TRANSLATION CONTROL SYSTEM FOR mRNA

Abstract

Provided is a translation control system that can realize autonomous translation regulation of an mRNA drug according to the change in a medical condition.　The translation control system for mRNA comprises the following (a), (b), and (c): (a) mRNA expressing a first fusion protein comprising a ligand recognition domain of a G protein-coupled receptor, an adapter protein-binding domain that binds to an adapter protein in response to the ligand, and a sequence-specific protease; (b) mRNA that expresses a second fusion protein comprising an adapter protein, a target sequence of the sequence-specific protease, a decomposition-promoting domain, and a translation control factor; and (c) an off-switch or on-switch mRNA that has a binding site for the translation control factor at 5'-UTR and encodes a target protein, or a DNA encoding the same. Also provided is a method for controlling the translation of intracellular mRNA in response to a ligand, the method comprising a step for introducing the system into a cell.

Description

mRNA translation control system

[0001] The present invention relates to mRNA translational control systems and methods for regulating mRNA translation in cells in response to ligands.

[0002] The tissues and organs of multicellular organisms are composed of many different types of cells. Proteins with various functions function within these organisms to maintain the proper functioning of cells and the organisms that contain them. However, in disease states, necessary proteins may be absent or insufficient. Furthermore, there are cases where it is necessary to introduce proteins into the body for the purpose of disease prevention.

[0003] Through the development and practical application of COVID-19 vaccines, attention has been drawn to messenger RNA (mRNA) medicines, a new drug discovery modality. mRNA medicines are useful because they can express a variety of therapeutic and preventive proteins, eliminate the risk of mutations caused by integration into the cell's original genomic DNA, and can express target proteins relatively uniformly in many cells because they do not require entry into the nucleus. However, once administered, mRNA vaccines continue to produce proteins for several days, during which the amount of translation cannot be adjusted.

[0004] The present inventors have developed an artificial translational regulator, the caliciviral VPg-based translational activator (CaVT), to control mRNA translation (see, for example, Patent Document 1 and Non-Patent Document 1). CaVT is composed of an RNA-binding domain that specifically binds to a specific RNA motif and a calicivirus-derived VPg protein. This VPg protein functions similarly to the cap protein, which plays an important role in the translation of eukaryotic mRNAs. By binding this VPg protein to target mRNAs via the RNA-binding domain, translation can be activated even for cap-less mRNAs. On the other hand, CaVT binds tightly to target mRNAs that naturally contain a cap protein and an RNA motif that strongly binds to the CaVT RNA-binding domain, inhibiting mRNA reading and thereby suppressing translation. Thus, CaVT is highly useful in that it can be used to activate or repress translation depending on the purpose, by modifying the target mRNA design.

[0005] By combining CaVT with proteins or intracellular antibodies that respond to specific compounds, we have achieved artificial translational control using compounds or light (e.g., Patent Document 1, Non-Patent Documents 1, 2, and 3), as well as autonomous translational control in response to specific proteins expressed in cells (e.g., Patent Document 2, Non-Patent Document 4).

[0006] Patent Publication No. 2021-122189 International Publication No. WO2023 / 027170

[0007] Nat. Commun., 11, 1297 (2020)STAR Protoc., 3, 101451 (2022)Cell Chem. Biol., 28, 662-674.e5 (2021)ACS Synth. Biol. 11, 1077-1085 (2022)

[0008] However, previous systems have not been able to detect ligands such as cytokines and hormones, which often fluctuate with changes in the condition of a disease, and regulate translation accordingly. A translation control system that can autonomously regulate the translation of mRNA drugs in response to changes in the condition is needed.

[0009] As a result of extensive research, the present inventors have come up with the idea of ​​controlling the translation of a switch mRNA having a translation control factor binding site in response to the presence of a ligand by using a fusion protein containing a translation control factor in combination with another fusion protein that can act on the fusion protein only in the presence of a ligand outside the cell, and have thus completed the present invention.

[0010] The present invention includes the following. [1] An mRNA translational control system comprising: (a) an mRNA that expresses a first fusion protein comprising a ligand-recognition domain of a G protein-coupled receptor, an adaptor protein-binding domain that binds to an adaptor protein in response to the ligand, and a sequence-specific protease, (b) an mRNA that expresses a second fusion protein comprising an adaptor protein, a target sequence for the sequence-specific protease, a degradation-promoting domain, and a translational control factor, and (c) an off-switch or on-switch mRNA that encodes a protein of interest and has a binding site for the translational control factor in its 5'-UTR, or DNA encoding either of them. [2] The system described in [1], wherein the mRNA of (a) is a first mRNA comprising a nucleic acid sequence encoding the first fusion protein, and the mRNA of (b) is a second mRNA comprising a nucleic acid sequence encoding the second fusion protein. [3] The translational control factor is a caliciviral VPg-based translational activator (CaVT) or a mutant thereof, and (c) is an off-switch mRNA, the off-switch mRNA having a Cap structure or a Cap analog at the 5' end, the translational control factor binding portion includes two or more binding motifs that specifically recognize MS2CP, at least two of the two or more binding motifs are linked via an RNA scaffold structure, and the binding motif for MS2CP is represented by the following formula (I): (In the formula, N １ ~N １５ each independently represents A, C, G, or U; R represents G or A; Y represents U or C; N １ and N １５ That is, N ２ and N １４ That is, N ３ and N １３ That is, N ４ and N １２ That is, N ５ and N １１ That is, N ６ and N １０ and N ７ and N ９and (c) form a base pair or a wobble base pair, respectively. [3] The system according to [1], wherein the translational regulatory factor is a caliciviral VPg-based translational activator (CaVT) or a mutant thereof, and (c) is an on-switch mRNA, the on-switch mRNA does not have a 7-methylguanosine 5'-phosphate structure, the translational regulatory factor binding portion contains one or more binding motifs that specifically recognize MS2CP, and the binding motif for MS2CP is represented by the following formula (I): (In the formula, N １ ~N １５ each independently represents A, C, G, or U; R represents G or A; Y represents U or C; N １ and N １５ That is, N ２ and N １４ That is, N ３ and N １３ That is, N ４ and N １２ That is, N ５ and N １１ That is, N ６ and N １０ and N ７ and N ９ and form a base pair or a wobble base pair, respectively. The system according to [1], having a potential secondary structure represented by the following formula: (A) (B) (C) (D) (E) (F) (G) (H) (I ...

[0011] According to the present invention, the translational repression state of the target protein can be released and the target protein can be expressed only in the presence of a ligand for the G protein-coupled receptor. On the other hand, in the absence of the ligand, the translational repression state of the target protein can be maintained and the expression of the target protein can be suppressed. This enables autonomous translational control of the mRNA encoding the target protein in response to the ligand in the body, which can contribute to further improving the functionality of mRNA medicines.

[0012] FIG. 1 is a schematic diagram showing the first fusion protein, the second fusion protein, and the off-switch mRNA in the absence of a ligand. The diagram shows a state in which the translational control factor in the second fusion protein tightly binds to the off-switch mRNA, suppressing translation of the off-switch mRNA. FIG. 2 is a schematic diagram showing the first fusion protein, the second fusion protein, and the off-switch mRNA in the presence of a ligand. The diagram shows a state in which, upon ligand-specific binding of the first and second fusion proteins, the degradation-promoting domain is activated, degrading the translational control factor, thereby releasing translational repression of the off-switch mRNA and allowing translation of the target protein. FIG. 3 is a schematic diagram showing the structure of the translational control factor corresponding to the second fusion protein used in the Examples or the Comparative Examples. (a) Schematic representation of a "linkerless" second fusion protein lacking a linker between the degradation-promoting domain and the translational control factor; (b) "linkered" second fusion protein containing a linker between the degradation-promoting domain and the translational control factor; and (c) "normal" protein consisting of a translational control factor. Figure 4 is a graph comparing the translational amounts of luciferase-encoding off-switch mRNA after inducing activation of the degradation-promoting domains of the proteins shown in Figures 3(a), (b), and (c) using a sequence-specific protease alone that is not fused to a G protein-coupled receptor. Figure 5 is a graph comparing the translational amounts of mRNA after changing the structure of the sequence-specific protease in an example in which a first mRNA encoding a first fusion protein containing the ligand recognition domain of the arginine vasopressin (AVP) receptor, a second mRNA encoding the second fusion protein shown in Figure 3(b), and an off-switch mRNA encoding luciferase were introduced into cells. FIG. 6 is a graph showing the ligand concentration-dependent translation amount of luciferase-encoding off-switch mRNA when the first fusion protein is the AVP receptor-TEV protease (C-terminal deletion-T30A) fusion protein of FIG. 5 and the second fusion protein is that of FIG. 3(b).Figure 7 is a graph showing the ligand concentration dependence of translational derepression in an example where an off-switch mRNA encoding luciferase was introduced into cells when the first fusion protein was the AVP receptor-TEV protease (C-terminal deletion-T30A) fusion protein of Figure 5 and the second fusion protein was that of Figure 3(b). Figure 8 is a graph showing the ligand concentration dependence of translational deactivation in an example where an on-switch mRNA encoding luciferase was introduced into cells when the first fusion protein was the AVP receptor-TEV protease (C-terminal deletion-T30A) fusion protein of Figure 5 and the second fusion protein was that of Figure 3(b). Figure 9 is a graph showing the translation amount of luciferase-encoding off-switch mRNA in the presence or absence of a ligand (PGE2) when the ligand is prostaglandin E2, the first fusion protein is a prostaglandin E2 receptor EP4-TEV protease (C-terminal deletion-T30A) fusion protein, and the second fusion protein is that shown in Figure 3(b). Figure 10 is a graph showing the translation amount of luciferase-encoding off-switch mRNA in the presence or absence of a ligand (BK) when the ligand is bradykinin, the first fusion protein is a bradykinin receptor B2-TEV protease (C-terminal deletion-T30A) fusion protein, and the second fusion protein is that shown in Figure 3(b). FIG. 11 is a graph showing the translation amount of off-switch mRNA encoding the anti-inflammatory protein IL-1Ra in the presence or absence of a ligand (PGE2) when the ligand is prostaglandin E2, the first fusion protein is a prostaglandin E2 receptor EP4-TEV protease (C-terminal deletion-T30A) fusion protein, and the second fusion protein is that shown in FIG. 3(b).

