Rapid method for producing antibodies

Abstract

The present disclosure relates to a rapid method for producing antibodies. The method uses OE-PCR to join templates encoding antibody domains, thereby forming a linear expression cassette encoding a fusion protein comprising the antibody domains. A self-cleaving peptide is positioned between variable domains such that translation of the linear expression cassette produces individual proteins, each comprising a light or heavy chain variable region. These individual proteins can then join to form an antibody. The disclosure also provides Methods of producing linear expression cassettes as well as methods of using such cassettes for treating individuals.

Description

RAPID METHOD FOR PRODUCING ANTIBODIES CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No.63 / 515,466, filed July 25, 2023, which is incorporated herein by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH & DEVELOPMENT

[0002] This invention was made with U.S. government support from the National Institutes of Health. The U.S. government may have certain rights in the disclosed invention. SEQUENCE LISTING

[0003] This application contains a sequence listing in computer readable format, the contents of which are herein incorporated by reference in their entirety. BACKGROUND

[0004] Antibodies are essential for vaccine-mediated protection, diagnostics, therapeutics, and research. Monoclonal antibodies (mAb), those derived from single B cell clones, can serve as therapeutics for emerging infectious diseases, as demonstrated recently during the SARS-CoV-2 pandemic. Antibodies are secreted proteins that naturally circulate throughout the body. They stem from cell-surface proteins called B cell receptors (BCR) that define the B cell hematopoietic lineage. During B cell development, the DNA that may encode the BCR heavy and light chains is derived from unique recombination events of variable and constant region exons for each chain. The two chains then pair together in duplicate to create a unique BCR for each B cell. The result is enough antibody diversity to bind almost any antigenic shape the immune system may encounter throughout life. Further antibody binding affinity evolves through somatic hypermutation of B cell BCR DNA, a process akin to natural selection often called affinity maturation. Competition for antigen binding determines the selection of B cells with higher affinity mutations, leading to their clonal expansion and development into memory B cells and antibody secreting cells such as plasmablasts and short- and long-lived plasma cells. Sequencing BCRs and creating the antibodies they encode in vitro provides individual monoclonal antibodies for research, diagnostic, prophylactic or therapeutic applications.

[0005] Methods employed to examine monoclonal antibodies in vitro have developed significantly since Milstein and Kohler’s Nobel prize winning hybrid cell technique published in 1975. Notable methods include hybridomas and hetero-hybrids, B cell transformations with Epstein-Barr virus and limiting dilution, multiplex PCR using single cells, phage, yeast, or bacterial display of heavy and light chain cDNA followed by a selection process, or direct DNA synthesis of in silico antibody sequences cloned into plasmids. While each of these methods has its benefits, they still require lengthy cloning and cell culture techniques. What is needed is a method for producing antibodies that is rapid and a scalable, thereby allowing speedy identification of antibodies having the desired properties. The present application discloses such a method and provides other benefits as well. SUMMARY OF THE DISCLOSURE

[0006] One aspect of the disclosure is a method of producing a linear expression cassette encoding a fusion protein comprising an interdomain peptide flanked by an Ig VL domain and an Ig VH domain, the method comprising performing OE-PCR to join a plurality of templates comprising: a set of two Ig variable domain-encoding templates, one member of the set containing a first ORF (ORF1) encoding a VL domain, the other member of the set containing a second ORF (ORF2) encoding a VH domain; a third template containing a third ORF (ORF3) encoding an interdomain peptide; a fourth template comprising a polyA signal sequence (PSS); and, a fifth template containing a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette, the templates are in the order: the fifth template, one member of the set of Ig variable domain-encoding templates, the third template, the other member of the set of Ig variable domain-encoding templates, the fourth template. In certain aspects, the ORFS may be joined in the order ORF1-ORF3-ORF2 in the linear expression cassette. Such ORFs may be joined in frame in the linear expression cassette to form a fourth ORF encoding a fusion protein comprising, in order, the VLdomain, the interdomain peptide, and the VHdomain. In certain aspects, the ORFS may be in the order ORF2-ORF3-ORF1 in the linear expression cassette. Such ORFS may be joined in frame in the linear expression cassette so that they form a fourth ORF encoding a fusion protein comprising, in order, the VHdomain, the interdomain peptide, and the VLdomain.

[0007] One aspect of the disclosure is a method of producing a linear expression cassette encoding a fusion protein comprising an interdomain peptide flanked byan Ig VLdomain and an Ig VHdomain, the method comprising performing OE-PCR to join a plurality of templates comprising: a first template containing a first ORF (ORF1) encoding an Ig VLdomain, a second template containing a second ORF (ORF2) encoding Ig VHdomain, a third template containing a third ORF (ORF3) encoding an interdomain peptide, a fourth template containing a polyA signal sequence, and, a fifth template comprising a promoter, thereby producing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette, the promoter is positioned so that it is operably joined to one or more ORFs in the linear expression cassette. In certain aspects, the templates may comprise overlapping sequences so in the linear expression cassette, the templates are in the order: fifth template-first template-third template-second template-fourth template. The ORFs in the linear expression cassette may be in the order ORF1-ORF3-ORF-2. Such ORFS may be joined in frame in the linear expression cassette so that they form a fourth ORF encoding a fusion protein comprising, in order, the VL domain, the interdomain peptide, and the VH domain. In certain aspects, the templates may comprise overlapping sequences so that in the linear expression cassette, they are in the order: fifth template-second template-third template-first template-fourth template. The ORFs in the linear expression cassette may be in the order ORF2-ORF3-ORF1. The ORFS may be joined in frame in the linear expression cassette so that they form a fourth ORF encoding a fusion protein comprising, in order, the VH domain, the interdomain peptide, and the VLdomain. In certain aspects, the promoter may be positioned 5’ of all the ORFS in the linear expression cassette.

[0008] In certain aspects, the interdomain peptide may comprise a linker peptide. In certain aspects, the interdomain peptide may comprise a self-cleaving peptide, which may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise a tandem self-cleaving peptide, which may comprise two or more self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptide may comprise P2A and T2A.

[0009] In certain aspects, the interdomain peptide may comprise an enzymatic cleavage site, which may be different from the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be positioned between the amino-terminal end of the interdomain peptide and the self-cleaving peptide. The enzymaticcleavage site may be a furin cleavage site. In certain aspects, the interdomain peptide may comprise a spacer between the enzymatic cleavage site and the self-cleaving peptide.

[0010] In certain aspects, the fourth template may comprise a WPRE, which may be located 5’ of the polyA signal sequence. The OE-PCR may comprise a forward primer that hybridizes to the fifth template at a location 5’ of the promoter. The OE-PCR comprise a reverse primer that hybridizes to the fourth template, which may hybridize within, or 3’ of, the polyA signal sequence. In certain aspects, the method may produce a linear expression cassette depicted in any one of FIGS.1-11.

[0011] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising, a first template containing a first ORF (ORF1) encoding an Ig VL domain, a second template containing a second ORF (ORF2) encoding a self-cleaving peptide, a third template containing a third ORF (ORF3) encoding an Ig VH domain, a fourth template containing a fourth ORF (ORF4) encoding an Ig CH1 domain, a fifth template containing a polyadenylation sequence, and, a sixth template comprising a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. In certain aspects, the 3’ end of the sixth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3, end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, and the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template. The linear expression cassette may comprise, in order, the sixth template, the first template, the second template, the third template, the fourth template, and the fifth template. The ORFs may be joined in-frame in the linear expression cassette so that they form a fifth ORF encoding a fusion protein that comprises, in order, the Ig VLdomain, the self-cleaving peptide, the Ig VHdomain, and the Ig CH1 domain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be different from the site cleaved by the self-cleaving peptide, positioned 5’ ofthe second ORF, and the enzymatic cleavage site may be a furin cleavage site. The second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the second ORF. The fifth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fifth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0012] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a first template containing a first ORF (ORF1) encoding an Ig VL domain, a second template containing a second ORF (ORF2) encoding a self-cleaving peptide, a third template containing a third ORF (ORF3) encoding an Ig VH domain, a fourth template comprising a polyadenylation sequence and containing a fourth ORF (ORF4) encoding an Ig CH1 domain located 5’ of the polyA signal sequence, and, a fifth template comprising a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs may be in the order ORF1-ORF2-ORF3-ORF4. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. The linear expression cassette may comprise, in order, the fifth template, the first template, the second template, the third template, and the fourth template. All the ORFs may be joined in-frame in the linear expression cassette to form a fifth ORF (ORF5) encoding a fusion protein comprising, in order, the Ig VLdomain, the self-cleaving peptide, the Ig VHdomain, and the Ig CH1 domain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be different from the site cleaved by the self-cleaving peptide positioned 5’ of the second ORF. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. The second template may comprise a second nucleic acid sequence encoding a spacer, and the second nucleic acid sequence may be positioned between the first nucleic acid sequence and the second ORF. The fourth template may comprise a WPRE,which may be positioned between ORF4 and the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fourth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0013] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising, a first template containing a first ORF (ORF1) encoding an Ig VHdomain, a second template containing a second ORF (ORF2) encoding an Ig CH1 domain, a third template comprising a third ORF (ORF3) encoding a self-cleaving peptide, a fourth template containing a fourth ORF (ORF4) encoding an Ig VL domain, a fifth template containing a polyadenylation sequence, and, a sixth template containing a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. The 3’ end of the sixth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, and the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template. The linear expression cassette may comprise, in order, the sixth template, the first template, the second template, the third template, the fourth template, and the fifth template. All the ORFs may be joined in-frame in the linear expression cassette to form a fifth ORF (ORF5) encoding a fusion protein comprising, in order, the Ig VHdomain, the Ig CH1 domain, the self-cleaving peptide, and the Ig VLdomain. The third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different cleavage site from the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be positioned 5’ of the third ORF. The third template may comprise a second nucleic acid sequence encoding a spacer, and the second nucleic acid sequence may be positioned between the first nucleic acid sequence and the second ORF. The fifth template may comprise a WPRE, which may be positioned 5’ the polyA signal sequence. The OE-PCR may comprise a reverse primer thathybridizes to the fifth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0014] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a first template containing a first ORF (ORF1) encoding an Ig VHdomain, a second template containing a second ORF (ORF2) encoding an Ig CH1 domain and a self-cleaving peptide, the CH1 domain being positioned upstream of the self-cleaving peptide, a third template containing a third ORF (ORF3) encoding an Ig VL domain, a fourth template containing a polyadenylation sequence, and, a fifth template containing a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. The linear expression cassette may comprise, in order, the fifth template, the first template, the second template, the third template, and the fourth template. All the ORFs are in-frame in the linear expression cassette so that all the ORFs form a fourth ORF encoding a fusion protein comprising, in order, the Ig VHdomain, the Ig CH1 domain, the interdomain peptide, and the Ig VLdomain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different cleavage site that the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be positioned between the coding sequence for the Ig CH1 domain and the coding sequence for the self-cleaving peptide. The second template may comprise a second nucleic acid sequence encoding a spacer, and the second nucleic acid sequence may be positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide. The fourth template comprises a WPRE, which may be positioned 5’ the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fourth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0015] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a set of two Ig variable domain-encoding templates, wherein one member of the set contains a first ORF (ORF1) encoding an Ig VLdomain, and the other member of the set contains a second ORF (ORF2) encoding an Ig VHdomain, a third template containing a third ORF (ORF3) encoding an Ig constant domain and a self-cleaving peptide, the constant domain being positioned upstream of the self-cleaving peptide, a fourth template containing a fourth ORF (ORF4) encoding an Ig constant domain, a fifth template comprising a polyA signal sequence, and a sixth template containing a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that the promoter may be positioned in the linear expression cassette to drive expression of all the ORFs, and the templates may be in the order: the sixth template, one member of the set of templates encoding an Ig variable domain, the third template, the other member of the set of templates encoding an Ig variable domain, the fourth template, and the fifth, wherein the Ig constant region encoded by the third template is from the same type (i.e., heavy or light) of chain as the as the Ig variable domain encoded by the one member of the pair of templates to which its amino terminal end is joined, and wherein the Ig constant region encoded by the fourth template is from the same chain as the Ig variable domain encoded by the other member of the pair of templates to which its amino terminal end is joined. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of one member of the pair of templates, the 3’ end of the one member of the pair of templates may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the other member of the pair of templates, the other member of the pair of templates may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, and the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template. In certain aspects, all the ORFs may be in-frame in the linear expression cassette to form a fifth ORF (ORF5) encoding a fusion protein comprising, in order, an Ig V domain, an Ig C1 domain from the same chain type as the V domain to which its N-terminal end is joined, the self-cleaving peptide, an Ig V domain of the opposite chain type as the upstream Ig V domain in the fusion protein, and an Ig C1 domain from the same chain type as the V domain to which its N-terminal end is joined. The fifth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The one member of the pair of templates may encode a VHdomain, the other member of the pair of templates may encode a VLdomain, ORF3 may encode a fusion protein comprising an IGCH1 domain joined to the self-cleaving peptide, and the fourth template may encode a CLdomain. The carboxy terminal end of the Ig CH1 domain is joined to the amino terminal end of the self-cleaving peptide. In certain aspects, all the ORFs may be in-frame in the linear expression cassette to form a fifth ORF encoding, in order, an Ig VH domain, an Ig CH domain, the self -cleaving peptide, an Ig VL domain, and an Ig CL1 domain. The one member of the pair of templates may encode a VL domain, the other member of the pair of templates may encode a VH domain, ORF3 may encode a fusion protein comprising an IG CL domain joined to a self-cleaving peptide, and the fourth template may encode a CH1 domain. The carboxy terminal end of the Ig CL domain may be joined to the amino terminal end of the self-cleaving peptide. In certain aspects, all the ORFs may be joined in-frame in the linear expression cassette to form a fifth ORF encoding, in order, an Ig VL domain, an Ig CL domain, the self -cleaving peptide, an Ig VH domain, and an Ig CH1 domain. The third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different site than the site cleaved by the self- cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be located between the coding sequence for the Ig constant domain and the coding sequence for the self-cleaving peptide. The third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide. The fifth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fifth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0016] One aspects is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a first template comprising a first ORF (ORF1) encoding a VLdomain, a second template comprising a second ORF (ORF2) encoding a CLdomain, a third template containing a third ORF (ORF3) encoding a self-cleaving peptide, a fourth template containing a fourth ORF (ORF4) encoding an Ig VHdomain, a fifth template comprising a fifth ORF (ORF5) encoding an Ig CH1 domain, a sixth template comprising a polyadenylation signal sequence, and a seventh template containing a promoter, therebyconstructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4-ORF5. The 3’ end of the seventh template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template comprises a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template, and the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the sixth template. All the ORFs may be in-frame in the linear expression cassette so that they form a sixth ORF encoding a fusion protein comprising in order, the Ig VL domain, the Ig CL domain, the self-cleaving peptide, the Ig VH domain, and the Ig CH1 domain. The third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different site from the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be positioned 5’ of the third ORF. The third template may comprise a second nucleic acid sequence encoding a spacer, and the second nucleic acid sequence may be positioned between the first nucleic acid sequence and the third ORF. The sixth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE- PCR may comprise a reverse primer that hybridizes to the sixth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0017] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a first template comprising a first ORF (ORF1) encoding a VLdomain, a second template comprising a second ORF (ORF2) encoding an Ig CLdomain and a self- cleaving peptide, the CLdomain being positioned upstream of the self-cleaving peptide, a third template containing a third ORF (ORF3) encoding an Ig VHdomain, a fourth template containing a fourth ORF (ORF4) encoding an Ig CH1 domain, and comprising a polyA signal sequence, wherein the polyA signal sequence is positioned 3’ of ORF4, and a fifth template containing a promoter, thereby constructing the linear expression cassette, wherein pairs oftemplates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1- ORF2-ORF3-ORF4. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. All the ORFs may be in-frame in the linear expression cassette so that they form a fifth ORF encoding a fusion protein comprising, in order, the Ig VL domain, the Ig CL domain, the self-cleaving peptide, the Ig VH domain, and the Ig CH1 domain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be different cleavage site than the cleavage site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be located between the coding sequence for the Ig CL domain and the coding sequence for the self-cleaving peptide. The second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide. The fourth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The WPRE may be positioned between ORF4 and the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fourth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence. ORF4 may encode additional heavy chain domains, which may comprise a CH2 domain and / or a CH3 domain, and the carboxy terminal end of the CH1 domain may be joined to the amino terminal end of the CH2 domain and the carboxy terminal end of the CH2 domain may be joined to the amino terminal end of the CH3 domain. All the ORFs may be in frame such that they encode a fusion protein comprising, in order, the Ig VLdomain, and the Ig CLdomain, the self-cleaving peptide, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3 domain. The polyA signal sequence may be 3’ of the Ig CH3 domain. A WPRE may be positioned between the carboxy terminal end of the Ig CH3 domain and the polyA signal sequence.

