GENOTYPING KITS

Abstract

The present invention relates to a kit comprising: a flow cell, which includes: a substrate; and first and second capture primers bound to the substrate; and a genotyping probe fluid, which includes: a liquid carrier; and a genotyping oligonucleotide in the liquid carrier, the genotyping oligonucleotide including: a first primer sequence; a probe sequence representative of a target genotyping locus; a restriction endonuclease site; and a second primer sequence that is at least partially complementary to the second capture primer.

Description

GENOTYPING KITS Cross-reference to related request This application claims the benefit of the U.S. provisional application serial number 62 / 981,866, filed on February 26, 2020, the contents of which are incorporated by reference in the present description in their entirety. Reference to the sequence list The sequence list submitted via EFS-Web is incorporated into this description in its entirety by reference. The file name is ILI184BPCT_IP-1897-PCT_Sequence_Listing_ST25.txt, the file size is 788 bytes, and the file creation date is December 29, 2020. Background The detection of specific nucleic acids can be used for research in diagnostic medicine and molecular biology. Gene probe assays can be useful, for example, for identifying infectious organisms, such as bacteria and viruses; in probing the expression of normal and mutant genes and identifying mutant genes, such as oncogenes; in tissue typing for compatibility before tissue transplantation; in comparing tissue or blood samples for forensic medicine; and for exploring homology between genes of different species. Summary This description outlines genotyping oligonucleotides that include specific sections of nucleotide sequences designed to perform designated functions in clustering, linearization, target locus identification, and / or sequencing. These genotyping oligonucleotides enable genotyping to occur in patternless or patterned flow cells and do not require additional immobilization components. A first aspect described herein is a kit comprising a flow cell including a substrate; and the first and second capture primers bound to the substrate; and a genotyping probe fluid, including: a liquid carrier; and a genotyping oligonucleotide in the liquid carrier, the genotyping oligonucleotide including: a first primer sequence; a probe sequence representative of a target genotyping locus; a restriction endonuclease site; and a second primer sequence that is at least partially complementary to the second capture primer. anocLn / Lznz / E / Yii It should be understood that any features of the kit described herein may be combined with each other in any manner and / or configuration desirable to achieve the benefits as described herein, which include, for example, achieving genotyping in a flow cell. A second aspect described herein is a method comprising: introducing a genotyping probe fluid into a flow cell that includes the first and second capture primers, the genotyping probe fluid including a plurality of genotyping oligonucleotides, each of the genotyping oligonucleotides including a first primer sequence; a probe sequence representative of a respective target genotyping locus; a restriction endonuclease site; and a second primer sequence that is at least partially complementary to the second capture primer, whereby a respective genotyping oligonucleotide reacts to produce respective clonal populations of amplicons of the respective genotyping oligonucleotide; linearizing the amplicons to produce probe templates;Sequence at least one probe identification section of the probe templates to identify each of the probe sequences; remove at least the respective incipient chains from the probe templates, thereby exposing a 3' OH group at one end of the probe templates; hybridize the respective samples to the probe templates; and perform the respective genotyping reactions of the samples on the exposed 3' OH groups. It should be understood that any of the method's features can be combined with others in any desirable way. Furthermore, it should be understood that any combination of the method's and / or kit's features can be used together and / or combined with any of the examples described herein to achieve the benefits as outlined herein, including, for example, achieving genotyping in a flow cell. Brief description of the figures The characteristics of the examples in this description will become clear with reference to the detailed description and figures that follow, in which similar reference numbers correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numbers or characteristics that have a function described above may or may not be described in connection with other figures in which they appear. Figure 1A is a schematic illustration of an illustrative genotyping oligonucleotide described herein; Figure 1B is a schematic illustration of another illustrative genotyping oligonucleotide described herein; onocLn / Lznz / E / Yii Figure 2A is a top view of an illustrative flow cell; Figure 2B is an enlarged and partially cropped view of an illustrative flow channel of the flow cell, including the depressions formed along the flow channel; Figures 3A to 3H schematically represent one illustrative method described in this description; and Figures 4A to 4H schematically represent another illustrative method described in this description. Detailed Description This description outlines genotyping oligonucleotides that include specific sections of nucleotide sequences. Each section of the nucleotide sequences in the genotyping oligonucleotide is designed to have a designated function in clustering, linearization, target locus identification, and / or sequencing. Genotyping oligonucleotides can be used in a patternless flow cell with capture primers on its surface, or in a patterned flow cell with depressions containing capture primers. Monoclonal populations (clusters) of amplicons can be generated from the respective genotyping oligonucleotides in different areas on the surface of the patternless flow cell or within the respective depressions of the patterned flow cell. The amplicons in a particular area or depression may differ from the amplicons in each of the other areas or depressions; therefore, each monoclonal population of amplicons can represent a unique target locus for genotyping. The genotyping oligonucleotides described herein allow genotyping to take place in patternless or patterned flow cells and do not require additional immobilization components, such as solid-phase globules. Furthermore, the genotyping oligonucleotides described herein may be suitable for use with any flow cell surface that uses cloning-amplified clusters. This description also includes methods for preparing a target genotyping locus, which can be used with the genotyping oligonucleotides. These methods are amplification methods that generate genomic DNA (gDNA) fragments without the need to introduce a cleavage site and perform fragmentation. anocLn / Lznz / E / Yii Definitions The terms used in this description shall be understood to have their ordinary meaning in the relevant art unless otherwise specified. Several terms used in this description and their meanings are set out below. As used in this description, the singular terms “a,” “an,” and “the” refer to both singular and plural unless the context clearly indicates otherwise. The term “comprising,” as used in this description, is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional unlisted stages of the method or elements. References throughout this specification to “an example,” “another example,” and so on, mean that a particular element (e.g., feature, structure, composition, and / or configuration) described in connection with the example is included in at least one example described herein and may or may not be present in other examples. Furthermore, it is understood that the elements described for any example may be combined in any suitable manner across the various examples unless the context clearly dictates otherwise. The terms “substantially” and “approximately” used throughout this specification, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms may refer to less than or equal to ±10% of a stated value, less than or equal to ±5% of a stated value, such as less than or equal to ±2% of a stated value, such as less than or equal to ±1% of a stated value, such as less than or equal to ±0.5% of a stated value, such as less than or equal to ±0.2% of a stated value, such as less than or equal to ±0.1% of a stated value, such as less than or equal to ±0.05% of a stated value. Furthermore, it should be understood that the ranges provided in this description include the stated range and any values ​​or subranges within that range, as if explicitly stated. For example, a range represented by approximately 2 mm to approximately 300 mm should be understood to include not only the explicitly stated limits of approximately 2 mm to approximately 300 mm, but also individual values ​​such as approximately 15 mm, 22.5 mm, 245 mm, etc., and subranges such as approximately 20 mm to approximately 225 mm, etc. Bonded: The state of two things being joined, held, attached, connected, or linked to each other, either directly or indirectly. For example, a nucleic acid can be bound to a functionalized polymer by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a physical bond that does not involve the sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, Van der Waals forces, hydrophilic interactions, and hydrophobic interactions. When two things are bound directly, there is no intermediate component. For example, the first capture primer and probe sequence in some illustrative anocLn / Lznz / E / Yii genotyping oligonucleotides are directly covalently linked to each other. When two things are bound indirectly, there is some intermediate component.For example, the first capture primer and probe sequence in some illustrative genotyping oligonucleotides are indirectly linked to each other through an index sequence portion and a primer site portion. Deposition: Any suitable application technique, which may be manual or automated and, in some cases, results in the modification of surface properties. Generally, deposition can be achieved using vapor deposition techniques, coating techniques, grafting techniques, or similar methods. Specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), rotary coating, dip coating, scraper blade coating, paddle dispensing, through-flow coating, spray printing, screen printing, micro-contact printing, inkjet printing, or similar methods. Depression: A distinct concave feature in a substrate or patterned resin that has a surface opening at least partially surrounded by one or more interstitial regions of the substrate or patterned resin. Depressions can have any of a variety of shapes at their opening on a surface, including, for example, round, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As examples, the depression can be a pit or two interconnected pits. The depression can also have more complex architectures, such as ridges, stepped features, etc. Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to all items in the collection. Exceptions may occur if explicit disclosure or context clearly dictates otherwise. Flow cell: A vessel having a chamber (e.g., a flow channel) where a reaction can take place, an inlet for supplying one or more reactants to the chamber, and an outlet for removing one or more reactants from the chamber. In some examples, the chamber allows for the detection of the reaction occurring within it. For example, the chamber may include one or more transparent surfaces that enable the optical detection of arrays, optically labeled molecules, or similar. Genomic DNA (gDNA): One or more polymeric chromosomal molecules of deoxyribonucleotides that occur naturally in the nucleus of a eukaryotic or prokaryotic cell, a virus, a mitochondrion, or a chloroplast and contain sequences that are naturally transcribed into RNA as well as sequences that the cell does not naturally transcribe into RNA. A eukaryotic gDNA contains at least one centromere, two telomeres, an origin of replication, and a sequence that the eukaryotic cell does not transcribe into RNA, which includes, for example, an intron or a transcription promoter. A prokaryotic gDNA contains at least one origin of replication and a sequence that the prokaryotic cell does not transcribe into RNA, which includes, for example, a transcription promoter.Eukaryotic genomic DNA can be distinguished from prokaryotic, viral, or organular genomic DNA, for example, according to the presence of introns in eukaryotic genomic DNA and the absence of introns in the gDNA of the others. Genotyping oligonucleotide: A single-stranded deoxyribonucleic acid sequence that includes sections of specific nucleotide sequences, one of which is a probe sequence representing a target locus for genotyping. The genotyping oligonucleotide can serve as a template for group generation. Index sequence portion: A short string, ranging from 10 to 30 nucleobases, that identifies the probe sequence in some illustrative genotyping oligonucleotides. Locus or Loci: A specific sequence location in a nucleic acid sample. The term may include predetermined or predicted nucleic acid sequences expected to be present in isolated nucleic acid molecules. These predetermined or predicted nucleic acid sequences may be referred to herein as “target genotyping loci” and may be region(s) of interest for analysis. The term is intended to encompass single nucleotide polymorphisms (SNPs), mutations, variable number of tandem repeats (VNTRs) and single tandem repeats (STRs), other polymorphisms, insertions, deletions, splicing variants, or any other known genetic marker. Nucleic acid; A polymeric or oligomeric form of nucleotides of any length, and may include deoxyribonucleotides, their analogues, or mixtures thereof. The term may refer to single-stranded or double-stranded oligonucleotides or to polynucleotides. Nucleotide: A heterocyclic base (a nucleobase) containing nitrogen, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of a nucleic acid sequence. In ribonucleotides (RNA), the sugar is ribose, and in deoxyribonuclease (DNA), the sugar is deoxyribose, a sugar lacking the hydroxyl group present at the 2' position in ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be either a purine or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogues of these. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified analogues and derivatives of these. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. Naturally occurring nucleotides generally have a backbone containing phosphodiester bonds.A nucleic acid analog can have any of the phosphate backbone, the sugar, or the nucleobase altered. Illustrative nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs such as peptide nucleic acid (PNA). onocLn / Lznz / E / Yii Nucleotide sequence section: A portion of the genotyping oligonucleotide. Each portion of the genotyping oligonucleotide can be designed to be involved in the specific process(es) in the method(s) described herein. Primer: A single-stranded deoxyribonucleic acid sequence that can hybridize to a specific sequence. An illustrative primer is a “capture primer.” A capture primer can be present in the depressions of a flow cell and can hybridize to a primer sequence of a genotyping oligonucleotide or an amplicon thereof. The capture primer can serve as a starting point for amplification and cluster generation. Another illustrative primer is a “sequencing primer.” A sequencing primer can hybridize to a portion of a single-stranded probe template to prime the synthesis of at least a portion of the single-stranded probe template. Other primers, such as random primers, can be used in a random primer amplification reaction to generate gDNA fragments, such as the target genotyping locus.Any primer can include any combination of nucleotides or their analogues. The primer length can be any number of bases and can include a variety of non-natural nucleotides. For example, a capture primer or a sequencing primer is a short string, ranging from 10 to 60 nucleobases, or from 20 to 40 nucleobases. Portion of the priming sequence: A priming site for sequencing a portion of the index sequence, both of which are included in some illustrative genotyping oligonucleotides. Probe sequence: A specific section of the genotyping oligonucleotide that includes a nucleotide sequence representing a target locus for genotyping. The probe sequence, or an amplicon thereof, includes 25 to 50 nucleobases in a specific order that is complementary to, and therefore can hybridize with, the target locus sequence. Single-stranded probe template: A single-stranded deoxyribonucleic acid sequence generated during clustering. The genotyping oligonucleotide serves as a template for cluster generation, and thus single-stranded probe templates are amplicons, or amplicon portions, of the genotyping oligonucleotide. Genotyping oligonucleotides Figures 1A and 1B schematically represent two different examples of 10,10' genotyping oligonucleotides. Each of the 10,10' genotyping oligonucleotides includes sections of specific nucleotide sequences, including a first primer sequence 12, a probe sequence 14, a restriction endonuclease site 16 or 16', and a second primer sequence 18 or 18'. anocLn / Lznz / E / Yii The illustrative genotyping oligonucleotide 10 shown in Figure 1A includes the first primer sequence 12 directly and covalently linked to the probe sequence 14, which is directly and covalently linked to the restriction endonuclease site 16, which is directly and covalently linked to the second primer sequence 18. An example of the method involving these genotyping oligonucleotides 10 is shown and described with reference to Figures 3A to 3H. The first primer sequence 12 of the genotyping oligonucleotide 10 may have the same polarity and sequence as a capture primer 22 (see Figure 2B) present on the surface of a flow cell 20 (see Figure 2A and Figure 2B). As such, the number, order, and type of nucleobases in at least a portion of the first primer sequence 12 depends on the number, order, and type of nucleobases in the capture primer 22. During clustering, amplicons are generated from the genotyping oligonucleotides 10 that include a sequence complementary to the first primer sequence 12 (e.g., P5'). This complementary portion (shown as C12 in Figure 3B) can hybridize to the capture primer 22. In one example, the first capture primer 22 has a universal sequence for capture and / or amplification purposes. An example of the first capture primer 22 includes P5 primers, examples of which are used on the surface of commercial flow cells marketed by Illumina Inc. for sequencing, for example, in HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOMA Analyzer™, and other instrument platforms. In another example, the first capture primer 22 includes the following: First catch feeder: 5' -> 3' AATGATACGGCGACCACCGA (sec. with ident. no. 1). The first primer sequence 12 may have the same sequence as the first capture primer 22. Although an example has been provided, it should be understood that other sequences may be used for the first primer 12 sequence and for the first capture primer 22. The first primer sequence 12 may also be at least partially the same as the first capture primer 22. By “at least partially the same” it is meant that a sufficient number of nucleobases in the first primer sequence 12 and in the first capture primer 22 are identical so that hybridization can occur between the two 12, 22. The first primer sequence 12 of the genotyping oligonucleotide 10 is directly linked to probe sequence 14. Probe sequence 14 is representative of a target genotyping locus. Therefore, probe sequence 14 is able to hybridize with the target locus sequence during genotyping. The restriction endonuclease site 16 of genotyping oligonucleotide 10 is directly linked to probe sequence 14. This restriction endonuclease site 16 provides genotyping oligonucleotide 10 with a digestion site. In one example, restriction endonuclease site 16 is sensitive to a restriction enzyme selected from the group consisting of a 4-base cleaver, a 5-base cleaver, and a 6-base cleaver. Some examples of 4-base cleavers include Dpnll, Fatl, MluCI, BfuCI, Mbol, Sau3AI, Bfal, BstUI, Pmll, Kasl, and others commercially available, for example, from New England BioLabs Inc., Thermo Fisher Scientific, etc. Some examples of 5-base cutters include BssKI, StyD41, Mael11, PspGI, Ddel, Fmul, PspGI, Tfil and others commercially available, for example, from New England BioLabs Inc.ThermoFisher Scientific, etc. Some examples of base 6 cutters include Acll, Afel, Nspl, Haell, Tatl, and others that are commercially available, for example, from New England BioLabs Inc., ThermoFisher Scientific, etc. The restriction endonuclease site 16 is located such that after cleavage / digestion with a restriction enzyme, the last base of probe sequence 14 is the final 3' OH that is exposed for the sequencing / genotyping reaction. The second primer sequence 18 of the genotyping oligonucleotide 10 is at least partially complementary to the second capture primer 24 (see Figure 2B) that is present on the surface of a flow cell 20. By “at least partially complementary” it is meant that a sufficient number of nucleobases in the second primer sequence 18 and in the second capture primer 24 are complementary so that hybridization can occur between the two 18, 24. As such, the number, order, and type of nucleobases in the second primer sequence 18 depend on the number, order, and type of nucleobases in the second capture primer 24. In one example, the second capture primer 24 has a universal sequence for capture and / or amplification purposes. An example of the second capture primer 24 includes the P7 primers, examples of which are used on the surface of commercial flow cells marketed by Illumina Inc. for sequencing, for example, in HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOMA Analyzer™, and other instrument platforms. In another example, the second capture primer 24 includes the following: Second catch feeder: 5' -► 3' CAAGCAGAAGACGGCATACGA (Section ID No. 2) The second primer 18 sequence is at least partially complementary to the second capture primer 24 sequence. In this example, the second primer 18 sequence may include the following: Second primer sequence: 5' —► 3' GTTCGTCTTCTGCCGTATGCT (sec. ID 3) Although an example has been provided, it should be understood that other sequences may be used for the second primer sequence 18 and for the second capture primer 24. anocLn / Lznz / E / Yii The second capture primer 24 in flow cell 20 also includes a cleavage site (see reference number 46 in Figure 3A). The cleavage site can be used to linearize bridging probe templates after cluster formation (described further with reference to Figure 3E). The chemistry of the cleavage site of the second capture primer 24 can be different from the chemistry of the restriction endonuclease site 16 of genotyping nucleotide 10 so that premature digestion of restriction endonuclease site 16 does not occur. The cleavage site and the restriction endonuclease site 16 have separate and specific cleavage reactions. These reactions can be considered orthogonal, since one reaction does not initiate, affect, or otherwise interfere with the other.Examples of suitable cleavage sites for the second capture primer 24 include enzymatically cleavable or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., links between nucleobases). The enzymatically cleavable nucleobase may be susceptible to cleavage by reaction with a glycosylase and an endonuclease, or with an exonuclease. A specific example of a cleavable nucleobase is deoxyuracil (dU), which the USER enzyme can target. In one example, the uracil base can be incorporated at position 7 from the 3' end of the second capture primer 24. In addition, other abasic sites can be used.Examples of chemically cleavable nucleobases, modified nucleobases, or connectors include 8-oxoguanine, a vicinal diol, a disulfide, a silane, an azobenzene, a photocleavable group, allyl T (a nucleotide analogue of thymine having allyl functionality), allyl ethers, or an ether with azide functionality. With reference now to Figure 1B, another example of a genotyping oligonucleotide 10' is schematically illustrated. The illustrative genotyping oligonucleotide 10' shown in Figure 1B includes more sections of nucleotide sequences than the genotyping oligonucleotide 10' shown in Figure 1A. Specifically, the genotyping oligonucleotide 10' further comprises an index sequence portion 26 and a priming site portion 28. In this example, the genotyping oligonucleotide 10' includes the first primer sequence 12 directly and covalently linked to the index sequence portion 26, which is directly and covalently linked to the priming site portion 28, which is directly and covalently linked to probe sequence 14, which is linked to the second primer sequence 18'.In this example, the 16' restriction endonuclease site can be located between probe sequence 14 and the second primer sequence 18', or it can be integrated into the second primer sequence 18'. An example of the method involving these 10' genotyping oligonucleotides is shown and described with reference to Figures 4A to 4H. The first primer sequence 12 of the genotyping oligonucleotide 10' can be any example set forth in the present description for the genotyping oligonucleotide 10. The first primer sequence 12 of the genotyping oligonucleotide 10' binds directly to index sequence portion 26. Index sequence portion 26 is unique to probe sequence 14 in the genotyping oligonucleotide 10'. As such, index sequence portion 26 provides a distinct identifier or barcode that can be used to identify the target locus sequence represented by probe sequence 14. anocLn / Lznz / E / Yii The index sequence portion 26 binds directly to the priming site portion 28. The priming site portion 28 can hybridize to a sequencing primer that initiates the introduction of nucleotides along the index sequence portion 26 in a template-dependent manner, one nucleobase at a time. The priming site portion 28 of the genotyping oligonucleotide 10' binds directly to probe sequence 14. As described herein, probe sequence 14 is capable of hybridizing to the target locus sequence during genotyping. In the genotyping oligonucleotide 10', probe sequence 14 binds to the second primer sequence 18'. In some examples, probe sequence 14 binds indirectly to the second primer sequence 18', and the restriction endonuclease site 16' is located between the two 14,18' sections. In other examples, probe sequence 14 binds directly to the second primer sequence 18', and the restriction endonuclease site 16' is integrated into the second primer sequence 18'. In either of these examples, the restriction endonuclease site 16' may be sensitive to a Type US restriction enzyme. The Type IIS restriction enzyme may be methyl-sensitive or methyl-insensitive. US-type restriction enzymes are a specific group of enzymes that recognize asymmetric DNA sequences (e.g., the 16' restriction endonuclease site) and cleave at a defined distance (e.g.