Composition for ameliorating hearing impairment comprising senna tora (l.) roxb. extract and the like

Abstract

The present invention relates to a composition for ameliorating, treating or preventing hearing impairment, comprising, as active ingredient(s), one or more selected from the group consisting of a Senna tora (L.) Roxb. extract, a Fagophyrum esculentum MOENCH. extract, a Sorghum bicolor extract, and a Phellinus linteus extract. The Senna tora (L.) Roxb. extract, the Fagophyrum esculentum MOENCH extract, the Sorghum bicolor extract, and / or the Phellinus linteus extract, according to the present invention, have the effect of restoring hearing function or ameliorating, preventing or treating hearing impairment, and thus can be effectively used as a pharmaceutical composition, a food composition, a health functional food, a quasi-drug composition, and a feed composition.

Description

Composition for improving hearing impairment containing cassia seed extract, etc.

[0001] The present invention relates to a composition for improving, treating, or preventing hearing impairment, comprising as active ingredients an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentumMOENCH.), an extract of sorghum (Sorghum bicolor), and / or an extract of Phellinus linteus.

[0002]

[0003] Among various sensory organ diseases, inner ear diseases have the highest incidence. To date, most research and development on ear-related diseases has focused on diseases caused by inflammation, such as bacterial otitis externa, malignant otitis externa, fungal otitis externa, otomycosis, otitis media, and labyrinthitis, and the development of related treatments has primarily focused on these diseases. However, in modern society, it has been reported that more than 40% of people over 50 years of age and more than 70% of people over 70 years of age exhibit hearing impairment, such as hearing loss. Oxidative stress, in particular, is known to be a major common causative factor in both degenerative and ototoxic hearing loss.

[0004] In this way, in modern society, due to factors such as increased noise exposure and an aging population, hearing loss caused by cell or nerve damage is becoming a bigger issue than ear-related diseases based on inflammation. Moreover, hearing loss is one of the most common and well-known diseases in modern society, to the extent that most people can distinguish between ear-related diseases caused by inflammation, such as bacterial otitis externa, malignant otitis externa, fungal otitis media, and inner otitis media, and hearing loss caused by cell or nerve damage. This hearing loss caused by cell or nerve damage can be caused by factors such as noise, aging, ototoxic drugs, neurotoxic chemicals, viruses, genetics, and in some cases, the cause is unknown.

[0005] Among the various causes of hearing loss, a newly emerging issue is hearing loss caused by side effects of cancer treatment. In modern society, cancer has become the leading cause of death, leading to a rapid increase in the number of people receiving anticancer drugs. However, the use of anticancer drugs can cause hearing loss. These side effects typically appear one to two weeks after treatment, but in some cases, they have been reported to occur as long as six months. With the increase in the number of cancer patients and the increased use of anticancer drugs, the number of patients with hearing loss is also rapidly increasing.

[0006] Many specialists and pharmaceutical professionals still rely on existing antibiotics or anti-inflammatory drugs to treat the above conditions, but these are not suitable treatments for hearing loss. This reliance on existing treatments stems from two factors: first, the lack of a known treatment for hearing loss, and second, the lack of clear understanding among many specialists and pharmaceutical professionals about treatment options for hearing loss. These issues continue to hinder the proper implementation of hearing loss treatment. In particular, research on the treatment of sensorineural hearing loss has focused on steroid therapy, but its effectiveness is limited to the acute phase.

[0007] Accordingly, while preclinical studies on various drugs have been reported to identify substances effective in preventing and treating hearing loss, limitations have been identified in progressing to clinical trials. Furthermore, no drugs have been approved for the prevention or treatment of hearing loss. Furthermore, there are virtually no drugs developed for the treatment of hearing loss that utilize natural products or materials without toxicity or risk to the human body. In other words, unlike ear diseases caused by inflammation, no suitable treatments have been developed for hearing loss.

[0008] Against this backdrop, the inventors of the present invention have conducted extensive research efforts to develop natural materials useful for hearing impairments such as hearing loss, and as a result, have confirmed that cassia seed extract, buckwheat extract, sorghum extract, and / or Phellinus linteus extract have an auditory cell protective effect and can be applied as materials for improving hearing loss, thereby completing the present invention.

[0009]

[0010] The present invention aims to solve the above-mentioned problems and other problems related thereto.

[0011] An exemplary object of the present invention is to provide a food composition for restoring hearing function; or improving or preventing hearing impairment; comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0012] Another exemplary object of the present invention is to provide a pharmaceutical composition for preventing or treating hearing impairment, comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0013] Another exemplary object of the present invention is to provide a health functional food for restoring hearing function; or improving or preventing hearing impairment; comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0014] Another exemplary object of the present invention is to provide a pharmaceutical composition for restoring hearing function; or improving or preventing hearing impairment; comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0015] Another exemplary object of the present invention is to provide a feed composition for restoring hearing function; or improving or preventing hearing impairment; comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0016] Another exemplary object of the present invention is to provide a method for recovering hearing function or improving, preventing or treating hearing impairment, which comprises administering to a subject in need thereof a composition comprising at least one active ingredient selected from the group consisting of a Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract and a Phellinus linteus extract in an amount effective for recovering hearing function or improving, preventing or treating hearing impairment.

[0017] Another exemplary object of the present invention is to provide a use of a composition comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract for restoring hearing function or improving, preventing, or treating hearing impairment.

[0018] Another exemplary object of the present invention is to provide a use of a composition comprising at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus as an active ingredient for the manufacture of a medicament for restoring hearing function or improving, preventing, or treating hearing impairment.

[0019] The technical problem to be achieved according to the technical idea of ​​the invention disclosed in this specification is not limited to the problem to solve the above-mentioned problem, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

[0020]

[0021] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0022] As one aspect for achieving the above purpose, a food composition for restoring hearing function; or improving or preventing hearing impairment; is provided, which comprises as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0023] In the present invention, "cassia seed" refers to the seeds of Cassia tora, an annual plant belonging to the legume family. Cassia tora is known to have pharmacological effects such as protecting the optic nerve, lowering blood pressure, and lowering cholesterol, but its use in the treatment of hearing impairment has not yet been reported.

[0024] In the present invention, the cassia seeds can be used as is without damaging their original form, or can be used after performing a pretreatment process in consideration of the process speed and process (manufacturing) efficiency intended by a person skilled in the art. The pretreatment process can include, for example, conventional selection, washing, cutting, powdering, drying, etc.

[0025] In the present invention, "buckwheat" is native to Central Asia and is cultivated throughout the country. It is cool in nature and is classified as a cold food. It is known to have the effect of reducing body heat and facilitating bowel movements, but there is currently no information known about its effect on improving hearing impairment.

[0026] In the present invention, buckwheat may be used as is without damaging its original form, or may be used after performing a pretreatment process in consideration of the process speed and process (manufacturing) efficiency intended by a person skilled in the art. The pretreatment process may include, for example, conventional steps such as sorting, washing, cutting, powdering, and drying.

[0027] In the present invention, the buckwheat extract may be an extract of buckwheat fruit, fruit skin, seed, leaf, flower or stem, and may specifically be an extract of buckwheat fruit skin, but is not limited thereto.

[0028] In the present invention, buckwheat hull refers to the hull of buckwheat fruit.

[0029] In the present invention, "sorghum" is an annual plant belonging to the gramineae family, distributed in Korea, China, Africa, South America, etc., and is known to activate intestinal function and be effective in treating cystitis, but its use in relation to hearing impairment has not yet been known.

[0030] In the present invention, sorghum may be used as is without damaging its original form, or may be used after performing a pretreatment process in consideration of the process speed and process (manufacturing) efficiency intended by a person skilled in the art, and the pretreatment process may include, for example, conventional steps such as sorting, washing, cutting, powdering, and drying.

[0031] In the present invention, the "Sanghwang mushroom" is a perennial mycelial mushroom distributed in Asia, North America, Australia, etc., and contains a large amount of beta-glucan polysaccharides, and is known to have anticancer, immune activity, antioxidant activity, etc. effects, but nothing is known about its effect on improving hearing impairment to date.

[0032] In the present invention, the mushroom may be used as is without damaging its original form, or may be used after performing a pretreatment process in consideration of the process speed and process (manufacturing) efficiency intended by a person skilled in the art, and the pretreatment process may include, for example, conventional steps such as selection, washing, cutting, powdering, and drying.

[0033] The term "hearing impairment" in the present invention refers to a state in which there is a limitation and functional defect in receiving and expressing language due to total or partial loss of hearing. The causes of the hearing loss include noise, aging, use of ototoxic drugs such as anticancer drugs, oxidative stress, heredity, trauma, earwax accumulation, infection, diabetes, autoimmune disease, or congenital disorders. Hearing loss can be classified into conductive hearing loss, which occurs when something blocks sound from reaching the sensory structures of the inner ear, sensory hearing loss, in which sound reaches the inner ear but is not converted into nerve impulses, neural hearing loss, in which nerve impulses are not transmitted to the brain, sensorineural hearing loss, or mixed loss related to both conductive and sensorineural hearing loss. Hearing impairment can be classified into deafness, in which a person cannot hear sounds at all or cannot communicate using sounds alone even if there is residual hearing, and hearing loss, in which communication is possible using residual hearing with the help of a device such as a hearing aid. In addition, the above hearing impairment may manifest as otitis media or tinnitus.

