, 0.299 mmol) and triethylamine (0.042 mL, 0.299 mmol) were added to the reaction mixture and the mixture was stirred for a further 15 minutes. Methanol was added to the reaction mixture and stirred at room temperature for 15 minutes, then saturated sodium bicarbonate aqueous solution was added and the mixture was extracted with chloroform. The organic layer was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was removed by vacuum distillation. Sodium azide (97 mg, 1.498 mmol) was added to the DMF solution (3.7 mL) of the obtained residue, and the mixture was stirred at 80°C for 75 minutes. After the reaction mixture was cooled to room temperature, water was added, and the mixture was extracted with ethyl acetate. The organic layer was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was removed by vacuum distillation. To a tetrahydrofuran solution (7.0 mL) of the obtained residue, Pd-C (746 mg, 0.70 mmol) and a 1,4-dioxane hydrochloride solution (0.88 mL, 3.50 mmol) were added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 3 hours. The reaction mixture was filtered through Celite, and the solvent was removed by distillation under reduced pressure. To a tetrahydrofuran solution (7.0 mL) of the obtained residue, Pd-C (746 mg, 0.70 mmol) and a 1,4-dioxane hydrochloride solution (0.88 mL, 3.50 mmol) were added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 2 hours. The reaction mixture was filtered through Celite, and the solvent was removed by distillation under reduced pressure. The obtained residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 48 (185 mg, total yield 37%) as a clear oil. 1 H-NMR(CDCl3)δ:0.87 (t, 12H), 1.18-1.42 (m, 58H), 1.50-1.63 (m, 10H), 2.28 (t, 4H), 2.66 (brs, 1H), 4.08 (t, 4H). ESI-MS (m / z): 681 (M+1).

[0259] Step 87 Synthesis of Compound I-80 To a 1.4 mL NMP solution of compound 48 (92 mg, 0.135 mmol), compound 26 (43 mg, 0.203 mmol), PyBOP (106 mg, 0.203 mmol), and DIEA (0.11 mL, 0.609 mmol) were added, and the mixture was stirred at room temperature for 2.5 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and then removed by vacuum distillation. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target product was removed by vacuum distillation, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-80 (94 mg, yield 83%) as a clear oil. 1H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.20-1.42 (m, 55H), 1.48-1.70 (m, 28H), 1.92 (m, 2H), 2.12 (m, 2H), 2.28 (m, 7H), 2.68 (brs, 2H), 3.37 (m, 1H), 3.94 (m, 3H), 4.08 (t, 4H), 6.28 (d, 1H). ESI-MS (m / z): 836 (M+1). [Examples]

[0260] Synthesis of compound I-65 [ka] Step 88 Synthesis of compound 49 To a 6 mL solution of compound 21 (300 mg, 0.440 mmol) in dichloromethane, N-Boc-4-carboxymethoxypiperidine (171 mg, 0.661 mmol), 2-methyl-6-nitrobenzoic anhydride (455 mg, 1.321 mmol), DIPA (0.49 mL, 2.64 mmol), and DMAP (11 mg, 0.088 mmol) were added, and the mixture was stirred at room temperature for 15 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and then removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 49 (390 mg, yield 96%) as a clear oil. 1 H-NMR(CDCl3)δ: 0.88(t, 14H), 1.20-1.42 (m, 58H), 1.45 (s, 11H), 1.48-1.70 (m, 26H), 1.85 (brs, 2H), 2.26 (t, 4H), 3.07 (m, 2H),3.55 (m, 1H), 3.76 (brs, 2H), 4.11 (m, 6H), 4.95 (m, 1H) ESI-MS (m / z): 923 (M+1).

[0261] Step 89 Synthesis of Compound I-65 Compound 49 (190 mg, 0.206 mmol) was mixed with 1 mL of 4 mol / L hydrochloric acid-1,4-dioxane solution and stirred at room temperature for 4 hours, then removed by distillation under reduced pressure. To the resulting residue, tetrahydrofuran solution (3 mL) was mixed with TBAI (16 mg, 0.044 mmol), triethylamine (0.243 mL, 1.75 mmol), and 2-bromoethanol (0.062 mL, 0.876 mmol) and stirred at room temperature for 72 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture and extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and then removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target product was removed by distillation under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-65 (74 mg, yield 39%) as a clear oil. 1 H-NMR(CDCl3)δ: 0.89 (t, 12H), 1.20-1.42 (m, 52H), 1.48-1.70 (m, 18H), 1.93 (m, 2H), 2.28 (m, 6H), 2.53 (m, 2H), 2.78 (m, 2H) 3.43 (m, 1H), 3.53 (t, 2H), 4.07 (t, 6H), 4.92 (m, 1H). ESI-MS (m / z): 867 (M+1). [Examples]

