Microorganism expressing threonine export protein rhtc, and use thereof for producing l-isoleucine

Abstract

The present disclosure provides: an L-isoleucine-producing microorganism expressing threonine export protein RhtC; a method for producing L-isoleucine, comprising a step of culturing the microorganism; a method for increasing L-isoleucine productivity of the microorganism, comprising a step of introducing a threonine export protein RhtC gene into a cell; and a use thereof for producing L-isoleucine.

Description

Microorganism expressing threonine efflux protein RHTC and its use for L-isoleucine production

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2023-0083501, filed June 28, 2023, the entire contents of which are incorporated herein by reference.

[0003] Numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.

[0004] The present disclosure relates to a microorganism expressing a threonine efflux protein RhtC and its use for producing L-isoleucine, and relates to a microorganism expressing a threonine efflux protein RhtC, a method for producing L-isoleucine using the microorganism, a method for increasing the L-isoleucine production ability of the microorganism, and / or a composition for producing L-isoleucine.

[0005]

[0006] L-isoleucine (Ile, I) is an essential amino acid used in the manufacture of various products, including animal feed, food additives, and pharmaceuticals. Because it plays a role in post-metabolism energy production, hemoglobin production, blood sugar regulation, and muscle building and repair, its use is increasing not only in fluids, nutritional supplements, and sports nutrition, but also in animal feed.

[0007] Based on this trend, various attempts are being made to improve productivity in the production of L-isoleucine using various microorganisms, including microorganisms of the genus Corynebacterium.

[0008] Despite these efforts, the development of technologies to improve the production of L-isoleucine is still required.

[0009]

[0010] [Prior Art Literature]

[0011] (Patent Document 1) US 10113190 B2 (October 30, 2018)

[0012] (Patent Document 2) US 2023-0012923 A1 (January 19, 2023)

[0013] The present disclosure provides an L-isoleucine producing microorganism expressing the threonine efflux protein RhtC.

[0014] The present disclosure provides a composition for producing L-isoleucine comprising at least one selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the same, a vector comprising the polynucleotide, and a microorganism expressing the threonine efflux protein RhtC.

[0015] The present disclosure provides a method for producing L-isoleucine, comprising the step of culturing a microorganism expressing the threonine efflux protein RhtC.

[0016] The present disclosure provides a method for increasing L-isoleucine production ability of a microorganism, comprising the step of introducing a polynucleotide encoding the threonine efflux protein RhtC into the microorganism.

[0017] The present disclosure provides a use for producing L-isoleucine, preparing an L-isoleucine-producing microorganism, and / or increasing the L-isoleucine production ability of a microorganism, wherein at least one selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the same, a vector comprising the polynucleotide, and a microorganism expressing the threonine efflux protein RhtC.

[0018]

[0019] The present disclosure searches for a protein having a function of imparting and / or increasing L-isoleucine production ability to a microorganism, and by introducing the protein into an appropriate host cell, develops a microorganism having L-isoleucine production ability or increased L-isoleucine production ability, thereby providing a microorganism including the protein, its use for producing L-isoleucine, and related technologies.

[0020]

[0021] Definition of Terms

[0022] In the present disclosure, the term “corresponding to” may refer to an amino acid sequence or nucleic acid sequence of a corresponding region identified by aligning the amino acid sequence or nucleic acid sequence of the polypeptide or polynucleotide with a specific amino acid sequence or nucleic acid sequence provided in the present disclosure, in any polypeptide or polynucleotide. Such sequence alignment may be performed using a conventional sequence alignment method, and for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. may be appropriately used.

[0023] In the present disclosure, the phrase “a polynucleotide (which may be used interchangeably with “nucleic acid molecule” or “gene”) or a polypeptide (which may be used interchangeably with “protein”) “has or includes or consists of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0024] In one example, the nucleic acid sequence or amino acid sequence provided in the present disclosure may include a modification by conventional mutagenesis, such as directed evolution and / or site-directed mutagenesis, to the extent that it maintains its original function or desired function.

[0025] In one example, a polynucleotide or polypeptide "comprises or consists of a particular nucleic acid sequence (base sequence) or amino acid sequence" means that the polynucleotide or polypeptide (i) essentially comprises the particular nucleic acid sequence (base sequence) or amino acid sequence, or (ii) consists of or essentially comprises a nucleic acid sequence or amino acid sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the particular nucleic acid sequence (base sequence) or amino acid sequence, and maintains the original function and / or the desired function. It can mean. In one example, the original function may be a threonine excretion function, and the desired function may mean L-isoleucine production ability (e.g., a function of imparting and / or increasing L-isoleucine production ability compared to the parent strain (non-introduced microorganism) when introduced into a host cell (microorganism).

[0026] As used herein, the terms "homology" or "identity" refer to the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0027] In addition, if it is an amino acid sequence that has such homology or identity and exhibits a function corresponding to the threonine efflux protein (the original function and / or the desired function), a protein having an amino acid sequence in which some of the sequences are deleted, modified, substituted or added may also be included within the scope of the protein that is the subject of mutation of the present disclosure.