(from 1 nucleotide to approximately 20 nucleotides) outside the recognition sequence. Some examples of methyl-insensitive US-type restriction enzymes are selected from the group consisting of Bbvl (BseXI), Bmrl, Bvel (BspMI), etc. Some methyl-sensitive US-type restriction enzymes are selected from the group consisting of SfaNI, FoKI, HGAI, etc. While some examples have been provided, any suitable US-type restriction enzyme can be used, depending on the recognition sequence of the 16' restriction endonuclease site. Both methyl-sensitive and methyl-insensitive enzymes are commercially available, for example, from New England BioLabs Inc., ThermoFisher Scientific, etc. When the 16' restriction endonuclease site is attached to the 18' end of the second primer sequence, any example of the second primer 18' sequence can be used. When the 16' restriction endonuclease site is integrated into the second primer 18' sequence, the 16' restriction endonuclease site can be inserted at any desired position along the length of the second primer 18' sequence. The position may depend on the position of a second restriction endonuclease site along the second 24' capture primer, the defined cleavage distance of the Type 11S restriction enzyme to be used, and where the cleavage is desired along the 10' genotyping oligonucleotide (or an amplicon thereof).This cleavage occurs before a genotyping reaction (during linearization, as further described herein) and makes the 10' genotyping oligonucleotide, or an amplicon thereof, ready for analysis of a target genotyping locus at a nucleobase of interest. For example, during a genotyping reaction, a sample of single-stranded DNA, e.g., the target genotyping locus, is hybridized, e.g., with the amplicon, and a one-synthesis sequencing reaction is performed to identify the nucleobase of interest. For this analysis to occur, the amplicon must be cleaved at a defined position, at anocLn / Lznz / E / Yii, where the next nucleobase to be sequenced is complementary to the nucleobase of interest.As such, the 16' restriction endonuclease site is positioned so that, after cleavage / digestion with a restriction enzyme, the last base of probe sequence 14 is the 3' end OH group exposed for sequencing / genotyping. For example, the 16' restriction endonuclease site can be integrated anywhere from base position 7 to base position 15 from the 3' end of the second primer sequence 18'. With the genotyping oligonucleotide 10', the second primer sequence 18' is complementary to the second capture primer 24' (see Figure 2B) that is present on the surface of a flow cell 20. As such, the genotyping oligonucleotide 10' can hybridize to the second capture primer 24' in the flow cell 20. The second 24' capture primer may also include the second restriction endonuclease site (see reference number 46' in Figure 4A), where the second restriction endonuclease site is complementary to the 16' restriction endonuclease site of the 10' genotyping oligonucleotide. Asymmetric sequences may be sensitive to type IIS restriction endonucleases. Cleavage within a certain predefined distance of the hybridized 16', 46' restriction endonuclease sites is performed during linearization (as mentioned above and further described with reference to Figure 4F). This removes the strands that should not be genotyped.The position of the second 46' restriction endonuclease site can be at the end or integrated into the second 24' capture primer, provided that the two 16', 46' restriction endonuclease sites can hybridize and form the Type IIS restriction endonuclease recognition site. Any example of the genotyping oligonucleotide 10,10' can be prepared using oligonucleotide synthesis processes. Flow cells The 10,10' genotyping oligonucleotides can be used with any patterned flow cell 20. Although not shown, it should be understood that other non-patterned flow cells (e.g., those without depressions) using the clustering chemistry described herein may be used alternatively in the examples described herein. With non-patterned flow cells, the clusters can be identified using software. An example of a patterned flow cell 20 is illustrated in Figure 2A, and an example of the patterned architecture within the flow cell 20 is shown in Figure 2B. The flow cell 20 includes a substrate 30 that at least partially defines a flow lane or channel 32. anocLn / Lznz / E / Yii Substrate 30 can be a single layer / material. Suitable illustrative single-layer substrates include epoxysiloxane, glass, modified or functionalized glass, plastics (including acrylics, polystyrene and styrene copolymers and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefin / cycloolefin (COP) polymers (such as ZEONOR® from Zeon), polyamides, etc.), nylon (polyamides), ceramics / ceramic oxides, silica, fused silica or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2Us) or other tantalum oxides (TaOx), hafnium oxide (HfO2), carbon, metals, inorganic glasses, or the like. When substrate 30 is a single layer, the depressions 38 (see Figure 2B) are defined in the single layer. As illustrated in Figure 2B, the substrate 30 can also be a multilayer substrate 30'. Examples of multilayer substrates 30' include glass or silicon with a coating layer of tantalum oxide or another ceramic oxide on the surface. Other examples of multilayer substrates 30' include a silicon-on-insulator (SOI) substrate. In the example shown in Figure 2B, the multilayer substrate 30' includes an underlying support 34 (e.g., glass or silicon) and a patterned material 36 located on the support 34. The pattern material 36 defines the depressions 38, which are separated by interstitial regions 40. The depressions 38 are located within each of the flow channel(s) 32. It should be understood that any material that can be selectively deposited, or deposited and patterned to form depressions 38 and interstitial regions 40, can be used for patterned material 36. As an example, an inorganic oxide can be selectively applied to substrate 34 by vapor deposition, spray printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., TazOs), aluminum oxide (e.g., Al₂O₃), silicon oxide (e.g., S₁O₂), hafnium oxide (e.g., HfO₂), etc. As another example, a resin can be applied to substrate 34 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, flood coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, scraper coating, spray printing, screen printing, micro-contact printing, etc. Suitable pattern application techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, micro-embossing techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin (e.g., POSS®, de Hybird Plastics), una resina epoxi silsesquioxano oligomérico no poliédrico, una resina de poli(etilenglicol), anocLn / Lznz / E / Yii una resina poliéter (p. ej., epoxis de anillo abierto), una resina acrílica, una resina de acrilato, una resina de metacrilato, una resina de fluoropolímero amorfo (p. ej., CYTOP®de Bellex) y combinaciones de estas. As used in this description, the term “polyhedral oligomeric silsesquioxane” refers to a chemical composition that is a hybrid intermediate (e.g., RS₂O₃.s) between silica (SiO₃) and silicon (R₂SiO₃). An example of a polyhedral oligomeric silsesquioxane is described in Kehagias et al., Microelectronics Engineering 86 (2009), pp. 776–778, which is incorporated herein by reference. In one example, the composition is an organosilicon compound with the chemical formula [RS₂O₃]ₙ, where the R groups may be the same or different. Illustrative R groups for polyhedral oligomeric silsesquioxane include epoxy, azide / azide, a thiol, a poly(ethylene glycol), a norbornene, a tetrazine, acrylates and / or methacrylates, or, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups. The resin composition described herein may comprise one or more different cage or core structures as monomeric units. In one example, the 30, 30' substrate can be fabricated using a round wafer with a diameter ranging from approximately 2 mm to approximately 300 mm, or a rectangular sheet or panel with its largest dimension up to approximately 10 feet (3 meters). In another example, the 30, 30' substrate is fabricated using a round wafer with a diameter ranging from approximately 200 mm to approximately 300 mm. In yet another example, a rectangular panel with a larger surface area than a 300 mm round wafer can be used. Large wafers, panels, and other substrate materials can be diced into individual 30, 30' flow cell substrates. In another example, the 30, 30' substrate is a die with a width ranging from approximately 0.1 mm to approximately 10 mm.Although illustrative dimensions have been provided, it should be understood that a substrate material with any of the dimensions suitable for making the 30, 30' substrate may be used. Flow cell 20 also includes a flow channel 32. Although several flow channels 32 are shown in Figure 2A, it should be understood that any number of channels 32 can be included in flow cell 20 (e.g., a single channel 32, four channels 32, etc.). Each flow channel 32 is a defined area between two bonded components (e.g., substrate 30, 30' and a lid, or two substrates 30, 30') into which fluids can be introduced and withdrawn. Each flow channel 32 can be isolated from every other flow channel 32 such that fluid introduced into any particular flow channel 32 does not flow into any adjacent flow channel 32. Examples of fluids introduced into flow channels 32 include reaction components (e.g., target locus gene library fragments, polymerases, etc.), washing solutions, and so on. As mentioned, flow channel 32 is defined between substrate 30, 30' and a lid (not shown) or between substrate 30, 30' and another substrate (not shown, but similar to substrate 30, 30'). anocLn / Lznz / E / Yii In one example, the cap or additional substrate can be bonded to at least a portion of the substrate 30, 30' e.g., in some of the interstitial regions 40. The bond formed between the cap and the additional substrate and the substrate 30, 30' can be a chemical bond, or a mechanical bond (e.g., using a fastener, etc.). The lid can be made of any material transparent to excitation light directed toward the substrate. Examples include glass (e.g., borosilicate, fused silicon, etc.), plastic, or similar materials. A commercially available example of suitable glass is D263® borosilicate glass, available from Schott North America, Inc. Commercially available examples of suitable plastic materials, namely cycloolefin polymers, are the ZEONOR® products available from Zeon Chemicals LP. The additional lid or substrate can be bonded to substrate 30, 30' using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma-activated bonding, glass filter bonding, or other methods known in the art. In one example, a bonding layer can be used to bond the lid or additional substrate to substrate 30, 30'. The bonding layer can be made of any material that will seal at least part of substrate 30, 30' and the lid or additional substrate from each other. In some examples, the bonding layer can be a radiation-absorbing material that aids in bonding. In one example, flow channel 32 has a rectangular configuration. The length and width of flow channel 32 may be smaller than the length and width of substrate 30, 30', respectively, so that the portion of the substrate surface surrounding flow channel 32 is available for bonding to a cap (not shown) or another substrate 30, 30'. In some cases, the width of each flow channel 32 may be at least approximately 1 mm, at least approximately 2.5 mm, at least approximately 5 mm, at least approximately 7 mm, at least approximately 10 mm, or greater. In some cases, the length of each flow channel 32 may be at least approximately 10 mm, at least approximately 25 mm, at least approximately 50 mm, at least approximately 100 mm, or greater. The width and / or length of each flow channel 32 may be greater than, less than, or between the values ​​specified above.In another example, flow channel 32 is square (e.g., 10 mm x 10 mm). The depth of each flow channel 32 can be as small as the thickness of a monolayer, for example, when micro-contact, spray, or inkjet printing is used to deposit a coating layer that defines the flow channel walls. The depth of the flow channel 32 can be greater, for example, when the flow channel 32 is partially defined in the substrate 30,30' (e.g., by etching, lithography, etc.) so that a portion of the substrate and the coating layer define the flow channel walls. As further examples, the depth of each flow channel 32 can be approximately 1 µm, approximately 10 µm, approximately 50 µm, approximately 100 µm, or greater. In one example, the depth can range from approximately 10 µm to approximately 100 µm. In another example, the depth can range from approximately 10 µm to approximately 30 µm. In yet another example, the depth is approximately 5 µm or less.It should be understood that the depth of each flow channel 32 may be greater than, less than, or between the values ​​specified above. anocLn / Lznz / E / Yii With reference specifically now to Figure 2B, an illustrative architecture is shown within one of the flow channels 32 of flow cell 20. As shown in Figure 2B, the patterned material 36 includes the depressions 38 defined therein and the interstitial regions 40 that separate adjacent depressions 38. Many different layers of depressions 38 can be considered, including regular, repeating, and irregular patterns. In one example, the depressions 38 are arranged in a hexagonal grid to achieve close packing and improved density. Other layers may include, for example, rectangular layers, triangular layers, and so on. In some examples, the layer or pattern may be an xy format of depressions 38 arranged in rows and columns. In some other examples, the layer or pattern may be a repeating arrangement of depressions 38 and / or interstitial regions 40. In still other examples, the layer or pattern may be a random arrangement of depressions 38 and / or interstitial regions 40.The pattern may include stripes, spirals, lines, triangles, rectangles, circles, arcs, squares, diagonals, arrows, and / or patterns. The layer or pattern of depressions 38 can be characterized with respect to the density of depressions 38 (number of depressions 38) in a defined area. For example, depressions 38 may be present at a density of approximately 2 million per mm². The density can be adjusted to different densities, including, for example, approximately 100 per mm², approximately 1000 per mm², approximately 0.1 million per mm², approximately 1 million per mm², approximately 2 million per mm², approximately 5 million per mm², approximately 10 million per mm², approximately 50 million per mm², or more or less. It should be further understood that the density of depressions 38 in the material with pattern 36 may fall between one of the lower and one of the upper values ​​selected from the ranges above.As examples, a high-density array might be characterized by having 38 depressions separated by less than approximately 100 nm, a medium-density array might be characterized by having 38 depressions separated by approximately 400 nm to approximately 1 pm, and a low-density array might be characterized by having 38 depressions separated by more than approximately 1 pm. While illustrative densities have been provided, it should be understood that any suitable density may be used. The density of the 38 depressions may depend, in part, on the depth of the 38 depressions. In some cases, it may be desirable for the spacing between the 38 depressions to be even greater than the examples listed in this description. The layer or pattern of depressions 38 can also or alternatively be characterized in terms of the average pitch, or the spacing from the center of depression 38 to the center of an adjacent depression 38 (center-to-center spacing) or from the left end of one depression 38 to the right end of an adjacent depression 38 (end-to-end spacing). The pattern may be regular, such that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, approximately 50 nm, approximately 0.1 pm, approximately 0.5 pm, approximately 1 pm, approximately 5 pm, approximately 10 pm, approximately 100 pm, or more or less.The average step for a particular pattern of depressions 38 may fall between one of the lower and upper values ​​selected from the ranges above. In one example, depressions 38 have a step (center-to-center spacing) of approximately 1.5 pm. While illustrative average step values ​​have been provided, it should be understood that other average step values ​​may be used. The size of each depression 38 can be characterized by its volume, opening area, depth and / or diameter. Each depression 38 can have any volume capable of confining a fluid. The minimum or maximum volume can be selected, for example, to accommodate the expected throughput (e.g., multiplexing), resolution, nucleotides, or