One or more primers for HLA-DP genes

Abstract

The present invention provides one or more primers capable of, with a high degree of coverage, detecting or amplifying HLA alleles over the full length (including non-translated regions) of HLA-DP genes. More specifically, the present invention provides one or more primers for HLA-DP genes, the primers being selected from the group consisting of items (1) and (2) mentioned below and combinations thereof: (1) one or more primers for HLA-DPA1 gene, the one or more primers for HLA-DPA1 gene each comprising a nucleotide sequence represented by SEQ ID NO: 1 or the like, or a nucleotide sequence complementary to the nucleotide sequence, or the like; and (2) one or more primers for HLA-DPB1 gene, the one or more primers for HLA-DPB1 gene each comprising a nucleotide sequence represented by SEQ ID NO: 9 or the like, or a nucleotide sequence complementary to the nucleotide sequence, or the like.

Description

One or more primers for the HLA-DP gene

[0001] The present invention relates to one or more primers for HLA-DP genes and the like.

[0002] The human leukocyte antigen (HLA) region on the short arm of chromosome 6 is highly polymorphic. Due to this high degree of polymorphism, it is a major target antigen for testing in transplantation and blood transfusion, and also has the function of presenting a variety of foreign and self-derived antigens.

[0003] Based on their function and structure, HLA molecules are broadly classified into class I molecules such as HLA-A, HLA-B, and HLA-C, and class II molecules such as HLA-DR, HLA-DQ, and HLA-DP. Class II molecules consist of an α chain and a β chain, and are expressed mainly in antigen-presenting cells such as dendritic cells, macrophages, and B cells, where they present peptides derived from exogenous antigens.

[0004] In the HLA class II gene region, the HLA-DR gene and the HLA-DQ gene are in a strong linkage disequilibrium relationship, whereas a recombination hotspot exists between the HLA-DQ gene and the HLA-DP gene.

[0005] The α and β chains of the HLA-DP molecule are encoded by the HLA-DPA1 gene and the HLA-DPB1 gene, respectively, and polymorphisms are observed in both the α and β chains. The HLA-DPA1 gene and the HLA-DPB1 gene are arranged on the genome as a head-to-head gene pair, and are characterized by a bidirectional transcription promoter simultaneously controlling the two genes (Non-Patent Document 1). In addition, it has been reported that a SNP (rs9277534) in the 3' untranslated region of the HLA-DPB1 gene is associated with the mRNA expression level of the HLA-DP gene (Non-Patent Document 2).

[0006] Commercially available HLA allele typing kits target only the coding regions of the HLA-DPA1 gene and HLA-DPB1 gene, and are unable to perform full-length gene sequence analysis, including untranslated regions. Therefore, for full-length gene sequences, including untranslated regions, only a portion of alleles are registered in the IMGT / HLA database. It will be important to perform full-length sequence analysis of the HLA-DPA1 gene and HLA-DPB1 gene, including untranslated regions, in the future.

[0007] Furthermore, prior literature has reported several primers capable of amplifying the HLA-DPA1 gene and the HLA-DPB1 gene by long-range PCR. However, no primer set has been reported that can comprehensively amplify multiple HLA alleles in a single PCR run of the entire gene, including the untranslated regions. In particular, prior literature has not reported a primer set that can comprehensively amplify HLA alleles in a single PCR run of the entire gene, including the untranslated regions, and that can phase HLA-DP. For example, the primers described in Patent Documents 1 and 2 and Non-Patent Document 1 do not consider comprehensive coverage of multiple HLA alleles. Furthermore, the disclosures of these documents are as follows:

[0008] The primers for the HLA-DPB1 gene described in Patent Document 1 cannot amplify the entire gene by PCR. Furthermore, the method of Patent Document 1 is a sequence analysis method using PCR that separates the HLA-DPB1 gene into three regions: the coding region and the intergenic region of the HLA-DPA1 gene. Therefore, in order to obtain a phased sequence of the HLA-DPB1 gene from the HLA-DPA1 gene, it is necessary to align six types of sequences. Therefore, it is not possible to phase the allele and promoter sequence in a single PCR.

[0009] Furthermore, the primers for the HLA-DPA1 gene described in Patent Document 2 do not contain a 5'-untranslated region and therefore cannot amplify the entire gene. Furthermore, the primers for the HLA-DPB1 gene described in Patent Document 2 cannot amplify the entire gene in a single PCR.

[0010] Furthermore, the method of Non-Patent Document 1 requires the use of three types of primer sets (six primers in total) to phase HLA-DP.