[0028] As used herein, the term "variant" refers to a protein or a gene encoding the same, which differs from the sequence defined by a given SEQ ID NO by conservative substitution and / or modification of one or more amino acids, but which maintains the functions or properties of the protein. A variant may have a diverse sequence due to one or more (e.g., one, two, three, etc.) amino acid substitutions, deletions, or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. The function of the variant may be maintained to an equivalent degree, increased, or insignificantly reduced compared to the native protein. Additionally, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are removed from the N-terminus and / or C-terminus of the mature protein. The term "variant" may also be expressed as variant, modification, mutated protein / polynucleotide, mutated polypeptide / polynucleotide, etc., and is not limited thereto as long as the term is used in the meaning of mutated.

[0029] For the purposes of this disclosure, the variant may, but is not limited to, one that retains or has increased activity (e.g., original activity and / or desired activity) compared to the wild-type or unmodified protein.

[0030] Variants of the protein in the present disclosure may be generated by conservative substitutions. The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. The variant may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; Among the amino acids having an uncharged side chain, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and aromatic amino acids among the nonpolar amino acids may include phenylalanine, tryptophan, and tyrosine. In addition, the variant may include deletion or addition of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of a protein that is involved in the transfer of the protein co-translationally or post-translationally. Additionally, the polypeptide may be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.

[0031] In the present disclosure, "homology" means the percentage of identity between two polynucleotide or polypeptide moieties. The sequence homology from one moiety to another moiety can be determined by known techniques. For example, homology can be determined by directly aligning sequence information and parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules using readily available computer programs. The computer programs may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), etc. In addition, homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form a stable duplex between homologous regions, then digesting them with a single-strand-specific nuclease and determining the size of the digested fragments.

[0032] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0033] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0034] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0035] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program, such as that disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0036] In the present disclosure, the term “about” described before a numerical value may be used to comprehensively mean a numerical value in a range equal to or similar to the numerical value described later, and in one example, the equal to or similar range may mean a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, ±1%, etc. of the described numerical value, but is not limited thereto.

[0037] In the present disclosure, even when only a numerical value is described, it can be interpreted as being used to comprehensively mean a numerical value in a range equal to or similar to the described numerical value, and in one example, the equal to or similar range can mean a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, ±1%, etc. of the described numerical value, but is not limited thereto.

[0038]

[0039]

[0040] Hereinafter, the present disclosure will be described in more detail.

[0041]

[0042] The present disclosure provides a microorganism expressing a threonine efflux protein RhtC and a technology related to the production of L-isoleucine using the same.

[0043] The present disclosure provides a microorganism expressing the threonine efflux protein RhtC.

[0044] More specifically, a microorganism expressing the threonine efflux protein RhtC,

[0045] (1) Threonine efflux protein RhtC,

[0046] (2) a polynucleotide encoding the above threonine efflux protein RhtC, and

[0047] (3) A vector containing the above polynucleotide

[0048] It may include one or more selected from the group consisting of .

[0049] The polynucleotide of (2) and / or (3) above,

[0050] (a) containing the gene for the threonine efflux protein RhtC, or

[0051] (b) a gene for the threonine efflux protein RhtC and a promoter (e.g., an enhanced promoter) operably linked to the gene;

[0052] It may include:

[0053]

[0054] threonine efflux protein

[0055] The threonine efflux protein may be L-threonine exporter (L-threonine efflux protein) RhtC. The L-threonine efflux protein RhtC is a protein that mediates the export of L-threonine out of cells and is known as an inner membrane protein having five transmembrane domains. As analyzed by experimental topology, the C-terminus of the protein may be present in the cytoplasm. In the present disclosure, the threonine efflux protein may be used as RhtC protein or interchangeably with RhtC. The threonine efflux protein RhtC may be a wild type or a mutant that maintains its original function and / or a desired function. The amino acid sequence of the threonine efflux protein may be obtained from a known database such as NCBI's GenBank.

[0056] The above threonine efflux protein RhtC may be a threonine efflux protein derived from Escherichia coli (E. coli).

[0057] In one specific example, the threonine efflux protein Rhtc may include an amino acid sequence having at least 70% identity with the amino acid sequence of SEQ ID NO: 11 or an amino acid sequence in which the amino acid corresponding to position 62 of SEQ ID NO: 11 is replaced with a different amino acid from the original. More specifically, the threonine efflux protein RhtC may include an amino acid sequence having an identity of 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more (the upper limit may be 100% or less than 100%) to the amino acid sequence of SEQ ID NO: 11 or an amino acid sequence in which the amino acid corresponding to the 62nd position of SEQ ID NO: 11 is replaced with an amino acid different from the original. By replacing the amino acid corresponding to the 62nd position of SEQ ID NO: 11 with an amino acid different from the original, the activity of the threonine efflux protein RhtC may be enhanced. In one example, the amino acid corresponding to position 62 of SEQ ID NO: 11 may be leucine (Leu, L). In one example, the amino acid different from the original may be serine (Ser, S). In one example, an amino acid sequence in which the amino acid corresponding to position 62 of SEQ ID NO: 11 is substituted with serine may be expressed as SEQ ID NO: 13. By substituting the amino acid corresponding to position 62 of SEQ ID NO: 11 (leucine; Leu, L) with serine (Ser, S), the activity of the threonine efflux protein may be enhanced.