[0018] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality oftemplates comprising a first template comprising a first ORF (ORF1) encoding an Ig VHdomain, a second template comprising a second ORF (ORF2) encoding an Ig CH1 domain, a third template containing a third ORF (ORF3) encoding a self-cleaving peptide, a fourth template containing a fourth ORF (ORF4) encoding an Ig VLdomain, a fifth template comprising a fifth ORF (ORF5) encoding an Ig CLdomain, a sixth template comprising a polyadenylation signal sequence, and a seventh template containing a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4-ORF5. The 3’ end of the seventh template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template, and the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the sixth template. All the ORFs may be in-frame in the linear expression cassette so that they form a sixth ORF encoding a fusion protein that comprises, in order, the Ig VH domain, the Ig CH1 domain, the self-cleaving peptide, the Ig VLdomain, and the Ig CLdomain. The third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different site than the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be positioned 5’ of the third ORF. The third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the third ORF. The sixth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the sixth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0019] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a first template comprising a first ORF (ORF1) encoding a VH domain,a second template comprising a second ORF (ORF2) encoding an Ig CH1 domain and a self- cleaving peptide, the CH1 domain being positioned upstream of the self-cleaving peptide, a third template containing a third ORF (ORF3) encoding an Ig VLdomain, a fourth template comprising a polyA signal sequence and containing a fourth ORF (ORF4) encoding an Ig CLdomain, the polyA signal sequence being positioned 3’ of ORF4, and a fifth template containing a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1- ORF2-ORF3-ORF4. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. All the ORFs may be in-frame in the linear expression cassette so that they form a fifth ORF encoding a fusion protein comprising, in order, the Ig VH domain, the Ig CH1 domain, the self-cleaving peptide, the Ig VL domain, and the Ig CL domain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different site than the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be located between the coding sequence for the Ig CH1 domain and the coding sequence for the self-cleaving peptide. The second template may comprise a second nucleic acid sequence encoding a spacer, and the second nucleic acid sequence may be positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide. The fourth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fourth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0020] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising a first template comprising a first ORF encoding an Ig VLdomain, a second template comprising a second ORF (ORF2) encoding an Ig CL domain and a self- cleaving peptide, the CL domain being positioned upstream of the self-cleaving peptide, athird template comprising at third ORF encoding a VHdomain, a fourth template comprising a polyA signal sequence and containing a fourth ORF (ORF4) encoding an Ig heavy chain constant region, and a fifth template comprising a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFS are in the order: ORF1-ORF2-ORF3-ORF4. In certain aspects, the Ig heavy chain region may comprise a CH1 domain, a CH2 domain, and a CH3 domain. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. All the ORFs may be in-frame in the linear expression cassette so that they form a fifth ORF encoding a fusion protein comprising, in order, the Ig VL domain, the Ig CL domain, the self-cleaving peptide, the Ig VH domain, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3 domain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different site than the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, which may be located between the coding sequence for the Ig CL domain and the coding sequence for the self-cleaving peptide. The second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide. The fourth template comprises a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fourth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0021] One aspect is a method of constructing a linear expression cassette for producing an antibody, the method comprising, performing OE-PCR to join a plurality of templates comprising a first template comprising a first ORF encoding an Ig VHdomain, a second template comprising a second ORF encoding heavy chain constant region and a self-cleaving peptide, the heavy chain constant region being positioned upstream of the self- cleaving peptide, a third template comprising at third ORF encoding a VL domain, a fourthtemplate comprising a polyA signal sequence and containing a fourth ORF (ORF4) encoding an Ig CLdomain, and a fifth template comprising a promoter, thereby constructing the linear expression cassette, wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFS are in the order: ORF1-ORF2-ORF3-ORF4. The 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. All the ORFs may be in-frame in the linear expression cassette so that they form a fifth ORF (ORF5) encoding a fusion protein comprising, in order, the Ig VH domain, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3 domain, the self-cleaving peptide, the Ig VL domain, and the Ig CL domain. The second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site, which may be a different site than the site cleaved by the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site, located between the coding sequence of the heavy chain constant region and the coding sequence for the interdomain peptide. The second template may comprise a second nucleic acid sequence encoding a spacer, and the second nucleic acid sequence may be positioned between the first nucleic acid sequence and the coding sequence for the self- cleaving peptide. The fourth template may comprise a WPRE, which may be positioned 5’ of the polyA signal sequence. The OE-PCR may comprise a reverse primer that hybridizes to the fourth template, and the reverse primer may hybridize within, or 3’ of, the polyA signal sequence.

[0022] In any aspect of the disclosure, the promoter may be positioned 5’ of all the ORFS in the linear expression cassette. The self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. The self-cleaving peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. The tandem self-cleaving peptides may comprise P2A and T2A.

[0023] One aspect of the disclosure is a linear expression cassette produced according to a method of the disclosure. The linear expression cassette may comprise an ORF encoding a fusion protein comprising an interdomain peptide flanked by an Ig VLdomain and an Ig VHdomain, and a promoter operably linked to at least one of the Ig variable domains. In certain aspects, the interdomain peptide comprise a linker peptide, and the fusion protein may comprise, in order, the Ig VLdomain, the linker peptide, and the Ig VHdomain, or the Ig VHdomain, the linker peptide, and the Ig VLdomain. In certain aspects, the interdomain peptide may comprise a self-cleaving peptide. In such aspects, fusion protein may comprise a self-cleaving peptide flanked by an Ig VLdomain and an Ig VHdomain, the carboxy terminal end of the VH domain being joined to the amino terminal end of Ig CH1 domain, and a promoter operably linked to at least one of the Ig variable domains. In such aspects the fusion protein may comprise in order, the Ig VL domain, the self-cleaving peptide, the Ig VH domain, and the Ig CH1 domain. In certain aspects, the fusion protein may comprise, in order, the Ig VH domain, the Ig CH1 domain, the linker peptide, and the Ig VL domain.

[0024] One aspect of the disclosure is a linear expression cassette produced according to a method of the disclosure, the linear expression cassette comprising an ORF encoding a fusion protein that may comprise, in order, the self-cleaving peptide flanked by an Ig VL domain and an Ig VH domain, an Ig CH1 being domain joined to the carboxy terminal end of the Ig VH domain, an Ig CL domain joined to the carboxy terminal end of the Ig VL domain, and a promoter operably linked to at least one of the Ig variable domains. In certain aspects, the fusion protein.

[0025] One aspect of the disclosure is a linear expression cassette produced according to a method of the disclosure. The linear expression cassette may comprise an ORF encoding a fusion protein in order, the Ig VLdomain, the Ig CLdomain, the self-cleaving peptide, the Ig VHdomain, and the Ig CH1 domain.

[0026] One aspect of the disclosure is a linear expression cassette produced according to a method of the disclosure, the linear expression cassette comprising an ORF encoding a fusion protein that may comprise, in order, the Ig VHdomain, the Ig CH1 domain, the self-cleaving peptide, the Ig VLdomain, and the Ig CLdomain. In certain aspects, the fusion protein may comprise the self-cleaving peptide flanked by an Ig light chain, and an Ig heavy chain, the light chain comprising a VLdomain and a CLdomain, the heavy chain comprising a VHdomain and domains CH1-CH3, and a promoter operably linked to at least one of the Ig variable domains. The fusion protein may comprise, in order, the Ig VLdomain, the Ig CL domain, the self-cleaving peptide, the Ig VH domain, the CH1 domain, the CH2 domain, and the CH3 domain. The fusion protein may comprise, in order, the Ig VH domain,the CH1 domain, the CH2 domain, and the CH3 domain, the self-cleaving peptide, the Ig VLdomain, and the Ig CLdomain. The fusion protein may comprise the structure of the linear expression cassette shown in any one of FIGS.1-11.

[0027] One aspect of the disclosure is a method of producing an antibody, comprising introducing into a cell a linear expression cassette of the disclosure. In certain aspects, the linear expression cassette is produced according to a method of the disclosure.

[0028] On aspect of the disclosure is a kit comprising templates for practicing a method of the disclosure. In certain aspects, the kit may be used to produce a linear expression cassette of the disclosure. In certain aspects, the kit may comprise a first template comprising a promoter, a second template comprising a first ORF encoding an interdomain peptide, and a third template comprising a polyA signal sequence, the third template optionally comprising a WPRE positioned 5’ of the polyA signal sequence, a forward primer that hybridizes to the first template, and a reverse primer that hybridizes to the third template. In certain aspects, the interdomain peptide may encode a linker sequence. In certain aspects, the interdomain peptide may encode a self-cleaving peptide. The forward primer may hybridize 5’ of the promoter. The reverse primer may hybridize to, or 3’ of, the polyA signal sequence. In certain aspects, the third template, may comprise a second ORF encoding an Ig C1 domain, the second ORF being positioned 5’ of the polyA signal sequence and the optional WPRE. The kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the third template. In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the second template, such that when used in an OE-PCR, the first and second ORF are joined in frame, thereby encoding a fusion protein comprising the CH1 domain joined to the self-cleaving peptide. In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, and a fifth template comprising a third ORF encoding an Ig CL domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the third template, and wherein the 3’ end of the fifth template shares an overlapping sequence with the 5’ end of the second template, such that when used in a OE-PCR of the disclosure, the first and third ORF are joined in frame, thereby encoding a fusion protein comprising the CL domain joined to the self-cleaving peptide. In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, and a fifthtemplate comprising a third ORF encoding an Ig CL domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the second template, and wherein the 3’ end of the fifth template shares an overlapping sequence with the 5’ end of the third template, such that when used in a OE-PCR of the disclosure, the first and second ORF are joined in frame, thereby encoding a fusion protein comprising the CH1domain joined to the self-cleaving peptide.

[0029] On aspect of the disclosure is a kit comprising: a first template comprising a promoter, a second template comprising a first ORF encoding a self-cleaving peptide, a third template comprising a polyA signal sequence, a second ORF encoding an Ig CH1 domain positioned 5’ of the polyA signal sequence, and optionally, a WPRE positioned between the second ORF and the polyA signal sequence, a forward primer that hybridizes to the first template, and a reverse primer that hybridizes to the third template. The forward primer may hybridize 5’ of the promoter. The reverse primer may hybridize to, or 3’ of, the polyA signal sequence. In certain aspects, the first ORF may encode a fusion protein comprising an Ig CL domain joined to the self-cleaving peptide. In certain aspects, the first ORF may encode a fusion protein comprising an Ig CL domain joined to the self-cleaving peptide, and the second ORF encodes an Ig CH2 domain joined to the Ig CH1 domain, and an IG CH3 domain joined to the CH2 domain, wherein the carboxy terminal end of the CH1 domain is joined to the amino terminal end of the CH2 domain, and the carboxy terminal end is joined to the amino terminal lend of the CH3 domain , such that the polyA signal sequence is 3’ of the CH3 domain and, optionally, the WPRE positioned between the CH3 domain and the polyA signal sequence. In certain aspects, ORF2 may encode the constant region of an Ig heavy chain.

[0030] One aspect of the disclosure is a kit comprising a first template comprising a promoter, a second template comprising a first ORF encoding a fusion protein comprising an Ig CH1 domain and a self-cleaving peptide, the carboxy terminal end of the Ig CH1 domain being joined to the amino terminal end of the self-cleaving peptide, a third template comprising a polyA signal sequence, and optionally comprising a WPRE 5’ of the polyA signal sequence, a forward primer that hybridizes to the first template, and a reverse primer that hybridizes to the third template. In certain aspects, the forward primer may hybridize 5’ of the promoter. In certain aspects, the reverse primer may hybridize to, or 3’ of, the polyA signal sequence. The third template may comprise a second ORF encoding an Ig CL domain positioned 5’ of the polyA signal sequence, and optionally, a WPRE positionedbetween the second ORF and the polyA signal sequence. The first ORF may encode an Ig CH2 domain joined to the Ig CH1 domain, and an Ig CH3 domain joined to the CH2 domain, wherein the carboxy terminal end of the CH1 domain is joined to the amino terminal end of the CH2 domain, and the carboxy terminal end of the CH2 domain is joined to the amino terminal lend of the CH3 domain, such that the amino terminal end of the self-cleaving peptide is joined o to the carboxy terminal end of the CH3 domain.

[0031] One aspect of the disclosure is a kit comprising a first template comprising a promoter, a second template comprising a first ORF encoding a fusion protein comprising an Ig CH1 domain and a self-cleaving peptide, the carboxy terminal end of the Ig CH1 domain being joined to the amino terminal end of the self-cleaving peptide, a third template comprising a polyA signal sequence, a second ORF encoding the constant region of an Ig heavy chain, the second ORF being positioned 5’of the polyA signal sequence, and optionally a WPRE positioned between the second ORF and the polyA signal sequence, a forward primer that hybridizes to the first template, and a reverse primer that hybridizes to the third template. The forward primer may hybridize 5’ of the promoter. The reverse primer may hybridize to, or 3’ of, the polyA signal sequence.

[0032] One aspect of the disclosure is a kit comprising a first template comprising a promoter, a second template comprising a first ORF encoding the constant region of an Ig heavy chain joined to a self-cleaving peptide, a third template comprising a polyA signal sequence, a second ORF encoding an Ig CLdomain, the second ORF being positioned 5’of the polyA signal sequence and, optionally, a WPRE positioned between the second ORF and the polyA signal sequence, a forward primer that hybridizes to the first template, and a reverse primer that hybridizes to the third template. The forward primer may hybridize 5’ of the promoter. The reverse primer may hybridize to, or 3’ of, the polyA signal sequence.

[0033] Use of a kit of the disclosure for constructing a linear expression cassette for producing an antibody.

[0034] One aspect of the disclosure is a method of protecting an individual against an infectious microorganism, the method comprising administering to the individual a linear expression cassette of the disclosure. The linear expression cassette may be constructed using a method of the disclosure. In certain aspects, the linear expression cassette may encode an antibody that binds to the infectious microorganism.