[0011] JP 2016-10318 A JP 2017-158570 A

[0012] Truong L et al. , HLA. 2020;96(3):299-311. Petersdorf EW et al. , N Engl J Med. 2015;373(7):599-609.

[0013] An object of the present invention is to provide one or more primers that are capable of detecting or amplifying HLA alleles over the entire length of the HLA-DP gene (including untranslated regions) with a high degree of coverage.

[0014] Another object of the present invention is to provide a primer set that can comprehensively amplify HLA alleles over the entire length of the HLA-DP gene (including untranslated regions) in a single gene amplification method and that can phase the HLA-DP gene more easily than conventional methods.

[0015] As a result of extensive research, the present inventors have discovered one or more primers for the HLA-DP gene that are capable of detecting or amplifying HLA alleles with a high degree of comprehensiveness across the entire length of the HLA-DP gene (including untranslated regions). Indeed, experiments have confirmed that the one or more primers for the HLA-DP gene discovered by the present inventors are capable of amplifying a large number of HLA alleles, including putatively novel HLA alleles, with a high degree of comprehensiveness (Tables 7 to 9). On the other hand, the primers described in Patent Documents 1 and 2 and Non-Patent Document 1 are considered to contain numerous mismatches because they have not been examined for comprehensiveness across a large number of HLA alleles. In fact, the primers for the HLA-DPB1 gene described in Patent Document 1 contained mismatches in 19 alleles (approximately 7% mismatches) in 137 cases (274 alleles) described in the Examples, and therefore it is highly likely that PCR amplification was not observed or that uniform amplification was affected (see Examples). Based on this finding, the present inventors have succeeded in providing one or more primers for the HLA-DP gene, thereby completing the present invention.

[0016] That is, the present invention is as follows: [1] One or more primers for the HLA-DP gene selected from the group consisting of the following (1) and (2) and combinations thereof: (1) one or more primers for the HLA-DPA1 gene, wherein the one or more primers for the HLA-DPA1 gene are (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, and / or (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof; and (2) one or more primers for the HLA-DPB1 gene, wherein the one or more primers for the HLA-DPB1 gene are (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, and / or (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof. [2] One or more primers for the HLA-DP gene according to [1], wherein the one or more primers for the HLA-DP gene are a primer set for amplifying the HLA-DP gene selected from the group consisting of the following (1') and (2') and combinations thereof: (1') a primer set for amplifying the HLA-DPA1 gene, the primer set for amplifying the HLA-DPA1 gene comprising (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, and (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof; and (2') a primer set for amplifying the HLA-DPB1 gene, A primer set, wherein the primers for amplifying the HLA-DPB1 gene include (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, and (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof.[3] Primers for one or more HLA-DP genes according to [1] or [2], wherein (1a) the first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, is (1a') a first primer comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 6, or a complementary nucleotide sequence thereof; (1b) the second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof, is (1b') a second primer comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 8, or a complementary nucleotide sequence thereof; (2a) the first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, is (2a') a first primer comprising the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 14, or SEQ ID NO: 18, or a complementary nucleotide sequence thereof; and (2b) the second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof, is (2b') a second primer comprising the nucleotide sequence of SEQ ID NO: 12 or SEQ ID NO: 16, or a complementary nucleotide sequence thereof. [4] A method for detecting the HLA-DP gene, comprising detecting one or more HLA-DP genes in a sample obtained from a human subject using one or more primers for the HLA-DP gene of any of [1] to [3], wherein the one or more HLA-DP genes are selected from the group consisting of the HLA-DPA1 gene, the HLA-DPB1 gene, and combinations thereof. [5] The method of [4], wherein the detection of one or more HLA-DP genes is carried out by amplifying the one or more HLA-DP genes. [6] A reagent for detecting the HLA-DP gene, comprising one or more primers for the HLA-DP gene of any of [1] to [3]. [7] A kit for detecting the HLA-DP gene, comprising the following (a) and (b): (a) one or more primers for the HLA-DP gene of any of [1] to [3]; and (b) a polymerase.

[0017] According to the present invention, it is possible to detect or amplify HLA alleles of the HLA-DP gene with a high degree of comprehensiveness. Furthermore, according to the present invention, it is possible to amplify the entire length of the HLA-DP gene, including the untranslated region. Furthermore, according to the present invention, it is possible to phase the HLA-DPA1 gene and the HLA-DPB1 gene with two types of primer sets.