[0262] Synthesis of compound I-61 [ka] Step 90 Synthesis of Compound 51 To a 10 mL solution of compound 50 (500 mg, 0.901 mmol) in dichloromethane, pentadecane-8-ol (103 mg, 0.451 mmol), 2-methyl-6-nitrobenzoic anhydride (155 mg, 0.451 mmol), DIPA (0.472 mL, 2.70 mmol), and DMAP (22 mg, 0.18 mmol) were added, and the mixture was stirred at room temperature for 20 hours. The organic layer was washed with saturated sodium chloride aqueous solution and then removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target substance was removed under reduced pressure. To a 3 mL solution of the resulting residue in dichloromethane, 3-pentyloctan-1-ol (82 mg, 0.412 mmol), 2-methyl-6-nitrobenzoic anhydride (189 mg, 0.549 mmol), DIPA (0.192 mL, 1.1 mmol), and DMAP (7 mg, 0.055 mmol) were added, and the mixture was stirred at room temperature for 20 hours. The organic layer was washed with saturated sodium chloride aqueous solution and then removed under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target substance (205 mg, 0.216 mmol) was removed under reduced pressure. To a 2 mL solution of the resulting residue in tetrahydrofuran, TBAF in tetrahydrofuran (0.649 mL, 0.649 mmol) was added, and the mixture was stirred at room temperature for 20 hours. Ethyl acetate was added to the reaction mixture, and the mixture was sequentially washed with saturated sodium bicarbonate aqueous solution, 2 mol / L hydrochloric acid aqueous solution, saturated sodium bicarbonate aqueous solution, and saturated sodium chloride aqueous solution. The organic layer was removed by reduced pressure distillation, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 51 (90 mg, yield 59%). 1 H-NMR(CDCl3)δ:0.88 (t, 12H), 1.27-1.64 (m, 73H), 2.28 (t, 4H), 3.57 (brs, 1H), 4.11 (t, 2H), 4.88 (m, 1H). ESI-MS (m / z): 710 (M+1).

[0263] Step 91 Synthesis of Compound I-61 To a 3 mL solution of compound 51 (143 mg, 0.202 mmol) in dichloromethane, compound 26 (64 mg, 0.302 mmol), 2-methyl-6-nitrobenzoic anhydride (208 mg, 0.605 mmol), DIPA (0.211 mL, 1.21 mmol), and DMAP (5 mg, 0.04 mmol) were added, and the mixture was stirred at room temperature for 16 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and then removed by vacuum distillation. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target product was removed by vacuum distillation, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound I-61 (127 mg, yield 73%) as a clear oil. 1 H-NMR(CDCl3)δ: 0.88 (t, 13H), 1.20-1.42 (m, 54H), 1.54-1.70 (m, 21H), 1.92 (m, 2H), 2.11 (m, 2H), 2.26(m, 7H),2.70 (brs, 2H), 3.40 (m, 1H), 4.13 (m, 4H), 4.95 (m, 2H) ESI-MS (m / z): 865 (M+1). [Examples]

[0264] Synthesis of compound I-73 [ka] Step 92 Synthesis of Compound 53 To a 2.6 mL solution of compound 52 (254 mg, 1.04 mmol) in dichloromethane, 4-nitrophenyl chloroformate (250 mg, 1.24 mmol) and triethylamine (0.172 mL, 1.24 mmol) were added under ice cooling, and the mixture was stirred at room temperature for 90 minutes. 4-nitrophenyl chloroformate (250 mg, 1.24 mmol), triethylamine (0.172 mL, 1.24 mmol), and dichloromethane (1.6 mL) were added to the reaction mixture, and the mixture was stirred for another 90 minutes. 4-nitrophenyl chloroformate (125 mg, 0.62 mmol), triethylamine (0.086 mL, 0.62 mmol), and dichloromethane (1.0 mL) were added to the reaction mixture, and the mixture was stirred for another 90 minutes. Water was added to the reaction mixture, and it was extracted with chloroform. The organic layer was washed with saturated sodium bicarbonate aqueous solution and removed by distillation under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 53 (386 mg, yield 91%) as a clear oil. 1 H-NMR(CDCl3)δ: 1.46 (s, 9H), 1.54-1.57 (m, 8H), 1.85 (brs, 2H), 3.12 (m, 2H), 3.54 (m, 1H), 3.77 (t, 4H), 4.43 (t, 2H), 7.39 (dd, 2H), 8.28 (dd, 2H). ESI-MS (m / z): 411 (M+1).

