Materials and methods of using proinsulin mRNA nanoparticles

Abstract

The disclosure provides a method of inducing immune tolerance to beta cells in a subject in need thereof. The method comprises administering to the subject a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each mRNA layer is positioned between a cationic lipid bilayer, and the mRNA encodes a proinsulin peptide. The disclosure also provides a method of treating or delaying the onset of Type 1 diabetes in a subject in need thereof, the method comprising administering to the subject a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each mRNA layer is positioned between a cationic lipid bilayer, and the mRNA encodes a proinsulin peptide.

Description

MATERIALS AND METHODS OF USING PROINSULIN MRNA NANOPARTICLESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 522,300, filed June 21 , 2023, the entire contents of which is hereby incorporated herein by reference.FIELD OF THE INVENTION

[0002] This application relates to use of nanoparticles comprising nucleic acids encoding proinsulin peptides.INCORPORATION BY REFERENCE

[0003] The following applications also are hereby incorporated by reference in their entireties: International Patent Application No. PCT / US20 / 42606, filed July 17, 2020; International Patent Application No. PCT / US21 / 16925, filed February 5, 2021 ; and International Patent Application No. PCT / US21 / 18831 , filed February 19, 2021.INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0004] A Sequence Listing, which is a part of the present disclosure, is submitted concurrently with the specification as a text file. The name of the text file containing the Sequence Listing is “58948_SeqListing.xml". The Sequence Listing was created on June 14, 2024, and is 5,274 bytes in size. The subject matter of the Sequence Listing is incorporated by reference herein in its entirety.BACKGROUND

[0005] Type 1 diabetes (T1 D) is a T cell-mediated autoimmune disease that targets and destroys insulin secreting beta cells located in the islets of Langerhans in the pancreas. Due to its short- and long-term complications, T1 D is both a daily and life-long burden for individuals and their families. Exogenous insulin is needed immediately for those diagnosed with T 1 D and is required for their lifetime. In the absence of therapy, severe, unsustainable metabolic derangements develop including hyperglycemia and ketoacidosis with associated sequelae, including rapid wasting and possible death. Immunotherapy has been investigated as a potential intervention for T1 D. However, prior immunotherapies have failed to provide effective and lasting protection from T 1 D. There remains a need for alternative treatment options for subjects suffering from or at risk of suffering from T1 D.SUMMARY

[0006] The disclosure provides a method of inducing immune tolerance to beta cells in a subject in need thereof. The method comprises administering to the subject a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each mRNA layer is positioned between a cationic lipid bilayer, and the mRNA encodes a proinsulin peptide. In various aspects, the proinsulin peptide is encoded by the nucleic acid sequence of SEQ ID NO: 1. Optionally, the nanoparticle comprises at least three nucleic acid layers, each of which is positioned between a cationic lipid bilayer. The outermost layer of the nanoparticle optionally comprises a cationic lipid bilayer. In various aspects, the nanoparticle comprises a zeta potential of about 40 mV to about 60 mV (e.g., a zeta potential of about 45 mV to about 55 mV). In various aspects, the cationic lipid is DOTAP or DOTMA. Optionally, the nanoparticle does not comprise a neutral lipid. In some aspects of the disclosure, the mRNA comprises one or more modified nucleotides, such as 1 -methylpseudouridine. The subject may suffer from Type 1 diabetes. The disclosure further contemplates that the subject does not suffer from symptoms of Type 1 diabetes.

[0007] The disclosure further contemplates use of a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each nucleic acid layer is positioned between a cationic lipid bilayer and the mRNA encodes a proinsulin peptide, for inducing immune tolerance to beta cells. Use of the nanoparticle in the preparation of a medicament for inducing immune tolerance to beta cells also is contemplated, as is the nanoparticle composition described herein for use in inducing immune tolerance to beta cells.

[0008] Additional embodiments and aspects of the presently disclosed nanoparticles, pharmaceutical compositions, and methods are provided below.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] FIG. 1 is a series of illustrations of different lipid based delivery vehicles: cationic RNA lipoplex, anion RNA lipoplex, and multilamellar RNA-NP of the present disclosure.

[0010] FIG. 2 is a bar graph illustrating proinsulin II production (y-axis, pmol / liter) in HEK293 cells transduced with multilamellar nanoparticles comprising preproinsulin II or proinsulin II mRNA vs. green fluorescent protein (GFP) mRNA control vaccine and untreated cells (UT).

[0011] FIG. 3 is a line graph illustrating percent survival (y-axis) of NOD mice treated with proinsulin II mRNA multilamellar NP (squares) at 8 weeks (3 IV injections) and 14 weeks (1injection) compared to untreated mice (n=40 per group; inverted triangle). Median time to diabetes was 21 weeks in vaccine group vs 17 weeks in untreated mice.

[0012] FIG. 4 is a line graph illustrating percent of subjects that were diabetes free (y-axis) following treatment with proinsulin II mRNA multilamellar NP.DETAILED DESCRIPTION

[0013] The disclosure provides materials and methods for inducing immune tolerance to beta cells in a subject in need thereof. The method comprises administering to the subject a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each mRNA layer is positioned between a cationic lipid bilayer, and the mRNA encodes a proinsulin peptide. Various aspects of the method are described below.

[0014] The nanoparticles of the method comprise a cationic lipid and nucleic acids (such as mRNA). As used herein the term “nanoparticle” refers to a particle that is less than about 1000 nm in diameter. As the nanoparticles of the present disclosure comprise cationic lipids that have been processed to induce liposome formation, the presently disclosed nanoparticles in various aspects comprise liposomes. Liposomes are artificially-prepared vesicles which, in exemplary aspects, are primarily composed of a lipid bilayer. Liposomes in various instances are used as a delivery vehicle for the administration of nutrients and pharmaceutical agents. In various aspects, the liposomes of the present disclosure are of different sizes and the composition may comprise one or more of (a) a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, (b) a small unicellular vesicle (SUV) which may be smaller than, e.g., 50 nm in diameter, and (c) a large unilamellar vesicle (LUV) which may be between, e.g., 50 and 500 nm in diameter. Liposomes in various instances are designed to comprise opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. In exemplary aspects, liposomes contain a low or a high pH in order to improve the delivery of the pharmaceutical formulations. In various instances, liposomes are formulated depending on the physicochemical characteristics such as, but not limited to, the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additionalprocesses involved during the application and / or delivery of the vesicles, the optimization size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to- batch reproducibility and possibility of large-scale production of safe and efficient liposomal products.

[0015] In exemplary embodiments, the nanoparticle comprises a surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, optionally, more than two nucleic acid layers. In exemplary instances, each nucleic acid layer is positioned between a lipid layer, e.g., a cationic lipid layer. In exemplary aspects, the nanoparticles are multilamellar comprising alternating layers of nucleic acid and lipid. In exemplary embodiments, the nanoparticle comprises at least three nucleic acid layers, each of which is positioned between a cationic lipid bilayer. In exemplary aspects, the nanoparticle comprises at least four or five nucleic acid layers, each of which is positioned between a cationic lipid bilayer. In exemplary aspects, the nanoparticle comprises at least more than five (e.g., 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) nucleic acid layers, each of which is positioned between a cationic lipid bilayer. As used herein the term “cationic lipid bilayer” is meant a lipid bilayer comprising, consisting essentially of, or consisting of a cationic lipid or a mixture thereof. Suitable cationic lipids are described herein. As used herein the term “nucleic acid layer” is meant a layer of the presently disclosed nanoparticle comprising, consisting essentially of, or consisting of a nucleic acid, e.g., RNA.

[0016] The unique structure of the nanoparticle of the present disclosure results in mechanistic differences in how the multilamellar nanoparticles (ML-NPs) exert a biological effect. Previously described RNA-based nanoparticles exert their effect, at least in part, through the toll-like receptor 7 (TLR7) pathway. Surprisingly, the multi-lamellar nanoparticles of the instant disclosure mediate efficacy independent of TLR7. While not wishing to be bound to any particular theory, intracellular pathogen recognition receptors (PRRs), such as MDA-5, appear more relevant to biological activity of the multi-lamellar nanoparticles than TLRs. This likely allows ML RNA-NPs to stimulate multiple intracellular PRRs (e.g., RIG-I, MDA-5) as opposed to singular TLRs (e.g., TLR7 in the endosome) culminating in greater release of type I interferons and induction of more potent innate immunity. This allows RNA-NPs to demonstrate superior efficacy with long-term survivor benefit.