[0034] Specifically, in the present invention, the hearing impairment may be hearing loss, but is not limited thereto. The hearing loss may be any one selected from the group consisting of noise-induced hearing loss, presbycusis, sudden hearing loss, auditory neuropathy due to diabetes, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss, and more specifically, may be noise-induced hearing loss, presbycusis, or ototoxic hearing loss caused by oxidative stress, but is not limited thereto. The hearing loss may be broadly classified into conductive hearing loss, which occurs when sound waves are not transmitted normally due to a disorder of the outer or middle ear, and sensorineural (sensorigenic, sensori-neurogenic) hearing loss, which occurs when there is an abnormality in the function of the cochlea to detect sound in the inner ear, or when there is damage to the auditory nerve that transmits sound stimulation to the brain. In addition, the hearing loss may be classified into central hearing loss, which occurs due to a disorder of the auditory center, and mixed hearing loss, which occurs in the combination of two or more disorders.

[0035] In the present invention, the composition comprising as an active ingredient at least one selected from the group consisting of a Senna tora (L.) Roxb. extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract may inhibit apoptosis of hair cells by reducing the expression of a hair cell apoptosis factor. In addition, the hair cell apoptosis factor may be cleaved caspase-3 (c-Cas3) and / or cytochrome c.

[0036] The term "hair cell" in the present invention refers to a cell located in the organ of Corti of the cochlea in the inner ear, which transmits sound to nerve cells. Damage to hair cells can lead to hearing impairment, including hearing loss. Therefore, hearing impairment can be improved by preventing hair cell death or promoting regeneration.

[0037] Specifically, in an embodiment of the present invention, it was confirmed that cell death was inhibited when treating hair cells treated with hydrogen peroxide with a cassia seed extract, a buckwheat extract, a sorghum extract, or a Phellinus linteus extract, and thus it was confirmed that the cassia seed extract, a buckwheat extract, a sorghum extract, or / and a Phellinus linteus extract have the effect of improving hearing impairment such as hearing loss.

[0038] Specifically, in an embodiment of the present invention, when treating a cassia seed extract, a buckwheat extract, a sorghum extract, or a Phellinus linteus extract to hair cells treated with hydrogen peroxide, intracellular ROS decreased, CellROX and DCFDA (2',7'-Dichlorofluorescin diacetate), which are reagents for measuring intracellular oxidative stress increased by hydrogen peroxide, decreased, and 4HNE (4-Hydroxy-2-nonenal), an indicator of oxidative stress due to noise exposure, decreased, confirming that intracellular oxidative stress was reduced, confirming that the cassia seed extract, buckwheat extract, sorghum extract, or / and Phellinus linteus extract have antioxidant effects.

[0039] In the present invention, the term "extract" includes an extract obtained by extraction treatment of the cassia seed, buckwheat, sorghum or Phellinus linteus, a diluted or concentrated extract, a dried product obtained by drying the extract, a controlled or purified product of the extract, or a mixture thereof, and all extracts in the form of formulations that can be formed using the extract itself and the extract.

[0040] In the present invention, the extraction is not particularly limited, and extraction can be performed according to a method commonly used in the relevant technical field. Non-limiting examples of the extraction method include hot water extraction, cold immersion extraction, solvent extraction, steam distillation, dissolution, compression, ultrasonic extraction, filtration, reflux extraction, etc., and these may be performed alone or in combination of two or more methods.

[0041] The extract of the present invention is obtained by extracting cassia seeds, buckwheat, sorghum, or Phellinus linteus using an appropriate solvent, and may include, for example, a crude extract, a polar solvent-soluble extract, or a non-polar solvent-soluble extract. The type of extraction solvent used to prepare the extract is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the extraction solvent include water; alcohols having 1 to 4 carbon atoms, such as methanol, ethanol, propanol, isopropanol, butanol, propyl alcohol, and butyl alcohol; polyhydric alcohols, such as glycerin, butylene glycol, and propylene glycol; hydrocarbon solvents, such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether, and dichloromethane; or mixtures thereof. For example, a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or mixed solvents thereof may be used.

[0042] The food composition of the present invention can be manufactured into various dosage forms, and unlike general drugs, it has the advantage of not having side effects that may occur when taking drugs for a long period of time by using food as a raw material. The food composition of the present invention can be manufactured into any form, and specifically, it can be one or more dosage forms selected from the group consisting of health functional food preparations such as tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, bars, beverages, gums, and candies, but is not particularly limited thereto.

[0043] In addition, the food composition of the present invention may contain food additives in addition to the effective ingredients. Food additives can generally be understood as substances added to, mixed with, or infiltrated into food during the manufacturing, processing, or preservation of food, and their safety must be guaranteed because they are consumed daily and over a long period of time with food. The food additives are classified into sweeteners, flavoring agents, preservatives, emulsifiers, acidulants, thickeners, etc. in terms of function, and are not particularly limited as long as they are consistent with the purpose to be achieved by the food composition of the present invention. In addition, the food composition of the present invention may contain, in addition to the food additives, physiologically active substances or minerals known in the art for the purpose of functionality and nutritional supplementation and guaranteed for safety as food additives. The physiologically active substances or minerals are not particularly limited as long as they are consistent with the purpose to be achieved by the food composition of the present invention.

[0044] The food composition of the present invention may include the aforementioned food additives in an effective amount that can achieve the purpose of addition depending on the product type, and with respect to other food additives that may be included in the food composition of the present invention, reference may be made to the food codes or food additive codes of each country.

[0045] In the present invention, “prevention” means any act of suppressing or delaying hearing impairment through administration of the pharmaceutical composition of the present invention, and “improvement” in the present invention means any act of improving hearing impairment through administration of the composition.

[0046] Another aspect of the present invention for achieving the above object provides a pharmaceutical composition for preventing or treating hearing impairment, comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0047] In the present invention, “cassia seed”, “buckwheat”, “sorghum”, “mushroom”, “extract”, “hearing impairment”, “prevention” or “hearing loss” are as described above.

[0048] In the present invention, “treatment” means any act of improving, alleviating, or beneficially changing a hearing impairment caused by administering the pharmaceutical composition of the present invention.

[0049] In the present invention, the "pharmaceutical composition" means a composition manufactured for the purpose of preventing or treating a disease, and each can be formulated and used in various forms according to conventional methods. For example, it can be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., depending on the route of administration, and can be formulated and used in the form of topical preparations and sterile injectable solutions. Specifically, the administration route can be any appropriate route including topical route, oral route, intravenous route, intramuscular route, and direct absorption through mucosal tissue, and two or more routes can also be used in combination. An example of a combination of two or more routes is a case where two or more drug formulations are combined according to the administration route, for example, a case where one drug is administered first via the intravenous route and another drug is administered secondarily via the topical route.

[0050] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier, excipient, or diluent according to a conventional method. Pharmaceutically acceptable carriers are well known in the art depending on the route of administration or dosage form, and specific examples thereof may be found in the pharmacopoeias of each country, including the 'Korean Pharmacopoeia'. Carriers, excipients, and diluents that may be included in the composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Additionally, carriers, excipients, and diluents that may be included in the composition of the present invention may be non-natural carriers, but are not limited thereto.

[0051] The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods. Specifically, when formulating, it can be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants that are commonly used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations can be prepared by mixing the above compound with at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include withepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin. Specific formulations of pharmaceutical compositions are known in the art, and reference may be made, for example, to Remington's Pharmaceutical Sciences (19th ed. 1995), which is incorporated herein by reference.

[0052] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. The pharmaceutically effective amount refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects. The effective dosage level may be determined based on factors including the patient's health condition, type and severity of the disease, drug activity and sensitivity to the drug, administration method, administration time, administration route and excretion rate, treatment period, combination or concurrent drug use, and other factors well known in the medical field. The dosage and frequency of administration do not limit the scope of the present invention in any way.

[0053] The pharmaceutical composition of the present invention can be administered to mammals, including rats, dogs, cats, cows, horses, pigs, and humans, via various routes, preferably to humans. Any route of administration is conceivable, including, but not limited to, oral, intravenous, intramuscular, or subcutaneous injection.

[0054] In the present invention, the meaning of “comprising as an effective ingredient” means including an effective amount capable of exhibiting a preventive or therapeutic effect on hearing impairment as a pharmaceutical composition.

[0055] Another aspect of the present invention for achieving the above object provides a health functional food for restoring hearing function; or improving or preventing hearing impairment; comprising as an active ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0056] In the present invention, “cassia seed”, “buckwheat”, “sorghum”, “mushroom”, “extract”, “hearing impairment”, “improvement”, “prevention” or “hearing loss” are as described above.

[0057] The term "health functional food" in the present invention refers to a food manufactured and processed using raw materials or ingredients with functionality beneficial to the human body. The term "functionality" refers to obtaining a beneficial effect for health purposes, such as regulating nutrients or physiological functions in relation to the structure and function of the human body. The health functional food of the present invention can be manufactured by methods commonly used in the art, and can be manufactured by adding raw materials and ingredients commonly added in the art during manufacturing.