[0018] FIG. 1 shows an overview of the relationship between the HLA-DP genes (HLA-DPA1 and HLA-DPB1 genes) and SNP (rs9277534) and the primers of the present invention. FIG. 2 shows the results of PCR amplification of the HLA-DPA1 gene. The numbers correspond to the conditions shown in Table 4. M: molecular weight marker; D: genomic DNA extracted from a cell line (Daudi) established from an African population was used as a template; L: genomic DNA extracted from human peripheral blood mononuclear cells derived from Hispanic Americans was used as a template; N: no genomic DNA was used (negative control). FIG. 3 shows the results of PCR amplification of the HLA-DPB1 gene. M: molecular weight marker; D: genomic DNA extracted from a cell line (Daudi) established from an African population was used as a template; L: genomic DNA extracted from human peripheral blood mononuclear cells derived from Hispanic Americans was used as a template; N: no genomic DNA was used (negative control). FIG. 4 shows novel HLA alleles detected with the primers of the present invention.

[0019] The present invention provides one or more primers for the HLA-DP gene selected from the group consisting of the following (1) and (2) and combinations thereof: (1) one or more primers for the HLA-DPA1 gene, wherein the one or more primers for the HLA-DPA1 gene are (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, and / or (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof; and (2) one or more primers for the HLA-DPB1 gene, wherein the one or more primers for the HLA-DPB1 gene are (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, and / or (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof.

[0020] The one or more primers of the present invention are not particularly limited as long as they can anneal to a target site in the HLA-DPA1 or HLA-DPB1 gene. For example, any primers containing natural nucleic acids or artificial nucleic acids can be used as the one or more primers of the present invention, but DNA primers are preferred from the viewpoints of versatility, cost, etc.

[0021] In one embodiment, the one or more primers of the present invention may be primers for one HLA-DP gene. For example, such one or more primers of the present invention have excellent coverage of HLA alleles and are therefore useful as sequencing primers or nucleic acid molecules that target RNA-guided nucleases (e.g., Cas9).

[0022] When the one or more primers of the present invention are sequencing primers or nucleic acid molecules directed to the target of an RNA-guided nuclease, from the viewpoint of targeting a region within the HLA-DP gene, one primer is the following primer ( FIG. 1 ): (1) one or more primers for the HLA-DPA1 gene, wherein the one or more primers for the HLA-DPA1 gene are (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7; or (2) one or more primers for the HLA-DPB1 gene, wherein the one or more primers for the HLA-DPB1 gene are (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15.

[0023] Furthermore, when one or more primers of the present invention are sequencing primers or nucleic acid molecules directed to the target of an RNA-guided nuclease, one primer may be (1a) a first primer containing the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or (2a) a first primer containing the base sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, from the viewpoint of targeting an untranslated region upstream of a gene that is particularly important for gene expression ( FIG. 1 ).

[0024] In another embodiment, the one or more primers of the present invention may be a primer set containing two or more primers. For example, such a primer set is useful as a primer set for gene amplification because it has excellent coverage of HLA alleles.

[0025] When the one or more primers of the present invention are a primer set containing two or more primers, the primer set may be the following primer set containing at least one specific primer that has excellent coverage of HLA alleles. (1) A primer set comprising two or more primers for amplifying the HLA-DPA1 gene, comprising: (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, and (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof; or a primer set comprising a primer selected from (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, or (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof, and another primer capable of amplifying the HLA-DPA1 gene in combination with the selected primer; or (2) A primer set comprising two or more primers for amplifying the HLA-DPB1 gene, comprising: (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, and (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof; or A primer set comprising a primer selected from (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, or (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof, and another primer capable of amplifying the HLA-DPB1 gene in combination with the selected primer.

[0026] The number of primers required for gene amplification varies depending on the type of gene amplification method. For example, in PCR, the number of primers required for gene amplification is two. On the other hand, in LAMP (Loop-mediated isothermal amplification) (see, e.g., WO 00 / 28082), the number of primers required for gene amplification is four or six. Therefore, when amplification by a gene amplification method requiring more than two primers is intended, the primer set may include additional primers.

[0027] Preferably, the one or more primers of the present invention may be the following primer set comprising two specific primers: (1') a primer set for amplifying the HLA-DPA1 gene, comprising (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, and (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof; and / or (2') primers for amplifying the HLA-DPB1 gene, comprising (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, and (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof.

