Novel mutant of mtrab system accessory protein lpqb and method for producing l-glutamic acid using same

Abstract

The present invention relates to a novel mutant of MtrAB system accessory protein LpqB and a method for producing L-glutamic acid using same. The mutant of MtrAB system accessory protein LpqB has changed protein activity obtained by substituting at least one amino acid among amino acid sequences constituting the MtrAB system accessory protein LpqB, and thus L-glutamic acid can be efficiently produced from a recombinant microorganism expressing the mutant.

Description

Novel variant of MTRAB system accessory protein LPQB and method for producing L-glutamic acid using the same

[0001] The present invention relates to a novel variant of the MtrAB system accessory protein LpqB and a method for producing L-glutamic acid using the same.

[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation, and its salt form, monosodium L-glutamate (MSG), adds balance and harmony to the overall taste of food, increasing the preference for foods such as meat, fish, chicken, vegetables, sauces, soups, and seasonings, and can enhance the taste of low-salt foods with up to 30% less salt, so it is widely used as a seasoning for household and processed food production.

[0003] A brief look at the fermentation pathway of L-glutamic acid reveals that glucose primarily passes through the glycolytic pathway, but some is metabolized through the pentose phosphate pathway into two molecules of pyruvate. One molecule fixes CO2 to become oxaloacetic acid, and the other combines with acetyl CoA from pyruvate to form citric acid. Oxaloacetate and citric acid then enter the citric acid cycle (TCA cycle) to become α-ketoglutaric acid. Here, the reductive amino acid oxidation of alpha-ketoglutarate proceeds efficiently to produce L-glutamic acid because the oxidative metabolic pathway from alpha-ketoglutarate to succinic acid is absent and isocitrate dehydrogenase and glutamate dehydrogenase are closely involved.

[0004] L-glutamic acid can be produced using wild-type strains obtained from nature or mutant strains modified to enhance their glutamic acid production ability. Recently, to improve the efficiency of L-glutamic acid production, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of useful substances such as amino acids and nucleic acids. Various recombinant strains or mutant strains with excellent L-glutamic acid production ability, as well as methods for producing L-glutamic acid using them, have been developed by applying genetic recombination technology. In particular, there have been attempts to increase L-glutamic acid production by directly inducing mutations in genes such as enzymes, transcription factors, and transport proteins involved in the L-glutamic acid biosynthetic pathway, or by inducing mutations in promoters that regulate their expression. However, because the types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-glutamic acid production are diverse, much research is still needed to determine whether changes in the activity of these proteins increase L-glutamic acid production.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] U.S. Patent No. 6,852,516

[0008] U.S. Patent No. 6,962,805

[0009] The present invention aims to provide a novel MtrAB system accessory protein LpqB variant.

[0010] In addition, the present invention aims to provide a polynucleotide encoding the above mutant.

[0011] In addition, the present invention aims to provide a transformant comprising the mutant or polynucleotide.

[0012] In addition, the present invention aims to provide a method for producing L-glutamic acid using the transformant.

[0013] One aspect of the present invention provides an MtrAB system accessory protein LpqB variant having an amino acid sequence of SEQ ID NO: 4, in which alanine (A) at position 407 in the amino acid sequence of SEQ ID NO: 2 is substituted with threonine (T).

[0014] The “MtrAB system accessory protein LpqB” used in the present invention is a component of the MtrAB system, which is one of the signal transduction mechanisms (two-component system) for microorganisms to recognize external environmental changes and respond to stress, and is known to function as a lipoprotein. The MtrAB system accessory protein LpqB in the present invention may be a polypeptide encoded by the NCgl0723 or lpqB gene and having MtrAB system accessory protein LpqB activity, but is not limited thereto.

[0015] Nucleic acid and protein sequence information for the above MtrAB system accessory protein LpqB can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0016] According to one specific example of the present invention, the MtrAB system accessory protein LpqB may be encoded by the base sequence of SEQ ID NO: 1 and may be composed of the amino acid sequence of SEQ ID NO: 2.

[0017] The base sequence or amino acid sequence of the MtrAB system accessory protein LpqB according to the present invention may include a base sequence or amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity compared to each sequence. Here, “homology” or “identity” means the rate of identity (%) between a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence when they are aligned and analyzed to correspond as much as possible.