[0017] In various aspects, the presently disclosed nanoparticle comprises a positively- charged surface. In some instances, the positively-charged surface comprises a lipid layer, e.g., a cationic lipid layer. In various aspects, the outermost layer of the nanoparticle comprisesa cationic lipid bilayer. Optionally, the cationic lipid bilayer comprises, consists essentially of, or consists of DOTAP. In various instances, the surface comprises a plurality of hydrophilic moieties of the cationic lipid of the cationic lipid bilayer. In some aspects, the core comprises a cationic lipid bilayer. In various instances, the core lacks nucleic acids. Optionally, the core comprises less than about 0.5 wt% nucleic acid.

[0018] In exemplary aspects, the nanoparticle has a diameter within the nanometer range and accordingly in certain instances are referred to herein as “nanoliposomes” or “liposomes.” In exemplary aspects, the nanoparticle has a diameter between about 50 nm to about 500 nm, e.g., about 50 nm to about 450 nm, about 50 nm to about 400 nm, about 50 nm to about 350 nm, about 50 nm to about 300 nm, about 50 nm to about 250 nm, about 50 nm to about 200 nm, about 50 nm to about 150 nm, about 50 nm to about 100 nm, about 100 nm to about 500 nm, about 150 nm to about 500 nm, about 200 nm to about 500 nm, about 250 nm to about 500 nm, about 300 nm to about 500 nm, about 350 nm to about 500nm, or about 400 nm to about 500 nm. In exemplary aspects, the nanoparticle has a diameter between about 50 nm to about 300 nm, e.g., about 100 nm to about 250 nm, about 110 nm ±5 nm, about 115 nm ±5 nm, about 120 nm ±5 nm, about 125 nm ±5 nm, about 130 nm ±5 nm, about 135 nm ±5 nm, about 140 nm ±5 nm, about 145 nm ±5 nm, about 150 nm ±5 nm, about 155 nm ±5 nm, about 160 nm ±5 nm, about 165 nm ±5 nm, about 170 nm ±5 nm, about 175 nm ±5 nm, about 180 nm ±5 nm, about 190 nm ±5 nm, about 200 nm ±5 nm, about 210 nm ±5 nm, about 220 nm ±5 nm, about 230 nm ±5 nm, about 240 nm ±5 nm, about 250 nm ±5 nm, about 260 nm ±5 nm, about 270 nm ±5 nm, about 280 nm ±5 nm, about 290 nm ±5 nm, or about 300 nm ±5 nm. In exemplary aspects, the nanoparticle is about 50 nm to about 250 nm in diameter. In some aspects, the nanoparticle is about 70 nm to about 200 nm in diameter.

[0019] In exemplary aspects, the nanoparticle is present in a pharmaceutical composition comprising a heterogeneous mixture of nanoparticles ranging in diameter, e.g., about 50 nm to about 500 nm or about 50 nm to about 250 nm in diameter. Optionally, the pharmaceutical composition comprises a heterogeneous mixture of nanoparticles ranging from about 70 nm to about 200 nm in diameter.

[0020] In exemplary instances, the nanoparticle is characterized by a zeta potential of about +40 mV to about +60 mV, e.g., about +40 mV to about +55 mV, about +40 mV to about +50 mV, about +40 mV to about +50 mV, about +40 mV to about +45 mV, about +45 mV to about +60 mV, about +50 mV to about +60 mV, or about +55 mV to about +60 mV. In exemplary aspects, the nanoparticle has a zeta potential of about +45 mV to about +55 mV. The nanoparticle invarious instances, has a zeta potential of about +50 mV. In various aspects, the zeta potential is greater than +30 mV or +35 mV. The zeta potential is one parameter which distinguishes the nanoparticles of the present disclosure and those described in, e.g., Sayour et al., Oncoimmunology 6(1 ): e1256527 (2016).

[0021] In exemplary aspects, the nanoparticles comprise a cationic lipid. In some embodiments, the cationic lipid is a low molecular weight cationic lipid such as those described in U.S. Patent Application Publication No. 20130090372, the contents of which are herein incorporated by reference in their entirety. The cationic lipid in exemplary instances is a cationic fatty acid, a cationic glycerolipid, a cationic glycerophospholipid, a cationic sphingolipid, a cationic sterol lipid, a cationic prenol lipid, a cationic saccharolipid, or a cationic polyketide. In exemplary aspects, the cationic lipid comprises two fatty acyl chains, each chain of which is independently saturated or unsaturated. In some instances, the cationic lipid is a diglyceride. For example, in some instances, the cationic lipid may be a cationic lipid of Formula I or Formula II:[Formula II] wherein each of a, b, n, and m is independently an integer between 2 and 12 (e.g., between 3 and 10). In some aspects, the cationic lipid is a cationic lipid of Formula I wherein each of a, b, n, and m is independently an integer selected from 3, 4, 5, 6, 7, 8, 9, and 10. In exemplary instances, the cationic lipid is DOTAP (1 ,2-dioleoyl-3-trimethylammonium-propane), or aderivative thereof. In exemplary instances, the cationic lipid is DOTMA (1 ,2-di-0-octadecenyl-3- trimethylammonium propane), or a derivative thereof.

[0022] In some aspects, the nanoparticles comprise liposomes formed from 1 ,2-dioleyloxy- N,N-dimethylaminopropane (DODMA) liposomes, Dil_a2 liposomes from Marina Biotech (Bothell, Wash.), 1 ,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2- dimethylaminoethyl)-[1 ,3]-dioxolane (DLin-KC2-DMA), and MC3 (US20100324120; herein incorporated by reference in its entirety). In some aspects, the nanoparticles comprise liposomes formed from the synthesis of stabilized plasmid-lipid particles (SPLP) or stabilized nucleic acid lipid particle (SNALP) that have been previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo. The nanoparticles in some aspects are composed of 3 to 4 lipid components in addition to the nucleic acid molecules. In exemplary aspects, the liposome comprises 55% cholesterol, 20% disteroylphosphatidyl choline (DSPC), 10% PEG-S-DSG, and 15% 1 ,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al., Pharm Res. 2005; 22(3):362-72. In exemplary instances, the liposome comprises 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, where the cationic lipid can be 1 ,2-distearloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1 ,2-dilinolenyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al., J. Control Release, 107(2): 276-87 (2005).

[0023] In some aspects, the liposomes comprise from about 25.0% cholesterol to about 40.0% cholesterol, from about 30.0% cholesterol to about 45.0% cholesterol, from about 35.0% cholesterol to about 50.0% cholesterol and / or from about 48.5% cholesterol to about 60% cholesterol. In some aspects, the liposomes may comprise a percentage of cholesterol selected from the group consisting of 28.5%, 31 .5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0% and 43.5%. In some aspects, the liposomes may comprise from about 5.0% to about 10.0% DSPC and / or from about 7.0% to about 15.0% DSPC.

[0024] In some aspects, the liposomes are DiLa2 liposomes (Marina Biotech, Bothell, Wash.), SMARTICLES® (Marina Biotech, Bothell, Wash.), neutral DOPC (1 ,2-dioleoyl-sn- glycero-3-phosphocholine) based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708-1713); herein incorporated by reference in its entirety) and hyaluronan-coated liposomes.

[0025] In various instances, the cationic lipid comprises 2,2-dilinoleyl-4-dimethylaminoethyl- [1 ,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), or di((Z)-non-2-en-1 -yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), andfurther comprise a neutral lipid, a sterol, and a molecule capable of reducing particle aggregation, for example, a PEG or PEG-modified lipid.

[0026] The liposome in various aspects comprises DLin-DMA, DLin-K-DMA, 98N12-5, 012- 200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids and amino alcohol lipids. In some aspects, the liposome comprises a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids. The amino alcohol cationic lipid comprises, in some aspects, lipids described in and / or made by the methods described in U.S. Patent Publication No. 20130150625, herein incorporated by reference in its entirety. As a non-limiting example, the cationic lipid in certain aspects is 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]-2-{[(9Z,2Z)-octadeca-9,12-dien-1 - yloxy]methyl}propan-1-ol (Compound 1 in US20130150625); 2-amino-3-[(9Z)-octadec-9-en-1 - yloxy]-2-{[(9Z)-octadec-9-en-1 -yloxy]methyl}propan-1-ol (Compound 2 in US20130150625); 2- amino-3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]-2-[(octyloxy)methyl]propan-1-ol (Compound 3 in US20130150625); and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]-2-{[(9Z,12Z)- octadeca-9,12-dien-1 -yloxy]methyl}propan-1 -ol (Compound 4 in US20130150625); or any pharmaceutically acceptable salt or stereoisomer thereof.