[0028] The primer sets (1') and (2') use two specific primers. These two specific primers are designed to generate large amplification products of 14,000 bp or more (Examples). Therefore, the primer sets (1') and (2') are preferably used in gene amplification methods that can easily generate large amplification products. Examples of such gene amplification methods include PCR, SDA (STRAND Displacement Amplification), Hybrid Capture, LCR (Ligase Chain Reaction), and Cleavase Invader.

[0029] When the one or more primers of the present invention are a primer set containing the above-mentioned two specific primers, it is possible to amplify the HLA alleles of the target gene to a greater extent than a primer set containing one specific primer, and it is also possible to amplify the full-length gene including the untranslated region of the gene.

[0030] A primer containing SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a complementary base sequence thereof, may have additional bases added to its 5' or 3' end. For example, such bases may be complementary to the corresponding bases in the target site. The number of complementary bases is not particularly limited and may be, for example, 1 to 10, preferably 1 to 5. Adding such bases to a primer allows it to anneal more stably to the target site, improving detection or amplification efficiency. However, since a primer containing SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a complementary base sequence thereof, can itself anneal well to the target site, it does not need to have additional bases added to its 5' or 3' end. Furthermore, the primer may be chemically modified (e.g., modified with an amino group) or may have a linker attached.

[0031] In certain embodiments, the first and second primers having additional bases added to the 5' or 3' end may be as follows: A first primer containing the nucleotide sequence of SEQ ID NO: 1 or its complementary nucleotide sequence may be a first primer containing the nucleotide sequence of SEQ ID NO: 2 or its complementary nucleotide sequence. A second primer containing the nucleotide sequence of SEQ ID NO: 3 or its complementary nucleotide sequence may be a second primer containing the nucleotide sequence of SEQ ID NO: 4 or its complementary nucleotide sequence. A first primer containing the nucleotide sequence of SEQ ID NO: 5 or its complementary nucleotide sequence may be a first primer containing the nucleotide sequence of SEQ ID NO: 6 or its complementary nucleotide sequence. A second primer containing the nucleotide sequence of SEQ ID NO: 7 or its complementary nucleotide sequence may be a second primer containing the nucleotide sequence of SEQ ID NO: 8 or its complementary nucleotide sequence. A first primer containing the nucleotide sequence of SEQ ID NO: 9 or its complementary nucleotide sequence may be a first primer containing the nucleotide sequence of SEQ ID NO: 10 or its complementary nucleotide sequence. A second primer containing the nucleotide sequence of SEQ ID NO: 11 or its complementary nucleotide sequence may be a second primer containing the nucleotide sequence of SEQ ID NO: 12 or its complementary nucleotide sequence. A first primer containing the nucleotide sequence of SEQ ID NO: 13 or its complementary nucleotide sequence may be a first primer containing the nucleotide sequence of SEQ ID NO: 14 or its complementary nucleotide sequence. A second primer containing the nucleotide sequence of SEQ ID NO: 15 or its complementary nucleotide sequence may be a second primer containing the nucleotide sequence of SEQ ID NO: 16 or its complementary nucleotide sequence. A first primer containing the nucleotide sequence of SEQ ID NO: 17 or its complementary nucleotide sequence may be a first primer containing the nucleotide sequence of SEQ ID NO: 18 or its complementary nucleotide sequence.

[0032] The outline of the base sequences of SEQ ID NOs: 1 to 18 is as follows (for details, see Table 4 and <Identification of core sequence> in the Examples).

[0033] A primer containing SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18, or a complementary base sequence thereof, may have additional bases added to its 5' or 3' end. For example, such bases may be complementary to bases in the target site. The number of complementary bases is not particularly limited and may be, for example, 1 to 10, preferably 1 to 5. When such bases are added to a primer, it can anneal more stably to the target site, improving detection or amplification efficiency. However, since a primer containing SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18, or a complementary base sequence thereof, can anneal very well to the target site, it is not necessary for additional bases to be added to its 5' or 3' end. Furthermore, the primer may be chemically modified (e.g., modified with an amino group) or may have a linker attached.

[0034] Primers containing SEQ ID NOs: 1 to 18 or their complementary base sequences may have a functional moiety (e.g., a base sequence containing non-complementary bases, such as a barcode sequence) added to their 5' ends, such as a labeling moiety that enables identification. Examples of such functional moieties include Universal Sequence (PacBio) and Adapter Overhang Nucleotide Sequence (Illumina).