[0058] In addition, the formulation of the above health functional food can be manufactured without limitation as long as it is a formulation recognized as a health functional food, and non-limiting examples of the formulation include one or more formulations selected from the group consisting of health functional food preparations such as tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, bars, beverages, gums, and candies, but are not particularly limited thereto.

[0059] Another aspect of the present invention for achieving the above object provides a composition for recovering hearing function; or improving or preventing hearing impairment; a quasi-drug product comprising at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract as an active ingredient.

[0060] In the present invention, “cassia seed”, “buckwheat”, “sorghum”, “mushroom”, “extract”, “hearing impairment”, “improvement”, “prevention” or “hearing loss” are as described above.

[0061] The quasi-drug composition of the present invention may include, in addition to the cassia seed extract, buckwheat extract, sorghum extract or / and Phellinus linteus extract, ingredients commonly used in quasi-drug compositions, such as, but not limited to, an abrasive, a humectant, a binder, a foaming agent, a sweetener, a preservative, a medicinal ingredient, a flavoring agent, a coloring agent, a solvent, a whitening agent, a solubilizer or a pH adjuster.

[0062] In the present invention, the type of the above-mentioned quasi-drug is not particularly limited and may be any quasi-drug commonly used in the relevant technical field. For example, the above-mentioned quasi-drug may be in one or more formulations selected from the group consisting of liquids, ointments, sprays, creams, gels, patches, and aerogels. These may be used alone or in combination of two or more.

[0063] Another aspect of the present invention for achieving the above object provides a feed composition for restoring hearing function or improving or preventing hearing impairment, comprising as an effective ingredient at least one selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

[0064] In the present invention, “cassia seed”, “buckwheat”, “sorghum”, “mushroom”, “extract”, “hearing impairment”, “improvement”, “prevention” or “hearing loss” are as described above.

[0065] The above feed composition may include a feed additive. The feed additive of the present invention corresponds to a supplementary feed under the Feed Management Act.

[0066] In the present invention, the term "feed" may mean any natural or artificial diet, meal, etc. or a component of said meal, especially for eating, ingesting, and digesting by an animal or suitable therefor.

[0067] The type of the above feed is not particularly limited, and feed commonly used in the relevant technical field can be used. Non-limiting examples of the above feed include plant-based feed such as grains, roots, food processing by-products, algae, fiber, pharmaceutical by-products, oils, starches, meal, or grain by-products; and animal-based feed such as proteins, inorganic substances, oils, minerals, oils, single-cell proteins, zooplankton, or food. These may be used alone or in combination of two or more types.

[0068] Another aspect of the present invention for achieving the above object provides a method for recovering hearing function or improving, preventing or treating hearing impairment, comprising administering to a subject in need thereof a composition comprising at least one active ingredient selected from the group consisting of a cassia seed extract, a buckwheat extract, a sorghum extract and a Phellinus linteus extract in an amount effective for recovering hearing function or improving, preventing or treating hearing impairment.

[0069] In the present invention, “cassia seed”, “buckwheat”, “sorghum”, “mushroom”, “extract”, “hearing impairment”, “improvement”, “prevention”, “treatment” or “hearing loss” are as described above.

[0070] In the present invention, “effective amount” means an amount sufficient to achieve the effect of restoring hearing function or improving, preventing or treating hearing impairment by the composition of the present invention described above.

[0071] The term "subject" as used herein includes, but is not limited to, a human, a monkey, a cow, a horse, a sheep, a pig, a chicken, a turkey, a quail, a cat, a dog, a mouse, a rat, a rabbit or a guinea pig, and may preferably be a mammal, and more preferably may mean a human.

[0072] As used herein, the term “administration” means providing a given substance to a subject by any suitable means.

[0073] The composition of the present invention may be administered orally or parenterally via any conventional route capable of reaching the target tissue. Furthermore, the composition of the present invention may be administered using any device capable of delivering the active ingredient to target cells, tissues, or organs.

[0074] Another aspect of the present invention for achieving the above purpose provides a use of a composition comprising at least one selected from the group consisting of a cassia seed extract, a buckwheat extract, a sorghum extract, and a Phellinus linteus extract as an effective ingredient for restoring hearing function; or improving, preventing, or treating hearing impairment.

[0075] In the present invention, “cassia seed”, “buckwheat”, “sorghum”, “mushroom”, “extract”, “hearing impairment”, “improvement”, “prevention”, “treatment” or “hearing loss” are as described above.

[0076] In the present invention, the purpose may be for recovering hearing function; improving, preventing or treating hearing impairment; or for manufacturing a drug for recovering hearing function; improving, preventing or treating hearing impairment.

[0077]

[0078] The cassia seed extract, buckwheat extract, sorghum extract, or / and Phellinus linteus extract according to the present invention have effects of restoring hearing function; or improving, preventing, or treating hearing impairment, and can be usefully used as pharmaceutical compositions, food compositions, health functional foods, quasi-drug compositions, and feed compositions.

[0079]

[0080] Figure 1 shows the IC of hydrogen peroxide by the death of hair cells (UB-OC1) according to the concentration of hydrogen peroxide treatment. 50 This shows the results of the verification.

[0081] Figure 2 shows the results of MTT analysis confirming the cell death inhibition effect of cassia seed extract treatment in ovarian cells treated with hydrogen peroxide.

[0082] Figure 3 shows the results of MTT analysis confirming the cell death inhibition effect of buckwheat hull extract treatment in ovarian cells treated with hydrogen peroxide.

[0083] Figure 4 shows the results of MTT analysis confirming the cell death inhibition effect of sorghum extract treatment in ovarian cancer cells treated with hydrogen peroxide.

[0084] Figure 5 shows the results of MTT analysis confirming the cell death inhibition effect of Phellodendron amurense extract treatment in ovarian cancer cells treated with hydrogen peroxide.

[0085] Figure 6 shows the results of confirming the effect of buckwheat extract treatment on reducing the expression of apoptotic factors (c-Cas3, cytochrome C) in ovarian cells treated with hydrogen peroxide.

[0086] Figure 7 shows the results of confirming the effect of treatment with a mushroom extract on reducing the expression of apoptotic factors (c-Cas3, cytochrome C) in ovarian cells treated with hydrogen peroxide.

[0087] Figure 8 shows the results of confirming the effect of inhibiting apoptosis by treatment with cassia seed extract in mouse stromal cells that were induced to apoptosis by treatment with hydrogen peroxide.

[0088] Figure 9 shows the results of confirming the effect of buckwheat hull extract treatment on the inhibition of apoptosis in mouse hair cells induced by apoptosis treatment with hydrogen peroxide.

[0089] Figure 10 shows the results of confirming the effect of suppressing cell death by treatment with sorghum extract in mouse hair cells that were induced to die by treatment with hydrogen peroxide.

[0090] Figure 11 shows the results of confirming the effect of inhibiting cell death by treatment with a mushroom extract in mouse hair cells that were induced to die by treatment with hydrogen peroxide.

[0091] Figure 12 shows the results of confirming the effect of Cassia tora extract on cochlear hair cell death inhibition after noise exposure.

[0092] Figure 13 shows the results of confirming the effect of buckwheat hull extract on cochlear hair cell death inhibition after noise exposure.

[0093] Figure 14 shows the results of confirming the effect of sorghum extract on cochlear hair cell death inhibition after noise exposure (a: cell death observed by staining cilia with phalloidin, b: cell death observed by staining nuclei with DAPI).

[0094] Figure 15 shows the results of confirming the effect of the extract of Phellodendron amurense on cochlear hair cell death inhibition after noise exposure (a: observation of cell death by staining cilia with phalloidin, b: observation of cell death by staining nuclei with DAPI).

[0095] Figure 16 shows the results of measuring auditory evoked potentials to determine the effect of cassia seed extract on hearing after noise exposure.

[0096] Figure 17 shows the results of measuring auditory evoked potentials to confirm the effect of buckwheat hull extract on hearing after noise exposure.

[0097] Figure 18 shows the results of confirming the effect of sorghum extract on hearing after noise exposure through auditory brainstem response.

[0098] Figure 19 shows the results of confirming the effect of the mushroom extract on hearing after noise exposure through auditory brainstem response.

[0099] Figure 20 shows the results of confirming the antioxidant effect of cassia seed extract treatment in mouse hair cells treated with hydrogen peroxide to induce intracellular oxidative stress.

[0100] Figure 21 shows the results of confirming the antioxidant effect of buckwheat extract treatment in mouse hair cells treated with hydrogen peroxide to induce intracellular oxidative stress.

[0101] Figure 22 shows the results of confirming the antioxidant effect of sorghum extract treatment in mouse hair cells treated with hydrogen peroxide to induce intracellular oxidative stress.

[0102] Figure 23 shows the results of confirming the antioxidant effect of treatment with a mushroom extract in mouse hair cells treated with hydrogen peroxide to induce intracellular oxidative stress.

[0103] Figure 24 shows the results of confirming the effect of buckwheat extract treatment on reducing oxidative stress in mouse hair cells after noise exposure.

[0104] Figure 25 shows the results of confirming the effect of reducing oxidative stress by treatment with sorghum extract in mouse hair cells after noise exposure.

[0105] Figure 26 shows the results of confirming the effect of reducing oxidative stress by treatment with a mushroom extract in mouse hair cells after noise exposure.

