Sacas9 sgrna targeting TTR and modification mode thereof

Abstract

The present invention provides an saCas9 sgRNA targeting TTR and a modification mode thereof. The modified saCas9 sgRNA comprises a guide RNA having a length of 20 to 22 nucleotides and an sgRNA scaffold having a length of 77 nucleotides, and the nucleotide sequence of the saCas9 sgRNA comprises at least one chemical modification; and the saCas9 sgRNA targeting TTR comprises a guide RNA at the 5' end, and the sequence of the guide RNA is at least 20, at least 21, or all 22 consecutive nucleotides of a nucleotide sequence as shown in any one of SEQ ID NOs: 1-9. The saCas9 sgRNA provided by the present invention can significantly improve the editing activity and reduce the off-target effects.

Description

A saCas9 sgRNA targeting TTR and its modification method

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202310828316.9 filed on July 6, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of gene editing, and more specifically, relates to various saCas9 nuclease-specific sgRNA chemical modification methods and targeting TTR gene sequences. Background Art

[0004] The CRISPR / Cas9 (Clustered regularly interspaced short palindromic repeats / CRISPR-associated protein 9) nuclease has enabled effective gene editing across diverse species, cell types, and animals. By recognizing specific PAM sequences and artificially designed guide RNAs (sgRNAs), Cas9 specifically binds to different locations in the genome, creating double-strand breaks (DSBs) in the DNA. By activating endogenous DNA repair mechanisms, insertions and deletions are created at these gaps, achieving gene knockout or knockin.

[0005] Long-term expression of Cas9 in cells can significantly increase its off-target efficiency, and transient expression in the form of RNA can significantly reduce off-target and improve safety.

[0006] Compared to the widely used SpCas9, SaCas9 is smaller in size but has comparable cleavage activity. Furthermore, the development of the SaCas9KKH variant has expanded the SaCas9 PAM recognition sequence from "NNGRRT" to "NNNRRT," increasing SaCas9's application flexibility. However, the intracellular cleavage activity of SaCas9 and its sgRNA via transient delivery via modified RNA has not been studied.

[0007] Cationic lipid nanoparticles are used to deliver Cas9 mRNA and chemically modified sgRNA into cells, animals, and humans, enabling effective gene knockout and achieving the goal of gene therapy. Heavily modified sgRNAs are also more stable and have higher knockout efficiency than sgRNAs modified only at the head and tail. However, some positions are not suitable for excessive modification, as this will affect enzyme activity and ultimately cutting efficiency. Therefore, heavy modification of sgRNA based on structural analysis is the best strategy, but the existing crystal structure of SaCas9 is partially missing, and structurally based sgRNA modification strategies remain to be studied.

[0008] Familial amyloidosis (ATTR) is caused by mutations in the gene TTR that encodes the thyroxine transporter protein. TTR is mainly synthesized in the liver, with a small amount produced in the choroid plexus and retina, and is responsible for transporting retinol and thyroxine throughout the body. TTR usually circulates in the blood as a soluble tetrameric protein. TTR mutations lead to misfolding and deposition, causing amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), etc. It is estimated that approximately 50,000 patients worldwide may be affected by FAP and FAC. A series of treatments for ATTR have been studied, but there are no approved drugs that can stop disease progression and improve quality of life.

[0009] Summary of the Invention

[0010] The purpose of the present invention is to provide a sgRNA suitable for saCas9 nuclease that can significantly improve editing activity and reduce off-target efficiency.

[0011] In a first aspect, the present invention provides a modified saCas9 sgRNA comprising a guide RNA of 20 to 22 nucleotides in length and an sgRNA backbone of 77 nucleotides in length, wherein the nucleotide sequence of the sgRNA comprises at least one chemical modification.

[0012] As used herein, the term "saCas9" refers to Staphylococcus aureus Cas9.

[0013] As used herein, the term "sgRNA" is a single-stranded guide RNA molecule comprising a guide RNA sequence complementary to the target DNA and an sgRNA backbone.