[0035] The primers used in the present invention as described above can be designed to have a specific number of bases (nucleotide length). This number of bases may be, for example, 15 or more, preferably 16 or more, more preferably 17 or more, even more preferably 18 or more, and particularly preferably 20 or more. This number of bases may also be, for example, 50 or less, preferably 45 or less, more preferably 40 or less, even more preferably 35 or less, and particularly preferably 30 or less. More specifically, this number of bases may be, for example, 15 to 50, preferably 16 to 45, more preferably 17 to 40, even more preferably 18 to 35, and particularly preferably 20 to 30.

[0036] The present invention also provides a method for detecting HLA-DP genes, which comprises detecting one or more HLA-DP genes selected from the group consisting of HLA-DPA1 gene, HLA-DPB1 gene, and combinations thereof in a sample obtained from a human subject using one or more primers of the present invention.

[0037] As a sample obtained from a human subject, any sample containing a target of one or more primers of the present invention can be used. Therefore, the sample obtained from a human subject is not particularly limited as long as it contains a genome and / or transcripts of the target HLA-DP gene, and examples include samples collected from humans and samples (e.g., cell samples) prepared from samples collected from humans. Preferably, a genome-containing sample is used. A minimally invasive sample is preferred as a genome-containing sample. Examples of such samples include hair, saliva, blood (e.g., whole blood, plasma, or serum), and mucous membranes (e.g., oral mucosa, nasal mucosa).

[0038] For detecting the HLA-DP gene in a sample, genomic DNA or transcripts of the HLA-DP gene may be extracted from the sample. Such extraction may be performed by any method. The extracted genomic DNA or transcripts of the HLA-DP gene may be subjected to an appropriate gene amplification method (e.g., PCR or LAMP) depending on the size of the intended amplification product. Alternatively, the sample may be directly subjected to the gene amplification method (e.g., direct PCR).

[0039] In the method of the present invention, the amplification product obtained by the gene amplification method using the gene amplification primer set of the present invention may be sequenced using a long-read sequencer. Examples of long-read sequencers include the Sequel system (Pacific Biosciences of California, Inc.) and a nanopore sequencer (Oxford Nanopore Technologies plc.). The gene amplification primer set of the present invention is capable of amplifying the full length of the HLA-DP gene, including the untranslated regions. By determining the nucleotide sequence of this amplification product using a long-read sequencer, the full length of the gene, including the untranslated regions of the HLA-DPA1 gene and the HLA-DPB1 gene, can be analyzed, and the HLA-DP region can be phased for each allele.

[0040] The methods of the present invention are useful, for example, for HLA testing for transplantation, selection of cancer drugs and treatments (eg, cancer vaccines), or for determining disease risk.

[0041] The present invention also provides a reagent for detecting HLA-DP genes, which comprises one or more primers of the present invention. The reagent of the present invention enables the method of the present invention to be carried out easily.

[0042] The reagent of the present invention can contain one or more primers of the present invention in the form of a powder (e.g., lyophilized) or solution. The solution is preferably an aqueous solution. Examples of aqueous solutions include water (e.g., sterile distilled water) and buffer solutions. Examples of buffer solutions include TE (Tris-EDTA) buffer, hydrochloric acid-potassium chloride buffer, glycine-hydrochloric acid buffer, citrate buffer, acetate buffer, citrate-phosphate buffer, phosphate buffer, Tris-hydrochloric acid buffer, glycine-sodium hydroxide buffer, carbonate-bicarbonate buffer, borate buffer, and tartrate buffer. When the reagent of the present invention is a solution containing one or more primers of the present invention, the concentration of the primer in the solution varies depending on factors such as the application of the primer and the dilution ratio when using the primer, but may be, for example, 0.1 to 100 mM, preferably 1 to 10 mM. The solution may also contain other components such as stabilizers.

[0043] The present invention also provides a kit for detecting an HLA-DP gene, which comprises (a) one or more primers of the present invention and (b) a polymerase. The kit of the present invention enables the method of the present invention to be carried out conveniently.

[0044] As the polymerase, an appropriate polymerase can be used depending on the type of gene amplification method. For example, in PCR, a heat-stable polymerase is preferably used, and in LAMP, a strand-displacing polymerase is preferably used. As the polymerase, a DNA polymerase is preferred.

[0045] The kit of the present invention may contain additional components in addition to (a) and (b). Such components include a deoxynucleoside triphosphate (dNTP) mixture, a reaction buffer, molecular weight markers, and controls (e.g., standards for amplification products of various HLA alleles). When the kit of the present invention contains additional components, the components may be provided in a form isolated from each other, for example, stored in different containers (e.g., tubes), or may be provided in a premixed form (e.g., PreMix).