[0106] Figure 27 shows the results of analyzing the expression levels of factors (Nrf2, Keap1, and HO-1) involved in the NRF2-KEAP1 pathway, an antioxidant mechanism induced by cassia seed extract in mouse dermal cells.

[0107] Figure 28a shows the expression levels of factors (Nrf2 and HO-1) involved in the NRF2-KEAP1 pathway, an antioxidant mechanism by buckwheat extract in mouse stromal cells, using WB, and Figure 28b shows the results of confirming the translocation of Nrf2 to the nucleus using immunofluorescence staining.

[0108] Figure 29 shows the results of analyzing the expression levels of factors (Nrf2, Keap1, HO-1, SOD1, NQO1, GSR, and eNOS) involved in the NRF2-KEAP1 pathway, an antioxidant mechanism by sorghum extract, in mouse dermal cells.

[0109] Figure 30a shows the expression levels of factors (Nrf2, Keap1, and HO-1) involved in the NRF2-KEAP1 pathway, an antioxidant mechanism by a mushroom extract in mouse hair cells, using WB, and Figure 30b shows the results of confirming the translocation of Nrf2 to the nucleus using immunofluorescence staining.

[0110] Figure 31 shows the results of HPLC analysis of the components contained in buckwheat extract.

[0111] Figure 32 shows the results of analyzing the expression levels of factors (Nrf2, Keap1, and HO-1) involved in the Nr2 / HO-1 pathway of rutin and isoquercitrin contained in buckwheat extract.

[0112]

[0113] Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0114]

[0115] Example 1. Preparation of Cassia Seed Extract, Buckwheat Extract, Sorghum Extract, and Phellinus Linteus Extract

[0116] 1-1. Cassia Seed Extract

[0117] 180g of Cassia tora was prepared and extracted with 1L of 70% fermented alcohol (ethanol, EtOH) at 80℃ for 360 minutes at 110rpm. The extract was filtered and concentrated using a rotary evaporator in a water bath at 60℃. The concentrate was frozen at -70℃ and then freeze-dried for 3 days. After freeze-drying, the extract was stored in a -20℃ freezer. A total of 180g of Cassia tora was extracted, obtaining 7.71g, and the yield was confirmed to be 4.28%.

[0118]

[0119] 1-2. Buckwheat extract

[0120] Buckwheat hulls (100 g) were ground in a blender, extracted by boiling with 1 L of 70% fermented alcohol (ethanol, EtOH) at 80°C for 180 minutes. The extract was filtered and concentrated using a rotary evaporator in a water bath at 60°C. The concentrate was frozen at -70°C and then freeze-dried for 3 days. After freeze-drying, the extract was stored in a -20°C freezer. 3.03 g of buckwheat hull raw material was extracted, and the yield was confirmed to be 3.03%.

[0121]

[0122] 1-3. Sorghum extract

[0123] 180g of sorghum was prepared and extracted with 1.8L of 70% fermented alcohol (ethanol, EtOH) at 80℃ for 360 minutes at 110 rpm. The extract was filtered and concentrated using a rotary evaporator in a 60℃ water bath. The concentrate was frozen at -70℃ and then freeze-dried for 3 days. After freeze-drying, the extract was stored in a -20℃ freezer. A total of 180g of sorghum raw material was extracted, obtaining 4.9g, and the yield was confirmed to be 2.72%.

[0124]

[0125] 1-4. Phellinus linteus extract

[0126] 180g of dried Phellinus linteus was prepared and extracted with 1L of 70% fermented alcohol (ethanol, EtOH) at 80℃ for 360 minutes at 110rpm. The extract was filtered and concentrated using a rotary evaporator in a 60℃ water bath. The concentrate was frozen at -70℃ and then freeze-dried for 3 days. After freeze-drying, the extract was stored in a -20℃ freezer. A total of 180g of dried Phellinus linteus was extracted, obtaining 17.96g, and the yield was confirmed to be 9.97%.

[0127]

[0128] Example 2. In vitro analysis of the efficacy of Cassia tora extract, buckwheat extract, sorghum extract, or Phellinus linteus extract on improving hearing impairment.

[0129] 2-1. Cell culture and hydrogen peroxide treatment

[0130] The auditory sensory hair cells derived from the organ of Corti, the auditory developmental organ of the mouse, were cultured in DMEM (Gibco™) containing 1% penicillin / streptomycin (Gibco™), 10% fetal bovine serum (FBS; WELGENE), and 50 U / mL INF-γ (Sigma Aldrich) at 33°C and 5% CO2 incubator for 8 days. After culture, the cells were cultured in the same medium except for INF-γ at 37°C and 5% CO2 incubator. In order to generate oxygen species (ROS) due to oxidative stress that occurs during noise-induced hearing loss, the UB-OC1 cell line was exposed to hydrogen peroxide (H2O2) at various concentrations (0, 50, 100, 250, 500, 750, 1000, 1500 μM) and quantitatively confirmed the cytotoxicity and apoptotic effects of hydrogen peroxide through MTT analysis. As a result, IC of hydrogen peroxide 50 was confirmed to be 750 uM (Fig. 1).

[0131]

[0132] 2-2. Analysis of inhibition of hair cell death

[0133] In Example 1-1, the UB-OC1 cell line cultured in Example 1-1 was treated with only 750 uM hydrogen peroxide, the group treated with 100 ug / mL of Cassia tora extract together with hydrogen peroxide (24-hour treatment), the group treated with 100 ug / mL of buckwheat extract (24-hour treatment), the group treated with 100 ug / mL of sorghum extract (24-hour treatment), and the group treated with 100 ug / mL of Phellinus linteus extract (24-hour treatment). The cell viability was measured using the MTT assay to confirm the antiapoptotic effect of auditory cell death. As a result, it was confirmed that the viability of hair cells was significantly increased in the group treated with cassia tora extract (Fig. 2), buckwheat extract (Fig. 3), sorghum extract (Fig. 4), and Phellinus linteus extract (Fig. 5) compared to the group treated with only H2O2. That is, it was confirmed that cassia seed extract, buckwheat extract, sorghum extract, and Phellinus linteus extract had the effect of protecting auditory cell lines and inhibiting cell death.

[0134]

[0135] 2-3. Analysis of decreased expression of apoptotic factors in stromal cells

[0136] In order to confirm the decrease in the expression of apoptotic factors in podocytes by the extract of the present invention, changes in the protein expression levels of cleaved caspase-3 (c-Cas3) and cytochrome c, which are apoptotic biomarkers, were analyzed. UB-OC1 cells were cultured as in Example 2-1 and the IC of hydrogen peroxide was analyzed. 50The concentration was set to 750 μM and the experiment was conducted. After seeding on plates and culturing UB-OC1 cells for 24 h, they were treated with buckwheat extract (50, 100, or 200 μg / ml) or Phellinus linteus extract (100, 250, or 500 μg / ml) and H2O2 (750 μM) together or H2O2 (750 μM) alone (control, CTR) for 15 h. The group that was not treated with anything was designated NT and used as a negative control. After that, total proteins were extracted using RIPA lysis buffer and SDS-PAGE was performed with 20 μg of protein. The primary antibody was diluted 1:1000 in TBS-T and stored overnight in a 4℃ shaking incubator with a PVDF membrane. The antibodies used were Cleaved Caspase-3 (Asp175) (#9661, Cell Signaling technology), Cytochrome c (D18C7) (#11940, Cell Signaling technology), and beta-actin (C4) (sc-47778, scbt). The following day, the sections were washed three times with TBS-T and incubated with secondary antibodies for 1 hour at room temperature. After washing three more times with TBS-T, the bands were identified using Chemidoc. The band intensities were quantified using ImageJ, normalized using beta-actin, and compared with the control group.

[0137] As a result, the buckwheat extract-treated group showed a decrease in cell death markers at all concentration levels compared to the control group (CTR) treated with H2O2 alone, and in particular, the cell protection effect from apoptosis was greatest at a concentration of 200 μg / ml (Fig. 6). In addition, the group treated with the Phellinus linteus extract also showed a decrease in cell death markers at all concentration levels compared to the control group (CTR) treated with H2O2 alone, and in particular, the cell protection effect from apoptosis was greatest at a concentration of 500 μg / ml (Fig. 7).

[0138]

[0139] Example 3. Analysis of the efficacy of Cassia tora extract, buckwheat extract, sorghum extract, or Phellinus linteus extract on improving hearing impairment in an ex vivo animal model.

[0140] C57BL / 6N mice, 4-5 days old, were purchased from Coretech Co., Ltd. (Pyeongtaek). Specifically, 5-day-old mice were placed on ice for 5 minutes to induce cryo-anesthesia, disinfected with 70% ethanol, and the heads were removed. The brains were removed under a microscope in a Petri dish containing ice-cold Hanks' balanced salt solution (HBSS) (WELGENE). The inner ear was separated from the surrounding tissues in the temporal bone. After transferring them to a clean Petri dish, the bone was removed from the cochlea, and the stria vascularis was isolated. After transferring the cochlear tissue to a cell culture insert (Millicell membrane) (Millipore) using a 1000ul coated pipette, the graft was properly positioned with the hair cells facing upward and cultured in DMEM / F12 (Gibco™) containing 10% B27, 10% FBS, 5% N2, and 1% penicillin / streptomycin for 24 hours in an incubator at 37°C and 5% CO2.