[0035] One aspect of the disclosure is a method of treating an individual for an infection by an infectious microorganism, the method comprising administering to the individual a linear expression cassette of the disclosure. The linear expression cassette may be constructed using a method of the disclosure. In certain aspects, the linear expression cassette may encode an antibody that binds to the infectious microorganism.

[0036] In any aspect of the disclosure, the promoter may be a CMV promoter. In any aspect of the disclosure, the antibody may be a scFv, a minibody, a diabody, a Fab or a whole antibody. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] FIG.1 illustrates a reaction (top) that produces a linear expression cassette in which an ORF an interdomain peptide is flanked by an ORF encoding an Ig VL domain and an ORF encoding an Ig VH domain (middle). The fusion protein encoded by such a linear expression cassette is illustrated at the bottom of the figure. When the interdomain peptide is a linker sequence, the resulting fusion protein would be a scFv. The left side of the figures illustrates a OE-PCR resulting in a protein in which the VL domain is joined to the amino terminal end of the interdomain peptide and the VH domain is joined to the carboxy terminal end of the interdomain peptide. The right side of the figures illustrates an OE-PCR resulting in a protein in which the VH domain is joined to the amino terminal end of the interdomain peptide and the VL domain is joined to the carboxy terminal end of the interdomain peptide. T1-T5 indicate the templates used in the OE-PCR. PF indicates the forward primer; PR indicates the reverse primer. PSS = polyA signal sequence.

[0038] FIG.2 illustrates a reaction (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide (SCP) is flanked by an ORF encoding an Ig VLdomain and an ORF encoding an Ig VHdomain joined to an Ig CH1 domain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. T1-T6 indicate the templates used in the OE-PCR. PFindicates the forward primer; PRindicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0039] FIG.3 illustrates a reaction (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide (SCP) is flanked by an ORF encoding an Ig VL domain and an ORF encoding an Ig VH domain joined to an Ig CH1 domain (middle). The proteins resulting from translation of such a linear expression cassette areillustrated at the bottom of the figure. In this illustration, the ORF encoding the Ig CH1 domain is encoded by the same template comprising the PSS and the optional WPRE. T1- T5 indicate the templates used in the OE-PCR. PFindicates the forward primer; PRindicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0040] FIG.4 illustrates a reaction (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide (SCP) is flanked by an ORF encoding an Ig VH domain joined to an Ig CH1 domain, and an ORF encoding an Ig VL domain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. T1-T6 indicate the templates used in the OE-PCR. PF indicates the forward primer; PR indicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0041] FIG.5 illustrates a reaction (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an Ig VH domain joined to an Ig CH1 domain, and an ORF encoding an Ig VL domain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the ORF encoding the Ig CH1 domain is encoded by the same template encoding the self-cleaving peptide (e.g., self- cleaving peptide). T1-T5 indicate the templates used in the OE-PCR. PF indicates the forward primer; PRindicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0042] FIG.6 illustrates an OE-PCR (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an Ig VLdomain joined to an Ig CLdomain, and an ORF encoding an Ig VHdomain joined to an Ig CH1 domain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the VL-CL is joined to the amino terminal end of the self-cleaving peptide while the VH-CH is joined to the carboxy terminal end of the self-cleaving peptide. T1-T7 indicate the templates used in the OE-PCR. PF indicates the forward primer; PR indicates the reverse primer. PSS =polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0043] FIG.7 illustrates an OE-PCR (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an Ig VLdomain joined to an ORF encoding an Ig CLdomain, and an ORF encoding an Ig VHdomain joined to an ORF encoding an Ig CH1 domain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the VL-CL is joined to the amino terminal end of the self-cleaving peptide while the VH-CH is joined to the carboxy terminal end of the self-cleaving peptide. In this illustration, the ORF encoding the Ig CH1 domain is encoded by the same template comprising the PSS and the optional WPRE. T1-T5 indicate the templates used in the OE- PCR. PF indicates the forward primer; PR indicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0044] FIG.8 illustrates an OE-PCR (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an Ig VH domain joined to an Ig CH1 domain, and an ORF encoding an Ig VL domain joined to an Ig CL domain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the VH-CH is joined to the amino terminal end of the self-cleaving peptide while the VL-CLis joined to the carboxy terminal end of the self-cleaving peptide. The resulting antibody would be a Fab. T1-T7 indicate the templates used in the OE-PCR. PFindicates the forward primer; PRindicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0045] FIG.9 illustrates an OE-PCR (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an Ig VHdomain joined to an Ig CH1 domain, and an ORF encoding an Ig VLdomain joined to an Ig CLdomain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the VH-CHis joined to the amino terminal end of the self-cleaving peptide while the VL-CLis joined to the carboxy terminal end of the self-cleaving peptide. In this illustration, the ORF encoding the Ig CL domain is encoded by the same template comprising the PSS and the optionalWPRE. The resulting antibody would be a Fab. T1-T7 indicate the templates used in the OE- PCR. PFindicates the forward primer; PRindicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0046] FIG.10 illustrates an OE-PCR (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an IG light chain, and an ORF encoding an Ig heavy chain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the Ig light chain is upstream of the self-cleaving peptide while the Ig heavy chain is downstream of the self-cleaving peptide. In this illustration, the ORF encoding the self-cleaving peptide encodes the Ig CL domain joined to self-cleaving peptide, while the ORF encoding the heavy chain is encoded by the same template comprising the PSS and the optional WPRE. The resulting antibody would be a whole antibody. T1-T5 indicate the templates used in the OE-PCR. PF indicates the forward primer; PR indicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0047] FIG.11 illustrates an OE-PCR (top) that produces a linear expression cassette in which an ORF encoding a self-cleaving peptide is flanked by an ORF encoding an IG heavy chain, and an ORF encoding an Ig light chain (middle). The proteins resulting from translation of such a linear expression cassette are illustrated at the bottom of the figure. In this illustration, the Ig heavy chain is upstream of the self-cleaving peptide while the Ig light chain is downstream of the self-cleaving peptide. In this illustration, the ORF encoding the self-cleaving peptide encodes the constant region of the IG heavy chain joined to self- cleaving peptide, while the ORF encoding the Ig CLdomain is encoded by the same template comprising the PSS and the optional WPRE. The resulting antibody would be a whole antibody. T1-T5 indicate the templates used in the OE-PCR. PFindicates the forward primer; PRindicates the reverse primer. PSS = polyA signal sequence. ECS= enzyme cleavage site; GSG represents a spacer (It should be noted while GSG is illustrated, any appropriate spacer may be used).

[0048] FIGS. 12A-12C show a comparison in antibody production by a plasmid containing an expression cassette and a two-plasmid system in which each plasmid expresses a separate antibody chain. FIG.12A illustrates a plasmid containing an expression cassette encoding the Ig light chain (IgK) and the Ig heavy chain (IgHC) of an antibody. FIG.12B illustrates a two-plasmid system in which the Ig light chain and the Ig heavy chain of an antibody are encoded by two separate plasmids. FIG. 12C shows the amount of antibody produced by transfecting cells with the two plasmids from the two-plasmid system of FIG. 12B (H+L) or the plasmid containing the expression cassette of FIG.12A (p2A).

[0049] FIGS.13A-D illustrate an exemplary five-piece OE-PCR rection for producing a linear expression cassette. FIG.13 A illustrates the five templates used to make an exemplary linear expression cassette: (P1) CMV promoter and enhancer; (P2) immunoglobulin kappa chain variable portion; (P3) immunoglobulin kappa chain constant (IgKc) portion, Furin 2A recognition site, GSG spacer, tandem P2A-T2A (2A) self-cleaving peptide; (P4) immunoglobulin heavy chain variable (IgH) portion; (P5) immunoglobulin heavy chain constant (IgHc) region, woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and bovine growth hormone polyadenylation signal (polyA). FIG. 13B illustrates the sequences of the individual templates joined together to form a linear expression cassette. FIG.13C shows P1-P5 DNA segments run on an agarose gel with a 1kb plus DNA ladder prior to overlapping PCR. FIG.13D shows the full linear antibody expression cassette containing P1-P5 run on an agarose gel with a 1kb plus DNA ladder.

[0050] FIGS.14A-14C demonstrates the utility of antibodies producing the using the disclosed methods. FIG. 14A shows the concentration of IgG produced from purified and unpurified linear expression cassettes transfected into cells. FIG. 14B shows ILT3 binding to H1N1 or H3N2 infected cells in vitro (DAPI, blue; HA, green). FIG. 14C shows the results of a microneutralization assay using an H3N2 virus and the following mAbs: positive control CR8020, negative control VRC-01, ILT3 from heavy and light chains (ILT3 H+L) or expression cassette (ILT32A).

[0051] FIGS.15A and 15B show agarose gel analysis (15A) of amplification products from 15 different OE-PCRs. Each of the resulting linear expression cassettes is 3.9kb in length, FIG.15B shows the concentration of the linear expression cassette in the corresponding reaction in FIG.15A, as determined by biolayer interferometry 5 days post transfection. Significance determined by Mann-Whitney test. DETAILED DESCRIPTION OF THE INVENTION

[0052] The present disclosure relates to methods for the rapid production of antibodies. More specifically, the present disclosure teaches using overlap extension polymerase chain reaction (OE-PCR) to produce a linear expression cassette useful forproducing an antibody. Such linear expression cassettes may comprise an open reading frame (ORF) that may encode, at least, an immunoglobulin (Ig) heavy chain variable (VH) domain and an ORF that may encode an Ig light chain variable (VL) domain. The OE-PCR produces the linear expression cassette by joining together a plurality of templates, the plurality comprising a template containing a promoter sequence, a template that may encode the Ig VHdomain, a template that may encode the Ig VLdomain, and a template that may encode an interdomain peptide. Templates that are to be joined so they are adjacent in the linear expression cassette share overlapping sequences at their ends. By careful design of which templates share overlapping sequences, the templates may be joined in any desired order in the linear expression cassette. Preferably, the templates are joined so that the ORFs in the individual templates are joined to form a fused ORF encoding a single, fusion protein. The template comprising the promoter may be designed so it is incorporated into the linear expression cassette such that it drives expression of any or all ORFs in the linear expression cassette, including the fused ORF encoding the single fusion protein. The template encoding the interdomain peptide may be designed so that is flanked by the Ig VH domain and Ig VL domain encoding templates in the linear expression cassette, such that in the encoded fusion protein the VH and VL domains do not abut one another but are separated by the interdomain peptide. Expression of the linear expression cassette can result in the production of the Ig VH and VL domains, which bind together to form a functional antibody. Such a method of producing an antibody-encoding linear expression cassette from templates encoding various parts of the antibody is beneficial since it allows rapid production of different antibodies. By simply swapping out the Ig VHdomain-encoding template and / or the Ig VLdomain-encoding template, with a template encoding a different Ig VHdomain and / or a templated encoding the Ig VLdomain, the OE-PRRC will produce an entirely different antibody. In certain methods of the disclosure, the linear expression cassette may be introduced into a cell, resulting in production of an antibody.

[0053] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the claims.

[0054] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearlydictates otherwise. For example, a nucleic acid molecule refers to one or more nucleic acid molecules. As such, the terms "a", "an", "one or more" and "at least one" can be used interchangeably. Similarly, the terms "comprising", “containing”, "including" and "having" can be used interchangeably. As used herein, the term “comprising” may be replaced with “consisting of” or with “consisting essentially of” in particular aspect, as desired.

[0055] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements or use of a "negative" limitation.

[0056] Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-expressed basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.

[0057] Unless otherwise expressly stated, certain features of the disclosure, which are, for clarity, described in the context of separate aspects, may also be provided in combination in a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, may also be provided separately or in any suitable sub-combination. All combinations of aspects are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0058] Publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art towhich the disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. Terms and phrases, which are common to the various aspects disclosed herein, are defined below.

[0060] OE-PCR is well known to those skilled in the art. PCR intended for amplifying a single DNA molecule generally uses a single DNA template and two primers that hybridize to the template, resulting in production of numerous DNA molecules each containing the same sequence as the original template (generally referred to as amplification). With regard to PCR, a “template” refers to a nucleic acid molecule, generally but not necessarily a DNA molecule, containing a nucleotide sequence intended to be amplified. As used herein, the terms “template”, “template polynucleotide”, and “template polynucleotide molecule”, may be used interchangeably and refer to nucleic acid molecules, generally a DNA molecule, present in the OE-PCR, that contain sequences intended for incorporation into the linear expression cassette. Briefly, and without intending to limit the method to the following description, OE-PCR is a PCR method in which the reaction mixture contains multiple template polynucleotide molecules, the individual sequences of which are copied and joined together during the reaction to form a single DNA molecule containing the sequence of each template polynucleotide molecule. In effect, the template polynucleotide molecules are “spliced’ together to form a single DNA molecule containing the sequences of all individual template polynucleotides. The method works because template polynucleotide molecules intended to be joined so that their sequences abut one another in the final DNA molecule contain overlapping sequences at or near their ends. An “overlapping sequence” refers to a nucleotide sequence in one polynucleotide molecule that is the reverse complement of a nucleotide sequence in a different polynucleotide molecule. For example, the sequences 5’GCTTATG3’ and the sequence 5’CATAAGC3’ would be considered overlapping sequences since they can hybridize to one another. When two templates contain overlapping sequences, the overlapping sequences can hybridize so that the two templates are held together. Polymerase present in the OE-PCR can then extend the free ends (e.g., the free 3’ end) of each template, resulting in a DNA molecule containing the sequences of the original, two template polynucleotides. OE-PCR can be used to join the sequences of multiple templates. By careful design of the overlapping sequences possessed by each template, the order in which the sequences of the template polynucleotide molecules are joined can be controlled, thereby yielding a linear expression cassette encoding a desiredfusion protein. The length of the over lapping sequences in the templates may be any length that allows the two template molecules containing the overlapping sequences to stably hybridize so that a polymerase can extend the ends of the hybridized templates. In certain aspects, the length of the overlapping sequence may be from about 5 nucleotides to about 100 nucleotides. In certain aspects, the overlapping sequence may be at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, or at least 95 contiguous nucleotides in length.

[0061] In discussing methods of the disclosure, the concepts of the directionality of DNA and sense must be considered. It is well known that DNA contains two strands, each strand made from a series of nucleotides joined together through phosphate bonds. Directionality in DNA refers to the end-end chemical orientation of a single strand of DNA. One end of a single strand of DNA contains a phosphate group attached to the 5’ carbon of the ribose ring, whereas the other end of the strand typically contains an unmodified -OH group attached to the 3’ carbon of the ribose ring. Thus, the single strand is usually referred to as having a 5’ end and a 3’ end. When two DNA molecules hybridize, they orient (“run”) in opposite directions such that nucleotide bases in the 5’ ends of each strand forming bond with complementary nucleotide bases in the 3’ end of the complementary strand. By convention, DNA is depicted as two paired strands, the top strand being oriented 5’-3’ left to right. Thus, the bottom strand is depicted 3’-5’ left to right. DNA strands may also be referred as “sense” strands “or “antisense” strands. A sense strand is a strand of DNA, the nucleotide sequence of which when read 5-3 contains an open reading frame (ORF). The strand complementary to the sense strand is referred to as the anti-sense strand. As noted above, OE-PCRs of the disclosure contain nucleic acid templates, pairs of which contain terminal, overlapping (reverse complementary) sequences so that the templates in the pair hybridize, one template oriented 5’-3 left-right, the hybridized partner template oriented 3’-5’ left to right. Because the intent of the disclosed method is to join various proteins into a fusion protein, if both templates contain an ORF, the sequences of the templates must be designed so that, when incorporated into the linear expression cassette, the individual ORFS are oriented in the same direction (5’-3’) so that they form the fusion protein. From this description, it should be clear that when two templates, each containing an ORF, hybridize, one will be a sense strand and the hybridized partner will be the antisense strand. Thus, to ensure that the ORF encoded by the anti-sense strand is oriented properly sothat it is incorporated into the fusion protein, the anti-sense strand will necessarily contain the reverse complementary sequence of the coding sequence of the ORF. When the sequence of the antisense strand is copied, the copied sequence, which will contain the actual ORF sequence, will be incorporated into the sense strand of the linear expression cassette, helping to form the fused ORF encoding the fusion protein. While conventionally, the sense strand is referred to as “encoding” a protein, for ease of discussion herein, an anti-sense strand comprising the reverse complementary sequence of the coding sequence of an ORF may also be referred to as encoding an ORF since the sequence of the ORF will be present in the linear expression cassette. Thus, a template used in a method of the disclosure may be a sense strand or an anti-sense strand, and either strand may be described as encoding a protein. Moreover, unless stated otherwise, reference to an antisense strand as encoding a protein means the anti- sense strand comprises the reverse complement of the sequence of the ORF for the protein so that when incorporated into the linear expression cassette, the ORF is in the sense strand so that it can join with other ORFS in the sense strand to form a fused ORF encoding a fusion protein.