[0014] As used herein, the term "saCas9 sgRNA" (hereinafter also referred to as "sgRNA") refers to an sgRNA suitable for use in combination with the saCas9 nuclease.

[0015] As used herein, the term "guide RNA" refers to an RNA fragment that is complementary to the target DNA and is located at the 5' end of the saCas9 sgRNA.

[0016] As used herein, the term "sgRNA backbone" is a chimera of the repeat sequence of CRISPR RNA (crRNA) and the trans-activating crRNA (tracrRNA) in the CRISPR targeting recognition system, wherein the crRNA contains a guide RNA in addition to the repeat sequence and can target different target DNAs, while the tracrRNA is a fixed sequence in the sgRNA, contains a stem-loop structure, and can bind to the Cas9 protein.

[0017] More specifically, the sgRNA backbone in this article comprises a repeat sequence / inverted repeat sequence region, a stem loop 1 region, a linker region, a stem loop 2 region and a 3' terminal region in the 5' to 3' direction, wherein the repeat sequence / inverted repeat sequence region includes a 14nt repeat sequence (repeat), a 4nt tetraloop (tetraloop) and a 16nt inverted repeat sequence (anti-repeat), which are respectively located at the 1-14nt position, 15-18nt position and 19-34nt position of the 5' end of the sgRNA backbone. The repeat sequence and the inverted repeat sequence are complementary to each other to form a stem loop, which binds to Cas9; the stem loop 1 region (stem loop 1) is 14nt in total and is located at the 35-48nt position of the 5' end of the sgRNA backbone; the stem loop 2 region (stem loop 2) is 24nt in total and is located at the 54-77nt position of the 5' end of the sgRNA backbone; the 5nt linker region (linker) connecting the stem loop 1 and the stem loop 2 is located at the 49-53nt position of the 5' end of the sgRNA backbone. Furthermore, the 3' end of the saCas9 sgRNA of the present invention is a variable sequence. More specifically, the saCas9 sgRNA may optionally include a nucleotide sequence UUUU at the 3' end.

[0018] According to the above description of the structural composition of the saCas9 sgRNA of the present invention, the length of the saCas9 sgRNA of the present invention can be between 97 and 103 nt (e.g., 97 nt, 98 nt, 99 nt, 100 nt, 101 nt, 102 nt, or 103 nt), depending on the different lengths of the guide RNA (which can be 20-22 nt) and whether the nucleotide sequence UUUU is included at the 3' end.

[0019] In one embodiment of the present invention, the at least one chemical modification may be selected from at least one of 2'-O-methyl modification, 2'-F modification, 2'-MOE modification and modification of phosphorothioate bond.

[0020] As used herein, the term "chemical modification" refers to the substitution of a certain atom or group on a nucleotide molecule by another atom or group.

[0021] As used herein, the term "2'-O-methyl modification" refers to the replacement of the hydroxyl group at the carbon 2 position of the pentose sugar in a nucleotide molecule with an -O-methyl group (also known as "methoxy," "-OMe," etc.). Furthermore, herein, the terms "mA," "mC," "mU," and "mG" are used to represent 2'-O-methyl modified nucleotides.

[0022] As used herein, the term "2'-F" refers to a nucleotide in which the hydroxyl group at the carbon 2 position of the pentose sugar is replaced by F (or "fluorine," "fluorine atom," etc.). Furthermore, herein, the terms "fA," "fC," "fU," and "fG" are used to represent 2'-F modified nucleotides.

[0023] As used herein, the term "2'-MOE" refers to a nucleotide in which the hydroxyl group at the carbon 2 position of the pentose sugar is replaced by a MOE group (also known as "methoxyethyl," "-(CH2)2OCH3," etc.). Furthermore, herein, the terms "moeA," "moeC," "moeU," and "moeG" are used to represent 2'-O-MOE-modified nucleotides.