[0265] Step 93 Synthesis of Compound 54 Compound 53 (147 mg, 0.358 mmol), DIEA (0.063 mL, 0.358 mmol), and DMAP (44 mg, 0.358 mmol) were added to a 1.8 mL dichloromethane solution of Compound 21 (61 mg, 0.089 mmol), and the mixture was heated under reflux for 13 hours. After the reaction mixture was cooled to room temperature, water was added and the mixture was washed. The organic layer was removed by distillation under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain Compound 54 (76 mg, yield 89%) as a clear oil. 1H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.25-1.45 (m, 63H), 1.51-1.60 (m, 47H), 1.80 (brs, 2H), 2.28 (t, 4H), 3.07 (m, 2H), 3.49 (m, 1H), 3.69 (t, 2H), 3.73 (brs, 2H), 4.08 (t, 4H), 4.26 (t, 2H), 4.67 (m, 1H). ESI-MS (m / z): 953 (M+1).

[0266] Step 94 Synthesis of Compound I-73 Compound 54 was used instead of compound 5 in step 4, and compound I-73 (57 mg, total yield 82%) was obtained as a clear oil in the same manner as in step 4. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.22-1.42 (m, 52H), 1.54-1.68 (m, 32H), 1.88 (d, 2H), 2.10 (t, 2H), 2.28 (m, 7H), 2.68 (brs, 2H), 3.34 (m, 1H), 3.67 (t, 2H), 4.08 (t, 4H), 4.26 (t, 2H), 4.67 (m, 1H). ESI-MS (m / z): 867 (M+1). [Examples]

[0267] Synthesis of Compound II-8 [ka] Step 95 Synthesis of Compound 56 To a toluene solution (5.0 mL) of methyl L-glycerate (300 mg, 2.50 mmol), 1-carbobenzoxy-4-piperidone (0.50 mL, 2.50 mmol) and p-toluenesulfonic acid monohydrate (47.5 mg, 0.25 mmol) were added, and the mixture was heated under reflux for 12 hours using a Dean-Stark apparatus. After the reaction mixture was cooled to room temperature, saturated sodium bicarbonate aqueous solution was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and removed by vacuum distillation. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate), and the solvent of the fraction containing compound 55 was removed by vacuum distillation. To a tetrahydrofuran-methanol-water mixture (8.4 mL, 1:2:1) of compound 55, lithium hydroxide monohydrate (352 mg, 8.39 mmol) was added and the mixture was stirred at room temperature for 17 hours. After removing the organic solvent by distillation under reduced pressure, water was added and the mixture was washed with chloroform. Saturated citric acid aqueous solution was added to the aqueous layer to adjust the pH to 3, and the mixture was extracted with chloroform. The organic layer was washed with saturated sodium chloride aqueous solution, dried over anhydrous magnesium sulfate, and filtered. The solvent was removed by distillation under reduced pressure to obtain compound 56 (359 mg, total yield 45%). 1 H-NMR(CDCl3)δ: 1.72-1.86 (brs, 4H), 3.55 (m, 2H), 3.72 (m, 2H), 4.22 (t, 1H), 4.30 (t, 1H), 4.66 (q, 1H), 5.14 (s, 2H), 7.31-7.39 (m, 5H). ESI-MS (m / z): 322 (M+1).

[0268] Step 96 Synthesis of Compound 57 Compound 57 (280 mg, 99% yield) was obtained as a clear oil in the same manner as in step 3, using compound 21 instead of compound 4 and compound 56 instead of compound 3. 1H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.25-1.40 (m, 52H), 1.53-1.71 (m, 30H), 2.28 (t, 4H), 3.63 (m, 4H), 4.09 (m, 5H), 4.25 (t, 1H), 4.59 (t, 1H), 4.92 (m, 1H), 5.13 (s, 2H), 7.31-7.36 (m, 5H). ESI-MS (m / z): 985 (M+1).