[0027] In various aspects, the liposome comprises (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1 ,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1 -yl) 9-((4- (dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE and SM; (iii) a sterol, e.g., cholesterol; and (iv) a PEG-lipid, e.g., PEG- DMG or PEG-cDMA, in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; 0.5-15% PEG-lipid.

[0028] In some aspects, the liposome comprises from about 25% to about 75% on a molar basis of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1 ,3]-dioxolane (DLin- KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1 - yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., from about 35 to about 65%, from about 45 to about 65%, about 60%, about 57.5%, about 50% or about 40% on a molar basis.

[0029] In some aspects, the liposome comprises from about 0.5% to about 15% on a molar basis of the neutral lipid e.g., from about 3 to about 12%, from about 5 to about 10% or about 15%, about 10%, or about 7.5% on a molar basis. Examples of neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE, and SM. In various aspects, the nanoparticle doesnot comprise a neutral lipid. In some embodiments, the formulation includes from about 5% to about 50% on a molar basis of the sterol (e.g., about 15 to about 45%, about 20 to about 40%, about 40%, about 38.5%, about 35%, or about 31% on a molar basis). An exemplary sterol is cholesterol. In some embodiments, the formulation includes from about 0.5% to about 20% on a molar basis of the PEG or PEG-modified lipid (e.g., about 0.5 to about 10%, about 0.5 to about 5%, about 1 .5%, about 0.5%, about 1 .5%, about 3.5%, or about 5% on a molar basis). In some embodiments, the PEG or PEG modified lipid comprises a PEG molecule of an average molecular weight of 2,000 Da. In other embodiments, the PEG or PEG modified lipid comprises a PEG molecule of an average molecular weight of less than 2,000, for example around 1 ,500 Da, around 1 ,000 Da, or around 500 Da. Examples of PEG-modified lipids include, but are not limited to, PEG-distearoyl glycerol (PEG-DMG) (also referred herein as PEG-C14 or C14-PEG), PEG-cDMA (further discussed in Reyes et al., J. Controlled Release, 107, 276-287 (2005), the contents of which is herein incorporated by reference in its entirety).

[0030] In exemplary aspects, the cationic lipid may be selected from (20Z,23Z)— N,N- dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z) — N,N-dimemylhexacosa-17,20-dien-9- amine, (1Z,19Z) — N,N-dimethylpentacosa-1 6, 19-dien-8-amine, (13Z,16Z) — N,N- dimethyldocosa-13,16-dien-5-amine, (12Z,15Z) — N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z) — N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z) — N,N-dimethyltetracosa-15,18- dien-7-amine, (18Z,21Z) — N,N-dimethylheptacosa-18,21 -dien-10-amine, (15Z,18Z) — N,N- dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z) — N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z) — N,N-dimeihyloctacosa-19,22-dien-9-amine, (18Z,21 Z) — N,N-dimethylheptacosa- 18,21 -dien-8-amine, (17Z,20Z) — N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z) — N,N- dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z) — N,N-dimethylhentriaconta-22,25-dien-10- amine, (21 Z,24Z) — N,N-dimethyltriaconta-21 ,24-dien-9-amine, (18Z) — N,N-dimetylheptacos- 18-en-10-amine, (17Z) — N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z) — N,N- dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z) — N-ethyl- N-methylnonacosa-20,23-dien-10-amine, 1 -[(11Z,14Z)-1-nonylicosa-11 ,14-dien-1 -yl]pyrrolidine, (20Z) — N,N-dimethylheptacos-20-en-10-amine, (15Z) — N,N-dimethyl eptacos-15-en-10-amine, (14Z) — N,N-dimethylnonacos-14-en-10-amine, (17Z) — N,N-dimethylnonacos-17-en-10-amine, (24Z) — N,N-dimethyltritriacont-24-en-10-amine, (20Z) — N,N-dimethylnonacos-20-en-10-amine, (22Z) — N,N-dimethylhentriacont-22-en-10-amine, (16Z) — N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z) — N,N-dimethyl-2-nonylhenicosa-12,15-dien-1 -amine, (13Z,16Z) — N,N-dimethyl-3- nonyldocosa-13,16-dien-1 -amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecan-8- amine, 1 -[(1 S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1 -[(1 S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21 -[(1 S,2R)-2- octylcyclopropyl]henicosan-10-amine, N,N-dimethyl-1 -[(1 S,2S)-2-{[( 1 R,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-1 -[(1 S,2R)-2- octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1 R,2S)-2-undecylcyclopropyl]tetradecan-5- amine, N,N-dimethyl-3-{7-[(1 S,2R)-2-octylcyclopropyl]heptyl}dodecan-1 -amine, 1 -[(1 R,2S)-2- heptylcyclopropyl]-N,N-dimethyloctadecan-9-amine, 1 -[(1 S,2R)-2-decylcyclopropyl]-N,N- dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1 S,2R)-2-octylcyclopropyl]pentadecan-8-amine, R — N,N-dimethyl-1 -[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]-3-(octyloxy)propan-2-amine, S — N,N- dimethyl-1 -[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]-3-(octyloxy)propan-2-amine, 1 -{2-[(9Z,12Z)- octadeca-9,12-dien-1 -yloxy]-1 -[(octyloxy)methyl]ethyl}pyrrolidine, (2S) — N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]-3-[(5Z)-oct-5-en-1 -yloxy]propan-2-amine, 1-{2-[(9Z,12Z)- octadeca-9,12-dien-1 -yloxy]-1 -[(octyloxy)methyl]ethyl}azetidine, (2S)-1 -(hexyloxy)-N,N-dimethyl- 3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]propan-2-amine, (2S)-1 -(heptyloxy)-N,N-dimethyl-3- [(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]propan-2-amine, N,N-dimethyl-1 -(nonyloxy)-3-[(9Z,12Z)- octadeca-9,12-dien-1 -yloxy]propan-2-amine, N,N-dimethyl-1 -[(9Z)-octadec-9-en-1-yloxy]-3- (octyloxy)propan-2-amine; (2S) — N,N-dimethyl-1 -[(6Z,9Z,12Z)-octadeca-6,9,12-trien-1 -yloxy]-3- (octyloxy)propan-2-amine, (2S)-1 -[(11 Z,14Z)-icosa-11 ,14-dien-1 -yloxy]-N,N-dimethyl-3- (pentyloxy)propan-2-amine, (2S)-1-(hexyloxy)-3-[(11 Z,14Z)-icosa-11 ,14-dien-1 -yloxy]-N,N- dimethylpropan-2-amine, 1 -[(11 Z,14Z)-icosa-1 1 ,14-dien-1 -yloxy]-N,N-dimethyl-3- (octyloxy)propan-2-amine, 1 -[(13Z,16Z)-docosa-13,16-dien-1 -yloxy]-N ,N-dimethyl-3- (octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1 -yloxy]-3-(hexyloxy)-N,N- dimethylpropan-2-amine, (2S)-1 -[(13Z)-docos-13-en-1 -yloxy]-3-(hexyloxy)-N,N-dimethylpropan- 2-amine, 1 -[(13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1 -[(9Z)- hexadec-9-en-1 -yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R) — N,N-dimethyl-H(1 - metoyloctyl)oxyl-3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]propan-2-amine, (2R)-1 -[(3,7- dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]propan-2-amine, N,N- dimethyl-1 -(octyloxy)-3-({8-[(1 S,2S)-2-{[(1 R,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1 -{[8-(2- oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11 E,20Z,23Z)— N,N- dimethylnonacosa-11 , 20, 2-trien-10-amine or a pharmaceutically acceptable salt or stereoisomer thereof.

[0031] In some aspects, the nanoparticle comprises a lipid-polycation complex. The formation of the lipid-polycation complex may be accomplished by methods known in the art and / or as described in U.S. Patent Publication No. 20120178702, herein incorporated by reference in itsentirety. As a non-limiting example, the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and / or polyarginine. In some embodiments, the composition may comprise a lipid-polycation complex, which may further include a non-cationic lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).

[0032] In various aspects, the cationic liposomes optionally do not comprise a non-cationic lipid. Neutral molecules, in some aspects, may interfere with coiling / condensation of multi- lamellar nanoparticles resulting in RNA loaded liposomes greater than 200 nm in size. Cationic liposomes generated without helper molecules can comprise a size of about 70-200 nm (or less). These constructs consist essentially of a cationic lipid with negatively charged nucleic acid, and may be formulated in a sealed rotary vacuum evaporator which prevents oxidation of the particles (when exposed to the ambient environment). In this aspect, the absence of a helper lipid optimizes mRNA coiling into tightly packaged multilamellar NPs where each NP contains a greater amount of nucleic acid per particle. Due to increased nucleic acid payload per particle, these multi-lamellar RNA nanoparticles drive significantly greater innate immune responses, which are a significant predictor of efficacy for modulating the immune system.