[0018] According to one specific example of the present invention, the MtrAB system accessory protein LpqB or the gene encoding it may be derived from wild type Corynebacterium glutamicum.

[0019] The term "variant" as used herein refers to a protein whose amino acid sequence is different from the original amino acid sequence due to a change in the base sequence of the gene encoding the protein. Specifically, one or more bases or nucleotides in the gene sequence are different due to substitution, insertion, deletion, etc., and the resulting translated polypeptide or protein is a protein variant in which one or more amino acids at the N-terminus, C-terminus, and / or internal portion of the amino acid sequence are conservatively substituted and / or modified, so that the polypeptide or protein differs from the amino acid sequence before the mutation, but the functions or properties are maintained. Here, a "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties, and may have little or no effect on the activity of the protein or polypeptide. The amino acids are selected from alanine (Ala, A), isoleucine (Ile, I), valine (Val, V), leucine (Leu, L), methionine (Met, M), asparagine (Asn, N), cysteine ​​(Cys, C), glutamine (Gln, Q), serine (Ser, S), threonine (Thr, T), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), glutamic acid (Glu, E), arginine (Arg, R), histidine (His, H), lysine (Lys, K), glycine (Gly, G), and proline (Pro, P).

[0020] Additionally, variants include those in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted, or portions are deleted from the N- and / or C-terminus of the mature protein.

[0021] Such variants may have increased (enhanced), unchanged, or decreased (weakened) abilities compared to the pre-mutation protein. Here, "increased or enhanced" includes cases where the activity of the protein itself is increased compared to the pre-mutation protein, cases where the overall enzyme activity level in the cell is higher than that of the wild-type strain or the strain expressing the pre-mutation protein due to increased expression or translation of the gene encoding the protein, and combinations thereof. In addition, "decreased or weakened" includes cases where the activity of the protein itself is decreased compared to the pre-mutation protein, cases where the overall enzyme activity level in the cell is lower than that of the wild-type strain or the strain expressing the pre-mutation protein due to inhibition of expression or translation of the gene encoding the protein, and combinations thereof. In the present invention, the term "variant" may be used interchangeably with "variant," "modification," "variant polypeptide," "mutated protein," "mutant," etc.

[0022] The MtrAB system accessory protein LpqB variant according to the present invention may comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with respect to the amino acid sequence of SEQ ID NO: 4, excluding the mutation position (amino acid residue at position 407). Such an MtrAB system accessory protein LpqB variant may comprise, without limitation, any amino acid sequence that maintains the function or property of the MtrAB system accessory protein LpqB variant.

[0023]

[0024] Another aspect of the present invention provides a polynucleotide encoding the MtrAB system accessory protein LpqB variant.

[0025] The "polynucleotide" used in the present invention is a polymer of nucleotides in which nucleotide units are covalently bonded to form a long chain, and is a DNA or RNA strand of a certain length or longer, and specifically refers to a polynucleotide fragment encoding the MtrAB system accessory protein LpqB variant.

[0026] According to one specific example of the present invention, the polynucleotide comprises a base sequence encoding an amino acid sequence of SEQ ID NO: 4, for example, it may comprise a base sequence of SEQ ID NO: 3.

[0027]

[0028] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the MtrAB system accessory protein LpqB variant.

[0029] In addition, another aspect of the present invention provides a transformant comprising the MtrAB system accessory protein LpqB variant or polynucleotide.

[0030] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene into a host cell. Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and a "regulatory sequence" includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0031] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0032] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0033] The "recombinant vector" used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell's genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0034] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, kanamycin, streptomycin, and chloramphenicol.

[0035] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0036] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, E. coli such as E. coliDH5α, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis, Bacillus thuringiensis, and various enterobacteria such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus.

[0037] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0038] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0039] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0040] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0041] According to one specific example of the present invention, the transformant may be a strain of the genus Escherichia or a strain of the genus Corynebacterium.

[0042] The above Escherichia genus strains may include, but are not limited to, Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, and Escherichia vulneris.

[0043] The above-mentioned strains of the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium. Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium Corynebacterium pollutisoli, Corynebacterium imitans,These may include, but are not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi, and Corynebacterium flavescens.

[0044] For example, the transformant may be a strain of the genus Corynebacterium, specifically Corynebacterium glutamicum.