[0046] In certain embodiments, detection may be performed in real time (e.g., real-time PCR). In this case, methods that enable real-time detection include, for example, the intercalator method and the fluorescent substance-labeled probe method. Therefore, when real-time detection is intended, the kit of the present invention may further include a fluorescent substance or a fluorescent substance-labeled probe as an additional component. Examples of fluorescent substances include fluorescent substances used in the intercalator method (e.g., SYBR (registered trademark) Green I). Examples of fluorescent substance-labeled probes include probes having a fluorescent substance bound to one of the 5'-end or 3'-end and a quencher bound to the other of the 5'-end or 3'-end (e.g., TaqMan (registered trademark) probe).

[0047] The present invention will be described in detail with reference to the following examples, but the present invention is not limited to these examples.

[0048] We describe the primer design procedure and evaluation for gene-specific PCR of the HLA-DPA1 and HLA-DPB1 genes.

[0049] <Primer design> Human genome reference sequence (genome assembly version hg38) and alternate Primers (HLA-DPA1_v1, HLA-DPA1_v2, HLA-DPB1_v1, HLA-DPB1_v2, HLA-DPB1_v3) were designed by running the PCR primer design tool Primer3 against conserved regions of the following sequences (chr6_GL000250v2_alt, chr6_GL000251v2_alt, chr6_GL000252v2_alt, chr6_GL000253v2_alt, chr6_GL000254v2_alt, chr6_GL000255v2_alt, chr6_GL000256v2_alt, chr6_GL383533v1_alt).

[0050] <Confirmation of Comprehensiveness of HLA Alleles> Whether the designed primer set is capable of comprehensively amplifying HLA alleles by PCR was confirmed in silico using publicly available whole genome sequence (WGS) data.

[0051] Publicly available WGS data for 137 cases from HipSci Resources were downloaded from the European Nucleotide Archive (ENA, https: / / www.ebi.ac.uk / ena, study PRJEB15299), and a FASTQ file containing only reads potentially derived from HLA genes and their vicinity was created using BWA 0.7.17 and samtools 1.10.

[0052] HLA allele calling was performed using HLAHD 1.2.1 for the generated FASTQ files of each sample (Tables 2 and 3).

[0053]

[0054]

[0055] For the FASTQ files created for each sample, freebayes 1.3.1, whatshape 1.0, and bcftools 1.10.2 were used to create consensus sequences for each allele of the HLA-DPA1 gene and HLA-DPB1 gene and their neighboring sequences, and these were matched with the HLA allele information of each sample.

[0056] The designed primers were DPA1_Fw_v1, DPA1_Rv_v1, DPA1_Fw_v2, DPA1_Rv_v2, DPB1_Fw_v1, DPB1_Rv_v1, DPB1_Fw_v2, DPB1_Rv_v2, and DPB1_Fw_v3 (see Table 4 for details). The binding sites that form the core sequences of the designed primers were evaluated using Bowtie2 2.3.5.1 to see if they were present in 137 consensus sequences registered in HipSci Resources, and it was confirmed that they were present in more than 99% of the consensus sequences.

[0057] <Comparison of HLA allele coverage of HLA-DPB1 gene primers> The coverage of known HLA-DPB1 gene primers (Patent Document 1) against 137 consensus sequences registered in HipSci Resources was evaluated using Bowtie2 2.3.5.1. As a result, of the 137 examples (274 consensus sequences) consisting of the HLA alleles listed in Table 3, mismatches were present in 19 consensus sequences (approximately 7% mismatches), which suggested a high possibility that PCR amplification would not be observed or that uniform amplification would be affected.

[0058] In contrast, the DPA1 and DPB1 gene primers designed as described above for 137 cases (274 consensus sequences) all had less than 1% mismatches. In particular, there were no mismatches at all for DPA1_Rv_v1, DPA1_Fw_v2, DPA1_Rv_v2, DPB1_Fw_v1, DPB1_Fw_v2, DPB1_Fw_v3, and DPB1_Rv_v2. Therefore, it was confirmed that the designed primers cover the HLA alleles listed in Tables 2 and 3.

[0059] <Experimental Confirmation of Specific PCR Amplification> To experimentally confirm whether the primers shown in Table 4 are capable of specific PCR amplification, PCR reactions were performed using each primer combination and genomic DNA extracted from a cell line established from an African population (Daudi:D) and human peripheral blood mononuclear cells (LP7:L) derived from Hispanic Americans as templates. Nuclease-free water (N) was used as a non-template control.