analyte reactivity for subsequent uses of the flow cell 20. For example, the volume can be at least approximately 1 x 10⁻³ pm³, at least approximately 1 x 10⁻² pm³, at least approximately 0.1 pm³, at least approximately 1 pm³, at least approximately 10 pm³, at least approximately 100 pm³, or more. Alternatively or additionally, the volume can be at most approximately 1 x 10⁴ pm³, at most approximately 1 x 10³ pm³, at most approximately 100 pm³, at most approximately 10 pm³, at most approximately 1 pm³, at most approximately 0.1 pm³, or less. The area occupied by each depression opening can be selected based on criteria similar to those outlined above for volume. For example, the area for each depression opening can be at least approximately 1 x 10⁻³ pm², at least approximately 1 x 10⁻² pm², at least approximately 0.1 pm², at least approximately 1 pm², at least approximately 10 pm², at least approximately 100 pm², or more. Alternatively, or additionally, the area can be at most approximately 1 x 10³ pm², at most approximately 100 pm², at most approximately 10 pm², at most approximately 1 pm², at most approximately 0.1 pm², at most approximately 1 x 10⁻² pm², or less. The area occupied by each depression opening can be larger, smaller, or fall within the values ​​specified above. The depth of each depression 38 can be large enough to store some polymeric hydrogels 42. In one example, the depth can be at least approximately 0.1 pm, at least approximately 0.5 pm, at least approximately 1 pm, at least approximately 10 pm, at least approximately 100 pm, or greater. Alternatively or additionally, the depth can be at most approximately 1 x 10³ pm, at most approximately 100 pm, at most approximately 10 pm, or less. In other examples, the depth is approximately 0.4 pm. The depth of each depression 38 can be greater than, less than, or between the values ​​specified above. anocLn / Lznz / E / Yii In some cases, the diameter or length and width of each depression 38 may be at least approximately 50 pm, at least approximately 0.1 pm, at least approximately 0.5 pm, at least approximately 1 pm, at least approximately 10 pm, at least approximately 100 pm, or more. Alternatively or additionally, the diameter or length and width may be at most approximately 1 x 10³ pm, at most approximately 100 pm, at most approximately 10 pm, at most approximately 1 pm, at most approximately 0.5 pm, at most approximately 0.1 pm, or less (e.g., approximately 50 nm). In some examples, the diameter or length and width is approximately 0.4 pm. The diameter or length and width of each depression 38 may be greater than, less than, or between the values ​​specified above. anocLn / Lznz / B / Yii In the example shown in Figure 2B, a polymeric hydrogel 42 is located within each of the depressions 38. An example of the polymeric hydrogel 42 includes an acrylamide copolymer, such as poly(N(5-azidoacetamdipentyl)acrylamide-co-acrylamide, PAZAM. PAZAM and some other forms of the acrylamide copolymer are represented by the following structure (I): where: RAse is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazol, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; RBes H or optionally substituted alkyl; Rc, RDy REse are selected independently of the group consisting of H and optionally substituted alkyl; each of the -(CH2)P- groups can be optionally substituted; p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; ym is an integer in the range of 1 to 100,000. An expert in the technique will recognize that the arrangement of recurring “n” and “m” features in structure (I) is representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination of these). anocLn / Lznz / E / Yii The molecular weight of PAZAM and other forms of acrylamide copolymer can range from approximately 5 kDa to approximately 1500 kDa or from approximately 10 kDa to approximately 1000 kDa, or can be, in one specific example, approximately 312 kDa. In some examples, PAZAM and other forms of acrylamide copolymer are linear polymers. In some other examples, PAZAM and other forms of acrylamide copolymer are slightly crosslinked polymers. In other examples, the polymeric hydrogel 42 can be a variation of structure (I). In one example, the acrylamide unit can be replaced by N,N-dimethylacrylamide ( ). In this example, the acrylamide unit in structure (I) can be replaced with , where RD, RE, and RF are each a C1-C6 alkyl group, and RG and RH are each a C1-C6 alkyl group (instead of H, as is the case with acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, N,N-dimethylacrylamide can be used in addition to the acrylamide unit. In this example, structure (I) can include in addition to the recurring features of “n” and onoc Ln / Lznz / E / YiA “m”, where RD, REy RFson each is H or a C1-C6 alkyl, and RGy RHson each is a C1-C6 alkyl. In this example, q can be an integer in the range of 1 to 100,000. As another example of the polymeric hydrogel 42, the recurring feature “n” in structure (I) can be replaced by a monomer including a heterocyclic azide group having structure (II): R2 where R1 is H or a C1-C6 alkyl; R2 is H or a C1-C6 alkyl; L is a linker comprising a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and 10 optional substituents on the carbon and any nitrogen atom in the chain; E is a linear chain comprising 1 to 4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and optional substituents on the carbon and any nitrogen atom in the chain; A is an N-substituted amide with an H or a C1-C4 alkyl coupled to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 ring members present as a single cyclic structure or a condensed structure. Specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl. As yet another example, polymeric hydrogel 42 can include a recurring unit of each of structures (III) and (IV): onoc Ln / ίζηζ / E / γΐΛ R1a RlbOK R2aR2by wherein each of R1a, R2a, R1b and R2b is independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R3a and R3b is independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl or an optionally substituted C7-C14 aralkyl; and each of L1 and L2 is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker. It should be understood that other molecules may be used to form the polymeric hydrogel 42, provided they are functionalized to graft capture primers 22, 24 or 22, 24' onto it. Other examples of suitable polymeric layers include those having a colloidal structure, such as agarose; or a polymeric mesh structure, such as gelatin; or a crosslinked polymeric structure, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or an azolized version of SFA. Examples of suitable polyacrylamide polymers may be synthesized from acrylamide and an acrylic acid or an acrylic acid containing a vinyl group, or from monomers that undergo [2+2] photocycloaddition reactions. Still other examples of suitable polymeric hydrogels 42 include mixed copolymers of acrylamides and acrylates.In the examples described herein, a variety of polymer architectures containing acrylic monomers (e.g., acrylamides, acrylates, etc.) can be used, such as branched polymers, including star polymers, star-shaped or star-block polymers, dendrimers, and the like. For example, the monomers (e.g., acrylamide, etc.) can be incorporated, either randomly or in blocks, into the branches (arms) of a star-shaped polymer. To introduce the polymeric hydrogel 42 into the flow channel 32, a mixture of the polymeric hydrogel 42 can be generated and then applied to the substrate 30, 30' (which includes the depressions 38). In one example, the polymeric hydrogel 42 can be present in a mixture (e.g., with water or with ethanol and water). The mixture can then be applied to the substrate surfaces (which include the depressions 38) using spin coating, immersion coating, spray coating, or flow of the material under positive or negative pressure, or another suitable technique. These types of techniques generally deposit the polymeric hydrogel 42 onto the substrate 30, 30' (e.g., in the depressions 38 and in the interstitial regions 40 surrounding the depressions 38). Other selective deposition techniques (e.g., involving a mask, controlled printing techniques, etc.) can be used to specifically deposit the polymeric hydrogel 42 into the flow channel 38 and not into the interstitial regions 40. In some examples, the substrate surface (including the portion exposed in the depressions 38) can be activated, and then the mixture (including the polymeric hydrogel 42) can be applied to it. In one example, a silane or silane derivative (e.g., norbornene silane) can be deposited onto the substrate surface using vapor deposition, spin coating, or other deposition methods. In another example, the substrate surface can be exposed to plasma incineration to generate the surface activating agent(s) (e.g., -OH groups) that can adhere to the polymeric hydrogel 42. Depending on the polymer hydrogel 42, the applied mixture may be exposed to a curing process. For example, curing may take place at a temperature ranging from room temperature (e.g., from approximately 18 °C to approximately 25 °C) to approximately 95 °C for a time ranging from approximately 1 millisecond to approximately several days. In some examples, polishing can be performed to remove the polymeric hydrogel 42 from the interstitial regions 40 on the perimeter of the depressions 38, while leaving the polymeric hydrogel 42 on the surface in the depressions 38 at least substantially intact. Flow cell 20 also includes the first and second capture primers 22, 24 or 22, 24'. Any example of the capture primers 22, 24 or 22, 24' described herein may be used. The set of capture primers 22, 24 or 22, 24' selected for a particular flow cell 20 may depend, in part, on which of the genotyping oligonucleotides 10, 10' will be used with it. A grafting process can be performed to graft the first and second capture primers 22,24 or 22,24' into the polymeric hydrogel 42 in the depressions 38. In one example, the first and second capture primers 22,24 or 22,24' can be immobilized in the polymeric hydrogel 42 by single-point covalent bonding at or near the 5' ends of each of the first and second capture primers 22,24 or 22,24'. This bonding leaves i) a specific portion of primer sequence of the capture primers 22,24 or 22,24' free to hybridize with its cognate primer sequence 12 or copied primer sequence C1e,Cw and i) a 3' free hydroxyl (OH) group for capture primer extension. Any suitable covalent bond can be used for bonding the first and second capture primers 22, 24 or 22, 24' to the polymeric hydrogel 42.Examples of terminated primers that can be used include alkyne-terminated primers, which can bind to an azide entity of the polymeric hydrogel 42. As mentioned, specific examples of suitable capture primers 22, 24 include primers P5 and P7, and a specific example of a suitable capture primer 24' is P7 modified to include the second restriction endonuclease site. anocLn / Lznz / E / Yii In one example, grafting may involve flow-through deposition (e.g., using a cap or additional substrate temporarily or permanently attached), dip coating, spray coating, sample dispensing, or another suitable method that will bond the primer(s) 22, 24, or 22, 24' to the polymer hydrogel 42. Each of these illustrative techniques may use a primer solution or mixture, which may include the primer(s) 22, 24, or 22, 24', water, a buffer, and a catalyst. With any of the grafting methods, the primer(s) 22, 24, or 22, 24' react(s) with reactive groups of the polymer hydrogel 42 in the depressions 38 and have no affinity for the surrounding interstitial regions 40. As such, the primer(s) 22, 24 or 22, 24' are selectively grafted into the polymeric hydrogel 42 in the depressions 38. Methods that include genotyping oligonucleotides Examples of the method described herein generally include introducing a genotyping probe fluid into a flow cell 20 comprising individual depressions 38 and the first and second capture primers 22, 24 or 22, 24' in each of the individual depressions 38, the genotyping probe fluid comprising a plurality of genotyping oligonucleotides 10 or 10', whereby a respective genotyping oligonucleotide 10 or 10' reacts in at least some of the individual depressions 38 to produce the respective clonal populations of amplicons from the respective genotyping oligonucleotide 10 or 10'; linearizing the amplicons to produce probe templates; sequencing at least one probe identification section of the probe templates to identify each of the probe sequences;remove at least the respective incipient chains from the probe templates, thereby exposing a 3' OH group at one end of the probe templates; hybridize the respective samples to the probe templates; and perform the respective genotyping reactions of the samples on the exposed 3' OH groups. In the method examples, the flow cell 20 can be introduced into a system (not shown), where it is in fluid communication with a fluidic control system (e.g., pumps, valves and the like) and is in optical communication with a lighting system and a detection system. Figure 3A to Figure 3H together illustrate an illustrative method involving the genotyping oligonucleotide 10. Figure 3A illustrates a depression 38 of the flow cell 20, which includes the polymeric hydrogel 42 having the first and second capture primers 22, 24 attached thereto. As described herein, the second capture primer 24 includes a cleavage site 46. In Figure 3B, a genotyping probe fluid (not shown) is introduced into flow cell 20 (e.g., into each flow channel 32). In this example, the genotyping probe fluid includes a liquid carrier and the genotyping oligonucleotide 10 in the liquid carrier. The liquid carrier of the genotyping probe fluid can be any suitable hybridization regulator, such as Tris-HCl or 0.5x sodium citrate saline (SSC) regulator. In some examples, the genotyping probe fluid includes a plurality of genotyping oligonucleotides 10, wherein each genotyping oligonucleotide 10 includes a probe sequence 14 different from every other genotyping oligonucleotide 10. With this fluid, different genotyping oligonucleotides 10 (each with a unique probe sequence 14) can be delivered to different depressions 38. As shown in Figure 3B, a genotype 10 oligonucleotide is seeded into depression 38. More specifically, the second primer sequence 18 of a genotype 10 oligonucleotide is hybridized with one of the second capture primers 24 into depression 38. When a genotyping oligonucleotide 10 is seeded, cluster generation can be initiated immediately. In other cases, hybridization (seeding) and cluster generation can be performed separately. The processes involved in cluster generation are shown in Figure 3B, Figure 3C, Figure 3D, and Figure 3E. As illustrated