[0024] As used herein, the term "modification of phosphorothioate bonds (or referred to as PS modification)" refers to the replacement of "P=O" in the phosphodiester bonds connecting nucleotide molecules by "P=S". Further, herein, the terms "A*", "C*", "U*", "G*" are used to indicate nucleotides whose 3' ends are modified by phosphorothioate bonds. When the hydroxyl group on the carbon 2 position of the pentose in the nucleotide molecule and the phosphodiester bond at the 3' end are modified at the same time, a combination of the two labels is used to represent the nucleotide, such as "mA*", "mC*", "mU*", "mG*", "fA*", "fC*", "fU*", "fG*", etc.

[0025] In one embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on at least 1, at least 2, at least 3 or at least 4 nucleotides of the 7 nucleotides at the 5' end and / or the 3' end of the saCas9 sgRNA. For example, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on 1, 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 5' end of the saCas9 sgRNA, and / or on 1, 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 3' end of the saCas9 sgRNA, wherein the number and position of modifications at the two ends are not affected by each other. In a preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on at least 3 or at least 4 nucleotides of the 5' end and / or the 3' end of the saCas9 sgRNA.

[0026] In one embodiment of the present invention, the 2'-O-methyl modification, the 2'-F modification or the 2'-MOE modification may be present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions -14 to -9, -3, -1, 1, 3 to 9, 11 to 27, 29 to 33, 36 to 39, 41, 42, 44 to 47, 49 to 77 of the saCas9 sgRNA.

[0027] According to the present invention, the numbering method of the nucleotide positions can be referred to in Figure 2. Taking the structure of Figure 2 as an example, the first nucleotide at the 5' end of the sgRNA backbone is used as the starting point and the positions are numbered as 1, 2, 3...77, 78, 79, 80, 81 toward the 3' end; and the first nucleotide at the 3' end of the guide RNA is used as the starting point and the positions are numbered as -1, -2, -3, -4, -5...-18, -19, -20, -21 toward the 5' end.

[0028] In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA. In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on all nucleotides at positions 11-22 of the saCas9 sgRNA. In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on all nucleotides at positions 62-69 of the saCas9 sgRNA. In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on all nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA.

[0029] In one embodiment of the present invention, the modification of the phosphorothioate bond may be present between at least 2, at least 3, at least 4 or at least 5 nucleotides of the 7 nucleotides at the 5' end and / or the 3' end of the saCas9sgRNA. For example, the modification of the phosphorothioate bond may be present between 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 5' end of the saCas9sgRNA; and / or the modification of the phosphorothioate bond may be present between 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 3' end of the saCas9sgRNA, wherein the number and position of modifications at the two ends are not affected by each other. In a preferred embodiment of the present invention, the modification of the phosphorothioate bond may be present between at least 4 or at least 5 nucleotides of the 5' end and / or the 3' end of the saCas9sgRNA.

[0030] In a preferred embodiment of the present invention, the chemical modification in the present invention is any one of Mod001-Mod0013.

[0031] In a second aspect, the present invention also provides a saCas9 sgRNA targeting TTR, which comprises a guide RNA at the 5' end, the sequence of the guide RNA being at least 20, at least 21, or all 22 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NOs: 1-9.

[0032] As used herein, the term "TTR" refers to transthyretin.

[0033] In one embodiment of the present invention, the sequence of the guide RNA may be at least 20, at least 21, or all 22 consecutive nucleotides at the 3' terminus of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-9. More preferably, the sequence of the guide RNA may be the 21 consecutive nucleotides at the 3' terminus of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-9. For greater clarity, taking SEQ ID NO: 1 as an example, the 21 consecutive nucleotides at the 3' terminus of the nucleotide sequence set forth in SEQ ID NO: 1 are GUGUCUGAGGCUGGCCCUACG.

[0034] In one embodiment of the present invention, the saCas9 sgRNA may further comprise an sgRNA backbone of 77 nucleotides in length.

[0035] In one embodiment of the present invention, the nucleotide sequence of the saCas9 sgRNA may comprise at least one chemical modification. In a preferred embodiment of the present invention, the at least one chemical modification is selected from at least one of a 2'-O-methyl modification, a 2'-F modification, a 2'-MOE modification, and a modification of a phosphorothioate bond.