[0013] Hereinafter, embodiments of the present invention will be described, but the present invention is not limited to the embodiments described below.

[0014] The present invention relates to an mRNA translation control system and method. The translation control system of the present invention comprises the following mRNAs (a), (b), and (c), or DNA encoding them: (a) an mRNA that expresses a first fusion protein comprising a ligand recognition domain of a G protein-coupled receptor, an adaptor protein binding domain that binds to an adaptor protein in response to the ligand, and a sequence-specific protease; (b) an mRNA that expresses a second fusion protein comprising an adaptor protein, a target sequence for the sequence-specific protease, a degradation promoting domain, and a translation control factor; and (c) an off-switch or on-switch mRNA that has the translation control factor binding site in its 5'-UTR and encodes a target protein.

[0015] Furthermore, the method of the present invention for regulating translation of mRNA in response to a ligand comprises the step of introducing into a cell a system comprising the above mRNAs (a), (b) and (c).

[0016] The present invention includes cases where the mRNA expressing the first fusion protein (the mRNA (a) above) and the mRNA expressing the second fusion protein (the mRNA (b) above) are separate mRNA molecules. It also includes cases where a single mRNA molecule expresses the first fusion protein and the second fusion protein as separate molecules. The following describes a first embodiment where the mRNA (a) and the mRNA (b) are separate RNA molecules, and a second embodiment where the mRNA (a) and the mRNA (b) are the same RNA molecule.

[0017] [First Embodiment] In a first embodiment of the present invention, the system and method of the present invention include a first mRNA (a) comprising a nucleic acid sequence encoding a first fusion protein comprising a ligand-recognition domain of a G protein-coupled receptor, an adaptor protein-binding domain that binds to an adaptor protein in response to the ligand, and a sequence-specific protease, and a second mRNA (b) comprising a nucleic acid sequence encoding a second fusion protein comprising an adaptor protein, a target sequence for the sequence-specific protease, a degradation-promoting domain, and a translation control element. That is, in the first embodiment, the system and method include an mRNA comprising a nucleic acid sequence encoding the first fusion protein and an mRNA comprising a nucleic acid sequence encoding the second fusion protein as separate molecules.

[0018] A translation control system and method according to a first embodiment will be described below.

[0019] In an embodiment of the present invention, regulating mRNA translation refers to the control of intracellular translation of the off-switch mRNA (c) or on-switch mRNA when a specific molecule that is a ligand of a G protein-coupled receptor (GPCR) is present outside the cell. More specifically, when (c) is an off-switch mRNA, in the absence of a ligand, translation of the off-switch mRNA (c) is suppressed, resulting in the non-expression of the target protein, whereas in the presence of a ligand, translational suppression of the off-switch mRNA (c) is released, resulting in the expression of the target protein. In other words, this is a system in which the target protein is output upon ligand input. Hereinafter, G protein-coupled receptor may be abbreviated as GPCR. Alternatively, when (c) is an on-switch mRNA, in the absence of a ligand, translational activation of the on-switch mRNA (c) is activated, resulting in the expression of the target protein, whereas in the presence of a ligand, translational activation of the on-switch mRNA (c) is released, resulting in the non-expression of the target protein. In other words, this is a system in which the output of the target protein is suppressed upon ligand input.

[0020] In an embodiment of the present invention, the "cells" into which the system containing the mRNAs of (a), (b), and (c) is introduced are not particularly limited and may be any cells. The cells may be single cells or a "cell population" which is a collection of two or more cells. There is no theoretical upper limit to the number of "cell populations," and the "cell population" refers to a population consisting of any number of cells.

[0021] The term "cells" may refer to cells collected from unicellular or multicellular species, or may be artificially engineered cells (including cell lines). Examples of such cells include yeast, insect cells, and animal cells, with animal cells being preferred. Examples of animal cells include cells derived from mammals (e.g., mice, rats, hamsters, guinea pigs, dogs, monkeys, orangutans, chimpanzees, and humans). Mammalian cells include cell lines such as monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary (CHO) cells, dhfr gene-deficient CHO cells, mouse L cells, mouse AtT-20 cells, mouse myeloma cells, rat GH3 cells, human embryonic kidney cells (e.g., HEK293 cells), human hepatoma cells (e.g., HepG2), and human FL cells. Primary cultured cells prepared from human and other mammalian tissues are also useful. Furthermore, zebrafish embryos and Xenopus oocytes can also be used. Furthermore, there are no particular limitations on the degree of differentiation of the cells or the age of the animal from which the cells are collected, and the cells may be any of (A) stem cells, (B) progenitor cells, (C) terminally differentiated somatic cells, or (D) other cells.

[0022] The "cell" may be a cell present in a living body or a cell present outside the body. For example, for the purpose of preventing or treating a disease, the cell may be a cell present in a living body, and for the purpose of inducing differentiation of cells for transplantation or evaluating cell function, the cell may be a cell present outside the body.

[0023] The design of the first fusion protein encoded by the mRNA (a), the second fusion protein encoded by the mRNA (b), and the off-switch or on-switch mRNA (c) is described below. In the design, a combination of a target ligand and a target protein ultimately expressed in response to the target ligand is selected, and the first and second fusion proteins are designed to match the ligand. The ligand can be selected from molecules that can be secreted extracellularly in the living organism that is the target of the translational control method of the present invention, so as to be suitable for the detection, prevention, alleviation, modulation, or treatment of symptoms, which are the goals of translational control of the off-switch or on-switch mRNA. The ligand can be selected from, but is not limited to, cytokines, hormones, neurotransmitters, or artificially synthesized receptor agonists, which are molecules that can fluctuate with changes in the pathological condition of the living organism. Representative cytokines include stromal cell-derived factor 1, and representative hormones include arginine vasopressin, adrenaline, thyrotropin-releasing hormone, prostaglandin E2, and bradykinin. Representative neurotransmitters include acetylcholine and endorphins.

[0024] GPCRs that specifically recognize certain ligands are widely known, and those skilled in the art can determine the combination of a ligand and a GPCR that recognizes it. Specific examples of ligand-GPCR combinations include, but are not limited to, arginine vasopressin and arginine vasopressin receptor, adrenaline and an adrenaline receptor, stromal cell-derived factor 1 and CXC motif-type chemokine receptor 4, prostaglandin E2 and prostaglandin E2 receptor EP4, and bradykinin and bradykinin receptor B2.

[0025] The target protein is a protein encoded by the off-switch or on-switch mRNA (c), whose translation and subsequent expression are controlled by the presence of a ligand, such as an extracellular secretory factor, that reflects a disease state. More specifically, the target protein may be a protein that is not expressed in the absence of a ligand but is desired to be expressed in the presence of a ligand, and that can identify the presence of the ligand or act to prevent, alleviate, regulate, or treat a condition or disease associated with the ligand. For example, specific combinations of a ligand and a target protein include, but are not limited to, combinations of an adrenergic receptor and a blood pressure-lowering peptide, and combinations of a bradykinin receptor or a prostaglandin receptor and an anti-inflammatory cytokine.

[0026] A first fusion protein encoded by the mRNA of (a) The first fusion protein comprises, from the N-terminus to the C-terminus, (a1) a ligand recognition domain of a GPCR, (a2) an adaptor protein binding domain that binds to an adaptor protein in response to the ligand, and (a3) ​​a sequence-specific protease, in this order.

[0027] (a1) Ligand Recognition Domain of G Protein-Coupled Receptors The ligand recognition domain of a GPCR is a portion containing an amino acid sequence that is specifically recognized by a ligand, and is a portion that includes at least the extracellular domain of the GPCR, multiple (particularly seven) transmembrane domains, and the intracellular or extracellular loop portion connecting these. The ligand recognition domain of a GPCR can include an amino acid sequence derived from a portion containing the above structure of a natural GPCR, a GPCR known from the literature, or a commercially available GPCR. Mutations of these can also be used as long as they do not impair the properties of localizing to the cell membrane, recognizing a ligand, and, upon recognition, changing the binding affinity between the adaptor protein binding domain described below and the adaptor protein. Examples of variants include, but are not limited to, variants in which conservative substitutions have been made in the amino acid sequence constituting the ligand-recognition domain of a naturally occurring, known, or commercially available GPCR; amino acid sequences in which one or several (e.g., 2, 3, 4, or 5) amino acids have been deleted, substituted, inserted, and / or added; and variants containing an amino acid sequence with 85% or more identity (e.g., 90%, 95%, 96%, 97%, 98%, 99% or more). Amino acid sequence identity can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) under the following conditions: expectancy = 10; gaps allowed; matrix = BLOSUM62; filtering = OFF). Furthermore, the ligand-recognition domain of a type of GPCR known as DREADD (Designer Receptors Exclusively Activated by Designer Drugs) can also be used. DREADDs are designer receptors that are activated only by designer drugs.DREADDs are also known as "RASSLs (receptors activated solely by synthetic ligands)." Specific examples of the ligand recognition domain of GPCRs that can be used include, but are not limited to, the N-terminus to the seventh transmembrane domain of the arginine vasopressin (AVP) receptor, adrenergic receptor, CXC motif chemokine receptor 4, prostaglandin E2 receptor EP4, and bradykinin receptor B2.