by the arrow in Figure 3B, the genotyping oligonucleotide 10 is copied from the 3' extension hybridized primers using a DNA polymerase. This generates amplicon 44A, which binds to the flow cell surface via the second capture primer 24. The labeled C1e, C12, and C12 sections of amplicon 44A are complementary copies of the restriction endonuclease site 16, probe sequence 14, and first primer sequence 12, respectively. The original genotyping oligonucleotide 10 is denatured, leaving amplicon 44A immobilized in depression 38 by means of the second capture primer 24. The single-stranded amplicon 44A is flipped and bridged, e.g., by hybridization of the copy of the first primer sequence C12 with an adjacent complementary first capture primer 22. This is shown in Figure 3C. As illustrated by the arrow in Figure 3C, the polymerase(s) extend(s) the hybridized primer (first capture primer 22) to form another amplicon 44B. The CC16 and CC14 sections of amplicon 44B are complementary copies of the Cw and Cuy sections, and therefore have the same sequences as the original restriction endonuclease site 16 and probe sequence 14, respectively. The C24 section of amplicon 44B is a complementary copy of the second capture primer 24 and therefore has the same sequence as the second primer 18 sequence.As illustrated in Figure 3C, the formation of amplicon 44B generates a double-strand bridge that includes amplicons 44A and 44B. Next, the double-stranded bridge is denatured, as shown in Figure 3D. This results in two copies (amplicons 44A and 44B) that are covalently linked to the flow cell 20. Isothermal bridge amplification or some other form of amplification amplifies the immobilized copies. For example, the copied templates coil up to hybridize with an adjacent complementary capture primer 22, 24, and a polymerase copies the copied templates to form double-stranded bridges, which are denatured to form two single-stranded chains. These two chains coil up and hybridize with adjacent complementary capture primers 22, 24 and extend again to form two new double-stranded loops. The process is repeated in each copy of the template in cycles of isothermal denaturation and amplification to create dense anocLn / Lznz / B / Yii clonal clusters of double-strand bridges.A simplified group, which includes two double-strand bridges, is shown in Figure 3E. It should be understood that the seeding of the respective genotyping oligonucleotides 10 into the respective depressions 38 and the amplification of such genotyping oligonucleotides 10 in the respective depressions 38 can take place under conditions where the amplification rate exceeds the seeding rate. As such, the relatively rapid rate at which copies (amplicons 44A, 44B) are made within the depression 38 that has been seeded with a genotyping oligonucleotide 10 will effectively exclude a second genotyping oligonucleotide 10 from seeding within that depression 38 for amplification. Therefore, a different genotyping oligonucleotide 10 (with a unique probe sequence 14) can be captured and amplified in each of the depressions 38, allowing simultaneous analysis of a plurality of different target genotyping loci in flow cell 20. Linearization of the bridged amplicons 44A, 44B can be accomplished by cleaving the amplicons attached to the second capture primers (e.g., the amplicons 44A) at the respective cleavage sites 46 of the second capture primers 24; and denaturing the cleaved portions of the amplicons (e.g., the amplicons 44A) attached to the second capture primers 24 to produce the probe templates 48 (Figure 3F). To initiate cleavage, a cleavage agent can be introduced into flow cell 20, e.g., through an inlet port (not shown). The cleavage agent selected will depend on the cleavage site 46 of the second capture primer 24. The cleavage agent can be either a chemical cleavage agent or an enzymatic cleavage agent, depending on the cleavage site 46. Cleavage at the cleavage site 46 cuts the amplicons 44A between the second capture primers 24 and the remainder of the amplicon sequence (which includes the Cw, Cu, and C12 sections or the Cw, Cu, and C22 sections (which is a complementary copy of capture primer 22)). As a result of cleavage, sections C16, Cu and C12 and sections Cw, Cu and C22 are no longer attached to the flow cell surface via primer 24 and can therefore be removed by denaturation. Denaturation can be carried out under any suitable conditions. Removal of sections C16, Cu and C12 and sections Cu, Cu and C22 leaves the amplicons 44B attached to the flow cell surface via the first capture primer 22 and hybridized to the second capture primers 24 (via section C24). In this example, the exposed single-stranded portion of the 44B amplicons, specifically sections CCw and CCu, form probe template 48. Section CCu is a complementary copy of section Cu and therefore has the same sequence as probe sequence 14. Sequencing this CCu section allows the identification / decoding of the original probe sequence 14.In some cases, a portion of the CCu section can be sequenced to identify or decode the original probe sequence. The CC16 section is a complementary copy of the C16 section and therefore has the same sequence as restriction enzyme site 16. When anocLn / Lznz / B / Yii is sequenced, the double-stranded section that includes CC16 and Nw (Figure 3G) provides a substrate for restriction enzyme cleavage. After cleavage and denaturation, each second capture primer 24 may have a 3' phosphate at its end that should be removed before further processing. The 3' phosphate can be removed by introducing a kinase, which deprotects the second capture primer 24, making it suitable for use as a sequencing primer (as described with reference to Figure 3G). Figure 3G illustrates the sequencing of probe template 48, which includes sections CC16 and CCu, the latter of which is at least one probe identification section. In the example shown, sequencing probe template 48 involves using the second capture primer 24 as a sequencing primer, and performing a base extension reaction (one base at a time) along probe template 48. In another example, section C24 and the second capture primer 24 can be denatured, and a separate sequencing primer (in solution) can be added. The separate sequencing primer can then hybridize to section C24, and a base extension reaction (one base at a time) would proceed along probe template 48. The underlying chemical process for sequencing can be polymerization (e.g., catalyzed by a polymerase enzyme). In a process based on a particular polymerase, fluorescently labeled nucleotides are added to the second capture primer 24 in a template-dependent manner, such that the order and type of nucleotides added to the second capture primer 24 can be detected. This allows the determination of the probe identifier sequence, e.g., section CC14, which can be used to decode the original probe 14 sequence. To initiate a first sequencing cycle, one or more labeled nucleotides, DNA polymerase, etc., can be supplied into / through flow cell 20, etc., where the extension of the sequencing primer causes a labeled nucleotide to be incorporated into probe template 48. This incorporation can be detected through an imaging event. During an imaging event, the illumination system can provide excitation light to flow cell 20. In some examples, fluorescently labeled nucleotides may also include a reversible termination property that stops further extension of the primer once a nucleotide has been added to template 48. For example, a nucleotide analog having a reversible terminator entity may be added to template 48 in such a way that no further extension can occur until a release agent is supplied to remove the entity. Therefore, for examples that use reversible termination, anocLn / Lznz / B / Yii, a release reagent may be supplied to flow cell 20, etc. (after detection has occurred). The washing may take place between the various fluid delivery stages. The sequencing cycle may then be repeated n times to extend template 48 by n nucleotides to generate an incipient chain that includes the incipient Nw section (which is complementary to the CCw section) and the incipient Nm section (which is complementary to the CC14 section). Sequencing the CC14 section provides the incipient chain section N14, which can be used to decode the original probe sequence 14 of the genotyping oligonucleotide 10. This information allows the user to identify the target genotyping locus to be analyzed in a particular depression 38 (since all templates 48 in a depression 38 have the same probe identification section, e.g., CCu). Sequencing the CCw section yields the nascent strand Nw section. As such, this sequencing example also generates the double-stranded section, which includes both CC16 and Nw, providing a substrate for restriction enzyme cleavage. After sequencing the probe identification section(s), the method further includes removing at least the respective incipient chains (including the Nu and Nw sections) from probe templates 48, thereby exposing a 3' OH group at one end of probe templates 48. In this example, the removal involves more than just the removal of the Nu and Nw incipient chains. It involves the digestion of restriction endonuclease sites, e.g., the CC16 and Nw sections, and the denaturation of the remaining incipient chain, including the Nu section, from probe templates 48. Probe template 48 includes the CCw section (which has the same sequence as restriction endonuclease site 16), and the nascent strand includes the Nw section (which is complementary to restriction endonuclease site 16). This double-stranded portion (CCw and Nw sections) creates a substrate for a suitable restriction endonuclease (restriction enzyme). As such, the restriction endonuclease sites—in this example, the CCw and Nw sections—can be digested by introducing the restriction endonuclease. As mentioned in this description, the restriction enzyme can be a 4-base cleavage restriction endonuclease, a 5-base cleavage restriction endonuclease, a 6-base cleavage restriction endonuclease, or similar. The restriction enzyme cleaves the CCw and Nw sections at specific nucleotides, which are schematically identified by the stars in Figure 3G.In this example, digestion of the restriction endonuclease site leaves the second capture primer 24 and the first capture primer 22, which has the CCu section attached to it, and the incipient Nu chain hybridizes with the CCu section. The incipient Nu chain is then denatured from the CCu section. Digestion and denaturation allow the CCw section and the incipient Nu and Nw chains to be removed from the depression 38 and the flow cell 20, e.g., by means of a washing step. anocLn / Lznz / B / Yii Digestion and denaturation expose a 3' OH group at one end of what remains of probe template 48. The remaining probe template is shown with reference number 52 in Figure 3H. The remaining probe template 52 includes capture primer 22 and section CC14, which is the same as the original probe sequence 14, and is therefore, in this example, complementary to a DNA sample having target genotyping locus 54. A sample of denatured DNA fragments, including target genotyping locus 54, is introduced into flow cell 20. Target genotyping locus 54 may be included in a library fluid containing a plurality of target genotyping loci, at least some of which have different loci for genotyping. The target genotyping loci may be prepared from the larger DNA sample using any genotyping library preparation technique. Some genotyping library preparation techniques involve amplification and fragmentation. Others involve amplification without fragmentation (examples of which are described below). As such, multiple copies of any type of target genotyping locus 54 may be present in the library fluid. Once introduced into flow cell 20, the target genotyping loci 54 hybridize with the respective complementary CC14 sections of the remaining probe templates 52 in depression 38. The genotyping reaction can then be performed. In this reaction, the remaining probe template 52 is used as a sequencing primer to perform a sequencing cycle as described herein. As shown in Figure 3H, a labeled nucleotide 57, which is complementary to the nucleobase of interest at the target genotyping locus 54, is incorporated into the remaining probe template 52. Although the description in this document focuses on a depression 38 and thus on the genotyping of a target genotyping locus 54, it should be understood that each depression 38 includes different probe templates 52 with different CCu sections. As such, with this method, hundreds of billions (depending on the number of depressions in the flow cell 20) of different loci can be genotyped simultaneously. Figure 4A to Figure 4H together illustrate another illustrative method involving the genotyping oligonucleotide 10'. Figure 4A illustrates a depression 38 of the flow cell 20, which includes the polymeric hydrogel 42 having the first and second capture primers 22, 24' attached to it. As described herein, the second capture primer 24' includes the second restriction endonuclease site 46'. In Figure 4B, a genotyping probe fluid (not shown) is introduced into the flow cell 20 (e.g., into each flow channel 32). In this example, the genotyping probe fluid includes a liquid carrier and the anocLn / Lznz / B / Yii genotyping oligonucleotide 10' in the liquid carrier. The liquid carrier can be any of the examples described herein.In some examples, the genotyping probe fluid includes a plurality of 10' genotyping oligonucleotides, where each 10' genotyping oligonucleotide includes a probe sequence 14 different from each other 10' genotyping oligonucleotide. With this fluid, different 10' genotyping oligonucleotides (each with a unique probe sequence 14) can be delivered to different 38 depressions. As shown in Figure 4B, a 10' genotyping oligonucleotide is seeded into depression 38. More specifically, the second 18' primer sequence and the 16' restriction endonuclease site of a 10' genotyping oligonucleotide hybridize respectively to one of the second 24' capture primers and its 46' restriction endonuclease site in depression 38. When a 10' genotyping oligonucleotide is seeded, cluster generation can be initiated immediately. In other cases, hybridization (seeding) and cluster generation can be performed separately. The processes involved in cluster generation are shown in Figure 4B, Figure 4C, Figure 4D, and Figure 4E. As illustrated by the arrow in Figure 4B, the genotyping oligonucleotide 10' is copied from the primers hybridized by the 3' extension using a high-fidelity DNA polymerase. This generates amplicon 44C, which binds to the flow cell surface via the second capture primer 24'. The sections labeled