[0062] As used herein, a “linear expression cassette” is a type of expression cassette resulting from a OE-PCR of the disclosure. A linear expression cassette of the disclosure is a linear (i.e., having a free 5’ end and a free 3’ end) DNA molecule comprising a promoter sequence (aka, a promoter) operably linked to at least one open reading frame (ORF). As used herein, the term “operably linked” means that the promoter and the linked ORF are juxtaposed such that the promoter directs transcription of the ORF. The promoter sequence is generally located, but need not be, at or near the 5’ end of the linear expression cassette. The ORF is generally located 3’ of the promoter. In certain aspects, the ORF may encode a fusion protein. Linear expression cassettes of the disclosure may, but need not, contain elements, such as a polyadenylation (polyA) signal sequence, and elements that stabilize mRNA transcribed from the linear expression cassette. Any suitable polyA signal sequence may be used in methods of the disclosure. One example of such a signal sequence is the bovine growth hormone(bGH) polyA signal sequence, which is represented by SEQ ID NO:10. Thus, in certain aspects, a template and / or a linear expression cassette of the disclosure may comprise a polyA signal sequence comprising, consisting of, or consisting essentially of, SEQ ID NO:10. An example of a stabilization element is a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).An exemplary sequence for a WPRE is represented by SEQ ID NO:9. Thus, in certain aspects, a template and / or a linearexpression cassette of the disclosure may comprise a WPRE comprising, consisting of, or consisting essentially of, SEQ ID NO:9.

[0063] As used herein, a “fusion protein” is a protein comprising two or more amino acid sequences that are joined together in a way not found in nature. The two or more amino acid sequences may, but need not be, from the same organism. In certain aspects, at least one of the wo or more amino acid sequences may be synthetic.

[0064] As used herein, a self-cleaving, antibody producing protein (scAPP), is a fusion protein comprising Ig light chain elements and Ig heavy chain elements necessary for forming a functional antibody, wherein the heavy chain elements and light chain elements are separated by a self-cleaving peptide. Following production of the sc-APP, the self- cleaving peptide cleaves the sc-APP, thereby separating the heavy chain and light chain elements, which then bind to one another, forming a functional antibody.

[0065] As used herein, the term “antibody” collectively refers to immunoglobulins or immunoglobulin-like molecules including by way of example and without limitation, IgA, IgD, IgE, IgG and IgM, combinations thereof, and similar molecules produced during an immune response in any vertebrate, for example, in mammals such as humans, goats, rabbits and mice, as well as non-mammalian species, such as shark immunoglobulins. The term “antibody” includes intact immunoglobulins and “antibody fragments” or “antigen binding fragments” that specifically bind to a molecule of interest (or a group of highly similar molecules of interest) to the substantial exclusion of binding to other molecules (for example, antibodies and antibody fragments that have a binding constant for the molecule of interest that is at least 103M−1greater, at least 104M−1greater or at least 105M−1greater than a binding constant for other molecules in a biological sample unrelated to the molecule of interest). The term “antibody” also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology 3rdunology, Ed., W.H. Freeman & Co., New York, 1997.

[0066] More particularly, “antibody” refers to a polypeptide ligand comprising at least a light chain and / or a heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope of an antigen. Antibodies are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH)region and the variable light (VL) region. Together, in most instances, the VHregion and the VLregion are responsible for binding the antigen recognized by the antibody.

[0067] Typically, an immunoglobulin has heavy (H) chains and light (L) chains interconnected by disulfide bonds. In humans, there are two types of light chain, lambda (λ) and kappa (κ). Methods of the disclosure may use either kappa chain sequences or lambda chain sequences. In humans, there are five main heavy chain classes (or isotypes) which determine the functional activity of an antibody molecule: IgM, IgD, IgG, IgA and IgE. Each heavy and light chain contains a constant region and a variable region, (the regions are also known as “domains”). Methods of the disclosure may use sequences from any isotype. In combination, the heavy and the light chain variable regions specifically bind the antigen. Light and heavy chain variable regions contain a “framework” region interrupted by three hypervariable regions, also called “complementarity-determining regions” or “CDRs”. The extent of the framework region and CDRs have been defined (see, Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1991, which is hereby incorporated by reference). The Kabat database is now maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species.

[0068] The CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, a VH CDR3 is located in the variable domain of the heavy chain of the antibody in which it is found, whereas a VLCDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found. Antibodies with different specificities (i.e., different combining sites for different antigens) have different CDRs. Although it is the CDRs that vary from antibody to antibody, only a limited number of amino acid positions within the CDRs are directly involved in antigen binding. These positions within the CDRs are called specificity determining residues (SDRs).

[0069] The term “antibody” is further intended to encompass digestion fragments, specified portions, derivatives, and variants thereof, including antibody mimetics or comprising portions of antibodies that mimic the structure and / or function of an antibody or specified fragment or portion thereof, including single chain antibodies and fragments thereof. Examples of binding fragments encompassed within the term “antigen bindingportion” of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CLand CH, domains; a F(ab′)2fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fdfragment consisting of the VHand CH, domains; a Fvfragment consisting of the VLand VHdomains of a single arm of an antibody, a dAb fragment (Ward et al. (1989) Nature 341:544-546), which consists of a VHdomain; and an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)). Bird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad Sci. USA 85:5879-5883. Single chain antibodies are also intended to be encompassed within the term “fragment of an antibody.” Any of the above-noted antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for binding specificity and neutralization activity in the same manner as are intact antibodies.

[0070] Non-human antibody sequences may also be used in methods of the disclosure. For example, camelid antibodies (from animals in the family Camelidae) are single domain antibodies that are made from only 2 heavy chains, referred to as heavy chain IgG (hcIgG). While these antibodies may not contain the CH1 region, they retain an antigen binding domain called the VHH region. VHH antibodies, also known as single domain antibodies or Nanobodies®, contain only the VHH region from the camelid antibody. Similarly, sharks also produce antibodies containing only heavy chains.

[0071] “Antibody fragments” or “antigen binding fragments” include proteolytic antibody fragments (such as F(ab′)2fragments, Fab′ fragments, Fab′-SH fragments and Fab fragments as are known in the art), recombinant antibody fragments (such as sFvfragments, dsFvfragments, bispecific sFvfragments, bispecific dsFvfragments, F(ab)′2fragments, single chain Fv proteins (“scFv”), disulfide stabilized Fvproteins (“dsFv”), diabodies, and triabodies (as are known in the art), and camelid antibodies (see, for example, U.S. Pat. Nos. 6,015,695; 6,005,079; 5,874,541; 5,840,526; 5,800,988; and 5,759,808). An scFvprotein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains.

[0072] As used herein, the term “antigen” refers to a compound, composition, or substance that may be specifically bound by the products of specific humoral or cellular immunity, such as an antibody molecule or T-cell receptor. Antigens can be any type of molecule including, for example, haptens, simple intermediary metabolites, sugars (e.g., oligosaccharides), lipids, and hormones as well as macromolecules such as complex carbohydrates (e.g., polysaccharides), phospholipids, and proteins. Common categories of antigens include, but are not limited to, viral antigens, bacterial antigens, fungal antigens, protozoa and other parasitic antigens, tumor antigens, antigens involved in autoimmune disease, allergy and graft rejection, toxins, and other miscellaneous antigens.

[0073] As used herein, “binding affinity” refers to the tendency of one molecule to bind (typically non-covalently) with another molecule, such as the tendency of a member of a specific binding pair for another member of a specific binding pair. A binding affinity can be measured as a binding constant, which binding affinity for a specific binding pair (such as an antibody / antigen pair) can be at least 1×10−5M, at least 1×10−6M, at least 1×10−7M, at least 1×10−8M, at least 1×10−9M, at least 1×10−10M, at least 1×10−11M or at least 1×10−12M. In one aspect, binding affinity is calculated by a modification of the Scatchard method described by Frankel et al., Mol. Immunol., 16:101-106, 1979. In another aspect, binding affinity is measured by an antigen / antibody dissociation rate. In yet another aspect, a high binding affinity is measured by a competition radioimmunoassay. In several examples, a high binding affinity for an antibody / antigen pair is at least about 1×10−8M. In other aspects, a high binding affinity is at least about 1.5×10−8M, at least about 2.0×10−8M, at least about 2.5×10−8M, at least about 3.0×10−8M, at least about 3.5×10−8M, at least about 4.0×10−8M, at least about 4.5×10−8M, or at least about 5.0×10−8M.

[0074] As used herein, the term “neutralizes” means the antibody blocks or reduces the infectivity of an infectious microorganism such as a virus or bacteria. “Infectivity” refers to the ability of a virus or bacteria to enter a host cell, replicate and spread to another host cell. Thus, an antibody of the disclosure may neutralize an infectious microorganism by interfering with any step of the replicative cycle. For example, a neutralizing antibody may inhibit binding of the microorganism to the cell, entry of the microorganism into the cell, in the case of a virus uncoating of the virus and / or escape of the virus from an endocytic vesicle, replication of the microorganism, formation of new microorganisms, and / or release of the microorganism from the infected cell.

[0075] One aspect of the disclosure is a method of producing a linear expression cassette encoding an antibody, the method comprising conducting an OE-PCR in accordance with the illustrated reactions in any one of FIGS.1-11.

[0076] scFv Any Order

[0077] One aspect of the disclosure is a method of producing a linear expression cassette encoding a fusion protein comprising an interdomain peptide flanked by an Ig VL domain and an Ig VH domain, the method comprising performing OE-PCR to join a plurality of templates comprising:

[0078] a set of two Ig variable domain-encoding templates, one member of the set containing a first ORF (ORF1) encoding a VL domain, the other member of the set containing a second ORF (ORF2) that may encode a VH domain,

[0079] a third template containing a third ORF (ORF3) encoding an interdomain peptide,

[0080] a fourth template comprising a polyA signal sequence, and,

[0081] a fifth template containing a promoter,

[0082] thereby constructing the linear expression cassette,

[0083] wherein pairs of templates share overlapping sequences such that in the linear expression cassette, the templates are in the order: the fifth template, one member of the set of Ig variable domain-encoding templates, the third template, the other member of the set of Ig variable domain-encoding templates, the fourth template. It will be understood that the OE-PCR may comprise a forward and a reverse primer that bind to and facilitate amplification of the full-length linear expression cassette. In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer may hybridize 5’ of the promoter in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer may hybridize within, or 3’ of, the polyA signal sequence. Examples of such reactions and the products resulting therefrom are illustrated in FIG.1.

[0084] It will be understood by those of skill in the art that the order in which the templates are joined to produce the linear expression cassette may be controlled by designing the templates such that templates to be joined so that they abut one another in the liner expression cassette share overlapping sequences. For example, to join a first and second template in the order Template 1-Template 2, the first template may have at its 3’ end a sequence that overlaps with (i.e., is the reverse complement of) a sequence at the 5’ end ofthe second template. During the OE-PCR, the first and second templates will hybridize via the overlapping sequences, and the polymerase will extend each template from its 3’end, copying the opposite template. The resulting molecule will have the sequence of the second template joined to the 3’ end of the first template.

[0085] In certain aspects, in the linear expression cassette the ORFs are in the order ORF1-ORF3-ORF2. In certain aspects, in the linear expression cassette the ORFs are in the order ORF2-ORF3-ORF1. It will be understood by those skilled in the art that ORFs’ are made of nucleotide sequences. In certain aspects, the ORFs may be joined in frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fourth ORF encoding the fusion protein. In certain aspects, the fusion protein may comprise, in order, the VL domain, the interdomain peptide, and the VH domain. In certain aspects, the fusion protein may comprise, in order, the VH domain, the interdomain peptide, and the VL domain.

[0086] As noted previously, the template encoding the interdomain peptide is positioned in the linear expression cassette so that it is flanked by the ORFs encoding the Ig VL and Ig VH domains. In certain aspects, the interdomain peptide may comprise a linker peptide. As used herein, a linker peptide is a short sequence of amino acid residues used to separate two regions or domains of a protein such as a fusion protein. In certain aspects, a linker peptide may generally be 3-25, amino acids in length, but may be 3-5, 5-10, 10-115, 15-25, 15-20 or 18-20, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. Any amino acid residue may be used to produce a linker peptide. In proteins in which it is desired that the linker peptide be flexible, it is common to use amino acid residues having small side chains. Examples of such amino acid residues include, but are not limited to, alanine, glycine and serine. As used herein, a spacer is a particular type of linker that is between one and 8 amino acids in lengths. Spacers generally comprise amino acid residues having short side chains, such as, alanine, glycine, and serine. In certain aspects, a spacer may be 3, 4, or 5 amino acids in length, and comprise alanine residues, glycine residues, serine residues, or combinations thereof.

[0087] Linear expression cassettes produced using methods of the disclosure contain a promoter for expressing proteins encoded by ORFs present within the cassette. Any promoter and / or enhancer may be used to express the encoded proteins and suitable promoters and / or enhancers are known to those skilled in the art. An enhancer / promoter exemplified herein is the cytomegalovirus (CMV) enhancer / promoterrepresented by SEQ ID NO:5. While any promoter may be used, in certain aspects, the promoter may comprise, consist of, or consist essentially of, SEQ ID NO:5.

[0088] In certain aspects, the template comprising the interdomain polynucleotide may encode a linker peptide, which may be a spacer peptide. Thus, the linear expression cassette may comprise a nucleotide sequence encoding a linker peptide. In certain aspects, the linker peptide may be flexible so that the VLand VHdomains can interact. In certain aspects, the linear expression cassette may encode a fusion protein comprising an Ig VH domain and an Ig VL domain, wherein the Ig VH domain and the VL domain are joined by a linker peptide. In certain aspects, the fusion protein may comprise a single chain antibody (scFv). In certain aspects, the linear expression cassette may encode a fusion protein in which the carboxy terminal end of the Ig VH domain is joined to the amino terminal end of the linker peptide and the carboxy-terminal end of the linker peptide is joined to the amino terminal end of the Ig VL domain. In certain aspects, the linear expression cassette may encode a fusion protein in which the carboxy terminal end of the Ig VL domain is joined to the amino terminal end of the linker peptide and the carboxy-terminal end of the linker peptide is joined to the amino terminal end of the Ig VH domain.