[0036] In one embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on at least 1, at least 2, at least 3 or at least 4 nucleotides of the 7 nucleotides at the 5' end and / or the 3' end of the saCas9 sgRNA. For example, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on 1, 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 5' end of the saCas9 sgRNA, and / or on 1, 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 3' end of the saCas9 sgRNA, wherein the number and position of modifications at the two ends are not affected by each other. In a preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on at least 3 or at least 4 nucleotides of the 5' end and / or the 3' end of the saCas9 sgRNA.

[0037] In a more preferred embodiment of the present invention, the 2'-O-methyl modification, the 2'-F modification or the 2'-MOE modification may be present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions -14 to -9, -3, -1, 1, 3 to 9, 11 to 27, 29 to 33, 36 to 39, 41, 42, 44 to 47, 49 to 77 of the saCas9 sgRNA.

[0038] In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA. In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on all nucleotides at positions 11-22 of the saCas9 sgRNA. In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on all nucleotides at positions 62-69 of the saCas9 sgRNA. In a more preferred embodiment of the present invention, the 2'-O-methyl modification, 2'-F modification or 2'-MOE modification may be present on all nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA.

[0039] In one embodiment of the present invention, the modification of the phosphorothioate bond may be present between at least 2, at least 3, at least 4 or at least 5 nucleotides of the 7 nucleotides at the 5' end and / or the 3' end of the saCas9sgRNA. For example, the modification of the phosphorothioate bond may be present between 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 5' end of the saCas9sgRNA; and / or the modification of the phosphorothioate bond may be present between 2, 3, 4, 5, 6 or all 7 nucleotides of the 7 nucleotides at the 3' end of the saCas9sgRNA, wherein the number and position of modifications at the two ends are not affected by each other. In a preferred embodiment of the present invention, the modification of the phosphorothioate bond may be present between at least 4 or at least 5 nucleotides of the 5' end and / or the 3' end of the saCas9sgRNA.

[0040] In a more preferred embodiment of the present invention, the nucleotide sequence of the saCas9 sgRNA is shown in any one of SEQ ID NOs: 12-25 and 27-29.

[0041] In a third aspect, the present invention also provides a composition comprising the above-mentioned saCas9 sgRNA, and saCas9 nuclease or mRNA encoding saCas9 nuclease.

[0042] In one embodiment of the present invention, the composition may be, for example, a pharmaceutical composition.

[0043] In a fourth aspect, the present invention further provides a kit comprising the saCas9 sgRNA or the composition described above, and optionally instructions for use.

[0044] In a fifth aspect, the present invention also provides use of the above-mentioned saCas9 sgRNA, the above-mentioned composition, or the above-mentioned kit in modifying target DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following detailed description, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0046] Figure 1 is a schematic diagram showing the design and screening of guide RNAs targeting the human TTR gene. A: Guide RNAs targeting the human TTR gene designed using CRISPOR and the corresponding exon locations. B: saCas9-sgRNA plasmids were transfected into HEK293 cells, and the editing efficiency was detected after 3 days. CR003353 is the spCas9 TTR guide RNA used by Intellia theraputics as a positive control.

[0047] Figure 2 shows the editing efficiency of saCas9 mRNA and the head-to-tail modified sgRNAs of the present invention in cells. AB: Design of the head-to-tail modified sgRNA, including the selection of a 21nt guide RNA, the addition of four U bases at the 3' end, and the 2'-OMe and PS modifications of the first and last three bases; C: Editing efficiency of the head-to-tail modified TTR-sg12, TTR-sg20, and VEGFA-sg8 in cells; Natural sgRNA refers to the natural, unmodified sgRNA; The mass ratio of saCas9 mRNA to sgRNA is 5:1 or 5:5, respectively.

[0048] Figure 3 shows the editing efficiency of a 21nt guide RNA in a head-to-tail modified sgRNA. A: sgRNA designs with different guide RNA lengths; B: Demonstrates the highest editing efficiency when the guide RNA is 21nt. The saCas9 mRNA to sgRNA mass ratios were 5:1 or 5:5, respectively.