Cm, C28, C26, and C12 of amplicon 44C are complementary copies of probe sequence 14, priming site portion 28, index sequence portion 26, and first primer sequence 12, respectively. The original 10' genotyping oligonucleotide is denatured, leaving the 44C amplicon immobilized in depression 38 by the second 24' capture primer and the second 46' restriction endonuclease site. The single-stranded 44C amplicon is flipped and bridged, e.g., by hybridization of the first primer sequence copy C12 with an adjacent complementary capture primer 22. This is shown in Figure 4C. As illustrated by the arrow in Figure 4C, the polymerase(s) extend(s) the hybridized primer to form another 44D amplicon. The CC14, CC26, and CC28 sections of the 44D amplicon are complementary copies of the Cu, C26, and C28 sections and thus have the same sequences as the original probe sequence 14, index sequence portion 26, and priming site portion 28, respectively. The C46· section of the 44D amplicon is a complementary copy of the second 46' restriction endonuclease site and thus has the same sequence as the 16' restriction endonuclease site of the 10' genotyping oligonucleotide. The C24' section of the 44D amplicon is a complementary copy of the second 24' capture primer and therefore has the same sequence as the second 18' primer sequence.As shown in Figure 4C, the formation of the 44D amplicon generates a double-stranded bridge that includes the 44C and 44D amplicons covalently linked to the flux cell 20. The double-strand bridge is then denatured, as shown in Figure 4D. This results in two copies (amplicons 44C and 44D) that are covalently linked to the flow cell 20. Isothermal bridge amplification or some other form of amplification amplifies the immobilized copies. For example, the copied templates coil up to hybridize with an adjacent complementary capture primer 22, 24', and a polymerase copies the copied templates to form double-strand bridges, which are denatured to form two single-stranded chains. These two chains coil up and hybridize with adjacent complementary capture primers 22, 24' and extend again to form two new double-stranded loops. The process is repeated on each template copy in cycles of isothermal denaturation and amplification to create dense clonal clusters of double-strand bridges. A simplified group, which includes two double-strand bridges, is shown in Figure 4E. It should be understood that the seeding of the respective 10' genotyping oligonucleotides into the respective 38 depressions and the amplification of such 10' genotyping oligonucleotides in the respective 38 depressions can take place under conditions where the amplification rate exceeds the seeding rate. As such, the relatively rapid rate at which copies (amplicons 44C, 44D) are made within the 38 depression seeded with one 10' genotyping oligonucleotide will effectively exclude a second 10' genotyping oligonucleotide from seeding within that 38 depression for amplification. Therefore, a different 10' genotyping oligonucleotide (with a unique probe sequence 14) can be captured and amplified in each of the 38 depressions, allowing simultaneous analysis of a plurality of different target genotyping loci in flow cell 20. In this example, amplification can be performed using methylated dCTP (deoxycytidine triphosphate) to protect the 16' restriction endonuclease site and the complementary Cas copies of the second 46' restriction endonuclease site. This modification will fully methylate the 44C, 44D amplicons and leave the 22, 24' capture primers (which include the second 46' restriction endonuclease site) hemimethylated. The double-stranded bridges are then linearized. The linearization is described with reference to Figure 4E and Figure 4F. The linearization of the bridged amplicons 44C, 44D in this illustrative method can be performed by digesting the restriction endonuclease portion 56 of the amplicons 44C, 44D to leave the second capture primers 24' in the depressions 38; and denaturing a remaining portion of the amplicons 44C, 44D to produce single-stranded probe templates 49 that include the first capture primers 22 and at least one probe identification section in the depressions 38. The result of the linearization process is shown in Figure 4F. anocLn / Lznz / B / Yii In this example, each of the 24' capture primers also includes the 46' restriction endonuclease site, where the 46' restriction endonuclease site is complementary to the 16' restriction endonuclease site of the 10' genotyping oligonucleotide and is therefore also complementary to the C46· section. As shown in Figure 4E, the double-strand bridges include the 46', Cw hybridized sections, which provide the respective substrates for restriction enzyme cleavage. More specifically, the C46· and 46' hybridized sections of the bridged amplicons 44C, 44D form the 56 restriction endonuclease portion, which is recognizable by a Type US restriction enzyme. In this example, digestion of the 56 restriction endonuclease portion is achieved by introducing the Type IIS restriction enzyme.Type IIS restriction enzymes may be methyl-sensitive or methyl-insensitive. Methylated protocols will protect sites internal to the C14 probe sequence copies, CCm, and / or may protect symmetric cleavages. Type US restriction enzymes will recognize asymmetric DNA sequences in the 56 region and cleave at a defined distance (e.g., from 1 nucleotide to approximately 20 nucleotides) outside the 56 region. Digestion leaves the 24' capture second primers bound to flow cell 20 and also cleaves the 44C amplicon at a desired position for genotyping. The remaining portions of the amplicons 44C, 44D can then be denatured, leaving the single-strand probe templates 49 attached to the flow cell 20. As shown in Figure 4F, the single-strand probe templates 49 include the first capture primers 22 and at least one probe identification section, which in this example includes part or all of section CCu, as well as sections CC28 and CC26. The method may further comprise blocking the second 24' capture primers prior to sequencing along at least one probe identification section of each of the first single-stranded probe templates 49. A blocking group (e.g., a 3' phosphate) may be added that is attached to the exposed 3' ends of the second 24' capture primers to prevent unwanted extension in these 24' primers. With reference now to Figure 4F, the sequencing of at least one probe identification section of the 49 single-stranded probe templates is illustrated. In this example, at least one probe identification section is section CC26, which is identical to the index sequencing portion 26. Sequencing at least one probe identification section involves introducing a sequencing primer 50, which hybridizes with section CC28, which is identical to the priming site portion 28. This sequencing primer 50 makes at least one probe identification section, e.g., CC26, of the single-stranded probe template 49 ready for sequencing. A base extension reaction is then performed along section CC26. The underlying chemical process for sequencing can be polymerization (e.g., catalyzed by a polymerase enzyme) as described in the present description with reference to Figure 3G. anocLn / Lznz / B / Yii To initiate a first sequencing cycle, one or more labeled nucleotides, DNA polymerase, etc., can be supplied into / through the flow cell 20, etc., where extension of the sequencing primer causes a labeled nucleotide to be incorporated into an incipient N26 chain formed along section CC26 of the single-stranded probe template 49. This incorporation can be detected through an imaging event. In some examples, fluorescently labeled nucleotides may also include a reversible termination property that stops further extension of the primer once a nucleotide has been added to the incipient chain N26. Therefore, for examples using reversible termination, a release reagent may be supplied to flow cell 20, etc. (after detection occurs). The washing may take place between the various fluid delivery stages. The sequencing cycle may then be repeated n times to extend the single-stranded probe template 49 by n nucleotides to generate an incipient chain that includes the incipient section N26 (which is complementary to section CC26, which has the same sequence as the index sequencing portion 26). Sequencing the incipient N26 strand can be used to identify the CC26 section and, therefore, the original index sequencing portion 26, which is unique to probe sequence 14 (and its complementary copy C14). This information allows the user to identify the target genotyping locus to be analyzed in a particular depression 38 (since all templates 49 in a depression 38 have the same probe identification section, e.g., CC26, and probe sequence section, e.g., CC14). After sequencing the probe identification section(s), the method further includes removing at least the respective incipient strands (including section N26) from the single-stranded probe templates 49. In this example, the removal involves denaturing the sequencing primer 50 and the incipient strand N26. A sample of single-stranded DNA fragments, including target genotyping locus 54, is introduced into flow cell 20, as shown in Figure 4H. Target genotyping locus 54 can be included in a library fluid containing a plurality of target genotyping loci, at least some of which have different loci for genotyping. The target genotyping loci can be prepared from the larger DNA sample using any genotyping library preparation technique. Some genotyping library preparation techniques involve amplification and fragmentation. Others involve amplification without fragmentation, as described below. As such, multiple copies of any type of target genotyping locus 54 can be present in the library fluid. Once introduced into flow cell 20, the target genotyping loci 54 hybridize with the respective complementary CC14 sections of the single-stranded probe templates 49 in depression 38. anocLn / Lznz / B / Yii The genotyping reaction can then be performed. In this reaction, single-stranded probe template 49 is used as a sequencing primer to perform a sequencing cycle as described herein. As shown in Figure 4H, a labeled nucleotide 57, which is complementary to the nucleobase of interest at the target genotyping locus 54, is incorporated into single-stranded probe template 49. Although the description in this document focuses on a depression 38 and thus on the genotyping of a target genotyping locus 54, it should be understood that each depression 38 includes different single-stranded probe templates 49 with different CCi4 sections. As such, with this method, hundreds of billions (depending on the number of depressions in the flow cell 20) of different loci can be genotyped simultaneously. In the examples described herein, instead of blocking the second 24 or 24' capture primers during sequencing and / or genotyping, these 24 or 24' primers could be cleaved after the decoding reactions using a cleavage process that will not adversely affect the 48 or 49 templates to be genotyped. Genotyping library preparation technique Any suitable genotyping library preparation technique can be used to prepare the target genotyping locus 54. The target genotyping locus 54 can be prepared from genomic DNA. Genomic DNA can be isolated from one or more cells, body fluids, or tissues. Any method suitable for obtaining a body fluid (e.g., blood, sweat, tears, lymph, urine, saliva, semen, cerebrospinal fluid, feces, or amniotic fluid) can be used. Specific examples include buccal swabs, mouth rinses, surgical excisions, fine-needle aspiration biopsies, or similar methods. Genomic DNA can also be obtained from one or more cells or tissues in primary culture, a propagated cell line, a fixed archival sample, a forensic sample, or an archaeological sample. Genetic DNA (gDNA) can be prepared by lysing a cell containing the DNA. The cell can be used under conditions that substantially preserve the integrity of the cell's gDNA. In one particular example, thermal lysis can be used to lyse a cell. In another, exposing a cell to an alkaline pH can be used to lyse it, provided it causes relatively little damage to the gDNA. Any of a variety of basic compounds, including potassium hydroxide, sodium hydroxide, and similar substances, can be used for lysis. Furthermore, relatively undamaged gDNA can be obtained from a lysed cell using an enzyme that degrades the cell wall. Cells lacking a cell wall, either naturally or due to enzymatic removal, can also be used by exposing them to osmotic stress.Other conditions that can be used to lyse a cell include exposure to detergents, mechanical disruption, heat by sonication, pressure differential such as in a French press, or Dounce homogenization. Agents that stabilize the gDNA may be included in a cell lysate or isolated gDNA sample; these include, for example, nuclease inhibitors, chelating agents, salts, regulators, and the like. In some examples, a crude cell lysate containing gDNA can be amplified directly without further gDNA isolation. For instance, a blood sample can be subjected to thermal lysis, and the crude cell lysate can then be amplified using any suitable method, including those described herein. Alternatively, gDNA can be further isolated from other cellular components prior to amplification. Consequently, amplification can be carried out on purified or partially purified gDNA. Genomic DNA can be isolated using known methods, including, for example, liquid-phase extraction, precipitation, solid-phase extraction, chromatography, and similar techniques. A representative amplified population of genomic fragments (target genotyping loci 54) can be provided by amplifying a native genome under conditions that replicate the genomic DNA (gDNA) template to produce one or more copies in which the relative proportion of each copied sequence is substantially the same as its proportion in the original gDNA. Any of a variety of methods that replicate genomic DNA in a sequence-independent manner can be used to prepare the target genotyping loci 54. In the examples described herein, double-stranded genomic DNA can be denatured to generate single-stranded genomic DNA templates that can be used in the amplification processes. In a specific example, the amplification method involves contacting a single-stranded genomic DNA template with a low-processivity polymerase, a plurality of primers and free nucleotides, thereby generating complementary fragments of the single-stranded genomic DNA template; and displacing the complementary fragments of the single-stranded genomic DNA template, thereby generating at least some of the respective samples. Low-processivity polymerases can synthesize short strands because they are naturally