[0028] (a2) Adapter Protein Binding Domain The adaptor protein binding domain is a portion that binds to an adaptor protein in response to a ligand. Here, "binding to an adaptor protein in response to a ligand" refers to the specific binding of a ligand to the ligand recognition domain (a1), which is accompanied by phosphorylation of the adaptor protein binding domain, making it available to bind to the adaptor protein. The adaptor protein binding domain can be an intracellular domain located at the C-terminus of a GPCR. For example, it may be a portion derived from the same GPCR as the ligand recognition domain (a1) and having an amino acid sequence C-terminal to the ligand recognition domain. The adaptor protein binding domain may also be a portion derived from a GPCR having an amino acid sequence C-terminal to the ligand recognition domain (a1). In such cases, it is necessary that the fusion with (a1) does not inhibit the functions of both. Mutants of the adaptor protein binding domain can also be used as long as they do not impair the ability to bind to an adaptor protein in response to a ligand. The mutant may be an amino acid sequence having the same mutation as defined in (a1) above in the amino acid sequence of the C-terminal portion derived from a GPCR. Specifically, for example, when (a1) is a ligand recognition domain of an AVP receptor, the C-terminal domain of the AVP receptor can be used. The C-terminal domain of the AVP receptor may be a domain located C-terminal to the seventh transmembrane domain of the AVP receptor. When (a1) is a ligand recognition domain of a prostaglandin E2 receptor, the cytoplasmic domain located at the C-terminus of the prostaglandin E2 receptor EP4 or the C-terminal domain of the AVP receptor can be used. When (a1) is a ligand recognition domain of a bradykinin receptor, the cytoplasmic domain located at the C-terminus of the bradykinin receptor B2 or the C-terminal domain of the AVP receptor can be used.

[0029] (a3) Sequence-Specific Protease The sequence-specific protease is a domain capable of cleaving a target amino acid sequence contained in the second protein fusion. Examples include, but are not limited to, Tobacco Etch Virus (TEV) protease or a mutant thereof, Hepatitis C Virus (HCV) protease, and Tobacco Vein Mottling Virus (TVMV) protease. The sequence-specific protease may be, in particular, a mutant of TEV protease in which the amino acids from residue 220 onward at the C-terminus are deleted. Furthermore, it may be a mutant of TEV protease in which the threonine at position 30 is substituted with alanine, or a mutant in which the serine at position 135 is substituted with asparagine.

[0030] The first fusion protein may contain (a1), (a2), and (a3) ​​from the N-terminus to the C-terminus, and may have a linker sequence of about 4 to 30 amino acids between these portions. The N-terminus of the first fusion protein must be (a1), but the C-terminus may further contain another amino acid portion.

[0031] Second fusion protein encoded by the mRNA of (b) The second fusion protein contains, from the N-terminus to the C-terminus, (b1) an adaptor protein, (2b) a target sequence for a sequence-specific protease, (b3) a degradation-promoting domain, and (b4) a translation control element, in this order.

[0032] (b1) Adaptor Protein The adaptor protein is a domain that binds to the adaptor protein binding domain (a2) contained in the first fusion protein in the presence of a ligand. Although β-arrestin can be used as the adaptor protein, any protein that specifically binds to the phosphorylated adaptor protein binding domain can be used, including artificially produced intracellular antibodies.

[0033] (b2) Target sequence of sequence-specific protease The target sequence of the sequence-specific protease is the target sequence of the sequence-specific protease (a3) ​​contained in the first fusion protein. It may be any sequence that can be cleaved by (a3). When the sequence-specific protease is TEV protease or a mutant thereof, the target sequence may be, for example, (ENLYFQ: SEQ ID NO: 14).

[0034] (b3) Degradation-Promoting Domain A degradation-promoting domain is a domain that degrades a protein bound to its C-terminus only when the domain is located at the N-terminus. Examples of the degradation-promoting domain include N-degron (HKSGAWKLPVSLVK: SEQ ID NO: 1) and its mutants. A degradation-promoting domain mutant can refer to an amino acid sequence having the same mutation as defined in (a1) above with respect to the amino acid sequence represented by SEQ ID NO: 1.

[0035] (b4) Translational Regulatory Factors Translational regulators are generally artificial translational regulators that contain at least an RNA-binding domain. More specifically, translational regulators used for translational repression contain or consist of an RNA-binding domain. Translational regulators that can activate translation in addition to translational repression contain an RNA-binding domain and a translational activator.

[0036] An RNA-binding domain is a domain that specifically recognizes a specific RNA sequence and forms an RNA-protein complex. Herein, a specific RNA sequence that specifically recognizes and binds to such an RNA-binding domain is referred to as a "binding motif" or "protein-binding motif." Any RNA-binding domain can be used in the present invention without particular limitation, as long as it is a protein that can bind to the binding motif. Specific examples of RNA-binding domains include MS2CP, L7Ae, LIN28A, PP7CP, dCas13, their mutants (e.g., in the case of MS2CP, the V29I mutant, L77P mutant, W82R mutant, C101R mutant, dlFG mutant, etc.), and fragments thereof that have RNA-binding ability. The activation and / or inhibition of translation of a target protein using MS2CP, L7Ae, and LIN28A have already been demonstrated. The RNA-binding domain is preferably MS2CP or a mutant thereof. In one embodiment of the present invention, the RNA-binding domain may be a protein comprising an amino acid sequence set forth in any one of SEQ ID NOS: 3, 5, and 7 (the nucleotide sequences encoding proteins consisting of these sequences are set forth in SEQ ID NOS: 2, 4, and 6, respectively), an amino acid sequence in which one or several (e.g., 2, 3, 4, or 5) amino acids have been deleted, substituted, inserted, and / or added to the amino acid sequence set forth in any one of SEQ ID NOS: 3, 5, and 7, or an amino acid sequence that shares 85% or more (e.g., 90%, 95%, 96%, 97%, 98%, 99% or more) identity with the amino acid sequence set forth in any one of SEQ ID NOS: 3, 5, and 7. As used herein, the term "RNA-binding domain" encompasses wild-type RNA-binding domains, mutants thereof, and fragments thereof. The conditions for calculating amino acid sequence identity may be the same as those described for (a1) above.

[0037] The translation activator that may be optionally included in the translation control factor is not particularly limited as long as it can recruit a translation initiation factor and activate translation. In one embodiment of the present invention, the translation activator comprises a VPg (viral protein genome-linked) protein. In the following description, VPg is used as an example of a translation activator, but when a translation factor other than VPg is used, "VPg" should be read as the other translation activator. The translation control system of the present invention, with the above-described configuration, can activate or inhibit protein translation.

[0038] The VPg protein is not particularly limited as long as it has the function of activating protein translation, and examples thereof include VPg proteins derived from viruses belonging to the genus Vesivirus, Lagovirus, or Potyvirus, as well as mutants of the VPg proteins and fragments thereof having translation activation function. Examples of viruses belonging to the genus Vesivirus include feline calicivirus (NCBI Accession No. NP_783307.1), canine vesivirus (NCBI Accession No. NP_786908.1), and swine vesicular exanthema virus (NCBI Accession No. NP_786894.1). Examples of viruses belonging to the genus Lagovirus include VPg of rabbit hemorrhagic disease virus (NCBI Accession No. NP_740330.1). Examples of viruses belonging to the genus Potyvirus include, but are not limited to, Lupinus mosaic virus, Bean yellow mosaic virus, and Papaya leaf distortion mosaic virus. A virus belonging to the genus Vesivirus, particularly feline calicivirus, is preferred. In one embodiment of the present invention, the VPg protein can be a protein comprising the amino acid sequence shown in SEQ ID NO: 9 (the nucleotide sequence encoding the protein consisting of this sequence is shown in SEQ ID NO: 8), an amino acid sequence in which one or several (e.g., 2, 3, 4, or 5) amino acids have been deleted, substituted, inserted, and / or added in the amino acid sequence shown in SEQ ID NO: 9, or an amino acid sequence having 85% or more identity (e.g., 90%, 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence shown in SEQ ID NO: 9. As used herein, the term "VPg protein" also encompasses VPg protein, VPg protein variants, and fragments thereof.

[0039] In one embodiment, a translational control factor having both translational repression and translational activation functions may be a fusion protein comprising an RNA-binding domain and a VPg protein, or may be a translational control factor in which a protein-binding domain such as an SH3 domain, a PDZ domain, a GK domain, or a GB domain and its binding partner are fused to the RNA-binding domain and the VPg protein, respectively.

[0040] When the translation control factor is a fusion protein, the RNA-binding domain may be present on the N-terminus side and the VPg protein on the C-terminus side, or the RNA-binding domain may be present on the C-terminus side and the VPg protein on the N-terminus side, and a linker may be present between them.

[0041] In a preferred embodiment of the present invention, the translational control factor having both translational repression and translational activation functions is a fusion protein of an RNA-binding domain and a VPg protein, and may be the caliciviral VPg-based translational activator (CaVT) disclosed in Non-Patent Document 1. The translational control factor may be a protein comprising the amino acid sequence shown in SEQ ID NO: 11 (the nucleotide sequence encoding the protein consisting of this sequence is shown in SEQ ID NO: 10), an amino acid sequence in which one or several (e.g., 2, 3, 4, or 5) amino acids have been deleted, substituted, inserted, and / or added in the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence having 85% or more identity (e.g., 90%, 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence shown in SEQ ID NO: 11.