[0141] The protective effect of Cassia tora extract, buckwheat extract, sorghum extract, or Phellinus linteus extract on hair cells of cochlear tissue cultured with hydrogen peroxide was confirmed. Specifically, after 24 hours of primary cochlear tissue culture, 500 uM hydrogen peroxide was treated with 100 ug / mL Cassia tora extract, 100 ug / mL Buckwheat extract, 100 ug / mL Sorghum extract, or 100 ug / mL Phellinus linteus extract and cultured for 24 hours. A control group treated with only hydrogen peroxide was prepared in the same manner. To directly observe hair cell death, actin filaments of hair cells of each experimental group were stained with Alexa Fluor™ 488 Phalloidin (Thermo Fisher Scientific) using immunofluorescence staining. Hair cells were observed using a confocal microscope (FV3000, Olympus), and the fluorescence intensity of the acquired hair cells was measured to analyze the data.

[0142] As a result, it was confirmed that cell death caused by hydrogen peroxide was significantly inhibited in the group treated with cassia seed extract (Fig. 8), buckwheat extract (Fig. 9), sorghum extract (Fig. 10), and Phellinus linteus extract (Fig. 11) compared to the group treated with only hydrogen peroxide.

[0143] These results confirm that cassia seed extract, buckwheat extract, sorghum extract, and Phellinus linteus extract have significant hearing protection effects, and through this, it was confirmed that cassia seed extract, buckwheat extract, sorghum extract, or Phellinus linteus extract have excellent effects in preventing, improving, and treating hearing loss.

[0144]

[0145] Example 4. Analysis of the efficacy of Cassia tora extract, buckwheat extract, sorghum extract, or Phellinus linteus extract on improving hearing impairment in an in vivo animal model.

[0146] 4-1. Analysis of the protective effect of hair cells after noise exposure

[0147] Because noise stimulation causes serious damage to hair cells in the cochlea, a noise-induced hearing loss mouse model was created using 6-8 week-old mice (C57BL / 6N) to determine the protective effects of cassia seed extract, buckwheat extract, sorghum extract, or Phellinus linteus extract on noise-induced hearing loss.

[0148] To evaluate the protective effect against noise-induced cochlear hair cell death, mice were administered Cassia tora extract (500 mg / Kg), buckwheat extract (100 mg / Kg), sorghum extract (200 mg / Kg), or Phellinus linteus extract (200 mg / Kg) before noise exposure (experimental group), untreated mice (control group), and a control group not administered Cassia tora extract, buckwheat extract, sorghum extract, or Phellinus linteus extract before noise exposure. The experimental groups were orally administered Cassia tora extract, buckwheat extract, sorghum extract, or Phellinus linteus extract and fed at the same time every day for 14 days, after which they were exposed to noise for 3 days. The noise was 120 dB white noise, exposed for 6 hours per day for a total of 3 days.

[0149] To measure hair cell death, mice were sacrificed on the 17th day. Mice were anesthetized with 2% avertin and transcardially perfused with saline (0.9% sodium chloride) followed by 4% paraformaldehyde (PFA, 0.1 M phosphate buffer, pH 7.2–7.4). The mouse heads were removed, and the inner ear was separated from the surrounding tissues from the temporal bone. The isolated inner ear was fixed in 4% paraformaldehyde (PFA, 0.1 M phosphate buffer, pH 7.2–7.4) in a refrigerator at 4°C for 24 hours and then decalcified in a 0.5 M ethylenediaminetetraacetic acid disodium salt solution for 3 days. The bone was removed from the decalcified cochlea and the stria vascularis was isolated under a microscope in a petri dish containing 0.1 M phosphate buffer (pH 7.2–7.4).

[0150] The isolated cochlear tissue was stained for hair cells using Alexa Fluor™ 488 phalloidin (Thermo Fisher Scientific), and then observed using a confocal microscope (FV3000, Olympus). The number of dead hair cells was counted and the data were analyzed.

[0151] As a result, in the experimental group administered cassia tora extract or buckwheat extract before noise exposure, it was confirmed that hair cell damage was significantly reduced in the apical, medial, and basal layers of the cochlea compared to the control group that was not administered cassia tora extract or buckwheat extract before noise exposure (cassia tora extract: Fig. 12 and buckwheat extract: Fig. 13). These results confirmed that cassia tora extract and buckwheat extract had excellent noise-induced hair cell protection effects.

[0152] In addition, it was confirmed that the sorghum extract or the Phellinus linteus extract significantly protected the apical, medial, and basal parts of the cochlea (sorghum extract: Fig. 14, Phellinus linteus extract: Fig. 15, a: observation of cell death by staining cilia with phalloidin, and b: observation of cell death by staining nuclei with DAPI). The degree of significance increased as the loss of hair cells increased, confirming that the sorghum extract and the Phellinus linteus extract had a significant effect on protecting hair cells from noise.

[0153]

[0154] 4-2. Analysis of hearing loss improvement after noise exposure

[0155] In order to confirm the effects of Cassia tora extract and buckwheat extract on hearing after noise exposure, a noise-induced hearing loss model was created using the same method as Example 4-1, and the mice were treated with Cassia tora extract and buckwheat extract, respectively, on days 0 and 17 before sacrificing them on the 17th day, and the auditory evoked potentials before (Before) and after (After) noise exposure were measured through EEG recordings. In addition, to confirm the effects of sorghum extract and Phellinus linteus extract on hearing after noise exposure, a noise-induced hearing loss model (experimental group, noise + sorghum extract or Phellinus linteus extract), a control group not administered sorghum extract before noise exposure (Noise), and a control group not treated with anything (untreated, sham) were created using the same method as Example 4-1, and the mice were sacrificed on the 17th day before (Before) and after (After) noise exposure, respectively, and the auditory brainstem response (ABR) was recorded.

[0156] The auditory evoked potential (AEP) measurement method evaluates the response to sound by measuring the evoked potential when a sound stimulus is converted into an electrical signal in the primary auditory nerve cells, hair cells, and transmitted to the brain through the auditory nerve. When a sound stimulus of 70 dB was given, normal mice showed a sound response with an average amplitude of 200 μV. To test the auditory evoked potential, the mice were anesthetized by intraperitoneal injection of 2% Avertin, and the body temperature was maintained at 37 ± 0.5℃ using a heating pad and evaluated. The stimulus sound for the auditory evoked potential test was a single tone of 1 kHz, 2 kHz, and 4 kHz, and the response generated at 70 dB was recorded and the amplitude was measured and compared between groups.

[0157] The auditory brainstem response (ABR) is a method for evaluating responses to sound by measuring the evoked potentials when sound stimuli are converted into electrical signals in hair cells, the primary auditory nerve cells, and transmitted to the brain through the auditory nerve. When responses to click tones of 0.1 milliseconds and ranging from 90 to 20 dB (in increments of -10 dB) were recorded, normal mice showed responses with an average threshold of 40±2 dB. To test the auditory brainstem response, mice were anesthetized by intraperitoneal injection of 2% avertin, and then evaluated while maintaining their body temperature at 37±0.5℃ using a heating pad. The stimulus for the ABR test was a single click tone of 0.1 milliseconds, and the response was recorded when the stimulus was reduced by 10 dB in increments of 10 dB from 90 to 20 dB. The amplitude and threshold were measured and compared between groups. In particular, the method for measuring the auditory brainstem response of the group treated with the sorghum extract is briefly illustrated in Fig. 18a. The sorghum extract prepared in Example 1 was dissolved in 5% Tween 80 and used, and the preparation of the noise-induced hearing loss animal model was carried out in the same manner as in Example 3-2 below, and the experimental results were derived through the auditory brainstem response measurement method (ABR Test) using the same method as above.

[0158] As a result, it was confirmed that in the group administered 500 mg / kg of Cassia tora extract and the group administered 200 mg / kg of buckwheat hull extract, the response reduced by noise exposure significantly increased in all three stimuli, and the amplitude of the sound response also significantly increased (Cassia tora extract: Fig. 16 and buckwheat extract: Fig. 17).

[0159] In addition, compared to the control group (noise) that was not administered sorghum extract or Phellinus linteus extract before noise exposure, which had decreased amplitude of sound response and increased threshold due to noise-induced hearing loss, it was confirmed that the threshold and amplitude of sound response were significantly improved in the sorghum extract administration group (noise + sorghum extract) and the Phellinus linteus extract administration group (noise + Phellinus linteus extract) (sorghum extract: Fig. 18 and Phellinus linteus extract: Fig. 19).

[0160] In particular, in the case of sorghum extract, the ABR amplitude was quantified based on 90 dB, and the noise exposure (5% Tween 80 + noise exposure) group showed a significant difference before and after noise exposure compared to the untreated (Sham, 5% Tween 80) group, but the sorghum extract treatment group (sorghum 200 mg / kg + noise exposure) did not show a significant difference (Fig. 18b). The ABR threshold of the noise exposure group was about 40 dB on average before noise exposure, but increased to 87.5 dB after noise exposure. This confirmed that noise exposure was performed properly. On the other hand, in the group treated with sorghum extract, the ABR threshold increased to 58 dB after noise exposure, but the threshold shift did not show a significant difference from the untreated (Sham) group (Fig. 18c). In other words, it was confirmed that oral administration of sorghum extract (SBE) before noise exposure was effective in protecting hearing.