detached from the single-stranded genomic DNA template before the entire strand is replicated. Some examples of low-processivity polymerases can synthesize fewer than 100 bases per polymerization event. Shorter fragments can be obtained using a polymerase that synthesizes fewer than 50, 40, 30, 20, 10, or 5 bases per polymerization event under amplification conditions. Low-processivity polymerases are selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment (Taq DNA polymerase fragment), Klenow fragment (the large fragment of Escherichia coli I DNA polymerase), Bsu DNA polymerase, Bsty DNA polymerase, and a modified polymerase.In this illustrative method, the term “modified polymerase” refers to any synthetic polymerase designed to synthesize fewer than 100 bases per polymerization event. Other suitable low-processivity polymerases include monomeric E. coli Pol III (which lacks the beta subunit) or E. coli Pol I. anoc in / ι 7n7 / E / Yl· The processivity of some polymerases can be altered by the processing conditions used. For example, processivity can be altered by the reaction temperature, the salt level (e.g., Mg2+) in the reaction (e.g., ionic strength), the pH, the regulator composition (e.g., creatine kinase or cAMP (cyclic adenosine monophosphate)), or combinations of these. As an example, a T7 DNA polymerase has low processivity at temperatures below 37 °C and also at high ionic strengths, e.g., greater than approximately 100 mM NaCl; but otherwise, it has high processivity. As another example, a Taq polymerase has high processivity at temperatures of approximately 70 °C when reacted with a 10-fold molar excess of DNA samples and random primers.In another example, the Klenow fragment of Escherichia coli DNA polymerase polymerization can be decreased by lowering the pH to less than 6.2. In yet another example, the efficiency of BST DNA polymerase (BST pol), a family A DNA pol, can be manipulated several times by substituting metal cofactors such as Mg++ and Cd++. Primers can be random primers. A population of random primers can be synthesized to include a higher content of guanine (G) and / or cytosine (C) nucleotides compared to adenine (A) and thymidine (T) nucleotides. The resulting random primer population will be GC-rich and, therefore, have a higher probability of hybridizing to high-GC regions of a genome, such as gene-coding regions of a human genome, which typically have a higher GC content than non-coding regions of gDNA. Primers in a random primer population can also have an identical sequence region, such as a universal tail. A universal tail can include a universal priming site for amplification. In this illustrative method, free nucleotides can include any naturally occurring nucleotide, such as deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate. Bringing the single-stranded genomic DNA template into contact with the low-processivity polymerase, the multiple primers, and the free nucleotides may involve mixing the various components together and exposing them to amplification conditions suitable for the low-processivity polymerase being used. During amplification, the primers bind to different portions of the single-stranded genomic DNA template, and the low-processivity polymerase inserts complementary free nucleotides into the template strand according to the template strand sequence. The low-processivity polymerase naturally detaches from the template strand, usually after 100 bases or fewer have been replicated. The replicated complementary fragments can be displaced using, for example, denaturation.The method may include repeating both the contact and displacement a predetermined number of cycles to generate additional complementary fragments at each predetermined number of cycles. anocLn / Lznz / B / Yii The following are some examples of this method. T4 DNA polymerase can be used for the amplification of single-stranded or denatured gDNA, for example, in approximately 50 mM of N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES) (pH 7.5), approximately 50 mM of Tris-HCl (pH 8.6) or approximately 50 mM of glycinate (pH 9.7). Illustrative reaction mixtures may also include approximately 50 mM KCl, approximately 5 mM MgCl₂, approximately 5 mM dithiothreitol (DTT), approximately 40 pg / ml gDNA, approximately 0.2 mM of each dNTP, approximately 50 pg / ml bovine serum albumin (BSA), approximately 100 μM of random primer (n=6), and approximately 10 units of T4 DNA polymerase incubated at 37 °C for at least one hour. Temperature cycling can be used to displace replicated strands for multiple rounds of amplification. Taq polymerase has low processivity at temperatures below 70 °C. Consequently, small fragments of genetically modified DNA (gDNA) can be obtained using Taq polymerase at low temperatures, or under other conditions where Taq has low processivity. For example, the Stoffel fragment, which lacks 289 amino acid residues at the N-terminus of Taq polymerase and has low processivity at 70 °C, can be used to generate relatively small gDNA fragments. The Taq or Stoffel fragment can be used to amplify denatured or single-stranded DNA templates, and temperature cycling can be used to displace the replicated strands for multiple amplification rounds. The Klenow fragment can be used for isothermal amplification of a genome to produce small genomic DNA fragments, for example, in a low-salt reaction (1=0.085) incubated at a temperature between approximately 5°C and 37°C. Illustrative buffers and pH conditions that can be used to amplify gDNA with the Klenow fragment include, for example, approximately 50 mM Tris HCl (pH 7.5), approximately 5 mM MgCl₂, approximately 50 mM NaCl, approximately 50 pg / ml bovine serum albumin (BSA), approximately 0.2 mM of each dNTP, approximately 2 pg of random primer (n=6), approximately 10 ng of gDNA template, and approximately 5 units of the Klenow fragment incubated at 37°C for approximately 16 hours. Similar reactions can be performed where one or more reaction components are omitted or substituted. For example, the regulator can be replaced with approximately 50 mM of phosphate (pH 7.4) or other pH values ​​can be used in the range of approximately 7.0 to 7.8. In another example, amplification conditions using the Klenow fragment may include, for example, approximately 10 ng of the gDNA template, approximately 2 mM of dNTP, approximately 10 mM of MgClz, approximately 0.5 U / μL (microliter) of polymerase, approximately 50 μM (micromolar) of random primer (n=6) and isothermal incubation at 37 °C for 16 hours. Another example of the amplification method described herein includes contacting a single-stranded genomic DNA template with a polymerase, a plurality of primers, and a mixture of free nucleotides including natural nucleotides and dideoxythymidine triphosphate (ddTTP), thereby generating complementary truncated fragments of the single-stranded genomic DNA template; and displacing the complementary truncated anocLn / Lznz / B / Yii fragments of the single-stranded genomic DNA template, thereby generating at least some of the respective samples. In this example, any suitable polymerase may be used. ddTTP acts as a truncation agent, and therefore a high-processivity polymerase may be used. Any of the polymerases described herein may be used in this illustrative method, provided that the processing conditions can be altered so that the polymerase exhibits higher processivity (e.g., can synthesize more than 100 bases per polymerization event). In one example, the high-processivity polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and a modified polymerase. In this illustrative method, the term “engineered polymerase” means any synthetic polymerase designed to synthesize more than 100 bases per polymerization event.High-processivity polymerases can produce fragments that are 10 kb (kilobase) to 20 kb in length. Other suitable high-processivity polymerases include the Φ29 polymerase. In this example, any of the random primers described in this description can be used. In this illustrative method, the free nucleotides in the mixture include natural nucleotides and dideoxythymidine triphosphate (ddTTP). Dideoxythymidine triphosphate serves as a synthesis termination nucleotide, or truncation agent. In one example, the natural nucleotides include deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate. In another example, the free nucleotide mixture includes a deoxythymidine triphosphate (dTTP) to dideoxythymidine triphosphate (ddTTP) ratio that varies from approximately 10:5 to approximately 10:0.01. A ratio within this range helps ensure that a desired number of deoxythymidine triphosphates are incorporated into the generated fragments before the dideoxythymidine triphosphate truncates the amplification. In one specific example, the dTTP to ddTTP ratio is approximately 10:1. Bringing the single-stranded genomic DNA template into contact with the polymerase, a plurality of primers, and the mixture of free nucleotides may involve mixing the various components together and exposing them to amplification conditions suitable for the polymerase being used. During amplification, the primers bind to different portions of the single-stranded genomic DNA template, and the polymerase introduces complementary natural nucleotides into the template strand according to the template strand sequence. When dideoxythymidine triphosphate (ddTTP) is introduced instead of deoxythymidine triphosphate (dTTP), amplification of that particular strand is terminated. As such, ddTTP truncates the replicated DNA fragment. The ratio of dTTP to ddTTP in the mixture helps ensure that the generated fragments are long enough for subsequent analysis. The replicated truncated complementary fragments can be displaced using, for example, denaturation. The method may include repeating both the contact and displacement of a predetermined number of cycles to generate additional truncated complementary fragments in each of the predetermined number of cycles. Any of the regulators (e.g., HEPES, Tris-HCl, glycinate, etc.), salts (e.g., KCl, MgCb, etc.), redox reagents (e.g., dithiothreitol) and / or stabilizers (e.g., bovine serum albumin (BSA)) may be used in this illustrative method in quantities suitable for high processivity. In a specific example, T7 DNA polymerase has high processivity under the following reaction conditions: approximately 40 mM Tris-HCl, pH 7.5, approximately 15 mM MgCl, approximately 25 mM NaCl, approximately 5 mM DTT, approximately 0.25 mM of each dNTP, from approximately 0.00025 mM to approximately 0.125 mM ddTTP, 50 pg / ml single-stranded gDNA, approximately 100 μM of random primer (n=6), from approximately 0.5 to approximately 1 unit of T7 DNA polymerase, reaction temperature greater than 37 °C. In another specific example, Taq polymerase is highly processive at temperatures of approximately 70 °C when reacted with a 10-fold molar excess of the DNA sample and random primers (n=6). An amplification reaction carried out under these conditions may also include a buffer, such as Tris-HCl at approximately 20 mM, pH approximately 7, approximately 1 mM to 2 mM MgCl₂, approximately 0.2 mM of each dNTP, and approximately 0.0002 mM to approximately 0.1 mM ddTTP. Additionally, a stabilizing agent, such as glycerol, gelatin, BSA, or a nonionic detergent, may be added. In yet another specific example, the Klenow fragment has a high processivity under the following reaction conditions: approximately 10 mM Tris-HCl, pH 7.9, approximately 10 mM MgCl2, approximately 50 mM NaCl, approximately 1 mM DTT, and approximately 100 g / mol BSA. In yet another specific example, Bst's DNA polymerase has high processivity under the following reaction conditions: approximately 20 mM Tris-HCl, pH 8.8, approximately 10 mM (NH4)2SO4, approximately 10 mM KCl, approximately 2 mM MgSO4, and approximately 0.1% of a non-ionic surfactant (e.g., TRITON™ X-100 from The Dow Chemical Co.). Both amplification processes described herein generate a plurality of gDNA fragments without requiring a fragmentation process. The single-stranded gDNA serves as a template for several target genotyping loci 54, and multiple amplicons are generated for each target genotyping locus 54. When introduced into a flow cell 20 containing the templates 48 or 49 to be genotyped, the amplified gDNA fragments (target genotyping loci 54) hybridize to the respective complementary sections of the genotyping templates 48 or 49. Kits onocLn / Lznz / E / Yii The genotyping nucleotides 10 or 10' and the flow cell 20 may be part of a genotyping kit. In one example, a kit comprises: a flow cell 20 including a substrate 30, 30' having depressions 38 separated by interstitial regions 40 and a first and second capture primers 22, 24 or 22, 24' attached within each of the depressions 38; and a genotyping probe fluid including a liquid carrier and a genotyping oligonucleotide 10 or 10' in the liquid carrier, the genotyping oligonucleotide 10 or 10' including a first primer sequence 12, a probe sequence 14 representative of a target genotyping locus 54, a restriction endonuclease site 16, 16' and a second primer sequence 18, 18' that is at least partially complementary to the second capture primer 24, 24'. The kit may also include components for preparing genotyping libraries, such as a whole genome sample, a polymerase (which may be a low-processivity polymerase as defined in this description), a plurality of primers and free nucleotides (in some examples including natural nucleotides and in other examples including a mixture of natural nucleotides and dideoxythymidine triphosphate (ddTTP)). Any illustrative genotyping oligonucleotide 10 or 10' can be used in the kit and any illustrative flow cell 20 can be used in the kit. The kit may alternatively include a patternless flow cell with primers across the entire surface of a flow channel. Additional notes It should be noted that all combinations of the foregoing concepts and additional concepts described in greater detail below (provided such concepts are not mutually inconsistent) are considered part of the subject matter of the invention described herein. In particular, all combinations of the claimed subject matter appearing at the end of this description are considered part of the subject matter of the invention described herein. It should also be noted that terminology used explicitly in this description, which may also appear in any description incorporated by reference, should have a meaning consistent with the particular concepts described herein. While several examples have been described in detail, it is understood that the examples described may be modified. Therefore, the above description is not intended to be limiting. anocLn / Lznz / E / Yii