[0049] Figure 4 shows the design of the heavily modified sgRNA form of saCas9 of the present invention. The bases marked with a single underline are 2'-OMe modified, the bases marked with a double underline are 2'-F modified, and the bases marked with an asterisk are PS modified.

[0050] Figure 5 shows the editing efficiency of heavily modified sgRNAs in cells. Different modified sgRNAs were co-transfected with saCas9 mRNA at varying mass ratios into the human Huh7 cell line. Genomic DNA was extracted three days later to measure editing efficiency. Natural sgRNA is a naturally unmodified sgRNA. Mod001 is a 102nt head-to-tail modified sgRNA, and G000480 is a heavily modified spCas9 TTR sgRNA used by Intellia Theraputics.

[0051] Figure 6 shows the application of modified sgRNAs to other sgRNA sequences. TTR-sg1 sgRNAs were modified with Mod001, Mod011, and Mod013, respectively, and co-transfected with saCas9 mRNA into human Huh7 cells. Genomic DNA was extracted three days later to assess editing efficiency. Unmodified native sgRNA served as a control. DETAILED DESCRIPTION

[0052] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0053] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0054] Hereinafter, the present invention will be described in more detail through examples.

[0055] Example

[0056] Example 1: Materials and Methods

[0057] A. Synthetic sgRNA

[0058] The guide sequences targeting endogenous genes such as VEGFA and EMX1 are previously reported (Ran, Cong et al., 2015; Chu et al., 2019). The guide RNA targeting the TTR gene provided in this invention was designed using CRISPOR. The guide RNA was linked to the AAV vector, and forward and reverse strand oligonucleotides were synthesized by Jinweizhi. After annealing, they were linked to the linearized saCas9 vector (Addgene, No. 61591) after BsaI digestion. The modified sgRNA was synthesized by Suzhou Beixin Co., Ltd.

[0059] B.saCas9-sgRNA plasmid transfection

[0060] When HEK293 cells reached 90% confluency, fresh medium was replaced for transfection. Each 6-well plate was transfected with 1.5 μg of saCas9-sgRNA plasmid using Lipofectamine 3000 (Thermo Fisher Scientific). After 3 days of culture, genomic DNA was collected to assess on-target and off-target efficiency.

[0061] C.saCas9 mRNA in vitro transcription (IVT)

[0062] Wild-type saCas9 and spCas9 were ligated to the TOPO vector, respectively. Using the TOPO vector as a template and primers T7-AG-F and BZ_Tail_2, PCR amplification was performed to obtain T7-cas9-polyA fragments of the corresponding size. The PCR products recovered from the gel were used as templates for IVT. The corresponding reaction system was:

[0063] Incubate at 37°C for 4-6 hours, then add DNase I at a final concentration of 0.3 U / μl, mix well, and incubate at 37°C for 15 minutes to digest the DNA template. The transcribed RNA was then purified and recovered using magnetic beads (Novozymes). The nucleotide sequences of the transcribed saCas9 mRNA and spCas9 mRNA are shown in SEQ ID NO: 52 and SEQ ID NO: 53, respectively.

[0064] D. Cell transfection with saCas9 mRNA and sgRNA

[0065] When Huh7 cells reached 90% confluency, fresh medium was replaced and transfection was prepared. Each 24-well plate was transfected with 500 ng of saCas9 mRNA and 500 ng or 100 ng of sgRNA at a weight ratio of 5:5 or 5:1 using RNAimax (Thermo Fisher Scientific). Genomic DNA was extracted 3 days after transfection to assess editing efficiency.

[0066] E. Editing efficiency detection (Indels analysis)

[0067] Primer 3.0 was used to design primers to specifically amplify a 500-bp fragment upstream and downstream of the sgRNA target sequence. The purified and recovered amplified fragments were subjected to Sanger sequencing, and the sequencing peaks were analyzed for editing efficiency using TIDE online software (https: / / tide.nki.nl).