[0089] In certain aspects, the interdomain polynucleotide may encode a self-cleaving peptide. Thus, the linear expression cassette may comprise a nucleotide sequence encoding a linker peptide. Self-cleaving peptides, which are known to those skilled in art, comprise an amino acid sequence that induces ribosome skipping during translation of mRNA. When placed between coding sequences, ribosome skipping results in the production of two separate proteins. Any self-cleaving peptide may be used. Examples of self-cleaving peptides are the 2A peptides, which is a class of self-cleaving peptides comprising P2A (ATNFSLLKQAGDVEENPGP) (SEQ ID NO:1), E2A (QCTNYALLKLAGDVESNPGP) (SEQ ID NO:2), F2A (VKQTLNFDLLKLAGDVESNPGP) (SEQ ID NO:3), and T2A (EGRGSLLTCGDVEENPGP) (SEQ ID NO:4). In certain aspects, the self-cleaving peptide may be a 2A peptide. In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the interdomain peptide may comprise one or more self-cleaving peptides, which may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, at least one of the one or more self-cleaving peptides is P2A or T2A. In certain aspects, the interdomain peptide may comprise a tandem self-sleaving peptide comprising, or consisting of, P2A and T2A. Incertain aspects, a self-cleaving peptide in a fusion protein of the disclosure may comprise, consist, or consist essentially of, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4. In certain aspects, a template and / or linear expression cassette of the disclosure may comprise a nucleotide sequence encoding a self-cleaving peptide that comprises, consists of, or consist essentially of, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

[0090] In certain aspects, the linear expression cassette may encode a fusion protein comprising an Ig VH domain and an Ig VL domain, wherein the Ig VH domain and the Ig VL domain are joined by one or more self-cleaving peptides. In certain aspects, the one or more self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the one or more self-cleaving peptides may comprise P2A or T2A. In certain aspects, the Ig VH domain and the VL domain may be joined by tandem- self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the Ig VH domain and the VL domain may be joined by tandem-self-cleaving peptides comprising P2A and T2A. In certain aspects, the carboxy terminal end of the Ig VH domain may be joined to the amino terminal end of the one or more self-cleaving peptides and the carboxy-terminal end of the one or more self-cleaving peptides is joined to the amino terminal end of the Ig VL domain. In certain aspects, the carboxy terminal end of the Ig VL domain is joined to the amino terminal end of the one or more self-cleaving peptides and the carboxy-terminal end of the one or more self-cleaving peptides is joined to the amino terminal end of the Ig VH domain.

[0091] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0092] It will be appreciated that because of the manner in which self- cleaving peptides work, the self-cleaving peptide will remain attached to the protein (i.e., a VLdomain, VH, CH1 domain, etc.) at its N-terminal end. While not required to produce a functional antibody, it may be desirable to remove the self-cleaving peptide from the protein to which it is attached. Thus, in certain aspects, the third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site 5’ of, and in frame with, the third ORF. It will be appreciated by those skilled in the art that, throughout the specification, such enzymatic cleavage site is a different cleavage site than the site cleaved by the self-cleaving peptide. In particular, the enzymatic cleavage site in the fusion protein is cleaved by anenzyme external to the encoded fusion protein. For example, the enzymatic cleavage site may be cleaved by a peptidase, which may be a proprotein convertase. Examples of such enzymes include, but are not limited to, furin (PACE), proprotein convertase (PC) 1 (PC1) (PC3), PC2, PC4, PC5 (PC6), and PC7. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the furin cleavage site in the fusion protein may comprise the sequence RXXR (SEQ ID NO:6), wherein “X” represents any amino acid. In certain aspects, the furin cleavage site in the fusion protein may comprise RXKR (SEQ ID NO:7) or RXRR (SEQ ID NO:8). In certain aspects, the third template may also encode a spacer between the enzymatic cleavage site and the third ORF. Thus, in certain aspects, the third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the third ORF.

[0093] In certain aspects, of the disclosure, the Ig VH and Ig VL domains may, but need not, originate from the same antibody.

[0094] One aspect of the disclosure is a method of producing a linear expression cassette encoding a fusion protein comprising an interdomain peptide flanked by an Ig VL domain and an Ig VH domain, the method comprising performing OE-PCR to join a plurality of templates comprising:

[0095] a first template containing a first ORF (ORF1) encoding an Ig VL domain,

[0096] a second template containing a second ORF (ORF2) encoding Ig VH domain,

[0097] a third template containing a third ORF (ORF3) encoding an interdomain peptide, and

[0098] a fourth template containing a polyA signal sequence, and,

[0099] a fifth template comprising a promoter,

[0100] thereby producing the linear expression cassette,

[0101] wherein pairs of templates share overlapping sequences such that in the linear expression cassette, the promoter is positioned so that it is operably joined to one or more ORFs in the linear expression cassette, and the ORFs are in the order ORF1-ORF- 3-ORF-2, or ORF2-ORF3-ORF1. In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter in the fifth template. In certain aspects, the OE-PCR may comprise areverse primer that hybridizes to the fourth template. In certain aspects, the revere primer may hybridize within, or 3’ of, the polyA signal sequence.

[0102] In certain aspects, the fifth template may be designed so it is positioned in the linear expression cassette 5’ of all the ORFs. In certain aspects, the promoter may be at, or near, the 5’ end of the linear expression cassette. In certain aspects, the fifth template may lack an overlapping sequence at its 5’ end. In certain aspects, the templates may comprise overlapping sequences so that in the linear expression cassette, they are in the order: fifth template-first template-third template-second template-fourth template. In certain aspects, the templates may comprise overlapping sequences so that in the linear expression cassette, they are in the order: fifth template-second template-third template-first template-fourth template.

[0103] In certain aspects, the 3’ end the fifth template shares an overlapping sequence with the 5’ end of the first template, the 3’ end of the first template shares an overlapping sequence with the 5’ end of the third template, the 3’ end of the third template shares an overlapping sequence with the 5’ end of the second template, and the 3’ end of the second template shares an overlapping sequence with the 5’ end of the fourth template.

[0104] In certain aspects, the 3’ end the fifth template shares an overlapping sequence with the 5’ end of the second template, the 3’ end of the second template shares an overlapping sequence with the 5’ end of the third template, the 3’ end of the third template shares an overlapping sequence with the 5’ end of the first template, and the 3’ end of the first template shares an overlapping sequence with the 5’ end of the fourth template.

[0105] In certain aspects, the ORFs may be joined in frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fourth ORF (ORF4) encoding the fusion protein. In certain aspects, the fusion protein may comprise, in order, the VLdomain, the interdomain peptide, and the VHdomain. In certain aspects, the fusion protein may comprise, in order, the VHdomain, the interdomain peptide, and the VLdomain.

[0106] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0107] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0108] Antibodies Comprising Constant Domains

[0109] In addition to the Ig VHand Ig VLdomains, certain antibodies encoded by linear expression cassettes of the disclosure may comprise other antibody domains. In certain aspects, the antibody encoded by the linear expression cassette may comprise an Ig VHand / or VLconstant region.

[0110] A. VL-SCP-VH-CH1

[0111] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising:

[0112] performing OE-PCR to join a plurality of templates comprising,

[0113] a first template containing a first ORF (ORF1) encoding an Ig VL domain,

[0114] a second template containing a second ORF (ORF2) encoding a self- cleaving peptide,

[0115] a third template containing a third ORF (ORF3) encoding an Ig VH domain,

[0116] a fourth template containing a fourth ORF (ORF4) encoding an Ig CH1 domain,

[0117] a fifth template containing a polyadenylation sequence, and,

[0118] a sixth template comprising a promoter,

[0119] thereby constructing the linear expression cassette,

[0120] wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction and the products resulting therefrom is illustrated in FIG.2.

[0121] In certain aspects, the 3’ end of the sixth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences. In certain aspects, the 3’ end of the fourth template and the 5, end of the fifth template share overlapping sequences.

[0122] In certain aspects, the 3’ end of the sixth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the firsttemplate, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3, end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, and the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template. In certain aspects, the linear expression cassette may comprise, in order, the sixth template, the first template, the second template, the third template, the fourth template, and the fifth template.

[0123] In certain aspects, all the ORFs may be joined in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, the Ig VL domain, the self-cleaving peptide, the Ig VH domain, and the Ig CH1 domain.

[0124] In certain aspects, the fifth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0125] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptides may comprise P2A or T2A. In certain aspects, the self-cleaving peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0126] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site 5’ of the second ORF. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the second ORF.

[0127] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the sixth template. In certain aspects, the forward primer may hybridize 5’ of the promoter sequence in the sixth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fifth template. In certain aspects, the reverse primer may hybridize within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a minibody or a diabody.

[0128] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0129] A. VL-SCP-VH-CH1

[0130] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0131] performing OE-PCR to join a plurality of templates comprising,

[0132] a first template containing a first ORF (ORF1) encoding an Ig VL domain,

[0133] a second template containing a second ORF (ORF2) encoding a self- cleaving peptide,

[0134] a third template containing a third ORF (ORF3) encoding an Ig VH domain,

[0135] a fourth template comprising a polyadenylation sequence and containing a fourth ORF (ORF4) encoding an Ig CH1 domain located 5’ of the polyA signal sequence, and,

[0136] a fifth template comprising a promoter,

[0137] thereby constructing the linear expression cassette,

[0138] wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. In certain aspects, the promoter is positioned in the linear expression cassette 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.3.

[0139] In certain aspects, the 3’ end of the fifth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences.

[0140] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence inthe 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template. In certain aspects, the linear expression cassette may comprise, in order, the fifth template, the first template, the second template, the third template, and the fourth template.

[0141] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0142] In certain aspects, all the ORFs may be joined in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, the Ig VL domain, the self-cleaving peptide, the Ig VH domain, and the Ig CH1 domain.

[0143] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the self-cleaving peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0144] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site 5’ of the second ORF. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the second ORF.

[0145] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a minibody or a diabody.

[0146] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0147] B VH-CH1-SCP-VL

[0148] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0149] performing OE-PCR to join a plurality of templates comprising,

[0150] a first template containing a first ORF (ORF1) encoding an Ig VHdomain,

[0151] a second template containing a second ORF (ORF2) encoding an Ig CH1 domain;

[0152] a third template comprising a third ORF (ORF3) encoding a self- cleaving peptide,

[0153] a fourth template containing a fourth ORF (ORF4) encoding an Ig VL domain,

[0154] a fifth template containing a polyadenylation sequence, and,

[0155] a sixth template containing a promoter,

[0156] thereby constructing the linear expression cassette,

[0157] wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.4.

[0158] In certain aspects, the 3’ end of the sixth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences. In certain aspects, the 3’ end of the fourth template and the 5’ end of the fifth template share overlapping sequences.

[0159] In certain aspects, the 3’ end of the sixth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, and the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template.

[0160] In certain aspects, the fifth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence.

[0161] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fourth ORF may encode a fusion protein that may comprise, in order, the Ig VHdomain, the Ig CH1 domain, the self-cleaving peptide, and the Ig VLdomain.

[0162] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the one or more self- cleaving peptides may comprise P2A or T2A. In certain aspects, the interdomain peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0163] In certain aspects, the third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site 5’ of the third ORF. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the second ORF.

[0164] In certain aspects, the OE-PCR may a forward primer that hybridizes to the sixth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the sixth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fifth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a minibody or a diabody.

[0165] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0166] B VH-CH1-SCP-VL

[0167] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0168] performing OE-PCR to join a plurality of templates comprising,

[0169] a first template containing a first ORF (ORF1) encoding an Ig VHdomain,

[0170] a second template containing a second ORF (ORF2) encoding an Ig CH1 domain and a self-cleaving peptide, the CH1 domain being positioned upstream of the self-cleaving peptide;

[0171] a third template containing a third ORF (ORF3) encoding an Ig VLdomain,

[0172] a fourth template containing a polyadenylation sequence, and,

[0173] a fifth template containing a promoter,

[0174] thereby constructing the linear expression cassette,

[0175] wherein pairs of templates share overlapping sequences such that in the linear expression cassette the promoter is positioned to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.5.

[0176] It will be appreciated by those skilled in the art that, with regard to a protein, an element referred to as ‘upstream” to a second element is positioned on the side of the second element that is nearest the amino terminal end of the protein. Similarly, an element referred to as ‘downstream” to a second element is positioned on the side of the second element that is nearest the carboxyl terminal end of the protein.

[0177] In certain aspects, the 3’ end of the fifth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences.

[0178] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template.

[0179] In certain aspects, the third template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence.

[0180] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fourth ORF. In certain aspects, the fourth ORF may encode a fusion protein that may comprise, in order, the Ig VHdomain, the Ig CH1 domain, the interdomain peptide, and the Ig VLdomain.

[0181] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the one or more self- cleaving peptides may comprise P2A or T2A. In certain aspects, the self-cleaving peptide may comprise a tandem self-cleaving peptide that may comprise at least two peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0182] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site located between the coding sequence for the Ig CH1 domain and the coding sequence for the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide.

[0183] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a minibody or a diabody.

[0184] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0185] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0186] performing OE-PCR to join a plurality of templates comprising,

[0187] a set of two Ig variable domain-encoding templates, wherein one member of the set contains a first ORF (ORF1) encoding an Ig VL domain, and the other member of the set contains a second ORF (ORF2) encoding an Ig VH domain,

[0188] a third template containing a third ORF (ORF3) encoding an Ig constant domain and a self-cleaving peptide, the CH1 domain being positioned upstream of the self-cleaving peptide;

[0189] a fourth template containing a fourth ORF (ORF4) encoding an Ig constant region,

[0190] a fifth template comprising a polyA signal sequence,

[0191] a sixth template containing a promoter,

[0192] thereby constructing the linear expression cassette,

[0193] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the templates are in the order: the sixth template, one member of the pair of templates encoding an Ig variable domain, the third template, the other member of the pair of templates encoding an Ig variable domain, the fourth template, and the fifth template, wherein the Ig constant region encoded by the third template is from the same type(i.e., heavy or light) of chain as the as the Ig variable domain encoded by the one member of the pair of templates to which the 5’ end of the third template is joined, and wherein the Ig constant region encoded by the fourth template is from the same chain as the Ig variable domain encoded by the other member of the pair of templates to which the 5’ end of the fourth template is joined.

[0194] In certain aspects, the promoter may be positioned 5’ of all the ORFs. In certain aspects, the antibody may be a fragment antigen-binding (Fab) antibody.

[0195] In certain aspects, the 3’ end of the fifth template and the 5’ end of the one member of the pair of templates may share overlapping sequences. In certain aspects, the 3’ end of the one member of the pair of templates and the 5’ end of the third template may share overlapping sequences. In certain aspects, the 3’ end of the template and the 5’ end of the other member of the pair of templates may share overlapping sequences. In certain aspects, the 3’ end of the other member of the pair of templates and the 5’ end of the fourth template may share overlapping sequences. In certain aspects, the 3’ end of the fourth template and the 5’ end of the fifth template may share overlapping sequences.

[0196] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the one member of the pair of templates, the 3’ end of the one member of the pair of templates may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotide sequence that overlapswith a nucleotide sequence in the 5’ end of the other member of the pair of templates, the other member of the pair of templates may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, and the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template.

