Synthetic 3D scaffold-cultured stem cell-derived exosomes for treating tendon pathologies

Abstract

Provided herein are compositions and methods of use for using exosomes derived from mesenchymal stem cells cultured on a scaffold consisting of synthetic fibers. The compositions are useful for treating musculoskeletal or connective tissue repair or degenerative conditions, for example, tendinopathy and tendon injury, and pain.

Description

SYNTHETIC 3D SCAFFOLD-CULTURED STEM CELL-DERIVED EXOSOMES FOR TREATING TENDON PATHOLOGIESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application Number 63 / 531,969, filed August 10, 2023, the contents of which are hereby incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant number G056246 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] This application incorporates-by-reference nucleotide sequences which are present in the file named “240807_00468-0009_Sequence_Listing_AWG.xml”, which is 4,096 bytes in size, and which was created on August 6, 2024 in the IBM-PC machine format, having an operating system compatibility with MS-Windows, which is contained in the xml file filed August 7, 2024 as part of this application.BACKGROUND

[0004] Tendons are fibrous tissues that transmit muscle forces to bone and play a critical role in maintaining stability of the joint and driving body movements. Injuries to the tendon, or tendon diseases such as tendinopathy, result in breakdown of the tendon tissue, resulting in pain, swelling, and loss of function.

[0005] The present disclosure provides tools relating to treating tendon diseases.INCORPORATION BY REFERENCE

[0006] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.SUMMARY

[0007] An isolated plurality of exosomes derived from mammalian stem cells, wherein exosomes of the plurality (i) have been derived from mammalian stem cells cultured on a 3D scaffold of substantially parallel filaments, and (ii) express miR-221-5p at a level higher than (a) an exosome derived from a mammalian stem cell of a same type which has not been cultured on a 3D scaffold of substantially parallel filaments, or (b) an exosome derived from a mammalian stem cell of a same type which has been cultured on a 2D scaffold.

[0008] A system for differentiating mammalian stem cells into a tendon lineage comprising a 3D scaffold comprising a plurality of filaments substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the filaments.

[0009] A system for inducing production of exosomes of the plurality described herein, from mammalian stem cells comprising a 3D scaffold comprising a plurality of filaments substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the filaments.

[0010] A method of treating a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising: obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system described herein, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to treat a connective tissue pathology or musculoskeletal pathology.

[0011] A method of treating pain associated with a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising: obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system described herein, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to treat a connective tissue pathology or musculoskeletal pathology.

[0012] A method of treating a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising administering to the subject an amount of exosomes which have been obtained from a culture of mammalian stems cells cultured on a scaffold of a system described herein, effective to treat a connective tissue pathology or musculoskeletal pathology.

[0013] A method of treating pain associated with a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising administering to the subject an amount of exosomes which have been obtained from a culture of mammalian stems cells cultured on a scaffold of a system described herein, effective to treat pain associated with a connective tissue pathology or musculoskeletal pathology.

[0014] A composition comprising a sterile pharmaceutically acceptable carrier and an amount of exosomes derived from a supernatant of mesenchymal stem cells cultured on a 3D scaffold comprising a plurality of fibers substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the fibers.

[0015] A composition comprising the isolated plurality of exosomes described herein, and a sterile pharmaceutically acceptable carrier.

[0016] A method of treating a connective tissue condition or musculoskeletal condition in a subject in need thereof, comprising administering to the subject a therapeutically-effective amount of a compound that reduces NLRP3 expression.

[0017] A method of suppressing IL-17A, IL-33, HIF-loc and / or NLRP3 in a tendon of a first mammalian subject comprising: obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system as described herein, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to suppress IL-17A, IL-33, HIF-lot and / or NLRP3 in a tendon.