[0060]

[0061] <HLA-DPA1 gene PCR conditions> For the PCR reaction, KOD One PCR Master Mix (Dye-free 2x PCR Master Mix) (Toyobo Co., Ltd.) was used. A total of 25 μL of solution was prepared: 12.5 μL of KOD One PCR Master Mix (Dye-free 2x PCR Master Mix), 3.75 μL of forward primer (2 μM), 3.75 μL of reverse primer (2 μM), 2.5 μL of nuclease-free water, and 2.5 μL of genomic DNA solution (5 ng). This was repeated 35 times, with two steps consisting of 15 seconds at 94 degrees and 3 minutes at 68 degrees. For this PCR, a C1000 Touch Thermal Cycler (Bio-Rad Laboratories, Inc.) was used.

[0062] <HLA-DPB1 Gene PCR Conditions> PCR reaction was carried out using SeqAmp DNA polymerase (Takara Bio Inc.) in 2× SeqAmp PCR Buffer (includes Mg ２＋, dNTPs) 10.0 μL, forward primer (2 μM) 2 μL, reverse primer (2 μM) 2 μL, Nuclease-free Water 3.1 μL, NSeqAmp DNA polymerase 0.4 μL, genomic DNA solution (12.5 ng) 2.5 μL A total of 20 μL solution was prepared. After incubating at 94 degrees for 1 minute, this was followed by two steps of 10 seconds at 98 degrees and 15 minutes at 68 degrees, and this process was repeated 30 times. In addition, a C1000 Touch Thermal Cycler (Bio-Rad Laboratories, Inc.) was used for this PCR.

[0063] Next, after the PCR reaction, the PCR amplified product was purified using Sera-Mag Select (Cytiva) and eluted with 25 μL of Buffer EB (QIAGEN).

[0064] The purified PCR amplification product was subjected to electrophoresis using a Genomic DNA ScreenTape system (Agilent Technologies) to confirm the state of PCR amplification (FIGS. 2 and 3). The amplification conditions (primer set) were as follows:

[0065]

[0066]

[0067] <Sequencing using a long-read sequencer> The PCR amplification products were sequenced using a Sequel system (Pacific Biosciences of California, Inc.).

[0068] PCR amplification was performed using primer sets of SEQ ID NOS: 6 and 8, 10 and 12, and 14 and 16 shown in Table 4, which had been modified with an amino group by adding a universal sequence to the 5' end, and SMRTbell Express Template Prep Kit 2.0, with the measurement instrument settings, reaction conditions, and amounts of reagents added basically following Procedure & Checklist Part Number 101-791-700 version 02 provided by PacBio. The universal sequence is the sequence described in Procedure & Checklist Part Number 101-791-800 provided by PacBio, and / 5AmMC6 / gcagtcgaacatgtagctgactcaggtcac (SEQ ID NO: 21) was added to the forward primer, and / 5AmMC6 / tggatcacttgtgcaagcatcacatcgtag (SEQ ID NO: 22) was added to the reverse primer.

[0069] <PCR conditions> PCR reaction was carried out using KOD One PCR Master Mix (Dye-free 2xPCR Master Mix) (Toyobo Co., Ltd.), KOD One PCR Master Mix (Dye-free 2xPCR Master Mix) 12.5μL, forward primer (2μM) 3.75μL, reverse primer (2μM) 3.75μL, genomic DNA solution (10ng) A total of 25μL solution was prepared. This was incubated at 94 degrees for 1 minute, followed by 2 steps of 10 seconds at 98 degrees and 3 minutes at 68 degrees, and this process was repeated 30 times. In addition, a C1000 Touch Thermal Cycler (Bio-Rad Laboratories, Inc.) was used for this PCR.

[0070] For the consensus sequence obtained by the Sequel system, HLA allele typing was performed using the sequence registered in the IMGT / HLA database as a reference sequence.

[0071] Analysis was performed using genomic DNA extracted from a cell line (Daudi) established from an African population and a cell line established from a Japanese population as templates. 37 cell lines established from the Japanese population were analyzed using the primer set of SEQ ID NOS: 6 and 8 and the primer set of SEQ ID NOS: 10 and 12 listed in Table 4, and 28 cell lines established from the Japanese population were analyzed using the primer set of SEQ ID NOS: 14 and 16 listed in Table 4.