[0058] In one example, the threonine efflux protein RhtC comprises a protein comprising an amino acid sequence of the amino acid sequence of the SEQ ID NO: 11 or an amino acid sequence in which an amino acid corresponding to the 62nd position of the SEQ ID NO: 11 is substituted with a different amino acid from the original, and maintains the original function (threonine efflux function) and / or the desired function (L-isoleucine production ability (function of imparting and / or increasing L-isoleucine production ability)), and a protein comprising an amino acid sequence of the amino acid sequence of the SEQ ID NO: 11 or an amino acid sequence in which an amino acid corresponding to the 62nd position of the SEQ ID NO: 11 is substituted with a different amino acid from the original, and has an amino acid sequence of 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more (the upper limit is It can be interpreted as including proteins having homology or identity of 100% or less than 100%.

[0059]

[0060] Polynucleotide encoding threonine efflux protein RhtC

[0061] In the present disclosure, the polynucleotide encoding the threonine efflux protein RhtC may include a gene encoding the threonine efflux protein RhtC described above.

[0062] The above gene may undergo various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in an organism that is to express the protein (codon optimization). In one specific example, the coding gene for the threonine efflux protein RhtC of SEQ ID NO: 11 may include the nucleic acid sequence of SEQ ID NO: 12, and the coding gene for a protein including an amino acid sequence in which the amino acid corresponding to position 62 of SEQ ID NO: 11 is substituted with serine (e.g., SEQ ID NO: 13) may include the nucleic acid sequence of SEQ ID NO: 14, respectively. The nucleic acid sequence may also include a nucleic acid sequence that is mutated within a range that does not change the amino acid sequence it encodes, in consideration of codon degeneracy and / or codon optimization.

[0063] In one example, the polynucleotide encoding the threonine efflux protein RhtC may further include a promoter in addition to the gene encoding the threonine efflux protein RhtC described above.

[0064] The above promoter may be operably linked to the gene. More specifically, the polynucleotide encoding the threonine efflux protein RhtC may comprise, in the 5' to 3' direction, a promoter and a gene encoding the threonine efflux protein RhtC.

[0065] As used herein, the term "operably linked" may mean that the promoter is functionally linked to the gene so that the promoter can perform transcriptional regulation of the gene. The operable linkage may be performed using genetic recombination techniques known in the art, including, but not limited to, conventional site-specific DNA cleavage and ligation.

[0066] The above promoter may be a strong promoter that enhances the expression (transcription) of an operably linked gene. In one specific example, the promoter may comprise the nucleic acid sequence of SEQ ID NO: 15. In another example, the promoter may be selected from known strong promoters, and may be at least one selected from the group consisting of, for example, cj1 to cj7 promoters (Korean Patent No. 10-0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL1 promoter, SPL7 promoter, SPL13(sm3) promoter (Korean Patent No. 10-1783170), O2 promoter (Korean Patent No. 10-1632642), tkt promoter, yccA promoter, PlysC promoter (e.g., PlysCP1 promoter (US 8426577 B2)), etc., but is not limited thereto. It is not.

[0067]

[0068] A vector comprising the above polynucleotide

[0069] In the present disclosure, a vector comprising the polynucleotide may refer to a DNA construct comprising the gene described above, or a gene and a promoter, and capable of replication / expression (transcription) in a host cell. The vector may be expressed as a recombinant vector or an expression vector.

[0070] The above vector is not particularly limited as long as it is capable of replication / transcription within a host cell, and may be selected from among all commonly used vectors. In one example, the vector may exist in the form of a plasmid within a host cell, or may be in the form of a vector capable of insertion into the genome (chromosome) of the host cell, but is not limited thereto.

[0071] The above vector may refer to a DNA construct comprising the polynucleotide operably linked to a suitable regulatory sequence so as to enable expression of the target protein (threonine efflux protein RhtC) in a suitable host cell. The regulatory sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the genome (chromosome) of the host cell, or may be integrated into the genome of the host cell.

[0072] Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, phage vectors or cosmid vectors such as pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used, or plasmid vectors such as pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used, but are not limited thereto. In other examples, as the vector, pDC24, pDCM2, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used, but are not limited thereto.

[0073] Vectors usable herein may be known expression vectors and / or vectors for insertion of polynucleotides into a host cell chromosome. Insertion of the polynucleotide into the host cell chromosome may be accomplished by any method known in the art, such as, but not limited to, homologous recombination or the CRISPR system.

[0074] The vector may further comprise a selection marker for determining whether the host cell has been transformed (e.g., whether the polynucleotide has been introduced into the host cell (e.g., inserted into the chromosome)). The selection marker is used to select cells transformed with the vector, i.e., to determine whether the polynucleotide has been introduced into the cell or inserted into the chromosome, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, resistance to cytotoxic agents, or expression of surface proteins. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0075]

[0076] Strengthening of polypeptides

[0077] In one example, the threonine efflux protein RhtC of the present disclosure may be enhanced.

[0078] As used herein, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of a particular polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0079] The above enhancement can be achieved by introducing an exogenous polypeptide, or by increasing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity of the polypeptide, the expression level, or the amount of a product resulting from the activity of the polypeptide.