[0018] In some embodiments, the present disclosure provides a method of treating a connective tissue condition in a subject in need thereof, comprises of administering to the subject a therapeutically-effective amount of exosomes derived from mesenchymal stem cells, wherein the mesenchymal stem cells were grown on a scaffold consisting of aligned fibers.BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIGS. 1A - 1C: Design of the automated machine scaffold fabrication system utilizing high-precision fine filament winding technology. (1A) Machine fabrication begins with first mounting the silk spool on to the supply end of the system. Servomotors drive the spool movements, which advance the fiber through a set of pulleys instrumented with transducers for force, position and length tracking for real-time feedback control in winding the fiber onto the spool at the receiving end. (IB) The receiving spool fixture houses an array of removable unit scaffold frames, on which fibersare winded to create individual unit scaffolds. The unit scaffold (indicated by yellow rectangle in (IB), and shown in (1C)) is designed specifically for use in a 4- or 8-well cell culture plate to be readily integrated into customized cell culture vessels for GMP-compliant scaled-up production of exosomes. The winding parameters were standardized to 50 fibers per lane, spacing of 40 pm between fibers and fiber tension of 0.5 N. Prototype scaffolds were previously produced to determine these parameters.

[0020] FIGS. 2A - 2D: Machine-made scaffold successfully produced exosomes with consistency. Exosomes were produced using mesenchymal stem cells grown on prototype and (2A) machine-made scaffolds in 8-well culture plate. Each scaffold basic unit was seeded with 3.5 xlO5cells and cultured in 4mL of medium. (2B) Ex3D particle numbers from 8 scaffolds as quantified by Fluorocet Kit. NTA characterization by Nanosight (2C). Prototype scaffold produced exosomes of larger mean size and spread than (2D) machine-made scaffolds. Insert images show freeze frames of particles in Brownian motion, whose movements within a fixed period of time determine particle size.

[0021] FIGS. 3A-3E: Western blot analysis of exosomal markers CD63, EpCAM, ANXA5, TSG101, GM130, FLOT1, ICAM, ALIX and CD81 in exosomes. (3A) Sample data showing cell culture-derived exosome detection based on exosomal markers with an Exo-Check Exosome Antibody Array. (3B) Analysis of the exosomal markers in exosomes produced using adipose derived stem cells grown on machine fabricated silk scaffolds (ADSC-silk), (3C) adipose derived stem cells grown on nanospun polycaprolactone (PCL) scaffolds (ADSC-PCL), (3D) bone marrow derived stem cells grown on silk scaffolds (BM-MSC-silk), and (3E) bone marrow derived stem cells grown on PCL scaffolds (BM-MSC-PCL).

[0022] FIGS. 4A-4J: (4A) Representative H&E images, (4B) modified Movin score, a semi- quantitative histologic scoring system that sums grades for cellularity, cell morphology, vascularity, and fiber arrangement based on a 0-3 scale for each parameter,1(4C) expression of NLRP3 (Novus, NBP2-12446), cleaved caspase-1 (Santa Cruz, sc-22166), mature IL-ip (ThermoFisher, P420B), and HMGB1 (Abeam, ab 18256) which are functional outcomes of NLRP3 activation, were reduced in the supraspinatus tendons of rats treated with Ex3D, exosomes derived from stem cells grown on 3D scaffolds (e.g., ADSC-Silk) compared to that treated with Ex2D, exosomes derived from stem cells grown in 2D cell culture without scaffold (control exosomes), in rats subjected overuse-induced tendinopathy. (4D) Heatmap of a select list of differentially elevated miRNAs in Ex3D that inhibit target genes critically involved in tendinopathy pathogenesis including IL-17RA, IL-33, HIF-la, and NLRP3, based on analysis by Affymetrix Transcriptome Analysis Console.2(4E) Alignment of miR-221-5p from rat (rno-miR-221-5p - ACCUGGCAUACAAUGUAGAUUU (SEQ ID NO: 1)) and human (hsa-miR-221-5p - ACCUGGCAUACAAUGUAGAUUU (SEQ ID NO: 1)) sequences (top) and sequence alignment between miR-221-5p (ACCUGGCAUACAAUGUAGAUUUC (SEQ ID NO: 3) and its predicted target NRLP3 (rat NLRP3 mRNA -GUGUGGAAGCAGGACUGCCAGGU (SEQ ID NO: 2)) (bottom). (4F) Relative expression of miR-221-5p in Ex2D and Ex3D derived from rat and human TSPCs. (4G) Western blot of NLRP3 (Novus Biologies, NBP2-12446) and 0-actin (Abeam, ab8227) from human tenocytes (87-year-old male) transfected with human (hsa)-miR-221-5p mimic or scrambled miRNA control, (both at 25nmol from Synbio Technologies) in the presence of 17ng / ml IL-ip. Cells were transfected using Lipofectamine RNAiMAX (Invitrogen) and lysed 72 hours after transfection. (4H) miR-221-5p suppresses expression of genes related to tendinopathy in rat tenocytes. This diagram is based on the real time PCR analyses of rat tenocytes transfected with miR-221-5p or a scrambled control in the presence of IL-ip for 24 hours. (41) Bioinformatic analysis from DIANA tool, Targets can, miRDBn, and miRTarBase predicted hsa-miR-221-5p suppresses multiple genes that regulates pathways which have been shown are critically related to tendinopathy.3’7(4J) Western blot confirming that miR- 221-5p suppresses ITGB1 (Thermofisher, PA5-29606) in human primary tenocytes. Human tenocytes were transfected and Western blot carried out as in (F). N=native; P=placebo. n=5 / group for (A); n=3 / group for (D), (F) and (H); * / ?<0.05, Student’s t-test.