[0161] These results confirm that cassia seed extract, buckwheat extract, sorghum extract, and Phellinus linteus extract have a significant hearing improvement effect, and through this, it was confirmed that cassia seed extract, buckwheat extract, sorghum extract, and Phellinus linteus extract have excellent effects in preventing, improving, and treating hearing loss.

[0162]

[0163] Example 5. Analysis of antioxidant efficacy of cassia seed extract, buckwheat extract, sorghum extract, or Phellinus linteus extract

[0164] 5-1. Analysis of antioxidant efficacy of cassia seed extract, buckwheat extract, sorghum extract, or Phellinus linteus extract in an in vitro model

[0165] 5-1-1. Cassia Seed Extract

[0166] To confirm whether the extract of Cassia tora reduces ROS even in an oxidative environment induced by hydrogen peroxide (H2O2) and has antioxidant effects, a CellROX experiment was conducted using UB-OC1 cells, which are auditory sensory hair cells, to visually confirm ROS expression. UB-OC1 cells were cultured as in Example 2-1 and the IC of hydrogen peroxide was measured. 50 The concentration was set to 750 μM and the experiment was conducted. Cover glasses coated with poly-D-lysine hydrobromide were placed in 12-well plates, and UB-OC1 cells were cultured for 24 hours. After culture, Cassia tora extract (100, 250, or 500 μg / ml) and H2O2 (750 μM) were treated together or H2O2 (750 μM) alone (control, CTR) for 15 hours. The group that was not treated with anything was named the control group (CTR) and used as a negative control, and N-Acetylcysteine ​​(NAC) was used as an antioxidant and a positive control.

[0167] After that, CellROX Green reagent (C10444, Invitrogen) was treated to the wells to a final concentration of 5 μM and stored in an incubator (37°C, 5% CO2) for 30 minutes. The medium was removed, washed with 0.1 M PBS, and fixed with 4% paraformaldehyde (PFA) for 15 minutes. After fixation, the cells were removed, washed with 0.1 M PBS, and the cover glass was removed and attached to a slide glass with Fluoroshield with DAPI (F6057, Sigma-aldrich). Images were then acquired using a 60X magnification confocal microscope.

[0168] As a result, the fluorescence intensity of the group treated with H2O2 was 1987 A.U., and compared to the control group (CTR, 987 A.U.), ROS increased by about 2 times, confirming that intracellular oxidative stress was induced by H2O2, and it was confirmed that ROS decreased in a concentration-dependent manner in cells treated with the Cassia tora extract (Fig. 20).

[0169]

[0170] 5-1-2. Buckwheat extract

[0171] To determine whether buckwheat extract has antioxidant and cytoprotective effects even in an environment of oxidative stress and cell aging induced by hydrogen peroxide, UB-OC1 cells, which are auditory sensory hair cells, were used to confirm the reduction in oxidative stress and changes in cell death biomarkers. Figure 21a briefly illustrates the experimental method. UB-OC1 cells were cultured as in Example 2-1 and the IC of hydrogen peroxide was measured. 50The concentration was set to 750 μM and the experiment was conducted. After seeding the plate and culturing UB-OC1 cells for 24 hours, buckwheat extract (50, 100, or 200 μg / ml) and H2O2 (750 μM) were treated together or H2O2 (750 μM) alone (CTR) for 15 hours. The group that was not treated with anything was designated NT and used as a negative control. After that, CellROX Green reagent (C10444, Invitrogen) and CM-H2DCFDA (General Oxidative Stress Indicator, C6827, Invitrogen) were used according to the manufacturer's instructions. After that, total proteins were extracted using RIPA lysis buffer and SDS-PAGE was performed with 20 μg of protein. Primary antibodies were diluted 1:1000 in TBS-T and stored overnight in a 4℃ shaking incubator with PVDF membranes. The antibodies used are Cleaved Caspase-3 (Asp175) (#9661, Cell Signaling technology), Cytochrome c (D18C7) (#11940, Cell Signaling technology), and beta Actin (C4) (sc-47778, scbt). The following day, after washing three times with TBS-T, the membranes were incubated with secondary antibodies for 1 hour at room temperature. After washing three more times with TBS-T, the bands were identified using Chemidox. The intensity of the bands was quantified using ImageJ, normalized using beta-Actin, and compared with the control group. Figure 21b shows the results of confirming the occurrence of intracellular oxidative stress using CellROX and DCFDA, respectively, by fluorescence and absorbance.

[0172] As a result, the CTR group treated with only H2O2 showed an increase in fluorescence intensity of CellROX and DCFDA by 8 to 9 times compared to the NT group, but the buckwheat extract (50, 100, or 200 μg / ml) treated group showed a decrease in CellROX by 1 / 2 times and in DCFDA by 1 / 10 times compared to the control group (CTR) (Fig. 21b).

[0173]

[0174] 5-1-3. Sorghum extract

[0175] To determine whether sorghum extract reduces ROS in an oxidative environment induced by hydrogen peroxide, a CellROX experiment was performed using UB-OC1 cells, which are auditory sensory hair cells. UB-OC1 cells were cultured as in Example 2-1, and the IC of hydrogen peroxide was measured. 50 The concentration was set to 750 μM and the experiment was conducted. Cover glasses coated with poly-D-lysine hydrobromide were placed in 12-well plates, and UB-OC1 cells were cultured for 24 hours. After culture, the cells were treated with sorghum extract (50, 100, or 200 μg / ml) and H2O2 (750 μM) together or H2O2 (750 μM) alone (CTR) for 15 hours. The untreated group was designated NT and used as a negative control. After that, CellROX Green reagent (CellROX Green reagent, C10444, Invitrogen) was treated to the wells at a final concentration of 5 μM, and the cells were stored in an incubator (37°C, 5% CO2) for 30 minutes. The medium was removed, washed with 0.1 M PBS, and fixed with 4% paraformaldehyde (PFA) for 15 minutes. After fixation, the cells were removed, washed with 0.1 M PBS, and the coverslips were removed and attached to slides with Fluoroshield with DAPI (F6057, Sigma-aldrich). Images were then acquired using a confocal microscope at 20X and 60X magnifications.

[0176] As a result, the fluorescence intensity of H2O2 was 2265 A.U., which was approximately 2-fold higher than that of the control group (CTR, 1028 A.U.), confirming that intracellular oxidative stress was induced by H2O2. In addition, it was confirmed that ROS was reduced in a concentration-dependent manner in cells treated with the sorghum extract. In particular, in the group treated with the sorghum extract at a concentration of 200 μg / ml, the fluorescence intensity value was 1081 A.U., which was recovered to the control level (Fig. 22). In other words, the sorghum extract reduced ROS even in an oxidative environment induced by H2O2.

[0177]

[0178] 5-1-4. Phellinus linteus extract

[0179] To determine whether the extract of Phellodendron amurense reduces ROS in an oxidative environment induced by hydrogen peroxide, a CellROX experiment was conducted using UB-OC1 cells, which are auditory sensory hair cells. UB-OC1 cells were cultured as in Example 2-1, and the IC of hydrogen peroxide was measured. 50 The concentration was set to 750 μM and the experiment was conducted. Cover glasses coated with poly-D-lysine hydrobromide were placed in 12-well plates, and UB-OC1 cells were cultured for 24 hours. After culture, the cells were treated with Phellinus linteus extract (50, 100, or 200 μg / ml) and H2O2 (750 μM) together or H2O2 (750 μM) alone (CTR) for 15 hours. The group that was not treated with anything was designated NT and used as a negative control. Thereafter, CellROX Green reagent (CellROX Green reagent, C10444, Invitrogen) was used according to the manufacturer's instructions.

[0180] As a result, the control group (CTR) treated with only H2O2 showed a 5-fold increase in CellROX compared to the NT group, but the group treated with Phellinus linteus extract (50, 100, or 200 μg / ml) showed a decrease in CellROX compared to the control group (CTR) at all concentration levels. In particular, it was confirmed that the inhibitory effect on oxidative stress was strongest at a concentration of 50 μg / ml (Fig. 23).

[0181]

[0182] 5-2. Analysis of antioxidant efficacy in in vivo animal models

[0183] We investigated whether buckwheat extract, sorghum extract, and Phellinus linteus extract could suppress the generation of oxidative stress caused by noise exposure in the cochlea of ​​mice. 4-hydroxynonenal (4HNE) is known to be an indicator of lipid peroxidation and oxidative damage and was used as a marker of oxidative stress. The animals used in the experiment, noise exposure, and extract administration methods were the same as in Example 3-3. Specifically, to determine the effect of buckwheat extract on noise-induced hearing loss, a noise-induced hearing loss mouse model was created using 6-8 week-old mice (C57BL / 6N). The animal models were administered buckwheat extract orally for 14 days as in Example 3-3, followed by noise exposure for 3 days. On the 17th day of the experiment, the mice were sacrificed and the cochleas were isolated. The isolated cochlear tissue was rapidly frozen using Tissue-Tek OCT Compound and sectioned at 15 μm using a microtome. Frozen sections were treated with blocking solution (10% in 0.1 M PBS, 0.3% Triton-X100, 2% Normal Serum) for 1 hour and treated with 4HNE (1:1000, Rb, BS631R, Bioss) overnight at 4°C. After washing with 0.1 M PBS, sections were treated with Alexa Fluor 488 (1:1000, Rb, ab150077, abcam) and phalloidin (1:400, A12379, Thermo Fisher Scientific) for 2 hours. After washing with 0.1 M PBS, sections were mounted on slide glass using Fluoroshield with DAPI (F6057, Sigma-aldrich), and images were acquired using a confocal microscope.