[0033] In some aspects, the nucleic acid molecules (e.g., mRNA) are present at a nucleic acid molecule: cationic lipid ratio of about 1 to about 5 to about 1 to about 25. In some aspects, the nucleic acid molecules (e.g., mRNA) are present at a nucleic acid molecule: cationic lipid ratio of about 1 to about 5 to about 1 to about 20, optionally, about 1 to about 15, about 1 to about 10, or about 1 to about 7.5. As used herein, the term “nucleic acid molecule: cationic lipid ratio” is meant a mass ratio, where the mass of the nucleic acid molecule is relative to the mass of the cationic lipid. Also, in exemplary aspects, the term “nucleic acid molecule: cationic lipid ratio” is meant the ratio of the mass of the nucleic acid molecule, e.g., mRNA, added to the liposomes comprising cationic lipids during the process of manufacturing the ML RNA NPs of the present disclosure. In exemplary aspects, the nanoparticle comprises less than or about 10 pg RNA molecules per 150 pg lipid mixture. In exemplary aspects, the nanoparticle is made by incubating about 10 pg RNA with about 150 pg liposomes. In alternative aspects, the nanoparticle comprises more RNA molecules per mass of lipid mixture. For example, the nanoparticle may comprise more than 10 pg RNA molecules per 150 pg liposomes. The nanoparticle in some instances comprises more than 15 pg RNA molecules per 150 pg liposomes or lipid mixture.

[0034] In exemplary instances, the nucleic acid molecules are mRNA. The mRNA optionally comprises non-coding regions that allow or enhance protein expression (e.g., 5’ and / or 3’ untranslated regions (UTRs)). In various aspects, the mRNA is modified (i.e., includes a modification which is not naturally found in the RNA). For example, the mRNA may comprise a 5'-cap, i.e., a cap structure found on the 5'-end of an mRNA molecule which generally is a guanosine nucleotide. Examples of cap structures include, but are not limited to, m7G(5')ppp (5')A; G(5')ppp(5')A; and G(5’)ppp(5')G. In various aspects, the modification(s) reduces immunogenicity of the RNA. For example, in various aspects, the RNA is rendered less immunogenic by incorporating modified nucleotides in the sequence that inhibit or reduce RNA- mediated activation of innate immune receptors and removing double-stranded RNA. In this respect, the RNA optionally comprises modified nucleotides in place of one or more uracil residues. Examples of modified nucleotides which reduce immunogenicity include, but are not limited to 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio- pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine, uridine 5- oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl- uridine (cm5U), 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chmSU), 5- carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5ll), 1-ethyl-pseudouridine, 5-methylaminomethyl -2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5 se2U), 5- carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5- carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1 -propynyl- pseudouridine, 5-taurinomethyl-uridine (xm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl- 2-thio-uridine (xm5s2U), 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine (m5s2U), 1 -methyl-4-thio-pseudouridine, 2-th io- 1 -methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1 -methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3 ip), 5- (isopentenylaminomethyl)uridine (inm5ll), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2ll), 4-thiouridine, 2’-O-methyl-uridine (Um), 5,2'-0-dimethyl-uridine (m5Um), 2'-0-methyl- pseudouridine (ipr|i), 2-thio-2'-0-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-0-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2 '-O-methyl-uridine (ncm5Um), 5- carboxymethylaminomethyl-2'-0-methyl-uridine (cmnm5Um), 3,2'-0-dimethyl-uridine (m3Um), 5- (isopentenylaminomethyl)-2'-0-methyl-uridine (inm5Um), 1 -thio-uridine, deoxythymidine, 2'-F- ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(l-E- propenyl amino)uridine. In various aspects, nucleotide comprising a modified nucleobase is pseudouridine, N1 -methyl-pseudouridine, or 5-methyl-uridine (m5U). Optionally, the mRNA comprises 1 -methyl-pseudouridine.

[0035] The mRNA incorporated into the nanoparticle encodes a proinsulin peptide.Proinsulin is protein produced by beta cells and which is the precursor of insulin. Beta cells produce preproinsulin, which comprises a signal peptide operably linked to proinsulin, which includes the insulin B-chain, C-peptide, and insulin A-chain. Preproinsulin is processed within the beta cells to produce mature proinsulin, which folds such that the C terminus of the B-chain connects the N terminus of A-chain via disulfide bonds. Proinsulin is converted into insulin and C-peptide in the beta cell granule. Proinsulin is a beta cell autoantigen targeted by autoreactive CD4+ T cells and B lymphocytes.

[0036] Human proinsulin is encoded by the nucleic acid sequence:AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTT TGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCA GGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCA GGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGC CATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTG ACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCT ACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAG GACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTG CTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGG GGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTC CCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATA CATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCC ATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTG ACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCC GGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGG CAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTG GGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTG GGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGC ACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTG CTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCA GGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACA ATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCC CGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGA ACCAGC (SEQ ID NO: 1 ).

[0037] In various aspects, the nanoparticles comprise a nucleic acid molecule (e.g., RNA molecule) comprising a nucleotide sequence encoding a chimeric protein comprising a LAMP protein. In certain aspects, the LAMP protein is a LAMP1 , LAMP 2, LAMP3, LAMP4, or LAMP5 protein.

[0038] The disclosure provides methods for, e.g., inducing immune tolerance to beta cells in a subject in need thereof, by administering to the subject a composition comprising the multilamellar mRNA nanoparticles encoding proinsulin described herein. In various aspects, the composition is administered in an amount which is effective to activate dendritic cells (DCs) in the subject to promote immune tolerance to beta cells. Immune tolerance may be detected by, e.g., detecting a reduction in diabetes-related antibodies, such as antibodies against islet cell components.

[0039] The present disclosure also provides a method of treating or delaying the onset of Type 1 diabetes (T 1 D) in a subject in need thereof. T 1 D typically progresses in three stages. In stage 1 , the subject tests positive for autoimmunity against beta cells. For example, a subject may test positive for two or more diabetes-related autoantibodies, e.g., antibodies against glutamic acid decarboxylase-65, islet cell cytoplasm, the intracytoplasmatic domain of the tyrosine phosphatase-like protein I A-2, zinc-transporter-8, and / or insulin. Autoimmunity also may be observed through pancreatic biopsy. In stage 2, the subject tests positive for two or more diabetes-related autoantibodies and blood sugar levels are abnormal. For example, a glucose tolerance test may show that the blood sugar level of the subject is between about 140 mg and 200 mg of glucose per dL (11 .1 mmol / l) of plasma two hours after 75 g of glucose have been taken on an empty stomach. The subject may not experience symptoms of T1 D in stage 2. In stage 3, there is significant beta cell loss due to autoimmunity and the subject has often received a clinical diagnosis. Subjects in stage 3 also generally exhibit symptoms of T1 D, e.g., frequent urination, excessive thirst, weight loss, and fatigue. Symptoms typically appear when asubject has only 30% of their beta cells left (i.e., a majority of beta cells are lost to autoimmunity). A glucose tolerance test result of blood sugar levels in excess of 200 mg of glucose per dL is associated with stage 3. The subject administered the composition of the disclosure may be at any point in the progression of the disease (stage 1 , stage 2, or stage 3) and exhibit any one or more of the hallmarks of the disease described. The subject may be considered pre-diabetic, wherein, for instance, the subject exhibits a blood glucose result between 100 and 125 mg / dL of glucose. The subject may suffer from Latent Autoimmune Diabetes of Adulthood (LADA). Optionally, the subject demonstrates a genetic predisposition for developing T 1 D (e.g. HLA, INS VNTR, and / or PTPN22 genotype).

[0040] The subject is a mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits, mammals from the order Carnivora, including Felines (cats) and Canines (dogs), mammals from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). In some aspects, the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). In some aspects, the mammal is a human. In some aspects, the human is an adult aged 18 years or older. In some aspects, the human is a child aged 17 years or less.