[0269] Step 97 Synthesis of Compound II-8 To a 2.8 mL ethyl acetate solution of compound 57 (280 mg, 0.28 mmol), Pd-C (15.1 mg, 0.014 mmol) was added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 5 hours. The reaction mixture was filtered through Celite, and the solvent was removed by distillation under reduced pressure. Subsequently, to a 5.5 mL solution of the resulting residue in dichloromethane, 36% formaldehyde solution (0.076 mL, 0.99 mmol) and sodium borohydride cyanohydride (53 mg, 0.85 mmol) were added, and the mixture was stirred at room temperature for 4 hours. 36% formaldehyde solution (0.076 mL, 0.99 mmol) and sodium borohydride cyanohydride (53 mg, 0.85 mmol) were added to the reaction mixture, and the mixture was stirred at room temperature for 39 hours. Saturated sodium bicarbonate aqueous solution was added to the reaction mixture, and it was extracted with chloroform. The organic layer was removed by vacuum distillation, and the resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target compound was removed by vacuum distillation, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to obtain compound II-8 (110 mg, total yield 45%) as a clear oil. 1 H-NMR(CDCl3)δ: 0.88 (t, 12H), 1.25-1.42 (m, 52H), 1.54-1.59 (m, 39H), 1.83 (m,2H), 1.96 (m, 1H), 2.28 (m, 7H), 2.53 (brs, 4H), 4.09 (m, 5H), 4.24 (t, 1H), 4.58 (dd, 1H), 4.92 (t, 1H). ESI-MS (m / z): 865 (M+1).

[0270] Compounds other than those listed above can also be synthesized in the same manner as described above.

[0271] [ka]

[0272] [ka]

[0273] [ka]

[0274] [ka]

[0275] The following compounds were synthesized according to the general synthesis methods and the methods described in the examples above. Their structures and properties (LC / MS data, NMR spectra) are shown in the table below. In the structural formula, the "wedge shape" and "dashed line" indicate the stereochemistry. In particular, for compounds where the stereochemistry is described, compounds with "a" in the "stereochemistry" column are racemic compounds whose relative stereochemistry has been determined. Compounds with "c" in the "stereochemistry" column indicate that the stereochemistry has been determined as shown in the chemical structure. Furthermore, in compounds where the bond forming the chiral carbon is indicated by a solid line, compounds with "d" in the "stereotype" section are racemic compounds.

[0276] [Table 1]

[0277] [Table 2]

[0278] [Table 3]

[0279] [Table 4]

[0280] [Table 5]

[0281] [Table 6]

[0282] [Table 7]

[0283] [Table 8]

[0284] [Table 9]

[0285] [Table 10]

[0286] ALN-319 and YS-119, used in comparative examples, were synthesized by the methods described in Patent Documents 4 and 5, respectively. ALN-319 represents the following compound: [ka] YS-119 represents the following compound: [ka]

[0287] Preparation Example 1: Preparation of siRNA1-encapsulated LNPs

[0288] As a lipid solution with a total lipid concentration of 40 mmol / L, the cationic lipids of the present invention or comparative examples, DSPC (Nippon Seika Co., Ltd.), cholesterol (Nippon Seika Co., Ltd.), and DMG-PEG 2000 (NOF Corporation) were dissolved in ethanol in a molar ratio of 60 / 8.5 / 30 / 1.5. As a nucleic acid solution with a concentration of 0.033 mmol / L, siRNA1 was dissolved in 50 mmol / L acetate-sodium acetate buffer (pH 4.0, Fujifilm Wako Pure Chemical Industries, Ltd.). The lipid solution and the nucleic acid solution were mixed at flow rates of 3 mL / min and 9 mL / min, respectively, to obtain a nucleic acid-lipid mixed solution. The obtained solution was replaced with phosphate-buffered saline (pH 7.4, Thermo Fisher Scientific) using a dialysis membrane (REPLIGEN, 50 kDa MWCO or Thermo Fisher Scientific, 10 kDa MWCO) to obtain siRNA1-encapsulated LNPs. The encapsulated nucleic acid is siRNA1 targeting HPRT1, having the sequences indicated by (SEQ ID NO: 1) and (SEQ ID NO: 2). Sense chain: G(F)^A(M)^U(F)^G(M)^A(F)^U(M)C(F)U(F)C(F)U(M)C(F)A(M)A(M)C(M)^U(F)^U(M)^U(F)^A(M)^A(F)(Sequence number: 1); Antisense chain: PO-U(M)^U(F)^A(M)A(F)A(M)G(F)U(F)U(F)G(M)A(F)G(M)A(M)G(M)A(F)U(M)C(F)A(M)U(F)C(M)^T(D)^T(D)(Sequence number: 2) In the notation, (F) represents 2'-F modified nucleic acid, (M) represents 2'-OMe modified nucleic acid, (D) represents DNA, ^ represents a phosphorothioate bond, and PO represents 5' terminal phosphate modification. These are used commonly throughout this specification.