[0184] Buckwheat extract was compared in three groups: untreated (Sham, 5% Tween 80), noise exposure treatment group (5% Tween 80 + noise exposure), and buckwheat extract treatment group (BWE, 200 mg / kg buckwheat + noise exposure). Sorghum extract was compared in three groups: untreated (Sham, 5% Tween 80), noise exposure treatment group (5% Tween 80 + noise exposure), and sorghum extract treatment group (SBE, 200 mg / kg sorghum + noise exposure). Phellinus linteus extract was compared in three groups: untreated (Sham, 5% Tween 80), noise exposure treatment group (5% Tween 80 + noise exposure), and Phellinus linteus extract treatment group (200 mg / kg Phellinus linteus + noise exposure).

[0185] As a result, a strong signal of 4HNE was generated in the noise-exposed group compared to the untreated group in all of the buckwheat extract, sorghum extract, and Phellinus linteus extracts (buckwheat extract: 990 A.U., sorghum extract: 990 A.U., Phellinus linteus extract: 1,991 AU). On the other hand, in the groups treated with buckwheat extract, sorghum extract, and Phellinus linteus extract, the 4HNE fluorescence level was observed to decrease to the level of the untreated group (buckwheat extract: 246 A.U., sorghum extract: 667 A.U., Phellinus linteus extract: 896 A.U.). These results confirmed that the buckwheat extract, sorghum extract, and Phellinus linteus extract were excellent in reducing oxidative stress caused by noise exposure (buckwheat extract: Fig. 24, sorghum extract: Fig. 25, and Phellinus linteus extract: Fig. 26). In addition, these results are consistent with the in vitro data showing that ROS was reduced in the groups administered with cassia seed extract, buckwheat extract, sorghum extract, and Phellinus linteus extract.

[0186]

[0187] 5-3. Confirmation of antioxidant mechanism

[0188] 5-3-1. Cassia Seed Extract

[0189] To confirm the antioxidant action mechanism of Cassia tora extract using the NRF2-KEAP1 pathway, the mRNA expression levels of factors involved in the NRF2-KEAP1 pathway were analyzed using real-time PCR (RT-PCR). UB-OC1 cells were cultured as in Example 2-1, and the IC of hydrogen peroxide was measured. 50 The concentration was set to 750 μM and the experiment was conducted. UB-OC1 cells were cultured in 6-well plates for 24 hours. After culture, the cells were treated with Cassia tora extract (100, 250, or 500 μg / ml) and H2O2 (750 μM) for 15 hours. Afterwards, RNA was extracted using an RNA kit according to the manufacturer's protocol and reverse transcribed into cDNA using ReverTra ACE qPCR RT Master Mix (FSQ-201, TOYOBO). PCR was performed using SYBR Green Realtime PCR Master Mix (QPK-201, TOYOBO) on a Quantstudia 6 Flex Real-Time PCR System. Primers were synthesized by Macrogen, and the sequences of the primers used are shown in Table 1 below. Results were calculated using 2-ΔΔCt and normalized to beta-actin. N-Acetylcysteine ​​(NAC) was used as a positive control as an antioxidant.

[0190] Gene primer sequence (5'-3') Sequence number NRF2FCAGCATAGAGCAGGACATGGAG1RGAACAGCGGTAGTATCAGCCAG2KEAP1FTCGAAGGCATCCACCCTAAG3RCTCGAACCACGCTGTCAATCT4HO-1FCACTCTGGAGATGACACCTGAG5RGTTCCTCTGTCAGCATCACC6

[0191] As a result, when the mRNA expression level was confirmed through RT-PCR, NRF2 (Nuclear factor erythroid-2-related factor 2) and KEAP1 (Kelch-like ECH-associated protein 1) increased depending on the treatment concentration of the Cassia tora extract, and HO-1 (Heme Oxygenase 1), a downstream antioxidant gene of the pathway, also increased depending on the treatment concentration of the Cassia tora extract (Fig. 27). In other words, it was confirmed that the Cassia tora extract protects cells from stress caused by ROS through the NRF2-KEAP1 pathway.

[0192]

[0193] 5-3-2. Buckwheat extract

[0194] To confirm the antioxidant mechanism of buckwheat extract, changes in genes of the Nrf2 / HO-1 pathway, a representative antioxidant mechanism of cells, were identified using WB and immunofluorescence staining. First, to confirm changes in the protein levels of Nrf2, Keap1, and HO-1 in cells using WB, UB-OC1 cells were cultured as in Example 2-1 and the IC of hydrogen peroxide was measured. 50The concentration was set to 750 μM and the experiment was conducted. After seeding on plates and culturing UB-OC1 cells for 24 hours, buckwheat extract (50 or 100 μg / ml) and H2O2 (750 μM) were treated together or H2O2 (750 μM) alone (CTR) for 15 hours. The group that was not treated with anything was designated NT and used as a negative control. After that, total protein was extracted using RIPA lysis buffer and SDS-PAGE was performed with 20 μg of protein. The primary antibody was diluted 1:1000 in TBS-T and stored overnight in a 4℃ shaking incubator together with a PVDF membrane. The antibodies used are Nrf2 (PA5-27882, Invitrogen), Keap1 (ab218815, abcam), HO-1 (ab13243, abcam), and beta-actin (Beta-Actin(C4), (sc-47778, scbt)). The next day, the sections were washed three times with TBS-T and incubated with secondary antibodies at room temperature for 1 hour. After washing again three times with TBS-T, the bands were confirmed using Chemidox. The intensity of the bands was quantified using ImageJ, normalized using beta-actin, and compared with the control group.

[0195] In addition, to confirm the translocation of Nrf2 to the nucleus using immunofluorescence staining, UB-OC1 cells were cultured as in Example 2-1 and the IC of hydrogen peroxide 50The concentration was set to 750 μM and the experiment was conducted. After seeding on plates and culturing UB-OC1 cells for 24 hours, buckwheat extract (100 or 200 μg / ml) and H2O2 (750 μM) were treated together or H2O2 (750 μM) alone (CTR) for 15 hours. The group that was not treated with anything was designated as NT and used as a negative control. After blocking with 5% normal serum, 0.3% Trion-X in PBS solution for 1 hour at room temperature, the cells were stored in a shaking incubator at 4℃ overnight with primary antibodies of Nrf2 1:500 (PA5-27882, Invitrogen) and Keap1 1:500 (ab218815, abcam). The following day, the cells were washed three times with PBS-T and incubated with secondary antibody (1:1000) for 1 hour. After three washes, images were taken using a confocal microscope, and five images for each group were analyzed using the Imaris analysis program to compare the fluorescence intensity of Nrf2 in the entire cytoplasm and nucleus.

[0196] As a result of performing WB, the CTR group treated with H2O2 (750 μM) alone in UB-OC1 cells did not induce significant changes in the Nrf2 / HO-1 pathway compared to the NT group, but in the group treated with buckwheat extract (50 or 100 μg / ml), the two genes of the Nrf2 / HO-1 pathway were confirmed to increase by 6-fold and 5-fold, respectively, compared to the NT group (Fig. 28a).

[0197] Furthermore, immunofluorescence staining results showed that the nuclear translocation of Nrf2 increased in the group treated with H2O2 (750 μM) alone compared to the control group. However, the group co-treated with buckwheat extract not only showed a significant increase in the level of nuclear translocation of Nrf2 (N-Nrf2) compared to the control group, but also showed an increase in the total level of Nrf2 in the cytoplasm (C-Nrf2). From this, it was confirmed that the buckwheat extract induces activation of the Nrf2 pathway and thus increases antioxidant capacity (Fig. 28b).

[0198]

[0199] 5-3-3. Sorghum extract

[0200] To analyze the mechanism of action of sorghum extract through the NRF2-KEAP1 pathway, mRNA expression levels were confirmed through RT-PCR. Cells were cultured as in Example 2, and the cytotoxicity and apoptotic effects of hydrogen peroxide on UB-OC1 cells were confirmed, and the IC of hydrogen peroxide was determined. 50 The concentration of 750 μM was set and the experiment was conducted. UB-OC1 cells were cultured in 6-well plates for 24 hours. After culture, sorghum extract (50, 100, or 200 μg / ml) and H2O2 (750 μM) were treated for 15 hours. After that, RNA was extracted using an RNA Kit according to the manufacturer's protocol and reverse transcribed into cDNA using ReverTra ACE qPCR RT Master Mix (FSQ-201, TOYOBO). PCR was performed using SYBR Green Realtime PCR Master Mix (QPK-201, TOYOBO) on a Quantstudia 6Flex Real-Time PCR System. Primers were synthesized and used by Macrogen, and the sequences of the primers used are shown in Table 1 above (NRF2, KEAP1, and HO-1) and Table 2 below (SOD1, NQO1GSR, Enos, and β-actin). Results were calculated using 2-ΔΔCt and normalized to β-actin.