[0068] Example 2: Screening of guide RNA targeting TTR

[0069] The four exon sequences of the human TTR gene were input into the CRISPOR software (http: / / crispor.tefor.net), and then nine 20nt guide RNA sequences were designed based on the NNGRRT PAM of saCas9. Table 1 shows the 22nt guide RNA sequences shown in SEQ ID NOs: 1-9. These are nucleotide structures formed by adding two nucleotides to the 5' end of the 20nt guide RNA sequence based on base pairing with the exons. The guide RNA sequences used in the examples are all consecutive nucleotides in the 22nt nucleotide sequences shown in SEQ ID NOs: 1-9.

[0070] Table 1

[0071] The nine 20-nt guide RNAs described above were linked to the saCas9 vector and transfected into HEK293 cells. Three days later, indel production was assayed. The results showed that the cleavage activities of the sg1, sg12, and sg20 guide RNAs were comparable to those reported for spCas9 guide RNAs. The results are shown in Figure 1.

[0072] Example 3: saCas9 single-stranded sgRNA head-to-tail modification pattern

[0073] In this example, a 21nt guide RNA sequence was used as an example, and four Us were added to the 3' end of the sgRNA to prevent the sgRNA end modification from affecting the binding of the saCas9 protein to the sgRNA. Then, the three phosphodiester bonds at the head and tail of the resulting 102nt sgRNA were modified with PS to obtain the nucleotide structure shown in Figure 2(A). Furthermore, the three bases at the head and tail were modified with 2'-OMe to obtain the nucleotide structure shown in Figure 2(B). Subsequently, it was transfected into the human huh7 cell line simultaneously with 100ng or 500ng of saCas9 mRNA, and the editing efficiency was detected after 3 days.

[0074] In this example, TTR-sg12 and TTR-sg20 were used as experimental groups, and VEGFA-sg8 was used as a positive control group. The modified nucleotide sequences are shown in Table 2 below. It was found that the three head-to-tail modified sgRNAs were able to produce effective editing, and the editing efficiency was 2.3-11.4 times that of the natural sgRNA. The results are shown in Figure 2 (C). The above results show that the 102nt sgRNA can effectively mediate gene editing of saCas9 using head-to-tail modifications. Therefore, the 102nt head-to-tail modification pattern with corresponding position modifications shown in the sequence in Table 2 is referred to as Mod001 modification in this article, that is, the nucleotides at positions -21, -20, -19, 79, 80, and 81 have 2'-O-methyl modifications, and the nucleotides at positions -21, -20, -19, 78, 79, and 80 have PS modifications at the 3' end.

[0075] Table 2

[0076] Example 4: saCas9 modified guide RNA length

[0077] Previous studies have reported that the editing efficiency of saCas9 guide RNA is highest when the length is 21-23nt. Since the head and tail modification of sgRNA may affect the binding of guide RNA to saCas9 and thus affect the cutting efficiency, sg12 is taken as an example in this embodiment to explore the effect of guide RNAs of different lengths on the cutting efficiency in the head and tail modified sgRNA. The modified nucleotide sequence is shown in Figure 3 (A) and Table 3 below. Among them, the head and tail modification pattern of the 20nt guide RNA modified at the corresponding position shown in SEQ ID NO: 14 in Table 3 is referred to as Mod002, and the head and tail modification pattern of the 22nt guide RNA modified at the corresponding position shown in SEQ ID NO: 15 in Table 3 is referred to as Mod003. The results show that the cutting efficiency of the 21nt guide RNA in the modified sgRNA is significantly higher than that of the 22nt and 20nt guide RNAs, and the results are shown in Figure 3 (B).