[0289] Preparation Example 2: Preparation of siRNA2-encapsulated LNPs In the same manner as in Preparation Example 1, siRNA2-encapsulated LNPs were obtained using the cationic lipid and siRNA2 of the present invention or comparative example. The encapsulated nucleic acid is an siRNA2 targeting SOD1, having the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4. Sense chain: G(F)^G(M)^G(F)^C(M)^A(F)^A(M)A(F)G(F)G(F)U(M)G(F)G(M)A(M)A(M)^A(F)^U(M)^G(F)^A(M)^A(F)(Sequence number: 3); Antisense chain: PO-U(M)^U(F)^C(M)A(F)U(M)U(F)U(F)C(F)C(M)A(F)C(M)C(M)U(M)U(F)U(M)G(F)C(M)C(F)C(M)^T(D)^T(D) ( Sequence ID: 4)

[0290] Preparation Example 3: Preparation of mRNA1-encapsulated LNPs As a lipid solution with a total lipid concentration of 10 mmol / L, the cationic lipids of the present invention or comparative examples, DSPC, cholesterol, and DMG-PEG 2000 were dissolved in ethanol in a molar ratio of 60 / 8.5 / 30 / 1.5. As a nucleic acid solution with a concentration of 100 mg / L, mRNA1 was dissolved in 50 mmol / L acetate-sodium acetate buffer (pH 4.0). The lipid solution and the nucleic acid solution were mixed at flow rates of 3 mL / min and 9 mL / min, respectively, to obtain a nucleic acid-lipid mixed solution. The external solution obtained was replaced with phosphate-buffered saline (pH 7.4) using a dialysis membrane to obtain mRNA1-encapsulated LNPs. The encapsulated nucleic acid used was OVA-targeted mRNA1 (TriLink, L-7210).

[0291] Test Example 1: Evaluation of particle size and encapsulation rate of nucleic acid-encapsulated LNPs The particle size and encapsulation rate of nucleic acid-encapsulated LNPs prepared in Preparation Examples 1-3 were evaluated. The average particle size of nucleic acid-encapsulated LNPs was measured using Zetasizer Nano ZS (Malvern). The inclusion rate of nucleic acid-encapsulated LNPs is Quant-iT TM Ribo Green TM Measurements were performed using the RNA Assay Kit (Thermo Fisher Scientific). The total nucleic acid concentration was measured from the composition after disintegration in the presence of 2% Triton X-100, and the unencapsulated nucleic acid concentration was measured from the composition without disintegration in the absence of 2% Triton X-100. The encapsulation rate was calculated using the following formula. Inclusion rate (%) = 100 - (Concentration of unencapsulated nucleic acids / Total nucleic acid concentration) × 100 Table 11 shows the average particle size (nm) and encapsulation rate (%) of siRNA1-encapsulated LNPs. The leftmost column in Table 11 indicates the cationic lipid used.

[0292] [Table 11]

[0293] As shown in Table 11, the siRNA1-encapsulated LNPs prepared using the present invention exhibited similar particle sizes to the comparative examples YS-119 and ALN-319. Furthermore, it was revealed that the siRNA1-encapsulated LNPs prepared using the present invention formed complexes with a higher nucleic acid encapsulation rate compared to the comparative examples.

[0294] Tables 12 and 13 show the average particle size (nm) and encapsulation rate (%) of siRNA2-encapsulated LNPs. The leftmost column in Tables 12 and 13 indicates the cationic lipid used.

[0295] [Table 12]

[0296] [Table 13]

[0297] As shown in Tables 12 and 13, the siRNA2-encapsulated LNPs prepared using the present invention exhibited a particle size similar to that of the comparative example YS-119. Furthermore, it was revealed that the siRNA2-encapsulated LNPs prepared using the present invention formed complexes with a higher nucleic acid encapsulation rate compared to the comparative example.

[0298] Table 14 shows the average particle size and encapsulation rate (%) of mRNA1-encapsulated LNPs. The leftmost column in Table 14 indicates the cationic lipid used.

[0299] [Table 14]

[0300] As shown in Table 14, mRNA1-encapsulated LNPs prepared using the present invention exhibited an average particle size similar to that of the comparative example ALN-319. Furthermore, it was revealed that mRNA1-encapsulated LNPs prepared using the present invention formed complexes with a higher nucleic acid encapsulation rate compared to the comparative example.

[0301] As shown in Tables 11-14, it was revealed that nucleic acid-encapsulated LNPs prepared using the present invention form complexes with a higher nucleic acid encapsulation rate compared to the comparative examples.