[0080] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0081] Specifically, the enhancement of the polypeptide of the present disclosure is

[0082] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0083] 2) Replacing the gene expression control region on the chromosome that codes for a polypeptide with a highly active sequence;

[0084] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0085] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0086] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0087] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0088] 7) Codon optimization of polynucleotides encoding polypeptides;

[0089] 8) Selecting and modifying or chemically modifying the exposed portion by analyzing the tertiary structure of the polypeptide; 9) Controlling the cellular localization of the protein (polypeptide); or

[0090] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0091] More specifically,

[0092] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto.

[0093] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0094] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0095] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.

[0096] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0097] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0098] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0099] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.

[0100] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0101] In one specific example, the threonine efflux protein RhtC of the present disclosure may be enhanced by replacing the promoter of the gene encoding the protein with an enhanced promoter. The above-mentioned strengthening promoter may be, but is not limited to, a CJ1 to CJ7 promoter (US Patent No. US 7662943 B2), a lac promoter, a trp promoter, a trc promoter, a tac promoter, a lambda phage PR promoter, a PL promoter, a tet promoter, a gapA promoter, a SPL7 promoter, a SPL13 (sm3) promoter (US Patent No. US 10584338 B2), an O2 promoter (US Patent No. US 10273491 B2), a tkt promoter, a yccA promoter, a PlysC promoter (e.g., a PlysCP1 promoter (US 8426577 B2)).

[0102]

[0103] Microorganisms expressing threonine efflux proteins

[0104] As described above, the present disclosure provides a microorganism expressing the threonine efflux protein RhtC.

[0105] In the present disclosure, “microorganism expressing threonine efflux protein RhtC” may mean a case where a microorganism that did not express threonine efflux protein RhtC begins to express the threonine efflux protein RhtC and / or a case where a microorganism that expresses threonine efflux protein RhtC begins to overexpress the threonine efflux protein RhtC.

[0106] The above microorganism is characterized by having an L-isoleucine production ability or an increased L-isoleucine production ability compared to a homologous microorganism or wild type that does not express the threonine efflux protein RhtC.

[0107] In one example, the microorganism expressing the threonine efflux protein RhtC is

[0108] (1) Threonine efflux protein RhtC,

[0109] (2) a polynucleotide encoding the above threonine efflux protein RhtC, and

[0110] (3) A vector containing the above polynucleotide

[0111] It may include one or more selected from the group consisting of .

[0112] In other words, the threonine efflux protein RhtC expressing microorganism may be a recombinant microorganism that has introduced (transformed) a polynucleotide encoding the threonine efflux protein RhtC and / or a vector containing the polynucleotide into a host cell (also expressed as a microorganism or parent strain).

[0113] When the microorganism as the host cell (wild type or microorganism into which the polynucleotide and / or vector encoding the threonine efflux protein RhtC has not been introduced) has the ability to produce L-isoleucine, the recombinant microorganism may have increased L-isoleucine production ability compared to the wild type and / or the host cell into which the polynucleotide and / or vector has not been introduced. When the microorganism as the host cell (wild type or microorganism into which the polynucleotide and / or vector encoding the threonine efflux protein RhtC has not been introduced) has no ability to produce L-isoleucine, the recombinant microorganism may have been endowed with the ability to produce L-isoleucine.

[0114] In one example, an L-isoleucine-producing microorganism comprising at least one selected from the group consisting of a threonine efflux protein RhtC of the present disclosure, a polynucleotide encoding the threonine efflux protein RhtC, and a vector comprising the polynucleotide may have increased productivity of L-isoleucine compared to a microorganism that does not comprise at least one selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the threonine efflux protein, and a vector comprising the polynucleotide. The microorganism that does not comprise at least one selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the threonine efflux protein, and a vector comprising the polynucleotide may be a homologous microorganism or a wild-type microorganism that does not express threonine efflux protein RhtC.

[0115] In the present disclosure, the term "microorganism" encompasses unicellular bacteria and may be used interchangeably with "cell." In the present disclosure, a microorganism prior to being mutated (transformed) to express the threonine efflux protein RhtC may be referred to as a "parent microorganism (parent strain) or host cell" to distinguish it from the mutated microorganism (recombinant microorganism).

[0116] In one example, the microorganism, for example, the microorganism as a host cell, may be (1) a microorganism that naturally has L-isoleucine production ability, (2) a microorganism that naturally has no or significantly low L-isoleucine production ability, and / or (3) a microorganism that has a mutation introduced (transformed) into the microorganism that naturally has L-isoleucine production ability or the microorganism that has no or significantly low L-isoleucine production ability to have L-isoleucine production ability or a microorganism that has improved L-isoleucine production ability. In one specific example, the microorganism as a host cell may be, but is not limited to, Corynebacterium glutamicum KCCM12739P (CA10-3101, US 2023-0098971 A1) or Corynebacterium glutamicum KCCM11248P (Korean Patent No. 10-1335789).

[0117] In one specific example, the microorganism may be a microorganism of the genus Corynebacterium. The microorganism of the genus Corynebacterium may include, but is not necessarily limited to, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, and the like. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0118] In one specific example, the microorganism may be, but is not limited to, a microorganism whose biosynthetic pathway of L-isoleucine is further enhanced to increase the production of L-isoleucine.