[0023] FIGS. 5 A - 5G: (5 A) miR-221-5p content in exosomes (Ex3D) derived from ADSCs grown on silk scaffolds (ADSC-Silk), and from BM-MSCs grown on PCL scaffolds (BM-MSC- PCL), compared to control exosomes (Ex2D) as assessed by SYBR real-time PCR. (5B) Representative immunocytochemistry of NLRP3 and HMGB1 in human primary tenocytes (69 year old, male) in the presence of 17ng / pL of IL-ip treated with placebo (PBS), Ex2D, ADSC-Silk (3xl08parti cles / lxlO6cells), BM-MSC-PCL (3xl08particles / lxlO6cells) and quantification of (5C)NLRP3 (Novus 12446) and (5D) HMGB1 (Abeam ab 18256) fluorescent intensities (Zeiss LSM 980 plus Airyscan Confocal, analyzed with Zeiss Zen software). (5E) Representative H&E images and (5F) Movin score of the Achilles tendons of nude rats subject to collagenase-induced Achilles tendinopathy (collagenase 0.015mg / ml) for 1 week, followed by treatment with one intra-tendinous injection of placebo (PBS), ADSC-Silk (3xl08particles), and BM-MSC-PCL (3xl08particles) for 3 weeks. (5G) Change in paw withdrawal threshold (PWT) in tendinopathic rats treated as in (5E). n=4 / group ( A); 6 / group (5C); 3 / group (5D); 6 / group (5E-5G); *p<0.05, * *p<0.01, ***p<0.001, oneway ANOVA with Tukey post-hoc test. Scale bar=100pm. Red=NLRP3, Blue=DAPI in (5B).

[0024] FIGS. 6A - 6D: Dose-dependent and dose schedule-dependent effect of Ex3D (e.g., ADSC-Silk) on collagenase-induced tendinopathy. (6A) Representative H&E images and immunohistochemistry of cleaved collagen from the Achilles tendon midsubstance of animals receiving Ex3D (e.g., ADSC-Silk) at increasing doses (106, 107, 108particles), or vehicle (PBS) injection compared with animals receiving a sham injection. (6B) Modified Movin score, a semi- quantitative histologic scoring system that sums grades for cellularity, cell morphology, vascularity, and fiber arrangement based on a 0-3 scale for each parameter, and quantification of immunohistochemistry intensity of cleaved collagen. Representative H&E images (6C) and Modified Movin Score (6D) of Achilles tendon midsubstance of animals receiving Ex3D (e.g., ADSC-Silk) at various schedules (every 4, 8, or 16 weeks) or vehicle compared with sham injection. Images evaluated in a blinded manner. n=3-4 / group. Mean±SEM, *p<0.05; **p<0.01, one-way ANOVA with Tukey post-hoc test.