[0042] The second fusion protein may contain, from the N-terminus to the C-terminus, (b1), (b2), (b3), and (b4), and may have a linker sequence of approximately 4 to 30 amino acids between these portions. In particular, it is preferable to include a linker consisting of 5 to 15 amino acids between the degradation-promoting domain (b3) and the translation control factor (b4). The linker between (b3) and (b4) is preferably a sequence such as GGGGS (SEQ ID NO: 36), which is unlikely to interfere with the structures of (b3) and (b4). This linker is expected to function to prevent mutual interference between the structures of (b3) and (b4). The N-terminus and C-terminus of the first fusion protein may further contain additional amino acid moieties.

[0043] Once the first and second fusion proteins have been designed as described above and their amino acid sequences have been determined, the structures of the first and second mRNAs that express them can be determined. The first mRNA may have a structure in which, from the 5' end to the 3' end, a 5'-UTR containing a Cap structure or Cap analog at the 5' end, an open reading frame containing a nucleic acid sequence encoding the first fusion protein, and a 3'-UTR containing PolyA are linked in this order.

[0044] The 5'-UTR of the first mRNA contains a cap structure or cap analog at its 5' end. The cap structure may be 7-methylguanosine 5'-phosphate. The cap analog is a modified structure that, like the cap structure, is recognized by the translation initiation factor eIF4E, and examples include, but are not limited to, Ambion's Anti-Reverse Cap Analog (ARCA), New England Biolabs' m7G(5')ppp(5')G RNA Cap Structure Analog, and TriLink's CleanCap. The cap analog may also be another modified structure recognized by a translation initiation factor. The 3' side of the cap structure or cap analog, but the 5' side of the start codon, may contain an arbitrary nucleic acid sequence, for example, approximately 0 to 300 bases, preferably approximately 20 to 200 bases. It is preferable that these arbitrary nucleic acid sequences do not form secondary structures and do not specifically interact with the second mRNA. It is also preferable that the 5'-UTR does not contain an AUG initiation codon.

[0045] The open reading frame, which is the coding region of the first mRNA, includes an initiation codon, a nucleic acid sequence encoding the first fusion protein, and a stop codon. The nucleic acid sequence encoding the first fusion protein includes, in this order from the 3' side of the initiation codon AUG to the 5' side of the stop codon, a nucleic acid sequence encoding (a1), a nucleic acid sequence encoding (a2), and a nucleic acid sequence encoding (a3). The nucleic acid sequences encoding each domain can be determined from the partial structure of the first fusion protein designed above.

[0046] The 3'-UTR of the first mRNA contains a PolyA tail. The PolyA tail may be a sequence of about 50 to 250 adenine bases. However, the about 50 to 250 adenine bases do not need to be consecutively linked, and other nucleic acid bases may be included between the adenine bases as long as the stability of the mRNA is maintained.

[0047] The second mRNA may have a structure in which, from the 5' end to the 3' end, a 5'-UTR containing a Cap structure or Cap analog at the 5' end, an open reading frame containing a nucleic acid sequence encoding the second fusion protein, and a 3'-UTR containing PolyA are linked in this order. The configurations of the 5'-UTR containing a Cap structure or Cap analog at the 5' end and the 3'-UTR containing PolyA can be the same as those of the first mRNA. The nucleic acid base sequences and numbers of nucleic acid bases of the 5'-UTR and 3'-UTR of the first and second mRNAs may be the same or different, but are preferably the same.

[0048] The open reading frame, which is the coding region of the second mRNA, contains an initiation codon, a nucleic acid sequence encoding the second fusion protein, and a stop codon. The nucleic acid sequence encoding the second fusion protein contains, in this order from the 3' side of the initiation codon AUG to the 5' side of the stop codon, a nucleic acid sequence encoding (b1), a nucleic acid sequence encoding (b2), a nucleic acid sequence encoding (b3), and a nucleic acid sequence encoding (b4). The nucleic acid sequences encoding each domain can be determined from the partial structure of the second fusion protein designed above.

[0049] (c) Switch mRNA Switch mRNAs include off-switch mRNAs, which suppress the translation of the mRNA they encode when a translation control factor binds to them, and on-switch mRNAs, which activate the translation of the mRNA they encode when a translation control factor binds to them. The structure of each mRNA is explained below.

[0050] (c(i)) Off-switch mRNA The off-switch mRNA has a Cap structure or a Cap analog at the 5' end and contains one or more binding motifs that specifically recognize an RNA-binding domain constituting a translation control factor, and a nucleic acid sequence encoding a target protein.

[0051] The off-switch mRNA of the present invention typically comprises one or more binding motifs in the 5'-UTR, and the binding motifs are stabilized by an RNA scaffold structure. In one embodiment of the present invention, the off-switch mRNA of the present invention preferably comprises two or more binding motifs for an RNA-binding domain, and at least two of the binding motifs are linked via an RNA scaffold structure. As used herein, the term "RNA scaffold structure" refers to a structure that links to one or more binding motifs, thereby stabilizing the motifs. Examples of such structures include, but are not limited to, structures having one or more stem regions formed by base pairing. The base pairs in the stem region can be designed to achieve the desired stability (it is generally believed that stability improves depending on the number of base pairs forming the stem region). When two or more binding motifs are linked, it is sufficient for at least one of them to have a scaffold structure; however, from the viewpoint of stability, it is preferable that all binding motifs are linked. Furthermore, the two or more motifs may be linked via a stem region or, alternatively, via another structure (e.g., a loop structure) without including a stem region. As used herein, stabilizing a binding motif means that fluctuations in the RNA structure are reduced compared to when there is no scaffold structure, increasing the probability that the RNA will have the potential secondary structure described below.

[0052] The binding motif for the RNA-binding domain contained in the off-switch mRNA of the present invention is not particularly limited as long as it binds to the RNA-binding domain. The binding of the RNA-binding domain to RNA via the binding motif inhibits translation of the target protein. For example, when the RNA-binding domain is MS2CP, the RNA-binding domain can be appropriately designed with reference to known literature (e.g., Grahn E et al., RNA. 7(11):1616-1627 (2001)). Specifically, at least one of the binding motifs is represented by the following formula (I) (the nucleotide sequence is shown as SEQ ID NO: 12): (In the formula, N １ ~N １５ each independently represents A, C, G, or U; R represents G or A; Y represents U or C; N１ and N １５ That is, N ２ and N １４ That is, N ３ and N １３ That is, N ４ and N １２ That is, N ５ and N １１ That is, N ６ and N １０ and N ７ and N ９ and form a base pair or a wobble base pair, respectively. １ A, N ２ is G or C (preferably G), N ３ G, N ４ U, N ５ G, N ６ G, N ７ G, N ８ U, N ９ C, N １０ C, N １１ C, N １２ A, N １３ U, N １４ is C or G (preferably C), N １５ is U, R is A, and Y is C.

[0053] As a structure that further stabilizes formula (I), the following structure shown in formula (II) can also be preferably used as a binding motif. (In the formula, N １ ~N １５ The definitions of R and Y are as described above; Xa and Xb are each independently A, G, C, or U; n and m are each independently an integer of 0 or greater; Xa, together with Xb, constitute a stem structure which may have a bulge loop. Examples of suitable RNAs include those having a potential secondary structure represented by the formula (II). n and m in formula (II) are each independently an integer of typically 1,000 or less, preferably 100 or less (e.g., 50, 20, 10, etc.).

[0054] Herein, potential secondary structures such as those represented by formula (I) or (II) above may be referred to as "binding motifs of RNA-binding domains" (sometimes simply abbreviated as "binding motifs"). When the RNA-binding domain is MS2CP, they are also referred to as "MS2CP-binding motifs." A potential secondary structure refers to a secondary structure that exists stably under physiological conditions, and whether or not a molecule has a potential secondary structure can be determined using a structure prediction program (ParasoR) (Kawaguchi, R. & Kiryu, H. Parallel computation of genome-scale RNA secondary structure to detect structural constraints on the human genome. BMC Bioinformatics 17, 203 (2016)).

[0055] In the above formula (II), when n and m are different integers, Xa and Xb have a bulge loop. When n and m are the same integer, the stem structure formed by Xa and Xb may also have a bulge loop, but from the viewpoint of the stability of the MS2CP-binding motif, a stem structure without a bulge loop is preferred.

[0056] In a preferred embodiment, the off switch of the present invention comprising two MS2CP-binding motifs comprises a structure of formula (II) above in which n and m are each independently 0 to 5 (e.g., 1), and a more specific structure comprises a structure of formula (II) above in which n and m are 1 and, in that case, Xa and Xb are C and G, respectively. Alternatively, it comprises a structure of formula (II) above in which n and m are each independently 5 to 10 (e.g., 7), and a more specific structure comprises a structure of formula (II) above in which n and m are 7 and, in that case, Xa and Xb are ACGAGCG and CGCUCGU, respectively, but is not limited thereto.

[0057] When the RNA switch of the present invention contains two or more binding motifs, at least two of the structures represented by structure (II) above may be linked via a multi-branched loop. The number of nucleotides in the multi-branched loop is not particularly limited, but may be, for example, 4 to 10 or 5 to 9 (e.g., 7). The multi-branched loop may also contain other structures, such as other multi-branched loops (which may further contain other structures, such as helix loop structures). For example, the multi-branched loop may be linked to 0 to 10 (e.g., 2 to 5) stem structures. Herein, an integrated structure composed of multiple secondary structures, such as a structure containing a binding motif such as an MS2CP-binding motif and having multiple structures represented by formula (II), is sometimes referred to as a "binding domain for an RNA-binding domain" (sometimes simply referred to as a "binding domain"). Such a binding domain is typically formed from at least two types of structures selected from a hairpin structure, a helix structure, a bulge loop, an internal loop, a multi-branched loop, and a pseudoknot structure.