[0302] Test Example 2: Evaluation of Storage Stability of Compositions The siRNA1-encapsulated LNPs and siRNA2-encapsulated LNPs prepared in Preparation Examples 1 and 2 were stored in sealed vials at room temperature, and the encapsulation rate before storage and after 4 weeks was measured in the same manner as in Test Example 1. The change in encapsulation rate was calculated using the following formula. Change in inclusion rate Δ(%) = Inclusion rate (after 4 weeks) - Inclusion rate (before storage)

[0303] Table 15 shows the change in encapsulation rate Δ(%) of siRNA1-encapsulated LNPs. The leftmost column in Table 15 indicates the cationic lipid used.

[0304] [Table 15]

[0305] As shown in Table 15, the siRNA1-encapsulated LNPs prepared using the present invention showed less change in encapsulation rate during storage and exhibited higher storage stability compared to the comparative example ALN-319.

[0306] Table 16 shows the change in encapsulation rate Δ(%) of siRNA2-encapsulated LNPs. The leftmost column in Table 16 indicates the cationic lipid used.

[0307] [Table 16]

[0308] As shown in Table 16, the siRNA2-encapsulated LNPs prepared using the present invention showed less change in encapsulation rate during storage and demonstrated high storage stability compared to the comparative example YS-119.

[0309] As shown in Tables 15 and 16, nucleic acid-encapsulated LNPs prepared using the present invention showed less change in encapsulation rate during storage and exhibited higher storage stability compared to the comparative example.

[0310] Test Example 3: Evaluation of the SOD1 gene expression repression activity of compositions using siRNA2. Human cervical cancer-derived cell line HeLa was prepared as a cell suspension to 80,000 cells / mL in DMEM containing 10% fetal bovine serum (FBS) and 500 units / mL penicillin streptomycin. 0.10 mL of this suspension was seeded into 96-well flat-bottom plates (CORNING) and cultured for 1 day at 37°C, 95-98% humidity, and 5% CO2. siRNA2-encapsulated LNPs prepared in Preparation Example 2 were added to the culture medium to achieve a final siRNA2 concentration of 3 nM, and the culture was continued. PBS was added to the culture medium as a control medium. 24 hours after adding nucleic acid-encapsulated LNPs, RNA extraction and cDNA synthesis were performed from the cells using the SuperPrep Cell Lysis&RT Kit for qPCR (Toyobo Co., Ltd.), and real-time PCR was performed using Fast SYBR Green Master Mix (ThermoFisher Scientific). GAPDH was used as an endogenous control. The experiment was performed with N=3 for each preparation. The primer sequences used to measure the expression level of human SOD1 were: Fw primer: AGTGCAGGGCATCATCAATTTC (Sequence ID: 5); The Rv primer is CCATGCAGGCCTTCAGTCAG (SEQ ID NO: 6), The primer sequences used to measure the expression level of human GAPDH were: Fw primer: GCACCGTCAAGGCTGAGAAC (Sequence ID: 7); The Rv primer is TGGTGAAGACGCCAGTGGA (Sequence ID: 8). The change in SOD1 expression was calculated by subtracting the difference (ΔCt) between the SOD1 expression level (Ct value) and the GAPDH expression level (Ct value) in cells treated with each composition (ΔΔCt), and then calculating the relative expression level (RQ) relative to the media control using the following formula. RQ(%)=2 -ΔΔCt ×100 Tables 17 and 18 show the relative expression levels (SOD1-RQ) of the SOD1 gene when each siRNA2-encapsulated LNP is added. The leftmost column in Tables 17 and 18 indicates the cationic lipid used.

[0311] [Table 17]

[0312] [Table 18]

[0313] As shown in Tables 17 and 18, the siRNA2-encapsulated LNPs prepared using the present invention demonstrated a higher suppression effect on SOD1 gene expression compared to the comparative example YS-119. Furthermore, it was revealed that the encapsulated siRNA2 could be efficiently transported into the cytoplasm.