[0197] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, an Ig V domain, an Ig C1 domain from the same chain type as the V domain to which its N- terminal end is joined, the self-cleaving peptide, an Ig V domain of the opposite chain type as the upstream Ig V domain in the fusion protein, and an Ig C1 domain from the same chain type as the V domain to which its N-terminal end is joined.

[0198] In certain aspects, of the disclosure, the Ig VH and Ig VL domains may, but need not, originate from the same antibody.

[0199] VLCL-SCP-VH-CH

[0200] In certain aspects, the one member of the pair of templates may encode a VL domain, the other member of the pair of templates may encode a VH domain, the third template may encode a fusion protein comprising an IG CL domain joined to a self- cleaving peptide, and the fourth template may encode a CH1 domain. In certain aspects, the carboxy terminal end of the Ig CLdomain is joined to the amino terminal end of the self- cleaving peptide. In such aspects, all the ORFs may be joined in-frame in the linear expression cassette so that they form a fifth ORF encoding, in order, an Ig VLdomain, an Ig CLdomain, the self -cleaving peptide, an Ig VHdomain, and an Ig CH1 domain.

[0201] VHCH1-SCP-VL-CL1

[0202] In certain aspects, the one member of the pair of templates may encoded a VHdomain, the other member of the pair of templates may encode a VLdomain, the third template may encode a fusion protein comprising an IGCH1 domain joined to the self-cleaving peptide, and the fourth template may encode a CLdomain. In certain aspects, the carboxy terminal end of the Ig CH1 domain may be joined to the amino terminal end of the self-cleaving peptide. In such aspects, all the ORFs may be joined in-frame in the linear expression cassette so that they form a fifth ORF encoding, in order, an Ig VHdomain, an Ig CH domain, the self -cleaving peptide, an Ig VL domain, and an Ig CL1 domain.

[0203] In certain aspects, the fifth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence.

[0204] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the interdomain peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0205] In certain aspects, the third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site located between the coding sequence for the Ig CH1 domain and the coding sequence for the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide.

[0206] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the sixth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the sixth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fifth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a Fab.

[0207] In certain aspects, of the disclosure, the Ig VH and Ig VL domains may, but need not, originate from the same antibody.

[0208] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0209] performing OE-PCR to join a plurality of templates comprising,

[0210] a first template comprising a first ORF (ORF1) encoding a VLdomain,

[0211] a second template comprising a second ORF (ORF2) encoding a CLdomain,

[0212] a third template containing a third ORF (ORF3) encoding a self- cleaving peptide,

[0213] a fourth template containing a fourth ORF (ORF4) encoding an Ig VH domain

[0214] a fifth template comprising a fifth ORF (ORF5) encoding an Ig CH1 domain,

[0215] a sixth template comprising a polyadenylation signal sequence, and,

[0216] a seventh template containing a promoter,

[0217] thereby constructing the linear expression cassette,

[0218] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4-ORF5. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.6.

[0219] In certain aspects, the 3’ end of the seventh template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences. In certain aspects, the 3’ end of the fourth template and the 5’ end of the fifth template share overlapping sequences. In certain aspects, the 3’ end of the fifth template and the 5’ end of the sixth template share overlapping sequences.

[0220] In certain aspects, the 3’ end of the seventh template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template, and the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the sixth template.

[0221] In certain aspects, the sixth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence.

[0222] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a sixth ORF. In certain aspects, the sixth ORF may encode a fusion protein that may comprise, in order, the Ig VLdomain, the Ig CL domain, the self-cleaving peptide, the Ig VHdomain, and the Ig CH1 domain.

[0223] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the interdomain peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0224] In certain aspects, the third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site 5’ of the third ORF. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the second ORF.

[0225] In certain aspects, the OE-PCR may a forward primer that hybridizes to the seventh template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the seventh template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the sixth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a Fab.

[0226] In certain aspects, of the disclosure, the Ig VH and Ig VL domains may, but need not, originate from the same antibody.

[0227] VL-CL-SCP-VH-CH1

[0228] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0229] performing OE-PCR to join a plurality of templates comprising,

[0230] a first template comprising a first ORF (ORF1) encoding a VLdomain,

[0231] a second template comprising a second ORF (ORF2) encoding an Ig CLdomain and a self-cleaving peptide, the CLdomain being positioned upstream of the self- cleaving peptide,

[0232] a third template containing a third ORF (ORF3) encoding an Ig VH domain,

[0233] a fourth template containing a fourth ORF (ORF4) encoding an Ig CH1 domain, and comprising a polyA signal sequence, wherein the polyA signal sequence is positioned 3’ of ORF4, and,

[0234] a fifth template containing a promoter,

[0235] thereby constructing the linear expression cassette,

[0236] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.7.

[0237] In certain aspects, the 3’ end of the fifth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences.

[0238] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template.

[0239] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0240] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, the Ig VLdomain, the Ig CLdomain, the self-cleaving peptide, the Ig VHdomain, and the Ig CH1 domain.

[0241] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the interdomain peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0242] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site located between the coding sequence for the Ig CL domain and the coding sequence for the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide.

[0243] In certain aspects, the OE-PCR may a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a Fab.

[0244] In certain aspects of the disclosure, ORF4 in the fourth template may encode additional Ig domains. Thus, in certain aspects, ORF4 may encode a CH2 domain and a CH3 domain, wherein the carboxy terminal end of the CH1 domain is joined to the amino terminal end of the CH2 domain and the carboxy terminal end of the CH2 domain is joined to the amino terminal end of the CH3 domain. In such aspect, the fusion protein may comprise, in order, the Ig VLdomain, and the Ig CLdomain, the interdomain peptide, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3 domain. In such aspects, the antibody may be an intact antibody. In certain aspects, the polyA signal sequence is 3’ of the Ig CH3 domain. In certain aspects, a WPRE may be positioned between the carboxy terminal end of the Ig CH3 domain and the polyA signal sequence.

[0245] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0246] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising

[0247] performing OE-PCR to join a plurality of templates comprising,

[0248] a first template comprising a first ORF (ORF1) encoding an Ig VHdomain,

[0249] a second template comprising a second ORF (ORF2) encoding an Ig CH1 domain,

[0250] a third template containing a third ORF (ORF3) encoding a self- cleaving peptide,

[0251] a fourth template containing a fourth ORF (ORF4) encoding an Ig VL domain,

[0252] a fifth template comprising a fifth ORF (ORF5) encoding an Ig CL domain,

[0253] a sixth template comprising a polyadenylation signal sequence, and,

[0254] a seventh template containing a promoter,

[0255] thereby constructing the linear expression cassette,

[0256] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4-ORF5. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.8.

[0257] In certain aspects, the 3’ end of the seventh template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences. In certain aspects, the 3’ end of the fourth template and the 5’ end of the fifth template share overlapping sequences. In certain aspects, the 3’ end of the fifth template and the 5’ end of the sixth template share overlapping sequences.

[0258] In certain aspects, the 3’ end of the seventh template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template may comprise a nucleotidesequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template, the 3’ end of the fourth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fifth template, and the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the sixth template.

[0259] In certain aspects, the sixth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence.

[0260] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a sixth ORF. In certain aspects, the sixth ORF may encode a fusion protein that may comprise, in order, the Ig VH domain, the Ig CH1 domain, the self-cleaving peptide, the Ig VL domain, and the Ig CL domain.

[0261] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the interdomain peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0262] In certain aspects, the third template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site 5’ of the third ORF. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the third template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the third ORF.

[0263] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the seventh template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the seventh template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the sixth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a Fab.

[0264] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0265] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising,

[0266] a first template comprising a first ORF (ORF1) encoding a VHdomain,

[0267] a second template comprising a second ORF (ORF2) encoding an Ig CH1 domain and a self-cleaving peptide, the CH1 domain being positioned upstream of the self-cleaving peptide,

[0268] a third template containing a third ORF (ORF3) encoding an Ig VLdomain,

[0269] a fourth template comprising a polyA signal sequence and containing a fourth ORF (ORF4) encoding an Ig CL domain, the polyA signal sequence being positioned 3’ of ORF4, and,

[0270] a fifth template containing a promoter,

[0271] thereby constructing the linear expression cassette,

[0272] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFs are in the order ORF1-ORF2-ORF3-ORF4. In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.9.

[0273] In certain aspects, the 3’ end of the fifth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences.

[0274] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template.

[0275] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0276] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, the Ig VH domain, the Ig CH1 domain, the self-cleaving peptide, the Ig VL domain, and the Ig CL domain.

[0277] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the interdomain peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0278] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site located between the coding sequence for the Ig CL domain and the coding sequence for the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide.

[0279] In certain aspects, the OE-PCR may a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a Fab.

[0280] In certain aspects of the disclosure, ORF2 in the second template may encode additional Ig domains. In certain aspects, ORF2 may encode a CH2 domain and a CH3 domain, wherein the carboxy terminal end of the CH1 domain is joined to the amino terminal end of the CH2 domain and the carboxy terminal end of the CH2 domain is joined to the amino terminal end of the CH3 domain. In such aspect, the fusion protein may comprise, in order, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3, the self-cleaving peptide, the Ig VL domain, and the Ig CL domain. In such aspects, the antibody may be a whole antibody. In such aspects, the second template may comprise the first nucleic acid sequenceencoding the enzymatic cleavage site located between the coding sequence for the Ig CH3 domain and the coding sequence for the self-cleaving peptide.

[0281] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0282] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising,

[0283] a first template comprising a first ORF encoding an Ig VL domain,

[0284] a second template comprising a second ORF (ORF2) encoding an Ig CL domain and a self-cleaving peptide, the CL domain being positioned upstream of the self- cleaving peptide,

[0285] a third template comprising at third ORF encoding a VH domain;

[0286] a fourth template comprising a polyA signal sequence and containing a fourth ORF (ORF4) encoding an Ig heavy chain constant region; and,

[0287] a fifth template comprising a promoter,

[0288] thereby constructing the linear expression cassette,

[0289] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFS are in the order: ORF1-ORF2-ORF3-ORF4. In certain aspects, the Ig heavy chain constant region comprises the CH1 domain, the CH2 domain, and the CH3 domain.

[0290] In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.10.

[0291] In certain aspects, the 3’ end of the fifth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences.

[0292] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence inthe 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template.

[0293] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0294] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, the Ig VL domain, the Ig CL domain, the self-cleaving peptide, the Ig VH domain, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3 domain.

[0295] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the self-cleaving peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0296] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site located between the coding sequence for the Ig CL domain and the coding sequence for the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide.

[0297] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a whole antibody.

[0298] In certain aspects, of the disclosure, the Ig VHand Ig VLdomains may, but need not, originate from the same antibody.

[0299] One aspect of the disclosure is a method of constructing a linear expression cassette for producing an antibody, the method comprising performing OE-PCR to join a plurality of templates comprising,

[0300] a first template comprising a first ORF encoding an Ig VHdomain,

[0301] a second template comprising a second ORF encoding heavy chain constant region and a self-cleaving peptide, the heavy chain constant region being positioned upstream of the self-cleaving peptide,

[0302] a third template comprising at third ORF encoding a VL domain;

[0303] a fourth template comprising a polyA signal sequence and containing a fourth ORF (ORF4) encoding an Ig CL domain, and,

[0304] a fifth template comprising a promoter,

[0305] thereby constructing the linear expression cassette,

[0306] wherein pairs of templates share overlapping sequences such that the promoter is positioned in the linear expression cassette to drive expression of all the ORFs, and the ORFS are in the order: ORF1-ORF2-ORF3-ORF4.

[0307] In certain aspects, the promoter is positioned 5’ of all the ORFs. An example of such a reaction, and the products resulting therefrom, is illustrated in FIG.11.

[0308] In certain aspects, the 3’ end of the fifth template and the 5’ end of the first template share overlapping sequences. In certain aspects, the 3’ end of the first template and the 5’ end of the second template share overlapping sequences. In certain aspects, the 3’ end of the second template and the 5’ end of the third template share overlapping sequences. In certain aspects, the 3’ end of the third template and the 5’ end of the fourth template share overlapping sequences.

[0309] In certain aspects, the 3’ end of the fifth template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the first template, the 3’ end of the first template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the second template, the 3’ end of the second template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, and the 3’ end of the third template may comprise a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template.

[0310] In certain aspects, the fourth template may comprise a WPRE. In such aspects, the WPRE may be located 5’ of the polyA signal sequence. In certain aspects, the WPRE is located between ORF4 and the polyA signal sequence.

[0311] In certain aspects, all the ORFs may be in-frame in the linear expression cassette so that the nucleotide sequences of all the ORFs form a fifth ORF. In certain aspects, the fifth ORF may encode a fusion protein that may comprise, in order, the Ig VH domain, the Ig CH1 domain, the Ig CH2 domain, and the Ig CH3 domain, the self- cleaving peptide, the Ig VL domain, and the Ig CL domain.

[0312] In certain aspects, the self-cleaving peptide may be selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the self-cleaving peptide may comprise P2A or T2A. In certain aspects, the self-cleaving peptide may comprise tandem-self-cleaving peptides selected from the group consisting of P2A, E2A, F2A, and T2A. In certain aspects, the tandem self-cleaving peptides may comprise P2A and T2A.

[0313] In certain aspects, the second template may comprise a first nucleic acid sequence encoding an enzymatic cleavage site located between the coding sequence of the heavy chain constant region and the coding sequence for the self-cleaving peptide. In certain aspects, the enzymatic cleavage site may be a furin cleavage site. In certain aspects, the second template may comprise a second nucleic acid sequence encoding a spacer, the second nucleic acid sequence being positioned between the first nucleic acid sequence and the coding sequence for the self-cleaving peptide.

[0314] In certain aspects, the OE-PCR may comprise a forward primer that hybridizes to the fifth template. In certain aspects, the forward primer hybridizes 5’ of the promoter sequence in the fifth template. In certain aspects, the OE-PCR may comprise a reverse primer that hybridizes to the fourth template. In certain aspects, the reverse primer hybridizes within, or 3’ of, the polyA signal sequence. In certain aspects, the antibody is a whole antibody.

[0315] In these aspects, the method may comprise obtaining the nucleotide sequence of a VLdomain and synthesizing, or having synthesized, the template comprising the VLdomain. In these aspects, the method may comprise obtaining the nucleotide sequence of a VHdomain and synthesizing, or having synthesized, the template comprising the VHdomain.

[0316] In certain aspects, of the disclosure, the Ig VH and Ig VL domains may, but need not, originate from the same antibody.

[0317] Linear Expression Cassettes

[0318] One aspect of the disclosure is a linear expression cassette produced using a method of the disclosure. In certain aspects, the linear expression cassette may comprise the general structure illustrated in any one of FIGS. 1-11. In certain aspects, the linear expression cassette may encode any an antibody. Any type of antibody may be encoded by the linear expression cassette. In certain aspects, the linear expression cassette may encode a scFv, a minibody, a diabody, a Fab or a whole antibody.

[0319] In certain aspects, the linear expression cassette may comprise an ORF encoding a fusion protein comprising an interdomain peptide flanked by an Ig VL domain and an Ig VH domain, and a promoter operably linked to the ORF (e.g., FIGS.1-11). In certain aspects, the interdomain peptide may comprise a linker peptide. In certain aspects, the fusion protein may comprise, in order, the Ig VL domain, the linker peptide, and the Ig VH domain. (FIGS. 1-3, 6, 7, 10) In certain aspects, the fusion protein may comprise, in order, the Ig VH domain, the linker peptide, and the Ig VL domain. (FIGS. 4, 5, 8, 9, 11) In certain aspects, the interdomain peptide may comprise a self-cleaving peptide.