[0058] Even when the binding motif is other than the MS2CP binding motif, those skilled in the art can design a corresponding binding motif or RNA domain to match the corresponding RNA binding domain. An L7Ae binding motif can be appropriately designed, for example, with reference to known literature (e.g., Shi X et al., Nat Chem Biol. 12(3):146-152 (2016)). Specific examples include those having the structure shown in formula (III) below. An LIN28A binding motif can be appropriately designed, for example, with reference to known literature (e.g., Kawasaki S et al., Nucleic Acids Res. 45(12):e117 (2017)). Specific examples include those having a stem-loop structure containing the GGGAU sequence. Furthermore, the degree of translation activation or inhibition can be adjusted by appropriately designing the position, sequence, structure, and modification of nucleotide residues of the binding motif within the RNA.

[0059] (In the formula, N １ ~N １１ each independently represents A, C, G, or U; ２ and N １０ and N ３ and N ９ and form a base pair or a wobble base pair, respectively.)

[0060] The length of the binding motif may be any number of bases, typically about 200 nucleotides or less, for example, about 100 nucleotides or less, preferably about 50 nucleotides or less, and more preferably about 40 nucleotides or less. The length of the binding domain may also be any number of bases, typically about 300 nucleotides or less, for example, about 200 nucleotides or less, and preferably about 150 nucleotides or less. A smaller total number of nucleotides facilitates mass production and offers significant cost benefits. There is no particular lower limit to the length of the binding motif and binding domain, as long as they contain a binding motif sequence (e.g., the sequence represented by SEQ ID NO: 12), but the length is, for example, 15 nucleotides or more, preferably 20 nucleotides or more, and more preferably 25 nucleotides or more.

[0061] The target protein is a protein that is the target of translational control, and may be any of the proteins exemplified above. Two or more target proteins may be encoded depending on the purpose of translational control.

[0062] The off-switch mRNA may preferably have a structure in which, from the 5' end to the 3' end, [a 5'-UTR having a Cap structure or Cap analog at the 5' end and containing a binding motif], [an open reading frame containing a nucleic acid sequence encoding a target protein], and [a 3'-UTR containing PolyA] are linked in this order.

[0063] The cap structure or cap analog can be selected from the same options as for the first mRNA. The binding motif may be located anywhere on the 3' side of the cap structure or cap analog and upstream of the translation initiation codon (i.e., in the 5'-UTR). The position of the binding motif within the 5'-UTR can change the translation activity of the off switch of the present invention, so the position can be adjusted appropriately depending on the purpose.

[0064] A spacer may optionally be included between the cap structure or cap analog and the binding motif, and / or between the binding motif and the start codon. The nucleic acid sequence of the spacer is not particularly limited, as long as it does not form a secondary structure within the switch mRNA and does not interact with the first and second mRNAs. The length of each spacer may be any number of bases, including 0 to 800 bases, 0 to 700 bases, 0 to 600 bases, 0 to 500 bases, 0 to 450 bases, 0 to 400 bases, 0 to 350 bases, 0 to 300 bases, 0 to 250 bases, 0 to 200 bases, 0 to 150 bases, 0 to 100 bases, 0 to 50 bases, 0 to 40 bases, 0 to 30 bases, 0 to 20 bases, or 0 to 10 bases. Base sequences such as restriction enzyme sites are also included in the spacer base sequence. Translation activity can be adjusted by adjusting the number of bases in the spacer.

[0065] A specific example of the 5'-UTR of the off-switch mRNA is, but is not limited to, the sequence shown in SEQ ID NO: 13 (AGGUCAGAUCCGCUAGCGGAUCCGGGAGCAGGUGAGGAUCACCCAUCUGCCACGAGCGAGGUGAGGAUCACCCAUCUCGCUCGUGUUCCCACCGGUCGCCACC). The 3'-UTR containing PolyA of the off-switch mRNA can be designed in the same manner as the 3'-UTRs of the first and second mRNAs.

[0066] The RNA-binding domain of a translation control factor specifically recognizes and binds to the binding motif of an off-switch mRNA, thereby inhibiting translation of the target protein. Previous research by the inventors has observed that when the RNA-binding domain is MS2CP, the stronger the binding strength between MS2CP and the binding motif, the lower the translation activity. Furthermore, when a motif having two MS2CP-binding motifs and a specific scaffold structure that tightly binds to MS2CP is used, translation activity is inhibited. Without wishing to be bound by any theory, these observations suggest that MS2CP also has the function of inhibiting translation by binding to the binding motif, and that the translation level is determined by the balance between activation via VPg protein and inhibition via MS2CP, with the inhibitory effect via MS2CP being enhanced as the binding between RNA and MS2CP becomes stronger. Furthermore, when two or more MS2CPs ​​bind to an off switch of the present invention having, for example, a structure in which two MS2CP-binding motifs are linked via a scaffold structure, the translation control factor of the present invention is constantly bound to RNA. It is presumed that this inhibits the ribosomes recruited by the VPg protein from moving along the RNA, resulting in the suppression of protein translation encoded by the off switch of the present invention. In fact, even when a translation control factor composed of L7Ae and VPg protein was used instead of a translation control factor composed of MS2CP and VPg protein, a translation inhibitory effect was observed when using RNA having a motif that tightly binds to L7Ae. Therefore, it is believed that the off switch of the present invention exhibits a protein translation inhibitory effect that is not limited to a specific structure by including two or more binding motifs, at least two of which are linked via a scaffold structure, by changing the sequence of the binding motifs, or by applying specific modifications to the nucleotide residues, thereby increasing the binding affinity with the RNA-binding domain to a certain level.

[0067] (c(ii)) On-switch mRNA On-switch mRNA does not have a 7-methylguanosine 5'-phosphate structure at the 5' end and contains a binding motif that specifically recognizes an RNA-binding domain constituting a translation control factor and a nucleic acid sequence encoding a target protein.

[0068] Preferably, the on-switch mRNA has a modification at the 5' end that inhibits RNA degradation and activates translation, both of which are effects of a normal Cap structure. In other words, the structure should not be recognized by the translation initiation factor eIF4E. More specifically, the 5' end preferably does not have a 7-methylguanosine 5'-phosphate structure. Examples of modifications at the 5' end of the on-switch mRNA include A-Cap (G(5')ppp(5')A).

[0069] On-switch mRNAs typically have one or more binding motifs in the 5'-UTR. The binding motif is not particularly limited as long as it specifically recognizes and binds to the RNA-binding domain. For example, it is preferable that the binding motif is one, and that the binding motif has a weak binding affinity with the translational regulatory factor, so that the translational regulatory factor does not inhibit mRNA translation. Binding of the translational regulatory factor to the off-switch mRNA via such a binding motif activates translation of the protein encoded by the mRNA. For example, when the RNA-binding domain is MS2CP, the binding motif can have a structure represented by formula (II) above.

[0070] The target protein is a protein whose translation amount is increased when the on-switch mRNA is translationally activated. The target protein can be selected from the same options as the target protein for the off-switch.

[0071] The on-switch mRNA may preferably have a structure in which, from the 5' end to the 3' end, [a 5'-UTR that does not have a 7-methylguanosine 5'-phosphate structure and contains a binding motif], [an open reading frame containing a nucleic acid sequence encoding a target protein], and [a 3'-UTR containing PolyA] are linked in this order.

[0072] The 5'-UTR of an on-switch mRNA simply needs to have a binding motif on the 3' side of the 5'-end modification structure, and the position of the binding motif within the 5'-UTR and the sequence and number of spacers can be selected from the options described in the design of off-switch mRNAs.

[0073] A specific example of the 5'-UTR of an on-switch mRNA is, but is not limited to, the sequence shown in SEQ ID NO: 37 (GGGCGAAUUAAGAGAGAAAAGAAGAGUACAUGAGGAUUACCCAUGUAAGAAGAAAUAUAAGACACCGGUCGCCACC). The 3'-UTR containing PolyA of an on-switch mRNA can be designed in the same manner as the 3'-UTRs of the first and second mRNAs.

[0074] When the RNA-binding domain of a translational regulator specifically recognizes and binds to the binding motif of the on-switch mRNA, a translational activator such as a VPg protein, which may be included in the translational regulator, recruits a translation initiation factor, activating the translation of the target protein. On the other hand, when the translational regulator is not bound, the 5' end does not contain a Cap structure or a Cap analogue with similar translation activation ability, and the translation of the target protein is therefore inhibited because the translation initiation factor cannot be recruited.

[0075] The sugar residue (ribose) of each nucleotide in the first, second, and off-switch or on-switch mRNAs described above may be modified for purposes such as reducing cytotoxicity. Examples of sites of modification in the sugar residue include substitution of the hydroxyl group or hydrogen atom at the 2', 3', and / or 4' position of the sugar residue with other atoms. Examples of types of modification include fluorination, alkoxylation (e.g., methoxylation, ethoxylation), O-allylation, S-alkylation (e.g., S-methylation, S-ethylation), S-allylation, and amination (e.g., -NH2). Such modifications of sugar residues can be carried out by methods known per se (see, for example, Sproat et al., (1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

[0076] Furthermore, the sugar residues of the first, second, and off-switch or on-switch mRNAs can be bridged at the 2' and 4' positions to form BNA (bridged nucleic acid) (LNA). Such modifications of sugar residues can also be carried out by methods known per se (see, for example, Tetrahedron Lett., 38, 8735-8738 (1997); Tetrahedron, 59, 5123-5128 (2003); Rahman SMA, Seki S., Obika S., Yoshikawa H., Miyashita K., Imanishi T., J. Am. Chem. Soc., 130, 4886-4896 (2008)). Furthermore, the first, second, and off-switch mRNAs can have modified (e.g., chemically substituted) nucleobases (e.g., purines and pyrimidines). Examples of such modifications include modification of the pyrimidine at position 5, modification of the purine at positions 6 and / or 8, modification with an exocyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo- or 5-iodo-uracil. Furthermore, for the purpose of reducing cytotoxicity, modified bases such as pseudouridine (Ψ), N1-methylpseudouridine (N1mΨ), and 5-methylcytidine (5mC) may be contained in place of normal uridine or cytidine. The positions of the modified bases, whether uridine or cytidine, can be all or part of the bases independently, and if part of the bases are modified, they can be located at random positions in any proportion.