[0041] The materials and methods described herein are useful, e.g., for treating a subject for a disease or disorder, such as Type 1 diabetes. As used herein, the term “treat,” as well as words related thereto, does not necessarily imply 100% or complete treatment or remission. Rather, there are varying degrees of treatment of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the methods of treating a disease or disorder can provide any amount or any level of treatment. Furthermore, the treatment provided by the method may include treatment of one or more conditions or symptoms or signs of the disease being treated. For instance, the treatment method of the present disclosure may inhibit one or more symptoms of the disease. Also, the treatment provided by the methods of the present disclosure may encompass slowing the progression of the disease. Symptoms of diabetes include frequent urination, excessive thirst, excessive hunger, weight loss, fatigue, blurry vision, body aches, dry mouth or skin, poor healing of wounds, hyperglycemia, loss of glycemic control, and low or inadequate levels of insulin or insulin activity.

[0042] Additionally, the treatment provided by the presently disclosed method may delay the onset T 1 D. The treatment also may encompass reducing the risk of disease development. Theterm “inhibit” and words stemming therefrom may not be a 100% or complete inhibition or abrogation. Rather, there are varying degrees of inhibition of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. The presently disclosed methods may inhibit the onset of the disease or a symptom thereof to any amount or level. In exemplary embodiments, the inhibition provided by the methods is at least or about a 10% inhibition (e.g., at least or about a 20% inhibition, at least or about a 30% inhibition, at least or about a 40% inhibition, at least or about a 50% inhibition, at least or about a 60% inhibition, at least or about a 70% inhibition, at least or about an 80% inhibition, at least or about a 90% inhibition, at least or about a 95% inhibition, or at least or about a 98% inhibition).

[0043] The disclosure further contemplates use of a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each nucleic acid layer is positioned between a cationic lipid bilayer and the mRNA encodes a proinsulin peptide, for treating or delaying the onset of T1 D. Use of the nanoparticle in the preparation of a medicament for treating or delaying the onset of T1 D also is contemplated, as is the nanoparticle composition described herein for use in treating or delaying the onset of T1 D.

[0044] With regard to the foregoing methods, the composition comprising the nanoparticles, in some aspects, is systemically administered to the subject. Optionally, the method comprises administration of any of the compositions described herein by way of parenteral administration. Parenteral dosage forms of any agent described herein can be administered to a subject by various routes, including, but not limited to, epidural, intracerebral, intracerebroventricular, epicutaneous, intraarterial, intraarticular, intracardiac, intracavernous injection, intradermal, intralesional, intramuscular, intraocular, intraosseous infusion, intraperitoneal, intrathecal, intrauterine, intravaginal administration, intravenous, intravesical, intravitreal, subcutaneous, transdermal, perivascular administration, or transmucosal. In various instances, the composition is administered to the subject intravenously.

[0045] The amount or dose of an active agent (i.e., the "effective amount") administered should be sufficient to achieve a desired biological effect, e.g., a therapeutic or prophylactic response, in the subject over a reasonable time frame. For example, one or more doses of the composition should be sufficient to, e.g., induce immune tolerance to beta cells a clinically acceptable period of time from the time of administration. By way of example and not intending to limit the present disclosure, the dose of the active agents of the present disclosure can be about 0.0001 to about 1 g / kg body weight of the subject being treated / day, from about 0.0001 toabout 0.001 g / kg body weight, or about 0.01 mg to about 1 g / kg body weight. In various aspects, the nanoparticle composition is administered according to any regimen including, for example, daily (1 time per day, 2 times per day, 3 times per day, 4 times per day, 5 times per day, 6 times per day), three times a week, twice a week, every two days, every three days, every four days, every five days, every six days, weekly, bi-weekly, etc. In various aspects, the composition is administered to the subject once a week.

[0046] Also provided herein are compositions comprising a nanoparticle of the present disclosure and a pharmaceutically acceptable carrier, excipient, or diluent. In exemplary aspects, the composition is a sterile composition. In exemplary instances, the composition comprises a plurality of nanoparticles of the present disclosure. Optionally, at least 50% of the nanoparticles of the plurality have a diameter between about 100 nm to about 250 nm. In various aspects, the composition comprises about 1010nanoparticles per mL to about 1015nanoparticles per mL, optionally about 1012nanoparticles ± 10% per mL.

[0047] In exemplary aspects, the composition of the present disclosure may comprise additional components other than the nanoparticle. The composition, in various aspects, comprises any pharmaceutically acceptable ingredient, including, for example, acidifying agents, additives, adsorbents, aerosol propellants, air displacement agents, alkalizing agents, anticaking agents, anticoagulants, antimicrobial preservatives, antioxidants, antiseptics, bases, binders, buffering agents, chelating agents, coating agents, coloring agents, desiccants, detergents, diluents, disinfectants, disintegrants, dispersing agents, dissolution enhancing agents, dyes, emollients, emulsifying agents, emulsion stabilizers, fillers, film forming agents, flavor enhancers, flavoring agents, flow enhancers, gelling agents, granulating agents, humectants, lubricants, mucoadhesives, ointment bases, ointments, oleaginous vehicles, organic bases, pastille bases, pigments, plasticizers, polishing agents, preservatives, sequestering agents, skin penetrants, solubilizing agents, solvents, stabilizing agents, suppository bases, surface active agents, surfactants, suspending agents, sweetening agents, therapeutic agents, thickening agents, tonicity agents, toxicity agents, viscosity-increasing agents, water-absorbing agents, water-miscible cosolvents, water softeners, or wetting agents. See, e.g., the Handbook of Pharmaceutical Excipients, Third Edition, A. H. Kibbe (Pharmaceutical Press, London, UK, 2000), which is incorporated by reference in its entirety. Remington’s Pharmaceutical Sciences, Sixteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980), which is incorporated by reference in its entirety.

[0048] Compositions of the present disclosure can be suitable for administration by any acceptable route, including parenteral and subcutaneous. Other routes include intravenous, intradermal, intramuscular, intraperitoneal, intranodal and intrasplenic, for example. In exemplary aspects, the composition is suitable for systemic (e.g., intravenous) administration. If the composition is in a form intended for administration to a subject, it can be made to be isotonic with the intended site of administration. For example, if the solution is in a form intended for administration parenterally, it can be isotonic with blood. The composition typically is sterile. In certain embodiments, this may be accomplished by filtration through sterile filtration membranes. In certain embodiments, parenteral compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag, or vial having a stopper pierceable by a hypodermic injection needle, or a prefilled syringe. In certain embodiments, the composition may be stored either in a ready-to-use form or in a form (e.g., lyophilized) that is reconstituted or diluted prior to administration. In this regard, the disclosure provides a kit comprising the composition with instructions for use.EXAMPLES

[0049] The following examples are given merely to illustrate the present invention and not in any way to limit its scope.EXAMPLE 1

[0050] This example describes a method of making nanoparticles of the present disclosure.

[0051] Preparation of DOTAP Liposomes

[0052] On Day 1 , the following steps were carried out in the fume hood. Water was added to a rotavapor bath. Chloroform (20 mL) was poured into a sterile, glass graduated cylinder. After opening a vial containing 1 g of DOTAP, 5 mL chloroform was added to the DOTAP vial using a glass pipette. The volume of chloroform and DOTAP was then transferred into a 1 -L evaporating flask. The DOTAP vial was washed by adding a second 5-mL volume of chloroform to the DOTAP vial to dissolve any remaining DOTAP in the vial and then transferring this volume of chloroform from the DOTAP vial to the evaporating flask. This washing step was repeated two more times until all the chloroform in the graduated cylinder was used. The evaporating flask was then placed into the Buchi rotavapor. The water bath was turned on and adjusted to 25 °C. The evaporating flask was moved downward until it touched the water bath. The rotation speed of the rotavapor was adjusted to 2. The vacuum system was turned on and adjusted to 40 mbar. After 10 minutes, the vacuum system was turned off and the chloroformwas collected from the collector flask. The amount of chloroform collected was measured.Once the collector flask is repositioned, the vacuum was turned on again and the contents in the evaporating flask was allowed to dry overnight until the chloroform was completely evaporated.

[0053] On Day 2, using a sterile graduated cylinder, PBS (200 ml_) was added to a new, sterile 500-mL PBS bottle maintained at room temperature. A second 500-mL PBS bottle was prepared for collecting DOTAP. The Buchi rotavapor water bath was set to 50eC. PBS (50 mL) was added into the evaporating flask using a 25-mL disposable serological pipette. The evaporating flask was positioned in the Buchi rotavapor and moved downward until 1 / 3 of the flask was submerged into the water bath. The rotation speed of the rotavapor was set to 2, allowed to rotate for 10 min, and then rotation was turned off. A 50-mL volume of PBS with DOTAP from the evaporating flask was transferred to the second 500 mL PBS bottle. The steps were repeated (3-times) until the entire volume of PBS in the PBS bottle was used. The final volume of the second 500 mL PBS bottle was 400 mL. The lipid solution in the second 500 mL PBS bottle was vortexed for 30 s and then incubated at 50SC for 1 hour. During the 1 hour incubation, the bottle was vortexed every 10 min. The second 500 mL PBS bottle was allowed to rest on overnight at room temperature.