[0078] Table 3

[0079] Example 5: Heavy modification pattern of sgRNA by saCas9

[0080] In this example, sg12-21nt is used as an example to further study the effect of heavy modification on the editing efficiency of sgRNA. The modified nucleotide sequences are shown in Figure 4 and Table 4 below. In particular, Mod13 removes 4 base Us on the basis of Mod11 and moves the 3' end modification forward to the bases at positions 75-77 in the stem-loop 2 region to explore whether the 4 base Us added at the 3' end are necessary; in addition, Intellia theraputics' Spcas9 TTR sgRNA G000480 is used as a positive control. In this article, the modification patterns with corresponding position modifications shown in the sequences in Table 4 are referred to as Mod004-Mod013, respectively.

[0081] Table 4

[0082] The results shown in Figure 5 show that compared to native unmodified sgRNAs, the editing efficiency mediated by sgRNAs modified with Mod006, Mod008, Mod009, Mod010, Mod011, Mod012, and Mod013 increased by 8-26 times. Compared to sgRNAs with head and tail modifications, the editing efficiency mediated by sgRNAs modified with Mod009, Mod011, and Mod013 increased by approximately 1.5 times. In other words, heavily modified sgRNAs significantly improved editing efficiency.

[0083] Example 6: Editing efficiency of other saCas9 sgRNAs after modification

[0084] The TTR-sg1-21nt sgRNA was modified with Mod001, Mod011, and Mod013. The modified nucleotide sequences are shown in Table 5 below. They were co-transfected with saCas9 mRNA at different doses into Huh7 cells, and the editing efficiency was detected after 3 days. As shown in Figure 6, compared with the natural TTR-sg1-21nt sgRNA, the editing efficiency mediated by sgRNA modified with Mod001, Mod011, and Mod013 increased by 6.7-15 times. Compared with the sgRNA modified with head and tail, the editing efficiency mediated by sgRNA modified with Mod011 and Mod013 increased by 1.3-1.5 times. In other words, the modifications provided by the present invention are applicable to different saCas9 sgRNAs.

[0085] Table 5

[0086] In addition, the amplification primers used in the examples are summarized as follows:

[0087] Table 6

[0088] Primers for amplifying Cas9:

[0089] T7-AG-F:CGTACAGAAGCTAATACGACTCACTATAAGGA (SEQ ID NO: 50)

[0090] BZ_Tail_2:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTCCTACTCAGGCTTTATTCAAAGACCA(SEQ ID NO: 51)

[0091] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0092] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0093] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A modified saCas9 sgRNA, characterized in that The saCas9 sgRNA comprises a guide RNA of 20 to 22 nucleotides in length and a sgRNA backbone of 77 nucleotides in length, and the nucleotide sequence of the saCas9 sgRNA comprises at least one chemical modification.

2. The saCas9 sgRNA according to claim 1, wherein The at least one chemical modification is selected from at least one of a 2'-O-methyl modification, a 2'-F modification, a 2'-MOE modification, and a modification of a phosphorothioate bond.

3. The saCas9 sgRNA according to claim 1, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 1, at least 2, at least 3 or at least 4 nucleotides out of the 7 nucleotides at the 5' end and / or 3' end of the saCas9 sgRNA, respectively.

4. The saCas9 sgRNA according to claim 1, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 3 or at least 4 nucleotides at the 5' end and / or 3' end of the saCas9 sgRNA, respectively.

5. The saCas9 sgRNA according to claim 1, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions -14 to -9, -3, -1, 1, 3 to 9, 11 to 27, 29 to 33, 36 to 39, 41, 42, 44 to 47, 49 to 77 of the saCas9 sgRNA.

6. The saCas9 sgRNA according to claim 5, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA.

7. The saCas9 sgRNA according to claim 6, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on all nucleotides at positions 11-22 of the saCas9 sgRNA.

8. The saCas9 sgRNA according to claim 6, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on all nucleotides at positions 62-69 of the saCas9 sgRNA.

9. The saCas9 sgRNA according to claim 6, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on all nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA.

10. The saCas9 sgRNA according to claim 1, wherein The modification of the phosphorothioate bond is present between at least 2, at least 3, at least 4 or at least 5 nucleotides out of the 7 nucleotides at the 5' end and / or the 3' end of the saCas9 sgRNA, respectively.