[0077] To improve resistance to nucleases and hydrolysis, the phosphate groups (e.g., terminal phosphate residues) contained in the first, second, and off-switch or on-switch mRNAs of the present invention may be modified. For example, the phosphate group P(O)O may be substituted with P(O)S (thioate), P(S)S (dithioate), P(O)NR2 (amidate), P(O)R, R(O)OR', CO, CH2 (formacetal), or 3'-amine (-NH-CH2-CH2-) (wherein each R or R' is independently H or substituted or unsubstituted alkyl (e.g., methyl, ethyl)). Examples of linking groups include -O-, -N-, and -S-, and adjacent nucleotides can be linked via these linking groups.

[0078] The present inventors have confirmed that the binding strength between an RNA-binding domain and a binding motif for the domain varies depending on the type of RNA modification. Therefore, by appropriately changing the type of modification, it is possible to adjust the binding strength between an RNA-binding domain and a binding motif for the domain. Specific modifications to the above nucleic acid bases, sugar residues, and phosphate residues are shown below, but are not limited to these.

[0079]

[0080] Once the molecular structure and nucleic acid sequence of the first, second, and off-switch or on-switch mRNAs have been determined as described above, those skilled in the art can synthesize them by any known genetic engineering method. For example, they can be obtained as synthetic mRNA molecules by in vitro transcription using a template DNA containing a promoter sequence.

[0081] Next, the introduction of the first, second, and off-switch or on-switch mRNA into cells will be described. Introduction of mRNA into cells can be performed either in vitro or in vivo, and is not particularly limited. The introduction of the first, second, and off-switch or on-switch mRNA into cells in vitro can be performed using any method commonly used for introducing RNA into cells in vitro. Methods for directly introducing RNA molecules into cells include, for example, lipofection, polymer, electroporation, calcium phosphate co-precipitation, DEAE-dextran, microinjection, and gene gun. The introduction of the first, second, and off-switch or on-switch mRNA into cells in vivo can be performed using any method commonly used for introducing RNA into cells in vivo. For example, in mammals, the RNA molecules can be directly introduced into cells using intramuscular injection, subcutaneous injection, intravenous injection, intra-articular injection, or other methods. The advantage of introducing synthetic RNA molecules is that the introduced mRNA is degraded with a half-life of within a few days, so it is not integrated into the genome, and the cells after introduction can be easily used for medical applications, etc. Furthermore, synthetic mRNA has the advantage of high transfection efficiency, allowing for the expression of a predetermined amount of the first and second fusion proteins in cells, and for the highly efficient introduction of off-switch or on-switch mRNA for expressing a target protein.

[0082] The first, second, and off-switch or on-switch mRNAs are preferably co-introduced into cells, because the activity ratio of proteins expressed from the two or more co-introduced mRNAs is constant within the cell, allowing the first fusion protein, the second fusion protein, and the off-switch or on-switch mRNA to be introduced at a constant ratio.

[0083] The first, second, and off-switch or on-switch mRNAs can also be introduced into cells using DNA constructs such as RNA expression vectors. DNA constructs can stably express the first, second, and off-switch or on-switch mRNAs for long periods of time. This is advantageous when the translational control system of the present invention is used for long-term intracellular expression. In this case, expression vectors encoding the first, second, and off-switch or on-switch mRNAs can be designed separately, and the two expression vectors can be directly introduced into cells using the same introduction method as described above. Expression vectors encoding the sequences of the first and second mRNAs can be those well known and commonly used in the art, such as viral vectors, artificial chromosome vectors, plasmid vectors, and transposon-based expression systems (sometimes referred to as transposon vectors). Examples of viral vectors include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, and Sendai viral vectors. Examples of artificial chromosome vectors include human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), and bacterial artificial chromosomes (BACs, PACs). As the plasmid vector, any mammalian plasmid can be used, including, for example, an episomal vector. As the transposon vector, an expression vector using the piggyBac transposon can be exemplified. It is also possible to design a DNA construct that expresses two or more of the first mRNA, the second mRNA, and the off-switch or on-switch mRNA as separate mRNAs from a single RNA expression vector.

[0084] By introducing a DNA construct encoding the first mRNA, the second mRNA, and the off switch or on switch mRNA into a cell, the first mRNA, the second mRNA, and the off switch or on switch mRNA transcribed from the expression vector and transcribed within the cell to produce the first mRNA, the second mRNA, and the off switch or on switch mRNA can be made to function in the same way as directly introduced synthetic mRNA molecules, thereby expressing the first fusion protein and the second fusion protein. The method of introducing a DNA construct into a cell is advantageous, for example, when integrating the construct into the cell's genome to prepare a cell that stably expresses the first fusion protein, the second fusion protein, and the off switch or on switch mRNA.

[0085] The amounts of the first, second, and off-switch or on-switch mRNA introduced into cells vary depending on the type of target cell and the structure of the mRNA, and are not limited to a specific amount. The amount of mRNA introduced that can achieve the desired translational control of the target protein can be determined by preliminary experiments, etc.

[0086] Next, the action and function of the translational control system according to the present invention will be described illustratively with reference to the drawings. FIG. 1 is a schematic diagram showing the states of the first and second fusion proteins and the off-switch mRNA in the absence of a ligand. The first fusion protein 1, expressed through translation of the first mRNA, binds to the cell membrane 10 via the transmembrane domain contained in the GPCR ligand-recognition domain 1a. In the absence of a ligand outside the cell, the adaptor protein-binding domain 1b is not phosphorylated and therefore cannot bind to the adaptor protein. Therefore, the probability that the sequence-specific protease 1c will come sufficiently close to its cleavage target sequence is low. The second fusion protein 2 is expressed through translation of the second mRNA. For the above reasons, the adaptor protein 2a cannot bind to the adaptor protein-binding domain 1b. Furthermore, because the degradation-promoting domain 2c contains the target sequence 2b of the sequence-specific protease at its N-terminus, it does not degrade the translation control factor 2d bound to its C-terminus. The translation control factor 2d then tightly binds to the off-switch mRNA 3, suppressing its translation. Therefore, the target protein encoded by off-switch mRNA 3 is not expressed.

[0087] On the other hand, Figure 2 is a schematic diagram showing the states of the first and second fusion proteins and the off-switch mRNA in the presence of an extracellular ligand. Ligand 4 binds to the ligand-recognition domain 1a of the GPCR. This causes the GPCR's ligand-recognition domain 1a and adaptor protein-binding domain 1b to undergo a conformational change and become activated, allowing the adaptor protein-binding domain 1b to bind to adaptor protein 2a. When the adaptor protein-binding domain 1b binds to the adaptor protein 2a, the sequence-specific protease 1c is positioned near its target sequence 2b and cleaves the second fusion protein 2 at the target sequence 2b. This positions the degradation-promoting domain 2c at the N-terminus and degrades the translation control factor 2d. The degraded translation control factor 2e can no longer bind to the off-switch mRNA 3, thereby releasing the translationally repressed state of the off-switch mRNA 3. This initiates translation of the off-switch mRNA 3, leading to the translation and expression of the target protein 5 encoded by the off-switch mRNA.

[0088] Although not shown, when an on-switch mRNA is used instead of an off-switch mRNA, the first and second fusion proteins are expressed from the first and second mRNAs, respectively, and function in response to the presence of a ligand in the same manner as in Figures 1 and 2. That is, in the absence of a ligand, the translation control factor remains undegraded and binds to the on-switch mRNA. Unlike the off-switch mRNA, when the translation control factor binds to the on-switch mRNA, it activates translation encoded by the on-switch mRNA, resulting in the expression of the target protein. On the other hand, in the presence of a ligand, the translation control factor is degraded and cannot bind to the on-switch mRNA. In this case, the target protein encoded by the on-switch mRNA is not translated or expressed.

[0089] Thus, according to the translation control system of the present invention, first fusion protein 1 obtained by translation of first mRNA, second fusion protein 2 obtained by translation of second mRNA, and off-switch mRNA 3 repress the translation of target protein 5 encoded by the off-switch mRNA in the absence of ligand 4, resulting in its non-expression, whereas target protein 5 is expressed in the presence of ligand 4. Alternatively, first fusion protein 1 obtained by translation of first mRNA, second fusion protein 2 obtained by translation of second mRNA, and on-switch mRNA activate the translation of the target protein encoded by the on-switch mRNA in the absence of a ligand, resulting in its expression, whereas target protein translation is repressed in the presence of a ligand. Furthermore, target protein 5 is expressed or inhibited in a manner generally dependent on the concentration of ligand 4. By utilizing these effects, target protein translation in response to specific symptoms becomes possible, making the system useful as an mRNA pharmaceutical.