[0054] On Day 3, PBS (200 mL) was added to the second 500 mL PBS bottle containing DOTAP and PBS. The second 500 mL PBS bottle was placed into an ultrasonic bath. Water was filled in the ultrasonic bath and the second 500 mL PBS bottle was sonicated for 5 min. The extruder was washed with PBS (100 mL) and this wash step was repeated. A 0.45 pm pore filter was assembled into a filtration unit and a new (third) 500 mL PBS bottle was positioned into the output tube of the extruder. In a biological safety cabinet, the DOTAP-PBS mixture was loaded into the extruder, until about 70% of the third PBS bottle was filled. The extruder was then turned on and the DOTAP PBS mixture was added until all the mixture was run through the extruder. Subsequently, a 0.22 pm pore filter was assembled into the filtration unit and a new (third) 500 mL PBS bottle was positioned into the output tube of the extruder. The previously filtered DOTAP-PBS mixture was loaded and run again throughout. The samples comprising DOTAP lipid nanoparticles (NPs) in PBS were then stored at 4eC.

[0055] RNA Preparation

[0056] Prior to incorporation into NPs, RNA was prepared in one of a few ways. For the purposes of this particular study, total tumor RNA was prepared by isolating total RNA (including rRNA, tRNA, mRNA) from tumor cells. In vitro transcribed mRNA was prepared by carrying out in vitro transcription reactions using cDNA templates produced by reverse transcription of totaltumor RNA. Tumor antigen-specific and Non-specific RNAs were either made in-house or purchased from a vendor.

[0057] Total tumor-derived RNA from tumor cells (e.g., B16F0, B16F10, and KR158-luc) is isolated using commercially available RNeasy mini kits (Qiagen) based on manufacturer instructions.

[0058] Briefly, RNA is isolated using commercially available RNeasy mini kits (Qiagen) per manufacturer’s instructions and cDNA libraries were generated by RT-PCR. Using a SMARTScribe Reverse Transcriptase kit (Takara), a reverse transcriptase reaction by PCR was performed on the total tumor RNA in order to generate cDNA libraries. The resulting cDNA was then amplified using Takara Advantage 2 Polymerase mix with T7 / SMART and CDS III primers, with the total number of amplification cycles determined by gel electrophoresis. Purification of the cDNA was performed using a Qiagen PCR purification kit per manufacturer’s instructions. In order to isolate sufficient mRNA for use in each RNA-nanoparticle vaccine, mMESAGE mMACHINE (Invitrogen) kits with T7 enzyme mix were used to perform overnight in vitro transcription on the cDNA libraries. Housekeeping genes were assessed to ensure fidelity of transcription. The resulting mRNA was then purified with a Qiagen RNeasy Maxi kit to obtain the final mRNA product.

[0059] Plasmids comprising DNA encoding tumor antigen-specific RNA (RNA encoding, e.g., pp65, OVA) and non-specific RNA (RNA encoding, e.g., Green Fluorescent Protein (GFP), luciferase) are linearized using restriction enzymes (i.e., Spel) and purified with Qiagen PCR MiniElute kits. Linearized DNA is subsequently transcribed using the mmRNA in vitro transcription kit (Life technologies, Invitrogen) and cleaned up using RNA Maxi kits (Qiagen). In alternative methods, non-specific RNA is purchased from Trilink Biotechnologies (San Diego, CA).

[0060] Preparation of Multilamellar RNA nanoparticles (NPs)

[0061] The DOTAP lipid NPs were complexed with RNA to make multilamellar RNA-NPs which were designed to have several layers of mRNA contained inside a tightly coiled liposome with a positively charged surface and an empty core (Figure 1). Briefly, in a safety cabinet, RNA was thawed from -80 °C and then placed on ice, and samples comprising PBS and DOTAP (e.g., DOTAP lipid NPs) were brought up to room temperature. Once components were prepared, the desired amount of RNA was mixed with PBS in a sterile tube. To the sterile tube containing the mixture of RNA and PBS, the appropriate amount of DOTAP lipid NPs wasadded without any physical mixing (without e.g., inversion of the tube, without vortexing, without agitation). The mixture of RNA, PBS, and DOTAP was incubated for about 15 minutes to allow multilamellar RNA-NP formation. After 15 min, the mixture was gently mixed by repeatedly inverting the tube. The mixture was then considered ready for systemic (i.e. intravenous) administration.

[0062] The amount of RNA and DOTAP lipid NPs (liposomes) used in the above preparation is pre-determined or pre-selected. In some instances, a ratio of about 15 pg liposomes per about 1 pg RNA were used. For instance, about 75 pg liposomes are used per ~5 pg RNA or about 375 pg liposomes are used per -25 pg RNA. In other instances, about 7.5 pg liposomes were used per 1 pg RNA. Thus, in exemplary instances, about 1 pg to about 20 pg liposomes are used for every pg RNA used.EXAMPLE 2

[0063] This example describes the characterization of the nanoparticles of the present disclosure.

[0064] Cryo-Electron Microscopy (CEM)

[0065] CEM was used to analyze the structure of multilamellar RNA-NPs prepared as described in Example 1 and control NPs devoid of RNA (uncomplexed NPs) which were made by following all the steps of Example 1 , except for the steps under “RNA Preparation” and “Preparation of Multilamellar RNA nanoparticles (NPs)”. CEM was carried out as essentially described in Sayour et al., Nano Lett 17(3) 1326-1335 (2016). Briefly, samples comprising multilamellar RNA-NPs or control NPs were kept on ice prior to being loaded in a snap-frozen in Vitrobot (and automated plunge-freezer for cryoTEM, that freezes samples without ice crystal formation, by controlling temperature, relative humidity, blotting conditions and freezing velocity). Samples were then imaged in a Tecnai G2 F20 TWIN 200 kV / FEG transmission electron microscope with a Gatan UltraScan 4000 (4k x4k) CCD camera. The control NPs contained at most two layers, whereas multilamellar RNA NPs contained several layers (illustrated in Figure 1 ).

[0066] Zeta Potentials

[0067] Zeta potentials of multilamellar RNA NPs were measured by phase analysis light scattering (PALS) using a Brookhaven ZetaPlus instrument (Brookhaven Instruments Corporation, Holtsville, NY), as essentially described in Sayour et aL, Nano Lett 17(3) 1326- 1335 (2016). Briefly, uncomplexed NPs or RNA-NPs (200 pL) were resuspended in PBS (1.2mL) and loaded in the instrument. The samples were run at 5 runs per sample, 25 cycles each run, and using the Smoluchowski model.

[0068] The zeta potential of the multilamellar RNA NPs prepared as described in Example 1 was measured at about +50 mV. Interestingly, this zeta potential of the multilamellar RNA NPs was much higher than those described in Sayour et al., Oncoimmunology 6(1 ): e1256527 (2016), which measured at around +27 mV. Without being bound to any particular theory, the way in which the DOTAP lipid NPs are made for use in making the multilamellar RNA NPs (Example 1) involving a vacuum-seal method for evaporating off chloroform leads to less environmental oxidation of the DOTAP lipid NPs, which, in turn, may allow for a greater amount of RNA to complex with the DOTAP NPs and / or greater incorporation of RNA into the DOTAP lipid NPs.

[0069] RNA Incorporation by Gel Electrophoresis:

[0070] A gel electrophoresis experiment was conducted to measure the amount of RNA incorporated into ML liposomes. Based on this experiment, it was qualitatively shown that nearly all, if not all, of the RNA used in the procedure described in Example 1 was incorporated into the DOTAP lipid NPs.EXAMPLE 3

[0071] This example describes a comparison of the nanoparticles of the present disclosure to cationic RNA lipoplexes and anionic RNA lipoplexes.

[0072] Cationic lipoplexes (LPX) were first developed with mRNA in the lipid core shielded by a net positive charge located on the outer surface (illustrated in Figure 1 ). Anionic RNA lipoplexes (illustrated in Figure 1 ) have been developed with an excess of RNA tethered to the surface of bi-lamellar liposomes. RNA-LPX were made by mixing RNA and lipid NP at ratios to equalize charge. Anionic RNA-NPs were made by mixing RNA and lipid NP at ratios to oversaturate lipid NPs with negative charge. Various aspects of the RNA-LPX and anionic RNA LPX were then compared to the multilamellar RNA NPs described in the above examples.