Claims

1. A kit, comprising: a flow cell, including: a substrate; and first and second capture primers bound to the substrate; and a genotyping probe fluid, including: a liquid carrier; and a genotyping oligonucleotide in the liquid carrier, the genotyping oligonucleotide including: a first primer sequence; a probe sequence representative of a target genotyping locus; a restriction endonuclease site; and a second primer sequence that is at least partially complementary to the second capture primer.

2. The kit as defined in claim 1, characterized in that the genotyping probe fluid includes a plurality of genotyping oligonucleotides, and wherein each genotyping oligonucleotide includes a probe sequence different from each of the other genotyping oligonucleotides.

3. The kit as defined in one of claims 1 or 2, characterized in that the second capture primer includes a cleavage site.

4. The kit as defined in claim 3, characterized in that the restriction endonuclease site is sensitive to a restriction endonuclease selected from the group consisting of a 4-base cutting restriction endonuclease, a 5-base cutting restriction endonuclease, and a 6-base cutting restriction endonuclease.

5. The kit as defined in one of claims 1 or 2, characterized in that the second capture primer further includes a second restriction endonuclease site, wherein the second restriction endonuclease site is complementary to the restriction endonuclease site of the genotyping oligonucleotide.

6. The kit as defined in claim 5, characterized in that the restriction endonuclease site and the second restriction endonuclease site are sensitive to a Type US methyl-sensitive restriction endonuclease.

7. The kit as defined in any one of claims 1 to 6, characterized in that the genotyping oligonucleotide further comprises an index sequence portion and a priming site portion between the first primer sequence and the probe sequence. onocLn / Lznz / E / Yii 8. The kit as defined in any one of claims 1 to 7, characterized in that: the substrate has depressions separated by interstitial regions; and the first and second capture primers are joined within each of the depressions.

9. A method comprising: introducing a genotyping probe fluid into a flow cell that includes first and second capture primers, the genotyping probe fluid comprising a plurality of genotyping oligonucleotides, each of the genotyping oligonucleotides comprising: a first primer sequence; a probe sequence representative of a respective target genotyping locus; a restriction endonuclease site; and a second primer sequence that is at least partially complementary to the second capture primer; whereby a respective genotyping oligonucleotide reacts to produce respective clonal populations of amplicons of the respective genotyping oligonucleotide; linearizing the amplicons to produce probe templates; sequencing at least one probe identification section of the probe templates to identify each of the probe sequences;remove at least the respective incipient chains from the probe templates, thereby exposing a 3' OH group at one end of the probe templates; hybridize the respective samples to the probe templates; and perform the respective genotyping reactions of the samples on the exposed 3' OH groups.

10. The method as defined in claim 9, characterized in that the linearization of the amplicons involves: cleaving the amplicons attached to the second capture primers at the respective cleavage sites of the second capture primers; and denaturing the cleaved portions of the amplicons attached to the second capture primers to produce the probe templates.

11. The method as defined in claim 10, characterized in that the sequencing of at least one probe identification section of the probe templates involves performing a base extension reaction along at least one probe identification section using the second capture primer as a sequencing primer.

12. The method as defined in claim 11, characterized in that removing at least the respective incipient chains from the probe templates involves: digesting the restriction endonuclease sites; and denaturing a remaining incipient chain from the probe templates.

13. The method as defined in claim 9, characterized in that each of the second capture primers further includes a second restriction endonuclease site, wherein the second restriction endonuclease site is complementary to the restriction endonuclease site of the genotyping oligonucleotide, and wherein the linearization of the amplicons includes: digesting a restriction endonuclease portion of the amplicons to leave the second capture primers; and denaturing a remaining portion of the amplicons to produce single-stranded probe templates including the first capture primers and at least one probe identification section.

14. The method as defined in claim 13, characterized in that the sequencing of at least a portion of the probe identification section of the single-stranded probe templates involves: introducing a sequencing primer; and performing a base extension reaction along at least one probe identification section of each of the single-stranded probe templates.

15. The method as defined in claim 14, characterized in that removing at least respective incipient chains from the single-stranded probe templates involves denaturing the incipient chains of at least one probe identification section.

16. The method as defined in any one of claims 13 to 15, further comprising blocking the second capture primers prior to sequencing along at least one probe identification section of each of the single-strand probe templates.

17. The method as defined in any one of claims 9 to 16, further comprising correlating each identified probe sequence with a respective clonal population of amplicons.

18. The method as defined in any one of claims 9 to 17, characterized in that, prior to hybridizing the respective samples with the probe templates, the method further comprises preparing the respective samples by: contacting a single-stranded genomic DNA template with a low-processivity polymerase, a plurality of primers, and free nucleotides to generate complementary fragments of the single-stranded genomic DNA template; and displacing the complementary fragments of the single-stranded genomic DNA template to generate at least some of the respective samples. anocLn / Lznz / E / Yii 19. The method as defined in claim 18, further comprising denaturing a double-stranded genomic deoxyribonucleic acid (DNA) to thereby generate the single-stranded genomic DNA template.

20. The method as defined in claim 18, further comprising repeating both the contact and displacement of a predetermined number of cycles to generate additional complementary fragments in each of the predetermined number of cycles.

21. The method as defined in claim 18, characterized in that the low processivity polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and a modified polymerase.

22. The method as defined in any one of claims 9 to 17, characterized in that prior to hybridizing the respective samples with the probe templates, the method further comprises preparing the respective samples by: contacting a single-stranded genomic DNA template with a polymerase, a plurality of primers, and a mixture of free nucleotides including natural nucleotides and dideoxythymidine triphosphate to thereby generate complementary truncated fragments of the single-stranded genomic DNA template; and displacing the complementary truncated fragments of the single-stranded genomic DNA template to thereby generate at least some of the respective samples.

23. The method as defined in claim 22, characterized in that the natural nucleotides include deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate, and wherein the mixture of free nucleotides includes a ratio of deoxythymine triphosphate to dideoxythymidine triphosphate in the range of approximately 10:5 to approximately 10:0.

01.

24. The method as defined in claim 22, further comprising denaturing a double-stranded genomic deoxyribonucleic acid (DNA), thereby generating the single-stranded genomic DNA template.

25. The method as defined in claim 22, further comprising repeating both the contact and displacement of a predetermined number of cycles to generate additional truncated complementary fragments in each of the predetermined number of cycles.

26. The method as defined in claim 22, characterized in that the polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and a modified polymerase. anocLn / Lznz / B / Yii