[0090] The mRNA translational control system of the present invention can also be provided as a translational control kit containing the first mRNA and second mRNA, off-switch or on-switch mRNA, or DNA encoding them. In this case, the translational control kit may include a medium suitable for cell culture and instructions for handling the first mRNA and second mRNA, off-switch or on-switch mRNA, or DNA encoding them. The instructions may include information such as experimental methods for determining the appropriate amount of mRNA to be introduced into specific cells and the appropriate amount to be introduced depending on the cell type. A kit including the mRNA translational control system of this embodiment enables disease-specific mRNA translational control.

[0091] [Second Embodiment] In a second embodiment of the present invention, the system of the present invention may be such that the mRNA (a) and the mRNA (b) are a single mRNA. This single mRNA may be capable of expressing the first and second fusion proteins as separate, distinct molecules. More specifically, the single mRNA includes, in the 5' to 3' direction, a nucleic acid sequence encoding the second fusion protein, a self-cleaving sequence encoding a self-cleaving peptide, and a nucleic acid sequence encoding the first fusion protein.

[0092] The 5'-UTR and 3'-UTR of a single mRNA can be designed in the same manner as the first or second mRNA described above. The open reading frame can then be designed to include, from the 5' end to the 3' end, a nucleic acid sequence encoding the second fusion protein, a self-cleaving sequence encoding a self-cleaving peptide, and a nucleic acid sequence encoding the first fusion protein, in that order. The self-cleaving peptide may be a viral 2A peptide or a 2A-like peptide with a similar function. Examples include, but are not limited to, F2A, E2A, T2A, and P2A. Modifications of sugar residues in the design of the mRNA molecule may include the variations described in the first embodiment. The translational control system according to the second embodiment, like the first embodiment, may also include a step of introducing into cells a single mRNA expressing the first and second fusion proteins and an off-switch or on-switch mRNA.

[0093] The translational control system and method according to the second embodiment has the advantage that it is not necessary to separately prepare and introduce the first and second mRNAs, thereby eliminating the possibility of cells expressing only one of the first or second fusion proteins.

[0094] [Third Embodiment] According to a third embodiment, the present invention relates to a pharmaceutical composition, particularly a pharmaceutical composition comprising the translational control system according to the first or second embodiment.

[0095] The pharmaceutical composition according to this embodiment may be a pharmaceutical composition used primarily in the living body of a multicellular organism to identify, prevent, alleviate, regulate, or treat a particular disease in response to the presence of a ligand by specifically relieving translational repression of a target protein encoded by the off-switch mRNA (c) or by suppressing translation of a target protein encoded by the on-switch mRNA associated with the disease. The multicellular organism is preferably a mammal (e.g., human, mouse, monkey, pig, rat, etc.), more preferably human.

[0096] The off-switch mRNA (c(i)) contained in the pharmaceutical composition for treating inflammatory diseases encodes an anti-inflammatory cytokine as the target protein, and the first fusion protein expressed by the mRNA (a) can contain a ligand-recognition domain of a GPCR whose ligand is a prostaglandin or bradykinin. This is expected to produce anti-inflammatory cytokines at the site of inflammation depending on the level of inflammation, thereby alleviating inflammation. The off-switch mRNA (c(i)) contained in the pharmaceutical composition for treating hypertension encodes a blood pressure-lowering peptide as the target protein, and the first fusion protein expressed by the mRNA (a) can contain a ligand-recognition domain of a GPCR whose ligand is adrenaline. This is expected to moderately suppress hypertension while avoiding the risk of excessively lowering blood pressure.

[0097] The on-switch mRNA (c(ii)) contained in the pharmaceutical composition for cancer treatment encodes an interleukin as the target protein, and the first fusion protein expressed by the mRNA (a) can contain the ligand-recognition domain of a type of GPCR called DREADD (Designer Receptors Exclusively Activated by Designer Drugs). This allows the translation activation of the interleukin to be canceled and the side effects to be suppressed when the side effects of the interleukin are too strong by administering the Designer Drug.

[0098] The pharmaceutical composition according to this embodiment may contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a substance commonly used in the pharmaceutical technology field that is added to facilitate the formulation and application of pharmaceutical compositions to living organisms without inhibiting or suppressing their functions. Examples of carriers include excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, and stabilizers. For example, lipid nanoparticles can be used as carriers for injectable formulations, but the carrier is not limited to a specific one.

[0099] The pharmaceutical composition according to this embodiment can be introduced into cells in vivo. Any commonly used method for introducing RNA into cells in vivo can be used. For example, in mammals, RNA molecules can be directly introduced into cells using intramuscular injection, subcutaneous injection, intravenous injection, intra-articular injection, or other methods. Alternatively, the composition can be introduced by being supported on a drug delivery carrier known in the art. Examples of such carriers include polymer nanoparticles, polymer micelles, dendrimers, liposomes, viral nanoparticles, and carbon nanotubes (see, e.g., Cho K. et al., Clin Cancer Res. 2008 Mar 1;14(5):1310-6). The pharmaceutical composition according to this embodiment can regulate the translation of a target protein in a ligand-specific manner. This is highly advantageous because it enables autonomous protein translation tailored to the disease state.

[0100] The present invention will be described in more detail below with reference to examples, which are not intended to limit the scope of the present invention.

[0101] [Experimental Methods] <Plasmid DNA Construction> Inserts were generated by PCR using PrimeSTAR Max DNA Polymerase (Takara Bio) and purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs). Cloning was performed using In-Fusion Snap Assembly Master Mix (Takara Bio). pDNA was amplified in Escherichia coli HST08 strain and purified using the Monarch plasmid miniprep Kit (New England Biolabs) or the PureYield Plasmid Miniprep System (Promega). DNA concentration was measured using a Nanodrop ONE (Thermo Fisher Scientific). The sequence of the constructed plasmid DNA was confirmed by Sanger DNA sequencing service (Azenta). The names and sequence numbers of the plasmid DNAs are shown in Table 1 below.

[0102]

[0103] <In vitro mRNA transcription> Template DNA was generated by PCR using PrimeSTAR Max DNA Polymerase and purified using the Monarch PCR & DNA Cleanup Kit. This template DNA was used as a template for approximately 6 hours of transcription at 37°C using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific). 6 mM ATP, CTP, GTP, N1-methyl-pseudo-UTP, and 4.8 mM CleanCap Reagent AG (3' OMe) (TriLink) were used as NTPs and cap analogs. After the reaction was completed, the DNA was purified using RNA CleanXP (Nippon Genetics). Dephosphorylation was performed at 37°C for 30 minutes using Quick CIP (New England Biolabs), followed by further purification using the RNeasy Mini Kit (Qiagen) or the Monarch RNA Cleanup Kit (New England Biolabs). RNA concentration was measured using a Qubit 4 Fluorometer in combination with the Qubit RNA BR Assay Kit (Thermo Fisher Scientific) or Nanodrop ONE. The size of the purified mRNA was confirmed using a Bioanalyzer and an RNA6000 Nano Kit (Agilent Technologies, Inc.) The names and sequence numbers of the template DNAs are shown in Table 2 below.

[0104]

[0105] <Transfection of messenger RNA into cells> 5 x 10 cells were placed in each well of a 96-well clear flat-bottom white plastic plate. 3 HuH-7 cells were seeded and cultured for one day in a CO2 incubator at 37°C. After that, the cells in each well were transfected with mRNA using 0.2 or 0.3 μl of Lipofectamine MessengerMAX (Thermo Fisher Scientific).

[0106] <Luciferase assay> After culturing the cells in a CO2 incubator at 37°C for 1 day after transfection, the luciferase activity of Luc2 and NanoLuc was measured using the Nano-Glo Dual-Luciferase Reporter Assay System (Promega) and a GloMax Navigator Microplate Luminometer (Promega). Luc2 luminescence was corrected by the luminescence of the transfection control, NanoLuc2, and expressed as a relative value, with the control value in each experiment set at 1.

[0107] Example 1: Translational activation via cleavage by TEV protease (TEVp) Plasmid DNA containing the gene for N-degron-fused CaVT was constructed to induce ligand-mediated approximation of receptor-fused TEVp and N-degron-fused CaVT, promoting CaVT degradation via TEVp cleavage of the N-degron N-terminus, thereby relieving translational repression by CaVT. To achieve ligand-dependent approximation of CaVT and receptor-fused TEVp, the N-terminus of CaVT was fused with not only an N-degron but also a β-arrestin gene as an adaptor protein that binds to activated receptors. Furthermore, considering the possibility that the N-degron fusion may affect CaVT protein folding, a linker sequence was added between the N-degron and CaVT. These plasmid DNAs were used as templates for PCR to generate linear DNAs for in vitro transcription, and mRNA was then generated from these DNAs by in vitro transcription.

[0108] To examine whether TEVp could relieve translational repression induced by N-degron-fused CaVT, we first transfected each mRNA into the human hepatocellular carcinoma (HuH-7) cell line. The conceptual structure of the CaVT used is shown in Figure 3. Three types of CaVT mRNA were used: (a) CaVT fused with an adaptor protein and an N-degron (no linker between the N-degron and CaVT), (b) CaVT fused with an adaptor protein and an N-degron (with a linker between the N-degron and CaVT), and (c) CaVT without an adaptor protein or an N-degron. The linker structure and length were 10 amino acid residues, with a highly flexible, glycine-rich structure. For each of these three types, we prepared a group with TEVp mRNA (which relieves translational repression) and a group without TEVp mRNA (which does not relieve translational repression). At the same time, we also introduced the off-switch mRNA 2xScMS2(C)-Luc2 (which expresses Luc2, a firefly luciferase), which is subject to translational control, and NanoLuc (Nluc) mRNA, a reporter to correct for variations in translation efficiency.