[0073] Cryo-Electron Microscopy (CEM) was used to compare the structures of the RNA LPX and the multilamellar RNA-NPs prepared as described in Example 1 . Uncomplexed NPs were used as a control. CEM was carried out as essentially described in Example 2. Examination of the images demonstrated that more RNA is held by the ML RNA-NPs. Additional data show that the concentration drops more with ML RNA-NP complexation versus RNA LPX supporting multilamellar formation of ML RNA-NPs not observed by simple mixing of equivalent amounts ofRNA and lipid NPs by mass or charge (i.e. , RNA-LPX and anionic RNA-LPX respectively). This supports that more RNA is “held” by ML RNA-NPs described herein.

[0074] RNA LPX, anionic lipoplex (LPX) or multilamellar RNA-NPs were administered to mice and spleens were harvested one week later for assessment of activated DCs (*p<0.05 unpaired t test). The RNA used in this experiment was tumor-derived mRNA from the K7M2 tumor osteosarcoma cell line. Mice treated with multilamellar RNA NPs exhibited the highest levels of activated DCs.EXAMPLE 4

[0075] This example describes studies in a clinically relevant animal model of T1 D.

[0076] Demonstration of central immune tolerance

[0077] Mice have two proinsulin genes, with the proinsulin II gene primarily expressed in the thymus. Impaired immune tolerance to proinsulin may be a stimulus for autoimmune diabetes. Autoimmunity is evaluated by measuring baseline and follow-up insulin autoantibodies, which correlate with risk for diabetes development. Splenocytes, regulatory T cell populations, and score murine pancreata are evaluated for insulitis severity in each experiment. To evaluate the efficacy in restoring central tolerance, NOD-INS2null (NOD insulin 2 knock out) mice will be treated with the multilamellar RNA composition described herein. These mice have no expression of proinsulin II in the thymus or pancreas. Both male and female get insulin autoantibodies by 4 weeks of age and diabetes 100% of the time with 90% having diabetes by age 13 weeks (compared to about 15% of NOD / ShiLtJ strain).

[0078] Method'. NOD-INS2null carrier mice will be obtained from Jackson Laboratory from cryo recovery. Carriers will consequently be crossed to breed homozygous NOD-INS2null mice with genotyping confirmed on PCR. We will use 4 groups of 10 homozygous NOD-INS2null mice: Group 1 treated with 3 weekly IV proinsulin II mRNA liposome vaccines starting at 4 weeks, an irrelevant mRNA control (GFP), an empty liposome group (no mRNA), and an untreated group. Each group with consistent of 5 male and 5 female mice. Vaccines will be prepared within one hour prior to vaccination, the vaccine will be prepared using 25 micrograms of RNA diluted in PBS and added to a DOTAP lipid multilamellar nanoparticle. Blood glucoses and weights will be monitored weekly. Serum will be collected at baseline and end-point and insulin antibodies will be evaluated using immunoprecipitation. End-point is defined as diabetes development or 24 weeks of age. Diabetes is defined as glucose levels at or above 250 mg / dlon two consecutive measurements obtained one day apart. Pancreata will also be obtained at end-point, fixed in formalin, and preserved in PBS before histopathology processing. They will then be scored for insulitis severity.

[0079] The nucleic acid sequence encoding mouse proinsulin II is provided here:GGGGACCCAGTAACCACCAGCCCTAAGTGATCCGCTACAATCAAAAACCATCAGCAA GCAGGAAGGTACTCTTCTCAGTGGGCCTGGCTCCCCAGCTAAGACCTCAGGGACTT GAGGTAGGATATAGCCTCCTCTCTTACGTGAAACTTTTGCTATCCTCAACCCAGCCTA TCTTCCAGGTTATTGTTTCAACATGGCCCTGTGGATGCGCTTCCTGCCCCTGCTGGC CCTGCTCTTCCTCTGGGAGTCCCACCCCACCCAGGCTTTTGTCAAGCAGCACCTTTG TGGTTCCCACCTGGTGGAGGCTCTCTACCTGGTGTGTGGGGAGCGTGGCTTCTTCTA CACACCCATGTCCCGCCGTGAAGTGGAGGACCCACAAGGTGAGTTCTGCCACTGAA TTCTGTCCCCAGTGCTAACTACCCTGGTTTTCTTCACACTTGGGACATTGTAAATTGT GTCCTAGGTGTGGAGGGTCTCGGGATAACCAGGGAGTGGGGACACGTTTCTGGGGG AAGCTAGACATATGTAAACATGGCAGCTGCCAGGAATGAGTAAGAATCCTGCCTTAA GGGGTCCTTGGTGGTAGTAACTTGGGACATGTGACTAGATCCCAGGATAGGTACCTA TTTAGGGCCCTCATAGAGCACTGCACTGACTGAAGATGAGTAGGCTTTAGAGGCCCA TGTGTCCATCCATGACCAGTGACTTGTCCCACAGGCATGCAACCCCTGCCACCTGCA GGGGTTAAGGGGCGAGAAAACCTGGGGTAGTAGGAGGTTGCTCAGCTACTCCTGAC TGGATTTTCCTATGTGTCTTTGCTTCTGTGCTGCTGATGCCCTGGCCTGCTCTGACAC AACCTCCCTGGCAGTGGCACAACTGGAGCTGGGTGGAGGCCCGGGAGCAGGTGAC CTTCAGACCTTGGCACTGGAGGTGGCCCAGCAGAAGCGTGGCATTGTAGATCAGTG CTGCACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACCCACCA CTACCCAGCCTACCCCTCTGCAATGAATAAAACCTTTGAATGAGCACAA (SEQ ID NO: 2).

[0080] Dosing and timing of administration

[0081] Methods: The NOD / ShiLtJ mouse strain is obtained from The Jackson Laboratory at age 4 weeks. Five groups of 15 NOD female mice will be utilized. Group 1 will receive three weekly IV proinsulin II mRNA liposome vaccines starting at 4 weeks of age (early weekly). Group 2 will receive three biweekly (every 2 weeks) vaccines starting at 4 weeks (early biweekly). Group 3 will receive three weekly IV injections starting at 8 weeks (late weekly).Group 4 will receive three biweekly injections starting at 8 weeks (late biweekly). A fifth group will remain untreated. Blood glucoses and weights will be monitored weekly. Insulin autoantibodies will be drawn at 4 weeks, 8 weeks, and at end-point. End-point is defined asdiabetes development or 32 weeks of age at which splenocytes, pancreata, serum, and immune cells will be collected and evaluated.

[0082] Silencing innate immunity and targeting immune tissues

[0083] The multi-lamellar liposome when given intravenously is expressed in immune tissues throughout the body as well as the lung and liver. Intracellular mRNA can become doublestranded and trigger Toll-like receptor (TLR) signaling, activating an innate immune response in conjunction with adaptive immunity. To further evaluate if this additional inflammatory response is helpful in conferring immune tolerance with autoantigens, the mRNA can be “silenced”, abrogating TLR signaling, via modifying the mRNA with 1 -methylpseudouridine. This prevents double stranded mRNA formation, but still allows MHC Class II peptide presentation, which could favor immune tolerance induction.

[0084] Methods: NOD / ShiLtJ mouse strain is obtained from The Jackson Laboratory at age 4 weeks. Six groups of 15 NOD female mice each will be utilized: an empty liposome (no mRNA control) group, the “unsilenced” proinsulin II mRNA multi-lamellar liposome vaccine group, a “silenced” proinsulin II group with 1 -methylpseudouridine modifications, an anionic proinsulin II mRNA lipoplex group, and two irrelevant mRNA (GFP) control groups (one with methylpseudouridine modifications and one anionic vaccine). The dose schedule will mimic the best group from the study described above. Baseline autoimmunity will be evaluated via serum collection for insulin autoantibodies prior to vaccination and at end-point. Blood glucoses and weights will be monitored weekly. End-point is defined as diabetes development or 32 weeks of age at which splenocytes, pancreata, serum, and immune cells will be collected and evaluated.