[0314] Test Example 4: Evaluation of the HPRT1 gene expression repression activity of compositions using siRNA1. A cell suspension of the human cervical cancer-derived cell line HeLa was prepared in DMEM containing 10% fetal bovine serum (FBS) and 500 units / mL penicillin streptomycin to a concentration of 80,000 cells / mL. 0.10 mL of the suspension was seeded into 96-well flat-bottom plates and cultured for 1 day at 37°C, 95-98% humidity, and 5% CO2. siRNA1-encapsulated nanoparticles prepared in Preparation Example 1 were added to the culture medium to achieve a final siRNA1 concentration of 1 nM, and the culture was continued. PBS was added to the culture medium as a control medium. 24 hours after adding the composition, RNA extraction and cDNA synthesis were performed from cells using the SuperPrep Cell Lysis&RT Kit for qPCR, and real-time PCR was performed using Fast SYBR Green Master Mix. GAPDH was used as an endogenous control. The experiment was performed with N=3 for each preparation. The primer sequences used to measure the expression level of human HPRT1 were: Fw primer: GGCAGTATAATCCAAAGATGGTCAA (Sequence ID: 9); The Rv primer is GTCAAGGGCATATCCTACAACAAAC (SEQ ID NO: 10), The primer sequences used to measure the expression level of human GAPDH are the sequences described in Sequence ID No. 7 and Sequence ID No. 8. The change in HPRT1 expression was calculated by subtracting the difference (ΔCt) between the HPRT1 expression level (Ct value) and the GAPDH expression level (Ct value) in cells treated with each siRNA1-encapsulated LNP from the ΔCt of HPRT1 in the control cells (ΔΔCt), and then calculating the relative expression level (RQ) relative to the control using the following formula. RQ(%)=2 -ΔΔCt ×100 Table 19 shows the relative expression levels (HPRT1-RQ) of the HPRT1 gene when each siRNA1-encapsulated LNP is added. The leftmost column in Table 19 indicates the cationic lipid used.

[0315] [Table 19]

[0316] As shown in Table 19, the siRNA1-encapsulated LNPs prepared using the present invention demonstrated a higher suppressive effect on HPRT1 gene expression compared to the comparative example YS-119. Furthermore, it was revealed that the encapsulated siRNA1 could be efficiently transported into the cytoplasm.

[0317] As shown in Tables 17-19, it was revealed that nucleic acid-encapsulated LNPs prepared using the present invention can efficiently transport the encapsulated nucleic acids into the cytoplasm.

[0318] Test Example 5: Evaluation of OVA protein expression activity of compositions using mRNA1 Human cervical cancer-derived cell line HeLa was used to prepare cell suspensions at a concentration of 10,000 cells / well in DMEM containing 10% fetal bovine serum (FBS), 100 units / mL penicillin, and 0.10 mg / mL streptomycin. 90 μL of each suspension was seeded into 96-well flat-bottom plates (Greiner) and cultured for 1 day at 37°C, 95-98% humidity, and 5% CO2. Nucleic acid-encapsulated LNPs prepared in Preparation Example 3 were added to the culture medium at concentrations of 25 ng / well and 200 ng / well, respectively, and culture was continued. For the medium control (control 1), DMEM was added to the culture medium. For the comparative control (control 2), only mRNA1 was added to the culture medium at concentrations of 25 ng / well or 200 ng / well. The test was performed three times for each nucleic acid-encapsulated LNP and nucleic acid addition amount, and the average value was calculated. Cell culture supernatant was collected 24 hours after the addition of nucleic acid-encapsulated LNPs. OVA proteins secreted into the culture supernatant were quantified using the OVA ELISA kit (ITEA). The table shows the OVA protein concentration in the culture supernatant when each nucleic acid-encapsulated LNP was added. 20 As shown below. The leftmost column in Table 20 indicates the type of control or the cationic lipid used, and ND indicates not detected.

[0319] [Table 20]

[0320] As shown in Table 20, mRNA1-encapsulated LNPs prepared using the present invention were shown to promote OVA protein expression compared to the comparative examples YS-119 and ALN-319. In other words, it was revealed that nucleic acid-encapsulated LNPs prepared using the present invention can efficiently transport the encapsulated nucleic acid into the cytoplasm. [Industrial applicability]

[0321] As is clear from the above, the lipid particles containing the novel cationic lipid of the present invention can efficiently encapsulate nucleic acids and maintain a high encapsulation rate even after storage for a certain period. Furthermore, the lipid particles containing the cationic lipid of the present invention exhibit high knockdown activity and protein expression promoting effects in vitro. From the above points, the cationic lipid of the present invention can be used as a pharmaceutical composition for nucleic acid delivery into cells.