11. The saCas9 sgRNA according to claim 10, wherein The modification of the phosphorothioate bond is present between at least 4 or at least 5 nucleotides at the 5' end and / or the 3' end of the saCas9 sgRNA, respectively.

12. The saCas9 sgRNA according to claim 1, wherein The modified saCas9sgRNA is modified by Mod001-Mod013.

13. The saCas9 sgRNA according to claim 1, wherein The sgRNA backbone comprises a repeat sequence / inverted repeat sequence region, a stem loop 1 region, a connecting region and a stem loop 2 region in sequence from 5' to 3' direction.

14. The saCas9 sgRNA according to claim 1, wherein The saCas9 sgRNA also contains the nucleotide sequence UUUU at the 3' end.

15. A saCas9 sgRNA targeting TTR, characterized in that The saCas9 sgRNA comprises a guide RNA at the 5' end, the sequence of the guide RNA being at least 20, at least 21, or all 22 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NOs: 1-9.

16. The saCas9 sgRNA according to claim 15, wherein The sequence of the guide RNA is at least 20, at least 21, or all 22 consecutive nucleotides at the 3' end of the nucleotide sequence shown in any one of SEQ ID NOs: 1-9.

17. The saCas9 sgRNA according to claim 15, wherein The saCas9 sgRNA also comprises a sgRNA backbone of 77 nucleotides in length.

18. The saCas9 sgRNA according to claim 15, wherein The nucleotide sequence of the saCas9 sgRNA comprises at least one chemical modification.

19. The saCas9 sgRNA according to claim 18, wherein The at least one chemical modification is selected from at least one of a 2'-O-methyl modification, a 2'-F modification, a 2'-MOE modification, and a modification of a phosphorothioate bond.

20. The saCas9 sgRNA according to claim 19, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 1, at least 2, at least 3 or at least 4 nucleotides out of the 7 nucleotides at the 5' end and / or 3' end of the saCas9 sgRNA, respectively.

21. The saCas9 sgRNA according to claim 19, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 3 or at least 4 nucleotides at the 5' end and / or 3' end of the saCas9 sgRNA, respectively.

22. The saCas9 sgRNA of claim 19, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions -14 to -9, -3, -1, 1, 3 to 9, 11 to 27, 29 to 33, 36 to 39, 41, 42, 44 to 47, 49 to 77 of the saCas9 sgRNA.

23. The saCas9 sgRNA of claim 22, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA.

24. The saCas9 sgRNA of claim 23, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on all nucleotides at positions 11-22 of the saCas9 sgRNA.

25. The saCas9 sgRNA of claim 23, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on all nucleotides at positions 62-69 of the saCas9 sgRNA.

26. The saCas9 sgRNA of claim 23, wherein The 2'-O-methyl modification, 2'-F modification or 2'-MOE modification is present on all nucleotides at positions 11-22 and 62-69 of the saCas9 sgRNA.

27. The saCas9 sgRNA of claim 19, wherein The modification of the phosphorothioate bond is present between at least 2, at least 3, at least 4 or at least 5 nucleotides out of the 7 nucleotides at the 5' end and / or the 3' end of the saCas9 sgRNA, respectively.

28. The saCas9 sgRNA of claim 27, wherein The modification of the phosphorothioate bond is present between at least 4 or at least 5 nucleotides at the 5' end and / or the 3' end of the saCas9 sgRNA, respectively.

29. The saCas9 sgRNA according to claim 14, wherein The nucleotide sequence of the saCas9 sgRNA is shown in any one of SEQ ID NOs: 12-25 and 27-29.

30. A composition comprising the saCas9 sgRNA according to any one of claims 1-29, and a saCas9 nuclease or an mRNA encoding a saCas9 nuclease.

31. A kit comprising the saCas9 sgRNA according to any one of claims 1-29 or the composition according to claim 30, and optionally instructions for use.

32. Use of the saCas9 sgRNA according to any one of claims 1-29, the composition according to claim 30, or the kit according to claim 31 in modifying a target DNA.

Images