[0045] The transformant in the present invention may be, but is not limited to, a strain comprising the above-described MtrAB system subprotein LpqB variant or a polynucleotide encoding the same, or a vector comprising the same, a strain expressing the above-described MtrAB system subprotein LpqB variant or polynucleotide, or a strain having activity against the above-described MtrAB system subprotein LpqB variant.

[0046] According to one specific example of the present invention, the transformant may be transformed to express the MtrAB system accessory protein LpqB variant, or may be transformed by introducing a polynucleotide encoding the MtrAB system accessory protein LpqB variant.

[0047] The transformant of the present invention may include other protein variants or genetic mutations in addition to the MtrAB system accessory protein LpqB variant.

[0048] According to one specific example of the present invention, the transformant may have the ability to produce L-glutamic acid.

[0049] The above transformant may have a natural ability to produce L-glutamic acid, or may have an artificial ability to produce L-glutamic acid.

[0050] According to one specific example of the present invention, the transformant may have an improved L-glutamic acid production ability due to a change in the activity of the MtrAB system accessory protein LpqB.

[0051] Specifically, it can be expected that the transformant according to the present invention has improved L-glutamic acid production ability by changing the lipoprotein constituting the cell wall due to mutation of the MtrAB system accessory protein LpqB, resulting in improved L-glutamic acid excretion ability.

[0052] As used herein, "improved productivity" means increased productivity of L-glutamic acid compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a strain that is directly the target of mutation or a strain transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Escherichia spp. strain or a Corynebacterium spp. strain, or an Escherichia spp. strain or a Corynebacterium spp. strain that is mutated from the wild type.

[0053] The transformant according to the present invention exhibits increased L-glutamic acid production ability compared to a strain (parent strain) containing the pre-mutant protein due to changes in the activity of the MtrAB system subprotein LpqB by introducing the MtrAB system subprotein LpqB mutant. Specifically, the transformant has an increase in L-glutamic acid production by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 20-fold, 30-fold, 40-fold, It may be increased by, but is not limited to, 50x, 60x, 70x, 80x, 90x, or 100x.

[0054] A composition comprising a transformant according to the present invention can be used as a composition for producing L-glutamic acid.

[0055]

[0056] Another aspect of the present invention provides a method for producing L-glutamic acid, comprising the steps of culturing the transformant in a medium; and recovering L-glutamic acid from the transformant or the medium in which the transformant is cultured.

[0057] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0058] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for Bacillus spp. strains can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0059] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0060] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0061] According to one specific example of the present invention, the step of recovering L-glutamic acid from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-glutamic acid produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0062] According to one specific example of the present invention, the step of recovering the L-glutamic acid may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0063] According to one specific example of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid.

[0064] The MtrAB system subprotein LpqB variant according to the present invention has a protein activity changed by substituting one or more amino acids in the amino acid sequence constituting the MtrAB system subprotein LpqB, thereby enabling efficient production of L-glutamic acid from a recombinant microorganism expressing the variant.

[0065] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0066]

[0067] Example 1. Construction of a strain expressing a mutant of the MtrAB system accessory protein LpqB.

[0068] In order to determine the effect of a mutant (SEQ ID NO: 4) in which alanine (A) at position 407 in the amino acid sequence of the MtrAB system accessory protein LpqB (SEQ ID NO: 2) is substituted with threonine (T) on L-glutamic acid production, a vector expressing the MtrAB system accessory protein LpqB mutant and a strain into which the vector was introduced were constructed.

[0069]

[0070] 1-1. Construction of vector pK_lpqB (A407T) for transformation

[0071] The genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template, and PCR was performed using the primer pairs of primers 1 and 2 and primer pairs of primers 3 and 4, respectively. Two PCR products of approximately 0.7 kb and 0.8 kb in size amplified through PCR were mixed and used as templates, and overlapping PCR was performed with the primer pair of primers 1 and 4 to link them into a single fragment. After treating the pK19msb vector (SEQ ID NO: 5) with the restriction enzyme smaI (NEB), the fragment was cloned using T4 ligase. The vector constructed in this way was named pK_lpqB(A407T). All PCRs used pfu premix (bioneer), and were denatured at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by a final extension at 72°C for 5 minutes. The primer sequences used for vector construction are shown in Table 1 below.