[0119] In one specific example, the microorganism may be a microorganism in which feedback inhibition of L-threonine dehydratase is released.

[0120] In the present disclosure, the term “threonine dehydratase (EC 4.3.1.19)” refers to an enzyme that produces 2-ketobutyrate from threonine, which is encoded by the ilvA gene and is known to be subject to feedback inhibition by L-isoleucine. Microorganisms of the genus Corynebacterium synthesize L-isoleucine through three intermediate metabolites using pyruvate and 2-ketobutyrate as precursors. The amino acid sequence of the threonine dehydratase can be obtained from the known database, NCBI’s GenBank or US 2023-0098971 A1 and US 10982244 B2.

[0121] In one specific example, the microorganism may be one in which feedback inhibition of homoserine dehydrogenase is released.

[0122] As used herein, the term "homoserine dehydrogenase (EC: 1.1.1.3)" refers to an enzyme encoded by the hom gene that catalyzes the synthesis of homoserine. Homoserine dehydrogenase is known to be subject to feedback inhibition by isoleucine. The amino acid sequence of the homoserine dehydrogenase can be obtained from the known databases, such as NCBI's GenBank or US 10982244 B2.

[0123] In one specific example, the microorganism may be one in which feedback inhibition of aspartate kinase is released. The term “aspartate kinase (EC: 2.7.2.4)” in the present disclosure is encoded by the lysC gene, and the amino acid sequence of the aspartate kinase can be obtained from a known database such as NCBI’s GenBank or US 10662450 B2.

[0124] As used herein, the term "release of feedback inhibition" may mean that the activity of a polypeptide, protein or enzyme is increased or enhanced compared to its intrinsic activity, or that the activity is not inhibited compared to its intrinsic activity. In one specific example, the microorganism may be a microorganism that has additionally introduced a genetic mutation (R407H) into the hom gene (US 10982244 B2), additionally introduced a genetic mutation (T381A, F383A and / or V323A) into the ilvA gene (US 2023-0098971 A1, US 10982244 B2), and / or additionally introduced a genetic mutation (L377K) into the lysC gene encoding aspartate kinase (US Registered Publication No. US 10662450 B2).

[0125]

[0126] The introduction of the polynucleotide or vector can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to introducing a polynucleotide encoding a target protein (threonine efflux protein RhtC) or a vector containing the same into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide can include both an integrated location within the chromosome of the host cell or an extrachromosomal location, as long as it can be expressed within the host cell. In addition, the polynucleotide can include DNA and / or RNA encoding the target protein. There is no limitation on the form in which the polynucleotide is introduced, as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the elements necessary for its own expression. The above expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal that are operably linked to the polynucleotide. The promoter is as described above. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as described above may mean that an expression control element (e.g., a promoter) and a polynucleotide are functionally linked so that the expression control element can perform transcriptional control (e.g., transcription initiation) of a polynucleotide encoding a target protein (threonine efflux protein RhtC).Operable linking can be accomplished using genetic recombination techniques known in the art, including, but not limited to, conventional site-specific DNA cleavage and ligation.

[0127] The method for transforming the above polynucleotide into a host cell can be performed by any method for introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, electeopulse, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation (polyethylene glycol-mediated uptake), DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0128] The introduction (insertion) of the above polynucleotide into the host cell genome (chromosome) can be performed by a person skilled in the art by appropriately selecting a known method. For example, it can be performed by conventional homologous recombination, or by using an RNA-guided endonuclease system (RNA-guided endonuclease system or CRISPR system; for example, a mixture (e.g., a mixture of an RNA-guided endonuclease protein and a guide RNA, etc.) including (a) an RNA-guided endonuclease (e.g., Cas9 protein, etc.), an encoding gene thereof, or a vector including the gene; and (b) a guide RNA (e.g., a single guide RNA (sgRNA), etc.), an encoding DNA thereof, or a vector including the DNA, a complex (e.g., a ribonucleic acid fusion protein (RNP), a recombinant vector (e.g., a vector including an RNA-guided endonuclease encoding gene and a guide RNA encoding DNA together, etc.), but is not limited thereto).

[0129] As used herein, the term "vector" refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein operably linked to suitable regulatory sequences so as to enable expression of the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the host cell's genome (chromosome) or may be integrated into the host cell's genome.

[0130]

[0131] L-isoleucine production applications

[0132] As described above, the microorganism expressing the threonine efflux protein RhtC provided in the present disclosure has L-isoleucine production ability, or is characterized by increased L-isoleucine production ability compared to a homologous microorganism or wild type that does not express the threonine efflux protein RhtC.

[0133] The above L-isoleucine productivity may encompass not only the L-isoleucine production function but also the excretion / secretion function of L-isoleucine. The above L-isoleucine productivity can be confirmed by the isoleucine concentration in the medium, the sugar consumption function, etc., but is not limited thereto.