Claims

1. Equation (I): 【Chemistry 1】 (In the formula, R １ is a C １ -C １０ alkyl group-substituted or unsubstituted formula: -(CH ２ ) ａ -L １ -(CH ２ ) ｂ -CH ３ ; R ２ C １ -C １０ C substituted with alkyl groups or unsubstituted ５ -C ２０ Alkyl alkyl group or C １ -C １０ Formulas substituted or unsubstituted with alkyl groups: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ And; L １ and L ２ These are, independently, -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a and b are independent integers greater than or equal to 1, and the sum of a and b is an integer between 5 and 25; c and d are independently integers greater than or equal to 1, and the sum of c and d is an integer between 5 and 25; R ３ and R ４ Each of these is independently a hydrogen atom or an unsubstituted C １ -C ６ It is an alkyl group; Or, R ３ and R ４ Together, they form a non-substitutive C ３ -C ５ Non-aromatic carbon rings may also be formed; R ５ is a hydrogen atom or an unsubstituted C １ -C ６ It is an alkyl group; R ６ and R ７ Each of these is independently a hydrogen atom, a carbon atom substituted with or unsubstituted with one hydroxyl group. １ -C ６ Alkyl alkyl groups, unsubstituted C ２ -C ６ Alkenyl group, unsubstituted C ２ -C ６ Alkynyl group or unsubstituted C ３ -C ７ It is a non-aromatic carbocyclic group; Alternatively, R3 and R7 may, together with the atom to which they are bonded, form an unsubstituted, non-aromatic heterocycle; R5 and R6, together with the atoms to which they are bonded, may form a non-aromatic heterocycle substituted with or unsubstituted with 1 to 4 halogen atoms or C1-C6 alkyl groups; R6 and R7 may, together with the atom to which they are bonded, form an unsubstituted, non-aromatic heterocycle; R ８ And R9 are each independently hydrogen atoms; Alternatively, R 3 and R ８ These atoms may, together with the atoms to which they bond, form an unsubstituted, non-aromatic heterocycle (where R9 is a hydrogen atom); If k is 1 or 2, R ８ and R ９ These may, together with the atoms to which they bond, form an unsubstituted non-aromatic carbocyclic ring or an unsubstituted non-aromatic heterocyclic ring; R ７ and R ８ R ５ and R ６ When they form a ring, they may, together with the atoms they bond to, form an unsubstituted, non-aromatic heterocycle (where R9 is a hydrogen atom); R10 is a hydrogen atom; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(=O)-, -N(R)S(=O) ２ -, -OS(=O) ２ -, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O) ２ -O-, -S(=O) ２ -N(R)-, -OP(=O)(-NR)O-, -C(=S)O- or -OC(=S)-; X is either O or S; p, q, s, and k are each independent integers between 0 and 2; r is an integer between 0 and 5; R is independently either a hydrogen atom or an unsubstituted carbon atom. １ -C ６ It is an alkyl group. A compound represented by or a pharmaceutically acceptable salt thereof.

2. L １ The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is -C(=O)O- or -OC(=O)-.

3. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein a and b are each independently integers between 5 and 10.

4. R ２ However, C １ -C １０ Formulas substituted or unsubstituted with alkyl groups: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ The compound according to any one of claims 1 to 3 or a pharmaceutically acceptable salt thereof.

5. L ２ The compound according to claim 4 or a pharmaceutically acceptable salt thereof, wherein the compound is -C(=O)O- or -OC(=O)-.

6. The compound according to claim 4 or 5, or a pharmaceutically acceptable salt thereof, wherein c and d are each independently integers between 5 and 10.

7. R ２ However, C １ -C １０ C substituted with alkyl groups or unsubstituted ５ -C ２０ A compound according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, which is an alkyl group.

8. Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)O-, or -N(R)C(=O)-, Each R is independently either a hydrogen atom or an unsubstituted C １ A compound according to any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, which is an alkyl group.

9. A compound according to any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, wherein Z is -OC(=O)-, -C(=O)O-, or -OC(=O)O-.

10. R ５ and R ６ The compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, wherein they, together with the atoms to which they are bonded, form an unsubstituted, non-aromatic heterocycle.

11. R ６ and R ７ The compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, wherein they, together with the atoms to which they are bonded, form an unsubstituted, non-aromatic heterocycle.

12. R ５ and R ６ However, together with the atoms to which they bond, they form an unsubstituted, non-aromatic heterocycle, and at the same time, R ７ and R ８ The compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, wherein they, together with the atoms to which they are bonded, form an unsubstituted, non-aromatic heterocycle.

13. The following compounds I-6, I-8, I-12, I-37, I-39, I-55, I-56, I-58, I-60, I-62, I-65, I-66, I-69, I-72, II-1, II-6 and II-7: 【Chemistry 2】 【Transformation 3】 【Chemistry 4】 A compound or a pharmaceutically acceptable salt thereof, selected from the group consisting of the following.

14. Lipid particles comprising the compound described in any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof.

15. A pharmaceutical composition comprising a compound according to any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof and a nucleic acid.

16. The pharmaceutical composition according to claim 15, wherein the nucleic acid is siRNA or mRNA.

Images