[0085] Analytical Plan: The log-rank test will be used to compare Kaplan-Meier survival curves between treatment groups and control groups. Changes in immune response parameters, diabetes development over time, and insulitis scores will be compared among treatment groups using linear and generalized linear mixed effect models (LMMs, GLMMs). Mixed models will allow us to account for both within-animal correlation of responses observed repeatedly over time and batch or laboratory day effects due to full replication at a later time. A two-way ANOVA model will be used to compare mean responses among mutually exclusive groups defined by both treatment and observation time. If alpha=0.05, 10 INS2 knock out and 15 NOD / ShiLtJ mice per group will have 80% power to detect a 50% reduction in the rate of diabetes, which is comparable to clinically significant reduction in diabetes in clinical trials with teplizumab.EXAMPLE 5

[0086] Using materials and methods described herein, a novel proinsulin mRNA multilamellar nanoparticle was generated. Proinsulin II was cloned into plasmids for in vitro RNA transcription. mRNA was loaded into multilamellar nanoparticles comprising DOTAP. Multilamellar mRNA vaccines reliably delivered beta-cell antigen specific therapy to cells (Figure 2). In vitro studies confirmed mRNA uptake and proinsulin expression in HEK293 cells.

[0087] Intravenous (IV) administration of multi-lamellar liposome nanoparticles with proinsulin II mRNA delayed diabetes in the NOD mouse (Figure 3). NOD / ShiLtJ strain mice were obtained at 4 weeks of age. It is a polygenic model that develops diabetes spontaneously as early as 10 weeks of age, with 90% of female mice diabetic by 32. Group 1 mice received three IV tail vein injections of mRNA nanoparticles every other day at 8 weeks and one dose at 23 weeks of age. Group 2 remained untreated. Mice were checked weekly for diabetes (glucose >250 mg / dl on two measurements one day apart). Kaplan-Meier survival curves, hazard ratio, median time to diabetes, and t-tests were used to compare time to diabetes. The diabetes rate by 32 weeks was 64.2% (9 / 14) in Group 1 compared to 78.6% (11 / 14) in Group 2 (Hazard ratio 1.60 95% Cl 0.66-3.86). By 15 weeks, the treatment group had no diabetes compared to 35.7% untreated (p=0.04). Median time to diabetes was 21 weeks in the treatment group and 17 weeks in the untreated group.

[0088] A further study was conducted using the materials and methods described herein. This study aimed to assess differences in safety and efficacy of a “prime-boost” approach versus weekly administration of the cationic proinsulin II mRNA multi-lamellar liposomes described herein in preventing diabetes in the non-obese diabetic (NOD) mouse model.

[0089] Proinsulin II was cloned into plasmid backbones, transcribed into mRNA, and loaded into nanoliposomes composed of a DOTAP lipid backbone (RNA:lipid-particle aggregates (LPA) ratio 1 :15). mRNA expression was validated with HEK293 cell culture transfection. NOD / ShiLtJ strain mice were obtained from Jackson Laboratory at 4 weeks of age. Group 1 received four IV tail vein injections of proinsulin mRNA vaccines weekly starting at 8 weeks of age. Group 2 received three IV proinsulin mRNA vaccines at 8 weeks of age every other day plus a single booster dose at 14 weeks of age. Group 3 remained untreated (n=25 mice / group). Mice were monitored after injections to assess for vaccine reactions and checked weekly for diabetes (glucose >250 mg / dl on two consecutive measurements one day apart). Kaplan Meier survival curves, relative risk, and median time to diabetes were used to compare diabetes developmentbetween groups (GraphPad Prism 10.0.2). Fisher’s exact test was used to compare rate of adverse events between vaccine groups.

[0090] In Group 1 , proinsulin mRNA nanoparticles were well tolerated until the 4th weekly dose when 21% (5 / 25) of mice experienced an inflammatory response within 30 minutes of vaccination leading to cardiorespiratory collapse. Group 2 experienced this reaction sooner at the 3rd dose in 12% (3 / 25) of mice; the 4th “booster” dose at week 14 was again well tolerated without further deaths. Overall vaccine reactions were not significantly different between groups (p=0.703). The overall rate of diabetes by 32 weeks of age in all vaccinated mice was 70.6% compared to 95.2% of untreated mice (relative risk 0.741 95% Cl 0.56-0.955), with no significant difference in diabetes development between the vaccine groups (p=0.968). Median time to diabetes was 19 weeks in Group 1 , 21 weeks in Group 2, and 16 weeks in untreated control. Cationic proinsulin II mRNA multi-lamellar liposome nanoparticles delayed diabetes development in NOD mice. The rate of vaccine reactions and diabetes development were not significantly different with a weekly vaccine dose schedule compared to a prime-boost approach. However, increased time between treatment doses delays the timing of adverse reactions.

[0091] This example demonstrates that the multilamellar nanoparticles of the disclosure delay the time to onset of diabetes in a clinically relevant animal model.

[0092] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0093] The use of the terms “a” and “an” and “the” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. If aspects of the invention are described as "comprising" a feature, embodiments also are contemplated "consisting of" or "consisting essentially of" the feature.

[0094] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range and eachendpoint, unless otherwise indicated herein, and each separate value and endpoint is incorporated into the specification as if it were individually recited herein. Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about" as that term would be interpreted by the person skilled in the relevant art.

[0095] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.

[0096] Preferred embodiments of this disclosure are described herein, including the best mode known to the inventors for carrying out the disclosure. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the disclosure to be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the disclosure unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

WHAT IS CLAIMED:1 . A method of inducing immune tolerance to beta cells in a subject in need thereof, the method comprising administering to the subject a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each mRNA layer is positioned between a cationic lipid bilayer, and the mRNA encodes a proinsulin peptide.

2. The method of claim 1 , wherein the proinsulin peptide is encoded by the nucleic acid sequence of SEQ ID NO: 1 .

3. The method of claim 1 or claim 2, wherein the nanoparticle comprises at least three nucleic acid layers, each of which is positioned between a cationic lipid bilayer.

4. The method of any one of claims 1 -3, wherein the outermost layer of the nanoparticle comprises a cationic lipid bilayer.

5. The method of any one of claims 1 -4, wherein the surface comprises a plurality of hydrophilic moieties of the cationic lipid of the cationic lipid bilayer.

6. The method of any one of claims 1 -5, wherein the core comprises a cationic lipid bilayer.

7. The method of any one of claims 1 -6, wherein the core comprises less than about 0.5 wt% nucleic acid.

8. The method of any one of claims 1 -7, the nanoparticle comprises a zeta potential of about 40 mV to about 60 mV.

9. The method of claim 8, wherein the nanoparticle comprises a zeta potential of about 45 mV to about 55 mV.

10. The method of any one of claims 1 -9, wherein the cationic lipid is DOTAP or DOTMA.11 . The method of any one of claims 1 -10, wherein the nanoparticle does not comprise a neutral lipid.

12. The method of any one of claims 1 -11 , wherein the mRNA comprises modified nucleotides.

13. The method of claim 12, wherein the mRNA comprises 1 -methylpseudouridine.

14. The method of any one of claims 1 -13, wherein the subject suffers from Type 1 diabetes.

15. The method of any one of claims 1 -13, wherein the subject does not suffer from symptoms of Type 1 diabetes.

16. A method of treating or delaying the onset of Type 1 diabetes (T 1 D) in a subject in need thereof, the method comprising administering to the subject a composition comprising a nanoparticle comprising a positively-charged surface and an interior comprising (i) a core and (ii) at least two mRNA layers, wherein each mRNA layer is positioned between a cationic lipid bilayer, and the mRNA encodes a proinsulin peptide.

17. The method of claim 16, wherein the proinsulin peptide is encoded by the nucleic acid sequence of SEQ ID NO: 1 .

18. The method of claim 16 or claim 17, wherein the nanoparticle comprises at least three nucleic acid layers, each of which is positioned between a cationic lipid bilayer.

19. The method of any one of claims 16-18, wherein the outermost layer of the nanoparticle comprises a cationic lipid bilayer.

20. The method of any one of claims 16-19, wherein the surface comprises a plurality of hydrophilic moieties of the cationic lipid of the cationic lipid bilayer.21 . The method of any one of claims 16-20, wherein the core comprises a cationic lipid bilayer.

22. The method of any one of claims 16-21 , wherein the core comprises less than about 0.5 wt% nucleic acid.

23. The method of any one of claims 16-22, the nanoparticle comprises a zeta potential of about 40 mV to about 60 mV.

24. The method of claim 23, wherein the nanoparticle comprises a zeta potential of about 45 mV to about 55 mV.

25. The method of any one of claims 16-24, wherein the cationic lipid is DOTAP or DOTMA.

26. The method of any one of claims 16-25, wherein the nanoparticle does not comprise a neutral lipid.

27. The method of any one of claims 16-26, wherein the mRNA comprises modified nucleotides.

28. The method of claim 27, wherein the mRNA comprises 1 -methylpseudouridine.

Images