[0134] In one example, the L-isoleucine production ability of the microorganism expressing the threonine efflux protein RhtC is about 30% or more (i.e., about 1.3 times or more), about 40% or more (i.e., about 1.4 times or more), about 50% or more (i.e., about 1.5 times or more), about 60% or more (i.e., about 1.6 times or more), about 70% or more (i.e., about 1.7 times or more), about 80% or more (i.e., about 1.8 times or more), about 90% or more (i.e., about 1.9 times or more), about 100% or more (i.e., about 2 times or more), about An increase of, but not limited to, 110% or more (i.e., about 2.1 times or more), about 120% or more (i.e., about 2.2 times or more), or about 130% or more (i.e., about 2.3 times or more) (the upper limit is not particularly limited, and may be, but is not limited to, about 300%, about 200%, or about 150%).

[0135] Accordingly, one example of the present disclosure provides a composition for producing L-isoleucine comprising at least one selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the same, a vector comprising the polynucleotide, and a microorganism expressing the threonine efflux protein RhtC.

[0136] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing amino acids, including, but not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers, or isotonic agents.

[0137] In the composition of the present disclosure, the variant, polynucleotide, vector, strain, medium, and L-amino acid, etc. are as described in the other aspects above.

[0138] Another example provides a method for producing L-isoleucine, comprising the step of culturing a microorganism expressing the threonine efflux protein RhtC.

[0139] Another example provides a method for producing an L-isoleucine-producing microorganism, and / or a method for imparting and / or increasing L-isoleucine production ability to a microorganism, comprising a step of introducing a polynucleotide encoding the threonine efflux protein RhtC or a vector containing the polynucleotide into a host cell (microorganism) and transforming the microorganism.

[0140] Another example provides a use for producing L-isoleucine, and / or preparing an L-isoleucine-producing microorganism, and / or imparting and / or increasing the L-isoleucine production ability of a microorganism, selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the same, a vector comprising the polynucleotide, and a microorganism expressing the threonine efflux protein RhtC.

[0141] The threonine efflux protein RhtC, the polynucleotide encoding the same, the vector containing the polynucleotide, the microorganism expressing the threonine efflux protein RhtC, the host cell, the transformation, etc. are as described above.

[0142] In a method for producing L-isoleucine, comprising a step of culturing a microorganism expressing the threonine efflux protein RhtC, the culturing may be performed in a medium suitable for culturing the microorganism (e.g., growth of the microorganism and / or production of L-isoleucine). The medium is well known to those skilled in the art to which the present disclosure pertains. The method may further comprise, after the culturing step, a step of recovering L-isoleucine from the cultured microorganism, the medium, or both.

[0143] In the above method, the step of culturing the microorganism is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. At this time, the culture conditions are not particularly limited thereto, but may be adjusted to an appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, most specifically pH 7.2) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid, sulfuric acid, phosphate, sulfate, etc.), and an aerobic condition may be maintained by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45°C, or 25 to 40°C, and the culture may be performed for about 10 to 160 hours, but is not limited thereto. The L-isoleucine produced by the culture may be secreted into the medium or may remain within the cells.

[0144] The medium usable for the above culture may be selected from the group consisting of sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid) as a carbon source, and may be used individually or in combination of two or more, but is not limited thereto. The medium may be selected from the group consisting of nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea), inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), and may be used individually or in combination of two or more, but is not limited thereto. As a phosphorus source, one or more selected from the group consisting of potassium phosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts may be used individually or in combination of two or more, but is not limited thereto. In addition, the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate, iron sulfate, manganese sulfate, etc.), amino acids, and / or vitamins.

[0145] The step of recovering the L-isoleucine may be to collect the desired amino acid from a medium, culture solution, or microorganism using a suitable method known in the art, depending on the culturing method. For example, the step of recovering the L-isoleucine may be performed by one or more methods selected from centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. The method of recovering the L-isoleucine may additionally include a purification step before, simultaneously with, or after the step.

[0146] Other examples provide compositions, methods, products, processes, or uses featuring one or more of the elements disclosed herein.

[0147]

[0148] The microorganism expressing the threonine efflux protein RhtC provided in the present disclosure has enhanced L-isoleucine production capacity compared to microorganisms that do not express the threonine efflux protein RhtC, and thus can be effectively used to produce L-isoleucine. Therefore, a wide range of industrial applications utilizing the L-isoleucine produced by the microorganism are expected, including in food, feed, and pharmaceuticals.

[0149]

[0150] The present invention will be described in more detail below through examples. However, these are merely illustrative and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that modifications to the examples described below may be made without departing from the essential spirit of the invention.

[0151]

[0152] Example 1. Construction of a recombinant vector for introducing the threonine efflux protein RhtC.

[0153] Example 1-1: Construction of plasmids for gene insertion

[0154] To insert the rhtC gene encoding the threonine export protein RhtC, NCgl2533 of the host cell (Corynebacterium glutamicum ATCC13032) genome was used as the insertion site. To replace the NCgl2533 gene with a foreign rhtC, NCgl2533 deletion and target gene insertion vectors were constructed. To construct the vectors, PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 as a template and primer pairs of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively. The primer sequences used to perform each of the above PCRs are as shown in Table 1 below.