[0072] As a result, it was confirmed that the primer set narrowed down this time was capable of amplifying a wide range of HLA allele groups (Tables 7, 8, and 9).

[0073]

[0074]

[0075]

[0076] As a result, it was confirmed that the narrowed-down primer set was capable of amplifying a putative novel HLA allele that differs from DPB1*05:01:01:03 by one base (FIG. 4).

[0077] The primer set narrowed down this time was confirmed to be capable of analyzing the entire length of the HLA-DPA1 gene and the HLA-DPB1 gene, including the untranslated regions, and to be capable of phasing the HLA-DP region for each allele (Table 10).

[0078]

[0079] <Identification of Core Sequence> To identify the core sequence of the forward primer or reverse primer, the designed primer was shortened by one base from the 5' and 3' ends, and a perfect match was confirmed on the human genome reference sequence (genome assembly version hg38). Core sequences uniquely matching upstream and downstream of the target gene were identified (the bold underlined sequences in Table 4). It was confirmed that the binding site of this core sequence uniquely matches the consensus sequence of the target gene for all 137 primers in HipSci Resources with a 99% or higher match.

Claims

1. One or more primers for the HLA-DP gene selected from the group consisting of the following (1) and (2) and combinations thereof: (1) one or more primers for the HLA-DPA1 gene, which are (1a) a first primer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary nucleotide sequence thereof, and / or (1b) a second primer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary nucleotide sequence thereof; and (2) one or more primers for the HLA-DPB1 gene, which are (2a) a first primer comprising the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, or a complementary nucleotide sequence thereof, and / or (2b) a second primer comprising the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 15, or a complementary nucleotide sequence thereof.

2. One or more primers for the HLA-DP gene according to claim 1, wherein the one or more primers for the HLA-DP gene are a primer set for amplifying the HLA-DP gene selected from the group consisting of the following (1') and (2') and combinations thereof: (1') a primer set for amplifying the HLA-DPA1 gene, the primer set for amplifying the HLA-DPA1 gene comprising (1a) a first primer comprising the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary base sequence thereof, and (1b) a second primer comprising the base sequence of SEQ ID NO: 3 or SEQ ID NO: 7, or a complementary base sequence thereof; and (2') a primer set for amplifying the HLA-DPB1 gene, A primer set for amplifying the HLA-DPB1 gene, comprising: (2a) a first primer comprising the base sequence of SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:17, or a complementary base sequence thereof; and (2b) a second primer comprising the base sequence of SEQ ID NO:11 or SEQ ID NO:15, or a complementary base sequence thereof.

3. One or more primers for HLA-DP genes according to claim 1, wherein (1a) the first primer comprising the base sequence of SEQ ID NO:1 or SEQ ID NO:5, or a complementary base sequence thereof, is (1a') a first primer comprising the base sequence of SEQ ID NO:2 or SEQ ID NO:6, or a complementary base sequence thereof; (1b) the second primer comprising the base sequence of SEQ ID NO:3 or SEQ ID NO:7, or a complementary base sequence thereof, is (1b') a second primer comprising the base sequence of SEQ ID NO:4 or SEQ ID NO:8, or a complementary base sequence thereof; (2a) the first primer comprising the base sequence of SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:17, or a complementary base sequence thereof, is (2a') a first primer comprising the base sequence of SEQ ID NO:10, SEQ ID NO:14, or SEQ ID NO:18, or a complementary base sequence thereof; and (2b) the second primer comprising the base sequence of SEQ ID NO:11 or SEQ ID NO:15, or a complementary base sequence thereof, is (2b') a second primer comprising the base sequence of SEQ ID NO:12 or SEQ ID NO:16, or a complementary base sequence thereof.

4. A method for detecting an HLA-DP gene, comprising detecting one or more HLA-DP genes in a sample obtained from a human subject using one or more primers for the HLA-DP gene according to any one of claims 1 to 3, wherein the one or more HLA-DP genes are selected from the group consisting of the HLA-DPA1 gene, the HLA-DPB1 gene, and a combination thereof.

5. The method of claim 4, wherein the detection of one or more HLA-DP genes is carried out by amplification of one or more HLA-DP genes.

6. A reagent for detecting the HLA-DP gene, comprising one or more primers for the HLA-DP gene according to any one of claims 1 to 3.

7. A kit for detecting an HLA-DP gene, comprising the following (a) and (b): (a) one or more primers for the HLA-DP gene according to any one of claims 1 to 3; and (b) a polymerase.

Images