[0201] Gene primer sequence (5'-3') SEQ ID NO: SOD1FAACCAGTTGTGTTGTCAGGAC7RCCACATGTTTCTTAGAGTGAGG8NQO1FGCCGAACACAAGCTGGAAG9RGGCAAATCCTGCTACGAGCACT10GSRFGCGTGAATGTTGGAT GTGTACC11RGTTGCATAGCCGTGGATAATTTC12eNOSFTGTCACTATGGCAACCAGCGT13RGCGCAATGTGAGTCCGAAAA14β-actinFGGCTGTATTCCCCTCCATCG15RCCAGTTGGTAACAATGCCATGT16

[0202] ICC was performed on poly-D-lysine hydrobromide-coated cover glasses placed in 12-well plates, and UB-OC1 cells were cultured for 24 hours. After culture, sorghum extract (50, 100, or 200 μg / ml) and H2O2 (750 μM) were treated for 15 hours. Subsequently, the cells were fixed with PFA for 15 minutes, washed with 0.1 M PBS, and treated with blocking solution for 1 hour at room temperature. After treatment with 4HNE (1:100, Ms, ab48506, abcam), HO-1 (1:200, Rb, ab13243, abcam) for 2 hours, the cells were washed and treated with secondary antibodies (4HNE (1:500, Ms 488, ab150109, abcam)) and HO-1 (1:500, Rb555, ab150086, abcam) for 2 hours. After washing with 0.1 M PBS, the cover glass was removed and attached to a slide glass with Fluoroshield with DAPI (F6057, Sigma-aldrich). After that, images were acquired using a 20X magnification confocal microscope.

[0203] As a result, the expression levels of NRF2, KEAP1, and downstream antioxidant genes and blood flow-improving genes such as HO-1, SOD1 (Superoxide Dismutase 1), NQO1 (NAD(P)H Quinone Oxidoreductase 1), GSR (Glutathione reductase), and eNOS (endothelial nitric oxide synthase) in the pathway increased. In addition, when HO-1, a representative antioxidant gene of the NRF2-KEAP1 pathway, was stained in cells, a significant result was obtained at a concentration of 200 μg / ml. On the other hand, the expression level of 4HNE, a ROS marker, was confirmed to decrease in a concentration-dependent manner of the sorghum extract (Fig. 29). From this, it was confirmed that the sorghum extract protects cells from oxidative stress caused by ROS through the NRF2-KEAP1 pathway.

[0204]

[0205] 5-3-4. Phellinus linteus extract

[0206] To investigate the antioxidant mechanism of the Phellinus linteus extract, WB and immunofluorescence staining were used to identify changes in the expression of Nrf2, Keap1, and HO-1 genes involved in the Nrf2 / HO-1 pathway, a representative cellular antioxidant mechanism, at the protein level. The specific experimental method was the same as in Example 5-3-2.

[0207] As a result of performing WB, it was confirmed that the two genes of the Nrf2 / HO-1 pathway increased by 1.5 to 2 times in the group treated with Phellinus linteus extract (50, 100, or 200 μg / ml) together with H2O2 (750 μM) in UB-OC1 cells compared to the NT group. Considering that not only the overall Nrf2 expression but also the HO-1 expression increased, it was confirmed that the Phellinus linteus extract activated the Nrf2 pathway and induced an increase in the expression of HO-1, a downstream antioxidant enzyme gene (Fig. 30a).

[0208] Furthermore, immunofluorescence staining results confirmed that the nuclear translocation of Nrf2 increased in the group treated with H2O2 (750 μM) alone compared to the control group. However, the group co-treated with Phellinus linteus extract not only showed a significant increase in the level of Nrf2 nuclear translocation (Nrf2_Nucleus) compared to the control group, but also showed an increase in the total level of Nrf2 in the cytoplasm (Fig. 30b). From this, it was confirmed that the Phellinus linteus extract induces activation of the Nrf2 pathway and increases the antioxidant capacity of cells.

[0209]

[0210] Example 6. Analysis of effective ingredients contained in buckwheat extract

[0211] 6-1. Component analysis using HPLC

[0212] In order to analyze the active ingredients contained in the extract, several components of the flavonoid series were designated as candidate components to analyze the components reported to have antioxidant effects among the substances known to be contained in the buckwheat extract, and the active ingredients of the extract were analyzed by HPLC analysis. The mobile phases used were 0.1% formic acid-H2O (phase A) and 0.1% formic acid-acetonitrile (phase B), and the gradient program was as follows: 15% B for 0-5 min, 15-20% B for 5-10 min, 20-50% B for 10-40 min, 50-80% B for 40-55 min, and 15% B for 55-60 min. The flow rate was always maintained at 0.8 mL / min. Other chromatographic conditions were as follows: the column was operated at 30°C, the scan detection wavelength was 200–600 nm, and the injection volume was 10.0 μL. All samples were analyzed in triplicate, and the amount of analyzed compounds was expressed as micrograms per gram of sample on a dry weight basis (μg / g DW).

[0213] As a result, it was confirmed that 1 mg of the extracted buckwheat 70% alcohol extract contained 4.38±0.14μg of rutin and 14.73±0.07μg of isoquercitrin, with the content of isoquercitrin being approximately 3.36 times higher than that of rutin (Fig. 31).

[0214]

[0215] 6-2. Analysis of Nr2 / HO-1 pathway activation levels by rutin and isoquercitrin

[0216] To determine the level of activation of the Nrf2 / HO-1 pathway by rutin and isoquercitrin, real-time PCR was used to compare the expression levels of factors involved in the intracellular Nrf2 / HO-1 pathway. UB-OC1 cells were treated with rutin (1, 10, or 100 μg / mL) or isoquercitrin (1, 10, or 100 μg / mL) at various concentrations. Other specific experimental methods were the same as in Example 5-3-1.

[0217] As a result, an increase in Nrf2 mRNA was confirmed in the group treated with 100 μg of rutin compared to the group treated alone, but no increase in the expression of HO-1 at the lower stage was observed. However, in the group treated with isoquercitrin and H2O2 (750 μM), an increase in Nrf2 / HO-1 mRNA was confirmed at all treatment concentrations (Fig. 32). From this, it was determined that the cytoprotective effect of buckwheat extract through the activation of Nrf2 / HO-1 was induced through isoquercitrin.

[0218] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A food composition for restoring hearing function; or improving or preventing hearing impairment, comprising as an active ingredient at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus.

2. In paragraph 1, A food composition, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or mixed solvents thereof.

3. In paragraph 1, The above hearing impairment is a food composition.

4. In paragraph 3, A food composition, wherein the above hearing loss is any one selected from the group consisting of noise-induced hearing loss, presbycusis, sudden hearing loss, diabetic auditory neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.

5. In paragraph 1, A food composition wherein the composition inhibits apoptosis of hair cells.

6. A pharmaceutical composition for preventing or treating hearing impairment, comprising as an active ingredient at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus.

7. In paragraph 6, The above hearing impairment is hearing loss, pharmaceutical composition.

8. In paragraph 7, A pharmaceutical composition wherein the above hearing loss is any one selected from the group consisting of noise-induced hearing loss, presbycusis, sudden hearing loss, diabetic auditory neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.

9. In paragraph 6, A pharmaceutical composition, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or mixed solvents thereof.

10. A health functional food for restoring hearing function; or for improving or preventing hearing impairment; comprising as an active ingredient at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus.

11. In paragraph 10, The above health functional food is a health functional food in one or more dosage forms selected from the group consisting of health functional food preparations in the form of tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, bars, beverages, gums, and candies.

12. A composition for restoring hearing function; or improving or preventing hearing impairment; a quasi-drug product, comprising as an active ingredient at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus.

13. In paragraph 12, A pharmaceutical composition, wherein the composition is in one or more dosage forms selected from the group consisting of liquid, ointment, spray, cream, gel, patch, and aerogel.

14. A feed composition for restoring hearing function; or improving or preventing hearing impairment, comprising at least one active ingredient selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus.

15. In paragraph 14, The above hearing impairment is hearing loss, feed composition.

16. In paragraph 15, A feed composition, wherein the above hearing loss is any one selected from the group consisting of noise-induced hearing loss, presbycusis, sudden hearing loss, diabetic auditory neuropathy, ototoxic hearing loss, traumatic hearing loss, and viral hearing loss.

17. A method for restoring hearing function, or improving, preventing, or treating hearing impairment, comprising administering to a subject in need thereof a composition comprising at least one active ingredient selected from the group consisting of a cassia seed (Senna tora (L.) Roxb.) extract, a buckwheat (Fagophyrum esculentum MOENCH.) extract, a sorghum (Sorghum bicolor) extract, and a Phellinus linteus extract.

18. Use of a composition comprising as an active ingredient at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus for the recovery of hearing function or for the improvement, prevention, or treatment of hearing impairment.

19. Use of a composition comprising at least one selected from the group consisting of an extract of cassia seed (Senna tora (L.) Roxb.), an extract of buckwheat (Fagophyrum esculentum MOENCH.), an extract of sorghum (Sorghum bicolor), and an extract of Phellinus linteus as an active ingredient for the manufacture of a medicine for restoring hearing function or improving, preventing, or treating hearing impairment.

Images