[0155] Sequence number name Sequence 1Primer 1TGAATTCGAGCTCGGTACCC TCATATTGAATTTCGCCCCA 2Primer 2CCTAAGCAGGTTGATTTagt actCCGCTGGAAAACATTTT 3Primer 3AAAATGTTTTCCAGCGGagt actAAATCAACCTGCTTAGG 4Primer 4GTCGACTCTAGAGGATCCCC TCCCACCAAATCTGCGCCCA

[0156] PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and denaturation, annealing, and polymerization under these conditions were repeated 28 times. As a result, DNA fragments of 1020 bp and 1043 bp, respectively, were obtained. The obtained DNA products were purified using a PCR purification kit (PCR Purification kit, QUIAGEN), and the purified amplified products were treated with the restriction enzyme smaI and then heat-treated at 65°C for 20 minutes. The pDC24 vector (SEQ ID NO: 16) and the Infusion Cloning Kit (TaKaRa) were cloned according to the provided manual to construct the vector pDC24△N2533 for NCgl1756 deletion and target gene insertion.

[0157]

[0158] Example 1-2: Construction of plasmids for promoter replacement and mutation introduction

[0159] To enhance the activity of rhtC, the coding gene (SEQ ID NO: 12) of rhtC (wild type; SEQ ID NO: 11) of E. coli W3110 (ATCC 27325) and the coding gene (SEQ ID NO: 14) of rhtC (L62S; SEQ ID NO: 13), a mutant based on it, were introduced (US 20230012923 A1). Using the PlysCP1 promoter (US 8426577 B2), which has a partially modified sequence based on PlysC, the promoters of the rhtC (wild type) and rhtC (L62S) genes were replaced with PlysCP1 (SEQ ID NO: 15), thereby constructing a plasmid that enhances rhtC activity.

[0160] The protein and DNA sequences used above are as shown in Table 2 below:

[0161]

[0162] Specifically, to construct strains having rhtC (wild type) and rhtC (L62S) introduced with the PlysCP1 promoter, a PlysCP1 promoter fragment (WO2009 / 096689) was obtained using pDZ_lysCP1 as a template and SEQ ID NO: 5 and SEQ ID NO: 6. PCR was performed using the chromosome of E. coli W3110 as a template and primers of SEQ ID NO: 7 and SEQ ID NO: 10, and a rhtC (wild type) fragment was obtained. In addition, PCR was performed using the chromosome of E. coli W3110 as a template and primers of SEQ ID NO: 7 and SEQ ID NO: 8 and SEQ ID NO: 9 and SEQ ID NO: 10, and a rhtC (L62S) fragment in which the 62nd amino acid was substituted from leucine to serine was obtained. The primer sequences used to perform each of the PCRs are as shown in Table 3 below.

[0163] SEQ ID NO NAME Sequence 5Primer5AAAATGTTTCCAGCGGAGTATTCAGGGTAGTTGACTAAA6Primer6AATAACATCAACATCTTTGTGCACCTTTCGATCT7Primer7AGATCGAAAGGTGCACAAAGATGTTGATGT TATTTCTCAC8Primer8ATTTTTTCGATAATCGAATGCAGGCCAAGC9Primer9GCTTGGCCTGCATTCGATTATCGAAAAAAT10Primer10CCTAAGCAGGTTGATTTAGTTCACCGCGAAAATAATCAAAT

[0164] PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; 30 cycles of denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization reactions were repeated 28 times. As a result, a 243 bp DNA fragment from the PlysCP1 promoter region, a 661 bp DNA fragment from the rhtC region, and 220 bp and 471 bp DNA fragments from the rhtC (L62S) region were obtained, respectively. The amplified products were purified using a PCR purification kit (PCR Purification kit, QUIAGEN) and used as insert DNA fragments for vector construction. The purified amplification product was treated with the restriction enzyme ScaI, and then heat-treated at 65°C for 20 minutes. The molar concentration (M) ratio of the pDC24△N2533 vector and the amplification product, the inserted DNA fragment, was set to 1:2. The vectors pDC24△N2533::PlysCP1_rhtC(Ec) and pDC24△N2533::PlysCP1_rhtC(Ec, L62S) were constructed to introduce rhtC (wild type) and rhtC(L62S) mutants onto the chromosome by cloning according to the provided manual using an Infusion Cloning Kit (TaKaRa).

[0165]

[0166] Example 2: Production and evaluation of a strain introducing rhtC into a Corynebacterium glutamicum L-isoleucine-producing strain (1)

[0167] The vector constructed in Example 1.2 was transformed into Corynebacterium glutamicum KCCM12739P (CA10-3101, Republic of Korea Patent No. 10-2363913), an isoleucine-producing strain, by electroporation to construct strains in which foreign rhtC (wild type) and rhtC (L62S) were introduced into the genome through homologous recombination. The strains constructed in this way were named CA10-3136 (rhtC (wild type) introduced) and CA10-3135 (rhtC (L62S) introduced), respectively.

[0168] To confirm the effect of increasing isoleucine productivity of the above strains, they were cultured using the following method. The parent strain and the mutant strain were inoculated into a 250 mL corner-bubble flask containing 25 mL of isoleucine production medium, and then cultured with shaking at 200 rpm for 60 hours at 32°C to produce L-isoleucine. The composition of the medium used in this example is as follows.