[0109] As a result, in all CaVT mRNA transfection groups (a)–(c), Luc2 translation repression was observed. Furthermore, in all CaVTs except for (c), which lacked an N-degron, this translation repression could be relieved by TEVp. Comparing (a) and (b), (a) exhibited weaker translation repression in the absence of TEVp, and therefore, the TEVp-induced change in translation level was greater in (b) (Fig. 4). Based on these results, (b) was used as the translational regulator in subsequent studies.

[0110] Example 2: Ligand-Responsive Translational Derepression Next, we constructed a ligand-responsive receptor fused to TEVp to examine whether the ligand could actually induce translational derepression by TEVp (Figures 1 and 2). The receptor we selected was the arginine vasopressin (AVP) receptor, a G protein-coupled receptor in which binding of the extracellular domain to a ligand induces binding of the intracellular domain to an adaptor protein. In addition to the full-length TEVp used in Example 1, three types of TEVp were fused to the receptor: a C-terminal truncated version in which the amino acids after K220 were removed to reduce ligand-independent cleavage; a C-terminal truncated version of the C-terminal truncated version, C-terminal truncated-T30A (the 30th amino acid residue of TEV protease was changed from threonine to alanine), and S135N. These receptor-fused TEVp mRNAs were transfected into HuH-7 cells together with the translational control factor CaVT, the off-switch mRNA 2xScMS2(C)-Luc2, and the reporter mRNA Nluc, which were also used in Example 1, and we examined whether translational repression could be relieved by adding the ligand AVP (10 μM).

[0111] As a result, we observed that the addition of AVP relieved translational repression in all cells transfected with receptor-fused TEVp mRNA, and the C-terminal truncated T30A fragment showed a particularly large increase in translational activity (Fig. 5).

[0112] Example 3: Ligand Concentration Dependence of Translational Repression We further investigated whether the translational repression induced by the combination of receptor-fused TEVp and the translational regulator CaVT is ligand concentration-dependent. We transfected HuH-7 cells with mRNAs of receptor-fused TEVp (C-terminal truncation-T30A), the translational regulator 2xScMS2(C)-Luc2, and Nluc, and analyzed the effect of the ligand AVP concentration on the translational yield of 2xScMS2(C)-Luc2, the target of translational regulation. As a result, even at a low concentration of 0.1 μM AVP, an increase in translation yield due to the repression of translational repression was observed. Furthermore, the translation yield increased with increasing AVP concentration. However, within the AVP concentration range of 0.1 to 10 μM, the increase in translation yield with increasing AVP concentration was gradual (Figure 6).

[0113] Example 4: Ligand concentration dependence of translational repression derepression The ligand concentration dependence of translational repression was examined under conditions more optimized than those in Example 3. As in Example 3, mRNAs of arginine vasopressin receptor-fused TEVp (C-terminal deletion-T30A), translational control protein, 2xScMS2(C)-Luc2, and Nluc were introduced into HuH-7 cells, and the effect of the ligand AVP concentration on the translational amount of 2xScMS2(C)-Luc2, the target of translational control, was analyzed. A concentration-dependent increase in translation amount was observed at 0.03 IU / ml or higher ( FIG. 7 ).

[0114] Example 5: Ligand Concentration Dependence of Translational Activation Deactivation. CaVT can be used for translational activation as well as translational repression by modifying the target mRNA. Therefore, we investigated whether translational activation can be deactivated in a ligand concentration-dependent manner, similar to translational repression. Arginine vasopressin receptor-fused TEVp (C-terminal truncation - T30A), translational control protein Nluc, and 1xMS2(U)site2-Luc2 mRNA were transfected into HuH-7 cells, and the effect of the ligand AVP concentration on the translational activity of 1xMS2(U)site2-Luc2, the target of translational regulation, was analyzed. The sequence of the template DNA used (1xMS2(U)site2-Luc2 IVT template) is shown in SEQ ID NO: 38. 1xMS2(U)site2-Luc2 is an on-switch mRNA that encodes the photoprotein Luc2, just like 2xScMS2(C)-Luc2. However, unlike 2xScMS2(C)-Luc2, which has a very strong CaVT-binding motif, 1xMS2(U)site2-Luc2 possesses a CaVT-binding motif with weak binding avidity that does not inhibit mRNA translation. Furthermore, to make translation dependent on the VPg protein contained in CaVT, the 5'-terminal cap structure was changed to A-cap, a translationally inactive Cap analog. As a result, as with the release of translational repression, a concentration-dependent decrease in translation was observed at AVP concentrations above 0.03 IU / ml (Figure 8).

[0115] Example 6: Receptor Modification for the Purpose of Changing the Target Molecule To investigate whether ligands other than arginine vasopressin could also be used as a target molecule, we created TEVp (C-terminal deletion-T30A) with the arginine vasopressin receptor fused to prostaglandin E2 receptor EP3, prostaglandin E2 receptor EP4, and bradykinin receptor B2. The sequences of the template DNA used (hEP3-TEVpDelta_T30A IVT template for CleanCap, hEP4-TEVpDelta_T30A IVT template for CleanCap, and hB2-TEVpDelta_T30A IVT template for CleanCap) are shown in SEQ ID NOs: 39 to 41. When the mRNAs of these receptor-fused TEVp (C-terminal truncated - T30A), translational regulatory protein, 2xScMS2(C)-Luc2, and Nluc were transfected into HuH-7 cells, the translational amounts of the prostaglandin E2 receptor EP4 and bradykinin receptor B2 increased in response to their corresponding ligands, prostaglandin E2 (Fig. 9) and bradykinin (Fig. 10), respectively.

[0116] Example 7: Translational Regulation of Secreted Anti-inflammatory Proteins To investigate whether translational regulation of proteins with actual therapeutic effects can be achieved in a similar manner to that of photoproteins, we constructed 2xScMS2(C)-IL1Ra-HiBiT, an mRNA encoding the anti-inflammatory protein IL-1Ra and containing a strong CaVT-binding motif. This 2xScMS2(C)-IL1Ra-HiBiT was co-transfected into HuH-7 cells with prostaglandin E2 receptor EP4-fused TEVp (C-terminal truncation - T30A) and mRNA for a translational regulatory protein, and the amount of IL-1Ra in the culture supernatant was quantified daily. The sequence of the template DNA used (2xScMS2(C)-IL1RA-HiBIT IVT template for CleanCap) is shown in SEQ ID NO: 42. Quantification was performed using a HiBiT tag fused to the C-terminus of IL-1Ra. The results demonstrated that the translational amount of IL1Ra increased in response to the target ligand, prostaglandin E2. Since prostaglandin E2 is a molecule secreted during inflammation, this result indicates that the translational level of a therapeutic protein can be regulated in response to an indicator molecule of the actual disease state.In contrast, no such ligand-dependent translational regulation was observed for the normal IL1Ra-HiBiT mRNA, which does not have a CaVT-binding motif (Fig. 11).

Claims

1. The following (a), (b), and (c): (a) an mRNA expressing a first fusion protein comprising a ligand recognition domain of a G protein-coupled receptor, an adaptor protein binding domain that binds to an adaptor protein in response to the ligand, and a sequence-specific protease; (b) an mRNA expressing a second fusion protein comprising an adaptor protein, a target sequence for the sequence-specific protease, a degradation promoting domain, and a translation control factor; (c) an off-switch or on-switch mRNA that has a binding site for the translation control factor in its 5'-UTR and encodes a protein of interest, or DNA encoding these.

2. The system described in claim 1, wherein the mRNA of (a) is a first mRNA comprising a nucleic acid sequence encoding the first fusion protein, and the mRNA of (b) is a second mRNA comprising a nucleic acid sequence encoding the second fusion protein.

3. The translation control factor is a Caliciviral VPg-based Translational activator (CaVT) or a mutant thereof, and the mRNA of (c) is an off-switch mRNA, which has a Cap structure or a Cap analog at the 5' end, and the translation control factor binding portion contains two or more binding motifs that specifically recognize MS2CP, and at least two of the two or more binding motifs are linked via an RNA scaffold structure, and the binding motif for MS2CP is represented by the following formula (I): (In the formula, N １ ~N １５ each independently represents A, C, G, or U; R represents G or A; Y represents U or C; N １ and N １５ By N ２ and N １４ By N ３ and N １３ By N ４ and N １２ By N ５ and N １１ By N ６ and N １０ and N ７ and N ９ and form a base pair or a wobble base pair, respectively.

4. The translation control factor is a Caliciviral VPg-based Translational activator (CaVT) or a mutant thereof, the mRNA of (c) is an on-switch mRNA, which does not have a 7-methylguanosine 5'-phosphate structure, the translation control factor binding portion contains one or more binding motifs that specifically recognize MS2CP, and the binding motif for MS2CP is represented by the following formula (I): (In the formula, N １ ~N １５ each independently represents A, C, G, or U; R represents G or A; Y represents U or C; N １ and N １５ By N ２ and N １４ By N ３ and N １３ By N ４ and N １２ By N ５ and N １１ By N ６ and N １０ and N ７ and N ９ and form a base pair or a wobble base pair, respectively.

5. The system of claim 1, wherein the ligand recognition domain of the G protein-coupled receptor and the adaptor protein binding domain comprise amino acid sequences derived from an arginine vasopressin receptor, a prostaglandin receptor, or a bradykinin receptor.

6. The system of claim 1, wherein the sequence-specific protease is a tobacco etch virus protease.

7. The system of claim 1, wherein the degradation-promoting domain is an N-degron.

8. A method for controlling intracellular mRNA translation in response to a ligand, comprising the step of introducing into a cell the system described in claim 1.

9. A pharmaceutical composition comprising the system of claim 1 and a pharma- ceutically acceptable carrier.