[0320] In certain aspects, the linear expression cassette may comprise an ORF encoding a fusion protein comprising an interdomain peptide flanked by an Ig VL domain and an Ig VH domain, an Ig CH1 domain joined to the Ig VH domain, and a promoter operably linked to the ORF (FIGS.2-11). In certain aspects, the fusion protein may comprise, in order, the Ig VLdomain, the interdomain peptide, the Ig VHdomain, and the Ig CH1 domain. (FIGS. 2, 3, 6, 7, 10) In certain aspects, the fusion protein may comprise, in order, the Ig VHdomain, the Ig CH1 domain, the linker peptide, and the Ig VLdomain. (FIGS.4, 5, 8, 9, 11) In certain aspects, the interdomain peptide may comprise a self-cleaving peptide.

[0321] In certain aspects, the linear expression cassette may comprise an ORF encoding a fusion protein comprising an interdomain peptide flanked by an Ig VLdomain and an Ig VHdomain, an Ig CH1 domain joined to the Ig VHdomain, an Ig CLdomain joined to the Ig VLdomain, and a promoter operably linked to the ORF. (FIGS. 6-11). In certain aspects, the interdomain peptide may comprise a self-cleaving peptide. In certain aspects, the fusion protein may comprise, in order, the Ig VLdomain, the Ig CLdomain, the interdomain peptide, the Ig VHdomain, and the Ig CH1 domain. (FIGS. 6, 7, 10) In certain aspects, the fusion protein may comprise, in order, the Ig VHdomain, the Ig CH1 domain, the linker peptide, the Ig VL domain, and the Ig CL domain. (FIGS.8, 9, 11)

[0322] In certain aspects, the linear expression cassette may comprise an ORF encoding a fusion protein comprising an interdomain peptide flanked by an Ig light chain, and an Ig heavy chain, the light chain comprising a VLdomain and a CLdomain, the heavy chain comprising a VHdomain and domains CH1-CH3, and a promoter operably linked to the ORF (FIGS.10 & 11). In certain aspects, the interdomain peptide may comprise a self- cleaving peptide. In certain aspects, the fusion protein may comprise, in order, the Ig VLdomain, the Ig CL domain, the interdomain peptide, the Ig VH domain, the CH1 domain, the CH2 domain, and the CH3 domain. (FIG. 10) In certain aspects, the fusion protein may comprise, in order, the Ig VH domain, the CH1 domain, the CH2 domain, and the CH3 domain, the linker peptide, the Ig VL domain, and the Ig CL domain. (FIG. 11) In certain aspects, the linear expression cassette may comprise the structure of the linear expression cassette shown in any one of FIGS.1-11.

[0323] Method of Producing an Antibody

[0324] One aspect of the disclosure is a method of producing an antibody, comprising introducing into a cell a linear expression cassette of the disclosure. Any antibody that may be encoded by a linear expression cassette of the disclosure may be produced. In certain aspects, the antibody may be a scFv, a minibody, a diabody, a Fab, or a whole antibody.

[0325] Any cell capable of transcribing the linear expression cassette to produce a mRNA molecule may be used to produce an antibody. Examples of such cells include, but are not limited to, mammalian cells, insect cells, fungal cells, and plant cells. Examples of mammalian cells useful for producing antibodies include, but are not limited to, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, murine myeloma cells (e.g., NS0 cells), NS), and human embryonic retinal cells (e.g., PER.C6 cells).

[0326] Any method of introducing DNA into a cell may be used to introduce the linear expression cassette into a cell. Examples of such methods include, but are not limited to, chemical methods, such as the use of cationic polymers, calcium phosphate, cationic lipids, and / or cationic amino acids, and physical methods, such as micro injection, biolistic particle delivery, electroporation, and laser-based transfection.

[0327] In certain aspects, the linear expression cassette may, but need not, be isolated from the OE-PCR. As used herein, the term “isolated” does not necessarily refer to a specific degree of purification, but instead refers to decreasing the level of one or more component of the OE-PCR. Examples of such components may include salts, unincorporatedtemplates, unincorporated primers, and the polymerase protein. For example, the once the OE-PCR is finished, the reaction mixture may be passed through a chromatography column to remove salts. The resulting mixture would contain an isolated linear expression cassette. In certain aspects, one or more components of the PCR may be eliminated to produce the isolated linear expression cassette.

[0328] The methods of the disclosure are particularly useful for rapidly producing antibodies. Once the sequence of a VH domain and a VL domain are known, templates comprising such sequences can be rapidly generated, and antibodies containing the VH and VL domains produced using the methods disclosed herein.

[0329] Kits

[0330] One aspect of the disclosure is a kit comprising templates and primers for practicing a method of the disclosure. In one aspect, the kit may comprise a first template comprising a promoter, a second template comprising a first ORF encoding an interdomain peptide, and a third template comprising a polyA signal sequence, the third template optionally comprising a WPRE 5’ of the polyA signal sequence, a forward primer that hybridizes to the first template, and a reverse primer that hybridizes to the third template. (e.g., FIG.1) In certain aspects, the interdomain peptide may encode a linker sequence. In certain aspects, the interdomain peptide may encode a self-cleaving peptide. In certain aspects, the forward primer hybridizes 5’ of the promoter. In certain aspects, the reverse primer hybridizes to, or 3’ of, the polyA signal sequence. In certain aspects, the third template may, optionally, comprise a second ORF encoding an Ig C1 domain, the second ORF being positioned 5’ of the polyA signal sequence and the optional WPRE. (e.g., FIG.3)

[0331] In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the third template. (e.g., FIG.2)

[0332] In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the second template, such that when used in an OE-PCR, the first and second ORF are joined in frame, thereby encoding a fusion protein comprising the CH1 domain joined to the self-cleaving peptide. (e.g., FIG.4)

[0333] In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, and a fifth template comprising a third ORF encoding an Ig CL domain, wherein the 3’ end of the fourth template shares anoverlapping sequence with the 5’ end of the third template, and wherein the 3’ end of the fifth template shares an overlapping sequence with the 5’ end of the second template, such that when used in a OE-PCR of the disclosure, the first and third ORF are joined in frame, thereby encoding a fusion protein comprising the CLdomain joined to the self-cleaving peptide. (e.g., FIG.6)

[0334] In certain aspects, the kit may comprise a fourth template comprising a second ORF encoding an Ig CH1 domain, and a fifth template comprising a third ORF encoding an Ig CL domain, wherein the 3’ end of the fourth template shares an overlapping sequence with the 5’ end of the second template, and wherein the 3’ end of the fifth template shares an overlapping sequence with the 5’ end of the third template, such that when used in a OE-PCR of the disclosure, the first and second ORF are joined in frame, thereby encoding a fusion protein comprising the CH1 domain joined to the self-cleaving peptide. (e.g., FIG.8).

[0335] One aspect of the disclosure is a kit comprising:

[0336] a first template comprising a promoter,

[0337] a second template comprising a first ORF encoding a self-cleaving peptide,

[0338] a third template comprising a polyA signal sequence, a second ORF encoding an Ig CH1 domain positioned 5’ of the polyA signal sequence, and optionally, a WPRE positioned between the second ORF and the polyA signal sequence,

[0339] a forward primer that hybridizes to the first template, and

[0340] a reverse primer that hybridizes to the third template. (e.g., FIG.3)

[0341] In certain aspects, the forward primer hybridizes 5’ of the promoter. In certain aspects, the reverse primer hybridizes to, or 3’ of, the polyA signal sequence.

[0342] In certain aspects, the first ORF may encode a fusion protein comprising an Ig CL domain joined to the self-cleaving peptide. (e.g., FIG.7)

[0343] In certain aspects, the first ORF may encode a fusion protein comprising an Ig CL domain joined to the self-cleaving peptide, and the second ORF may encode an Ig CH2 domain joined to the Ig CH1 domain, and an IG CH3 domain joined to the CH2 domain, wherein the carboxy terminal end of the CH1 domain is joined to the amino terminal end of the CH2 domain, and the carboxy terminal end is joined to the amino terminal lend of the CH3 domain , such that the polyA signal sequence is 3’ of the CH3 domain and,optionally, the WPRE positioned between the CH3 domain and the polyA signal sequence. In certain aspects, ORF2 may encode the constant region of an Ig heavy chain. (e.g., FIG.10)

[0344] One aspect of the disclosure is a kit comprising:

[0345] a first template comprising a promoter,

[0346] a second template comprising a first ORF encoding a fusion protein comprising an Ig CH1 domain and a self-cleaving peptide, the carboxy terminal end of the Ig CH1 domain being joined to the amino terminal end of the self-cleaving peptide,

[0347] a third template comprising a polyA signal sequence, and optionally comprising a WPRE 5’ of the polyA signal sequence,

[0348] a forward primer that hybridizes to the first template, and

[0349] a reverse primer that hybridizes to the third template. (e.g., FIG.5)

[0350] In certain aspects, the forward primer hybridizes 5’ of the promoter. In certain aspects, the reverse primer hybridizes to, or 3’ of, the polyA signal sequence.

[0351] In certain aspects, the third template may comprise a second ORF encoding an Ig CL domain positioned 5’ of the polyA signal sequence, and optionally, a WPRE positioned between the second ORF and the polyA signal sequence. (e.g., FIG.9)

[0352] In certain aspects, the first ORF may encode an Ig CH2 domain joined to the Ig CH1 domain, and an Ig CH3 domain joined to the CH2 domain, wherein the carboxy terminal end of the CH1 domain is joined to the amino terminal end of the CH2 domain, and the carboxy terminal end of the CH2 domain is joined to the amino terminal lend of the CH3 domain, such that the amino terminal end of the self-cleaving peptide is joined o to the carboxy terminal end of the CH3 domain. (e.g., FIG.11)

[0353] One aspect of the disclosure is a kit comprising:

[0354] a first template comprising a promoter,

[0355] a second template comprising a first ORF encoding a fusion protein comprising an Ig CH1 domain and a self-cleaving peptide, the carboxy terminal end of the Ig CH1 domain being joined to the amino terminal end of the self-cleaving peptide,

[0356] a third template comprising a polyA signal sequence, a second ORF encoding the constant region of an Ig heavy chain, the second ORF being positioned 5’of the polyA signal sequence, and optionally a WPRE positioned between the second ORF and the polyA signal sequence,

[0357] a forward primer that hybridizes to the first template, and

[0358] a reverse primer that hybridizes to the third template. (e.g., FIG.10) In certain aspects, the forward primer hybridizes 5’ of the promoter. In certain aspects, the reverse primer hybridizes to, or 3’ of, the polyA signal sequence.

[0359] One aspect of the disclosure is a kit comprising:

[0360] a first template comprising a promoter,

[0361] a second template comprising a first ORF encoding the constant region of an Ig heavy chain joined to a self-cleaving peptide,

[0362] a third template comprising a polyA signal sequence, a second ORF encoding an Ig CL domain, the second ORF being positioned 5’of the polyA signal sequence and, optionally, a WPRE positioned between the second ORF and the polyA signal sequence,

[0363] a forward primer that hybridizes to the first template, and

[0364] a reverse primer that hybridizes to the third template. (e.g., FIG.11) In certain aspects, the forward primer hybridizes 5’ of the promoter. In certain aspects, the reverse primer hybridizes to, or 3’ of, the polyA signal sequence.

[0365] Kits of the disclosure may optionally comprise additional reagents and components necessary for producing linear expression vectors, such as buffers, polymerases, proteases, tubes, vials, and the like.

[0366] Methods of Treating

[0367] One aspect of the disclosure is a method of protecting an individual or treating an individual in need of such protection or treatment, the method comprising administering a composition comprising linear expression cassette of the disclosure or a linear expression cassette produced according to a method of the disclosure, wherein the linear expression cassette may encode an antibody that protects or treats the individual. Such a method may be used to protect or treat an individual for any disease or infection that may be suitably treated using an antibody. Examples of suitable diseases include, but are not limited to, infectious diseases, cancer, inflammatory diseases, autoimmune diseases, osteoporosis, eye diseases, cardiovascular diseases, including high cholesterol, nervous system disorders, chronic pain, Alzheimer’s disease and Parkinson’s disease.

[0368] As used herein, the terms “individual”, “subject” and “patient” may be used interchangeably and includes any animal, including mammals. Mammals include, but are not limited to, farm animals (such as, for example, horses, cows, and pigs), companion animals (such as, for example, dogs and cats), laboratory animals (such as, for example, mice, rats, and rabbits), and non-human primates. The terms individual, subject,and patient by themselves, do not denote a particular age, sex, race, and the like. Thus, individuals of any age, whether male or female, are intended to be covered by the present disclosure and include, but are not limited to the elderly, adults, children, babies, infants, and toddlers. Likewise, the methods of the present invention can be applied to any race, including, for example, Caucasian (white), African American (black), Native American, Native Hawaiian, Hispanic, Latino, Asian, and European. In some embodiments, the subject is a human. In some embodiments, the human is a patient under the care of a physician.

[0369] One aspect of the disclosure is a method of treating an individual for, or protecting an individual against, cancer, the method comprising administering a composition comprising linear expression cassette of the disclosure or a linear expression cassette produced according to a method of the disclosure, wherein the linear expression cassette may encode an antibody that treats, or protects against, cancer. Examples of cancers treatable using methods of the disclosure, include, but are not limited to, solid tumors, metastatic cancers, and blood-borne cancers.

[0370] One aspect of the disclosure is a method of treating an individual for, or protecting an individual against, an autoimmune disorder, the method comprising administering a composition comprising linear expression cassette of the disclosure or a linear expression cassette produced according to a method of the disclosure, wherein the linear expression cassette may encode an antibody that treats, or protects against, an autoimmune disorder. Examples of autoimmune disorders treatable using methods of the disclosure, include, but are not limited to, rheumatoid arthritis, psoriatic arthritis, Crohn’s disease, ulcerative colitis, plaque psoriasis, uveitis, multiple sclerosis, and diabetes.

[0371] One aspect of the disclosure is a method of protecting an individual against an infectious microorganism, the method comprising administering a composition comprising linear expression cassette of the disclosure or a linear expression cassette produced according to a method of the disclosure, wherein the linear expression cassette may encode an antibody that binds to the infectious microorganism. In certain aspects, the infectious microorganism may be a bacterium, a virus, or a fungus.

[0372] One aspect of the disclosure is a method of treating an individual for an infection by an infectious microorganism, the method comprising administering a composition comprising linear expression cassette of the disclosure or a linear expression cassette produced according to a method of the disclosure, wherein the linear expressioncassette may encode an antibody that binds to the infectious microorganism. In certain aspects, the infectious microorganism may be a bacterium, a virus, or a fungus.

[0373] A linear expression cassette may be administered using techniques well known to those in the art. Techniques for formulation and administration may be found, for example, in "Remington's Pharmaceutical Sciences", 18th ed., 1990, Mack Publishing Co., Easton, PA. Vaccines may be administered by means including, but not limited to, traditional syringes, needleless injection devices, or microprojectile bombardment gene guns. Suitable routes of administration include, but are not limited to, parenteral delivery, such as intramuscular, intradermal, subcutaneous, intramedullary injections, as well as, intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, just to name a few. For injection, the linear expression cassette may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer.