[0169]

[0170] <Production medium>

[0171] (pH 7.2) Glucose 10% (w / v), yeast extract 0.2% (w / v), ammonium sulfate 1.6% (w / v), monobasic potassium phosphate 0.1% (w / v), magnesium sulfate heptahydrate 0.1% (w / v), iron sulfate heptahydrate 10 mg / L, manganese sulfate monohydrate 10 mg / L, biotin 200 μg / L

[0172]

[0173] After the culture was completed, the amount of L-isoleucine produced (isoleucine content in the medium) was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 4 below.

[0174] Isoleucine concentration (g / L) Yield improvement compared to parent strain (△, %p) CA10-3101 (parent strain) 2.1 - CA10-3136 [CA10-3101△N2533::PlysCP1_rhtC(Ec)] 3.7 1.6, 76% CA10-3135 [CA10-3101△N2533::PlysCP1_rhtC(Ec, L62S)] 4.5 2.4, 114%

[0175] As a result, as shown in Table 4 above, it was confirmed that the parent strain, Corynebacterium glutamicum CA10-3101, produced approximately 2.1 g / L of isoleucine. In the strain CA10-3136 into which rhtC was introduced, approximately 3.7 g / L of isoleucine was produced, showing an approximately 80% increase in productivity compared to the parent strain, and in the strain CA10-3135 into which rhtC (L62S) was introduced, the sugar consumption rate increased and approximately 4.5 g / L of isoleucine was produced, showing an approximately 114% increase in productivity compared to the parent strain.

[0176]

[0177] Example 3: Production and evaluation of rhtC-introduced strain in Corynebacterium glutamicum L-isoleucine-producing strain (2)

[0178] The vector constructed in Example 1.2 was introduced into the L-isoleucine producing strain KCJI-38 (KCCM11248P, Republic of Korea Patent No. 10-1335789) treated with NTG (N-Methyl-N'-nitro-N-nitrosoguanidine) by electric pulse method, and then transformed by spreading on a selection medium containing 25 mg / L of kanamycin to obtain mutants having rhtC or rhtC (L62S) introduced into the chromosome. The strains constructed in this way were named CA10-3137 and CA10-3138. Thereafter, the L-isoleucine concentration in the culture medium was measured in the same manner as in Example 2, and the results are shown in Table 5 below.

[0179] Isoleucine concentration (g / L) Yield improvement compared to parent strain (△, %p) KCCM11248P (parent strain) 1.0 CA10-3137 [KCCM11248P△N2533::PlysCP1_rhtC(Ec)] 1.8 0.8, 80% CA10-3138 [KCCM11248P△N2533::PlysCP1_rhtC(Ec, L62S)] 2.4 1.4, 140%

[0180] As a result, as shown in Table 5 above, it was confirmed that the parent strain, Corynebacterium glutamicum KCCM11248P, produced approximately 1.0 g / L of isoleucine. It was confirmed that the strain CA10-3137, into which rhtC was introduced, produced approximately 1.8 g / L of isoleucine with an increased sugar consumption rate, showing an approximately 80% increase in productivity compared to the parent strain, and the strain CA10-3138, into which rhtC (L62S) was introduced, showed an approximately 140% increase in productivity compared to the parent strain, showing an increased sugar consumption rate and produced approximately 2.4 g / L of isoleucine.

[0181]

[0182] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. L-isoleucine-producing microorganism expressing the threonine efflux protein RhtC.

2. An L-isoleucine producing microorganism according to claim 1, wherein the microorganism comprises at least one selected from the group consisting of a threonine efflux protein RhtC, a polynucleotide encoding the threonine efflux protein RhtC, and a vector comprising the polynucleotide.

3. In the first paragraph, the threonine efflux protein RhtC is a microorganism comprising an amino acid sequence having at least 70% identity with the amino acid sequence of SEQ ID NO: 11 or an amino acid sequence in which the amino acid corresponding to position 62 of SEQ ID NO: 11 is replaced with a different amino acid from the original.

4. A microorganism in the third paragraph, wherein the amino acid different from the original is serine.

5. A microorganism in the first paragraph, wherein the threonine efflux protein RhtC is enhanced.

6. In the first paragraph, the microorganism is a microorganism of the genus Corynebacterium.

7. In the 6th paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

8. In the first paragraph, the microorganism has an increased ability to produce L-isoleucine compared to a microorganism that does not include at least one selected from the group consisting of the threonine efflux protein RhtC, a polynucleotide encoding the threonine efflux protein RhtC, and a vector comprising the polynucleotide.

9. In the first paragraph, the microorganism is a microorganism in which feedback inhibition of L-threonine dehydratase is released.

10. In the first paragraph, the microorganism is a microorganism in which feedback inhibition of homoserine dehydrogenase is released.

11. A method for producing L-isoleucine, comprising a step of culturing a microorganism of any one of claims 1 to 10 in a medium.

12. A method for producing L-isoleucine, further comprising a step of recovering L-isoleucine from the cultured microorganism, medium, or both of the above-described items.

13. A method for increasing L-isoleucine production capacity of a microorganism, comprising a step of transforming a host cell by introducing a polynucleotide encoding a threonine efflux protein RhtC or a vector containing the polynucleotide.

14. Use of a microorganism according to any one of claims 1 to 10 for producing L-isoleucine.

15. A composition, method, product, process, or use characterized by one or more elements disclosed herein.