[0072] Sequence number Primer name Primer sequence (5'-3') 6 Primer 1 GATCCTTCTGGCCAGGTGTTG 7 Primer 2 CCGGTTGTTGTCGATCGTGCG 8 Primer 3 CGCACGATCGACAACAACCGG 9 Primer 4 CCAGCGTGATGTCGTGCTC

[0073]

[0074] 1-2. Production of L-glutamic acid producing strain with pK_lpqB(A407T) introduced

[0075] To construct an L-glutamic acid-producing strain, Corynebacterium glutamicum U3 (accession number KCCM13218P) was used as the parent strain. The final concentration of the pK_lpqB(A407T) vector was prepared to be 1 ㎍ / ㎕ or more, and Corynebacterium glutamicum U3 was electroporated (Reference: Tauch et al., FEMS Microbiology letters 123 (1994) 343-347). 1 ㎖ of regeneration medium (containing 18.5 g / ℓ of Brain Heart infusion and 91 g / ℓ of sorbitol) was added, and the mixture was heat-treated at 46°C for 6 minutes. After treatment, the cells were transferred to a 15 ml cap tube, cultured at 30°C for 2 hours, and plated on a selection medium (containing 5 g / L tryptone, 5 g / L NaCl, 2.5 g / L yeast extract, 18.5 g / L Brain Heart infusion powder, and 15 g / L agar) containing 20 mg / L kanamycin. Colonies generated by culturing at 30°C for 72 hours were cultured in BHI medium (18.5 g / L Brain Heart infusion powder) for 15 hours to induce secondary recombination, and 10 -2 ~ 10 -3 The culture was diluted to 10% sucrose and plated on a selective medium to isolate colonies. The isolated colonies were cultured on two types of selective media each containing kanamycin and sucrose, and a strain that was not resistant to kanamycin and could grow on a medium containing sucrose was selected. The selected strain was named lpqB (A407T).

[0076]

[0077] Experimental Example 1. Evaluation of L-glutamic acid production capacity

[0078] The L-glutamic acid production ability of strain lpqB (A407T) expressing the MtrAB system accessory protein LpqB mutant was evaluated compared to the parent strain Corynebacterium glutamicum U3.

[0079] Each strain was inoculated at 1% of the volume in a 100 mL flask containing 10 mL of the glutamic acid production medium in Table 2 below, and cultured with shaking at 30°C, 200 rpm, for 48 hours. After completion of the culture, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0080] Glutamic acid production medium Glucose 70.0 g / L (NH4)2SO4 5.0 g / LMgSO4 0.4 g / LUrea 2.0 g / L Soybean hydrolysate 15.0 ml / LKH2PO4 1.0 g / LFeSO4 10.0 mg / LMnSO4 10.0 mg / LThiamine_HCl 200.0 ug / LBiotin 2.0 ug / LCaCO 3 5.0 %

[0081] L-glutamic acid production (g / L) Parent strain 14.31 lpq B (A407T) 16.1

[0082] As shown in Table 3 above, strain lpqB (A407T) expressing the MtrAB system accessory protein LpqB mutant was confirmed to have an L-glutamic acid production increase of approximately 12.6% compared to the parent strain by substituting alanine, the 407th amino acid in the amino acid sequence of the MtrAB system accessory protein LpqB, with threonine.

[0083]

[0084] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0085] [Accession number]

[0086] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0087] Accession number: KCCM13218P

[0088] Date of acceptance: 20220629

[0089]

Claims

1. A variant of the MtrAB system accessory protein LpqB having an amino acid sequence of SEQ ID NO: 4, in which the 407th alanine (A) in the amino acid sequence of SEQ ID NO: 2 is substituted with threonine (T).

2. A polynucleotide encoding a variant of claim 1.

3. A transformant comprising the variant of claim 1 or the polynucleotide of claim 2.

4. In claim 3, The above transformant is a transformant that is a strain of the genus Escherichia or a strain of the genus Corynebacterium.

5. In claim 3, The above transformant is a transformant having the ability to produce L-glutamic acid.

6. A step of culturing the transformant of claim 3 on a medium; and A method for producing L-glutamic acid, comprising a step of recovering L-glutamic acid from the transformant or the medium in which the transformant is cultured.

Images