[0374] A linear expression cassette of the disclosure may be formulated with a carrier suitable for a particular route of administration. “Carriers” as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. A “pharmaceutically acceptable carrier” is an excipient that does not interfere with the effectiveness of the biological activity of a compound of the invention. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids, Hanks' solution, Ringer's solution, or physiological saline buffer; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt- forming counterions such as sodium; and / or nonionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®.

[0375] In certain aspects, a linear expression cassette of the disclosure is formulated as a micro- or nanoparticle. Such nanoparticles may allow for increased internalization of the linear expression cassette, increased cellular uptake, less degradation, and more stability of the linear expression cassette. Examples of materials used in producingsuch micro- and / or nanoparticles include, but are not limited to, synthetic polymers (e.g., poly[lactide-co-glycolide] (PLGA), poly [ethylene imine) (PEI), and γ-polyglutamic acid (γ- PGA)), natural polymers (e.g., chitosan, poly(ethylene glycol) (PEG)), cationic lipids, inorganic materials, lipid nanoparticles, liposomes, and hybrids thereof. EXAMPLES

[0376] Herein is described a simple cost- and time-efficient method to express antibodies from a single amplicon containing both heavy and light chain sequences generated from an overlapping PCR reaction. The advantage of this method is that any antibody can be regenerated in vitro if the sequence is available in silico without having to synthesize the entire antibody sequence. By adding the constant elements of the linear cassette to the variable synthesized DNA fragments of the heavy and light chains, an overlapping PCR reaction can be used to create a transfectable linear cassette in ~2 hours.

[0377] Methods

[0378] ELISA

[0379] ELISA plates were coated with recombinant H3 hemagglutinin from A / Singapore / INFIMH-16-0019 / 2016 (H3N2) at 1-10 mg or 1 mg of goat anti-human IgG in PBS in 100 mL per well overnight at 4⁰C or for 1-3 hours at 37⁰C. Plates were washed three times in wash buffer (PBS-Tween (0.05)) and blocked with 4% BSA in wash buffer for one hour at 37⁰C, and then washed three times with wash buffer. Supernatants or purified antibodies were added in 2-3-fold dilutions and incubated for two hours at 37⁰C or overnight at 4⁰C. Subsequently, the plates were washed three times with wash buffer and HRP-conjugated secondary antibodies were added (HRP-anti-human IgG) for one hour at room temperature, and then washed three times in wash buffer. 50 mL of high sensitivity TMB (3,3', 5,5;-tetramethylbenzidine) solution (BioLegend®; Cat# 421501) was added to each well and stopped by adding 50 mL of stop solution, and subsequently read at 450 nm using a BioTek Cytation 7. Standard curves of a known monoclonal antibody concentration were generated by Graphpad Prism 7.

[0380] Antibody Expression Cassettes

[0381] Plasmids containing antibody expression cassettes were created first as heavy and light chains separately in an expression plasmid generated at TwistBiosciences, as well as various custom generated, single plasmids. The plasmid showing the best expression was taken forward, which contained a CMV promoter, CMV enhancer, a spacer,kappa light chain sequence with genes of a previously unknown H3-specific antibody with germline genes for the light chain of IgKV3-20, IgKJ5, and CDR3 of CQQYGTSPPTTF. The light chain constant portion was then followed by a furin cleavage site26to remove excess residues from the self-cleaving tandem P2A-T2A peptide27and a GSG spacer. Subsequent sequence included an IgG1 isotype heavy chain starting from the signal peptide in a 10x generated sequence containing IGHV1-18*01, IGHD6-13*01, IGHJ4*02 genes and CDR3 of CARDAPFYYSSWSSDYW. The rest of the human IgG1 constant region, followed by the WPRE to potentially enhance RNA stability, transcriptional termination, and large RNA shuttling outside the nucleus, followed by the bovine growth hormone polyadenylation signal. Once the single plasmid sequence was optimized, primers were designed to amplify a linear expression cassette using the Platinum™ SuperFi II DNA Polymerase (Invitrogen™; Cat# 12361010).

[0382] Overlap-Extension PCR

[0383] The linear antibody expression cassette, once tested for the ability to produce antibodies upon transfection, was then broken down into multiple pieces to test an overlapping PCR reaction where new antibody sequences could be swapped in and out of the heavy and light chain variable portions as described in the text. Various cycling conditions were tested and the final conditions were as follows: 1) 98C 1min 2) 98C 30sec 3) 55C 2min 4) 72C 5min, 5) 98C 30sec 6) 60C 30sec 7) 72C 1min 8) Go to #5 for 25-34x cycles 9) 72C 5min 10) 4C hold. For a 25 mL reaction, 5x buffer (5 mL), 10 mM forward [GCTGATCGAGTGTAGCCAGA] and reverse [CATAGAGCCCACCGCATCC] primers (1.25 mL each), 10mM dNTP (0.5 mL), 2 ng / mL of P1 / P3 / P5 (0.5 mL), 5 ng / mL of P2 / P4 (0.5mL), Platinum™ SuperFi II DNA Polymerase (0.5 mL; Invitrogen™; Cat# 12361010), nuclease-free water (14 mL). Amplicons were then taken forward by multiple methods used to gel extract or purify PCR products including ChargeSwitch PCR Clean-Up Kit (Invitrogen™; Cat: CS12000), E-Gel™ CloneWell™ II Agarose Gels with SYBR Safe, 0.8% (Invitrogen™ Cat# G661818), and GeneJET Genomic DNA Purification Kit (Thermo Scientific™; Cat# K0721). PCR products were run on DNA gels on an Invitrogen™ E-Gel™ iBase™ with 0.8%-2% E-gels and visualized only under blue light. Images were taken with the GE Amersham™ Imager 680.

[0384] Expression of monoclonal antibodies

[0385] Antibodies were generated by transfecting plasmids or single PCR amplicons described in the manuscript with the Expi293F™ Expression System(ThermoFisher Scientific; Cat# A14635) per manufacturer’s instructions. Generally, 6-well plates were used with 4mL using the Benchmark Incu-shaker mini with carbon dioxide with a rotational speed of 125rpm. Supernatants were harvested from day 5-8 post-transfection, spun down at 3,000g-4,000g for 20 minutes, 0.22 mm sterile filtered and stored at 4C until processed through rProtein A Sepharose® Fast Flow antibody purification resin (Cytiva™; Cat: 17-1279-01). Buffer exchange into PBS was done through Amicon Ultra-4 or 15 tubes with molecular weight cut-offs of 15, 50, and 100 kD. The controls were transfection supernatants of either no DNA as negative controls, VRC-01 IgG1 antibody from heavy and light chain plasmids as positive controls, or an antibody expression construct that produced predominantly light chain protein.

[0386] Virus infections

[0387] A / California / 07 / 2009 (H1N1) and A / Hong Kong / 01 / 1968ma (H3N2) were used to infect MDCK cells for one hour in serum-free Roswell Park Memorial Institute (RPMI) 1640 Media at a multiplicity of infection of (MOI) 1.0 with trypsin as previously described28. After 24-48 hours, infected cells were stained for fluorescence microscopy with DAPI (4’,6-diamidino-2-phenylindole) and the anti-H3 monoclonal antibody described herein, followed by an anti-human IgG secondary antibody conjugated to FITC. Images were taken with the Zeiss LSM 710 inverted confocal microscope (Zeiss, Oberkochen, Germany).

[0388] Microneutralization assay

[0389] Cell grown A / North Carolina / 04 / 2016 (H3N2) was used to infect MDCK cells for 2 hours with 100 TCID50in a microneutralization assay as previously described29with 50 mL of antibodies diluted from 50 mg / mL to 0.2 mg / mL and mixed with 50 mL of virus. The negative control is an IgG1 anti-HIV envelope (VRC-01) antibody, and positive control is a well-studied CR802025anti-HA stem antibody that has been shown to neutralize group 2 influenza viruses.

[0390] Protein gels

[0391] Agilent Protein 230 kits were used to run transfection supernatants on an Agilent 2100 Bioanalyzer following the manufacturer’s instructions. Coomassie stained SDS-page non-reduced gels were run with transfection supernatants and ladder (Precision Plus Protein™ Kaleidoscope™ Prestained Protein Standards from Bio-Rad; Cat# 1610375). Images were taken with the GE Amersham™ Imager 680.

[0392] Biolayer interferometry

[0393] Biolayer interferometry (BLI) measurements were performed on an Octet® R8 machine with ProA biosensors (Cat# 18-5010) which detect IgG within a range of 0.25-2000 mg / mL. Data acquisition and analysis was done with Octet® BLI Discovery / Analysis Studio software.

[0394] Statistical Analysis

[0395] Statistical significance was determined using GraphPad Prism 8.0 software where shown in the figures and text. Both paired and unpaired tests were performed where appropriate using the non-parametric Mann-Whitney test. The lack of statistical significance was noted as n.s. in the figures and the p-values were given in the text.

[0396] As proof of concept, a plasmid containing an antibody expression cassette (FIG. 12A) was compared to a two-plasmid system (FIG. 12B) more commonly used because heavy and light chains derive from separate transcripts. The antibody expression cassette consisted of a promoter, enhancer, leader sequence, light chain, furin cleavage site, spacer, self-cleaving peptide, heavy chain, woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and polyA signal (Fig. 12A). As shown in FIG. 12C, cells transfected with the plasmid containing the antibody expression cassettes produced significantly more antibody (6.3-fold increase) than did cells transfected by a plasmid containing a heavy chain and a plasmid containing light chain (i.e., when the heavy and light chain genes were on separate plasmids).

[0397] To create a linear expression cassette, the variable portions that define the antibody clone (P2 and P4) were added to other elements by a five-piece overlapping PCR reaction using a high-fidelity polymerase (P1-P5; . FIGS. 13A & 13C). This reaction takes less than two hours and produces a transfectable DNA amplicon of ~3.9kb (FIGS.13B & 13D) with no detectable PCR errors by Sanger sequencing as expected from the 2.17 × 10−7error rate of the polymerase utilized.

[0398] Amplified products resulting from the overlapping PCR reaction can be directly transfected or column purified by gel extraction or PCR clean-up methods. For instance, transfecting a 25 μL overlapping PCR reaction that is purified or unpurified yielded no difference in antibody produced under the same conditions (FIG.14A; p = 0.50).

[0399] To demonstrate utility, an antibody expression cassette was made for an unknown antibody sequence from B cells derived from an influenza-vaccinated individual. After amplifying and transfecting the linear expression cassette, the mAb containing supernatant bound to H3N2 infected cells by fluorescence microscopy but notH1N1 (FIG. 14B), and measurably bound to a group 2 hemagglutinin (H3 HA) out to a dilution of ~1 in 105in an ELISA (FIG. 14C) at 1.08 ng / mL. Additionally, the purified antibody from the expression cassette functionally neutralized an H3N2 virus in vitro to levels similar to a previously described group 2 influenza-specific neutralizing antibody (FIG. 14D). Thus, the antibody expression cassette produced a functional neutralizing antibody (named here as ILT3) that bound to its epitope on purified hemagglutinin protein and on infected cells.

[0400] The variability of antibody sequences can present a challenge to antibody generation. To examine the robustness of this method, 15 linear mAb cassettes were generated concurrently from memory B cells of unknown specificity. All 15 amplified antibody expression cassettes produced transfectable products (FIG. 15A) which were simultaneously transfected, resulting in sufficient amounts of mAb for downstream applications after 5 days (FIG.15B; avg=47.4 mg / mL; range 13.6-98 mg / mL).

[0401] Described herein is a simple, efficient, and flexible method for human mAb antibody expression. Required to create the cassette is a PCR machine, PCR reagents, and synthesized DNA fragments. The overlapping PCR reaction takes approximately 2 hours and generates enough product in one or two reactions of 50 mL to be transfected either directly or post-PCR clean-up or gel extraction. This method can be applied to any isotype (e.g., IgM, IgD, IgG, IgA, and IgE) as a medium-throughput or high- throughput method. This method is a simple and useful alternative to synthesizing a full antibody sequence, while reducing the time, reagents, and expertise needed for cloning and plasmid preparation.

[0402] This written description uses examples to disclose the invention, including the best mode, and to enable any person skilled in the art to practice the invention, including making and using any devices or systems and performing any incorporated methods. The patentable scope of the invention is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.

Claims

WHAT IS CLAIMED IS:

1. A method of producing a linear expression cassette encoding a fusion protein comprising an interdomain peptide flanked by an Ig VLdomain and an Ig VHdomain, the method comprising performing an overlapping extension -polymerase chain reaction (OE-PCR) to join a plurality of templates comprising: a set of two Ig variable domain-encoding templates, one member of the set containing a first ORF (ORF1) encoding a VL domain, the other member of the set containing a second ORF (ORF2) encoding a VH domain; a third template containing a third ORF (ORF3) encoding an interdomain peptide; a fourth template comprising a polyA signal sequence; and, a fifth template containing a promoter, thereby producing the linear expression cassette, wherein pairs of templates share overlapping sequences such that in the linear expression cassette, the templates are in the order: the fifth template, one member of the set of Ig variable domain-encoding templates, the third template, the other member of the set of Ig variable domain-encoding templates, the fourth template.

2. The method of claim 1, wherein the ORFS are in the order ORF1-ORF3-ORF2 in the linear expression cassette.

3. The method of claim 2, wherein the ORFS are joined in frame in the linear expression cassette so that they form a fourth ORF encoding the fusion protein comprising, in order, the VL domain, the interdomain peptide, and the VH domain.

4. The method of claim 1, wherein the ORFS are in the order ORF2-ORF3-ORF1 in the linear expression cassette.

5. The method of claim 4, wherein the ORFS are joined in frame in the linear expression cassette so that they form a fourth ORF encoding the fusion protein comprising, in order, the VHdomain, the interdomain peptide, and the VLdomain.

6. The method of claim 1, wherein the promoter is positioned 5’ to all the ORFS in the linear expression cassette.

7. The method of claim 1, wherein the interdomain peptide comprises at least one element selected from the group consisting of a linker peptide, a self-cleaving peptide, and an enzymatic cleavage site.

8. The method of claim 1, wherein the fourth template comprises a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).

9. The method of claim 8, wherein the WPRE is located 5’ of the polyA signal sequence.

10. The method of claim 1, wherein the OE-PCR comprises a forward primer that hybridizes to the fifth template at a location 5’ of the promoter.

11. The method of claim 1, wherein the OE-PCR comprises a reverse primer that hybridizes to the fourth template.

12. The method of claim 1, wherein the 3’ end of the fifth template comprises a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of one member of the set of Ig variable domain-encoding templates, the 3’ end of the one member of the set of Ig variable domain-encoding templates comprises a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the third template, the 3’ end of the third template comprises a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the other member of the set of Ig variable domain-encoding templates, and the 3’ end of the other member of the pair of templates comprises a nucleotide sequence that overlaps with a nucleotide sequence in the 5’ end of the fourth template.

13. The method of claim 1, wherein the method produces a linear expression cassette shown in FIG.

1.

14. A method of treating an individual for a disease, the method comprising administering a composition comprising a linear expression cassette produced according to the method ofany one of claims 1-13, wherein the VHand VLdomains encoded by the linear expression cassette form an antibody that binds a biological molecule in the disease pathway.

15. A kit comprising the third template of claim 1, the fourth template of claim 1, the fifth template of claim 1, a forward primer that hybridizes 5’ of the promoter in the fifth template, and a reverse primer that hybridizes to the fourth template, wherein the interdomain peptide comprises at least one element selected from the group consisting of a spacer, a self-cleaving peptide, and an enzymatic cleavage site.

Images