[0025] FIG. 7 : Dose-dependent effect of Ex3D (e.g., ADSC-Silk) on tendinopathy -related pain at increasing doses (106, 107, 108particles) or vehicle, compared with sham injection. The von Frey assay using the simplified up-down method with von Frey filaments (Stoelting) was used to estimate the paw withdrawal threshold (PWT) of the rodent’s right limb. Mean±SEM, *p<0.05; **p<0.01; one-way ANOVA with Tukey post-hoc test. n=3-4 / group.

[0026] FIGS. 8A-8D: Effect of Ex3D in mitigating pathologic features of overuse-induced tendinopathy in rats. (8A) Representative H&E images and immunofluorescent staining of cleaved collagen (Ibex, Cat.# 50-1035) from the supraspinatus tendon midsubstance. (8B) Modified Movin score1(n=5 / group), a semi-quantitative histologic scoring system that sums grades for cellularity, cell morphology, vascularity, and fiber arrangement based on a 0-3 scale for each parameter. (8C) Quantification of immunofluorescent intensity of cleaved collagen immunostaining, and (8D) Col I / III immunostaining (Col I: Abeam Cat.# ab34710, Col III: Abeam Cat.# ab7778, n=3 / group). Mean±SEM, *p<0.05; **p<0.01, one-way ANOVA with Tukey post-hoc test. Ex2D-T - exosomes (Ex2D) produced from tendon stem / progenitor cells (TSPCs) grown in 2D cultures; Ex2D-A - exosomes (Ex2D) produced from adipose derived stems cells (ADSCs) grown in 2D cultures; Ex3D- T-I - exosomes (Ex3D) produced from TSPCs grown in 3D silk scaffolds (dose 1); Ex3D-T-2 - exosomes (Ex3D) produced from TSPCs grown in 3D silk scaffolds (dose 2); Ex3D-A-l - exosomes (Ex3D) produced from ADSCs grown in 3D silk scaffolds (dose 1); Ex3D-A-2 - exosomes (Ex3D) produced from ADSCs grown in 3D silk scaffolds (dose 2). Dose 1 = 3.5xl08particles. Dose 2 = 7.0xl08particles.

[0027] FIGS. 9A-9B: Ex3D improve tendinopathic tendon mechanical properties. (9 A) Load at failure (maximum load), and 9B) tissue modulus (stress / strain). The supraspinatus was loaded to failure as described in the text above. Maximum load was recorded and the tissue modulus was calculated. Mean±SEM, *p<0.05; **p<0.01, one-way ANOVA with Tukey post-hoc test. n=6- 12 / group. Ex2D-T - exosomes (Ex2D) produced from tendon stem / progenitor cells (TSPCs) grown in 2D cultures; Ex2D-A - exosomes (Ex2D) produced from adipose derived stems cells (ADSCs) grown in 2D cultures; Ex3D-T - exosomes (Ex3D) produced from TSPCs grown in 3D silk scaffolds (dose 1 and dose 2 data pooled); Ex3D-A - exosomes (Ex3D) produced from ADSCs grown in 3D silk scaffolds (dose 1 and dose 2 data pooled). Dose 2 = 7.0xl08particles.

[0028] FIG. 10: Ex3D relieve symptoms of pain in overuse-induced tendinopathy rats, von Frey assay using the simplified up-down method with von Frey filaments (Stoelting) was used to estimate the paw withdrawal threshold (PWT) of the rodent’s front limbs. The average of both front limbs is shown. Mean±SEM, *p<0.05 vs. Sham or indicated comparison; *p<0.05; **p<0.01; oneway ANOVA with Tukey post-hoc test. n=6-12 / group. Ex2D-T - exosomes (Ex2D) produced from tendon stem / progenitor cells (TSPCs) grown in 2D cultures; Ex2D-A - exosomes (Ex2D) produced from adipose derived stems cells (ADSCs) grown in 2D cultures; Ex3D-T - exosomes (Ex3D) produced from TSPCs grown in 3D silk scaffolds (dose 1 and dose 2 data pooled); Ex3D-A - exosomes (Ex3D) produced from ADSCs grown in 3D silk scaffolds (dose 1 and dose 2 data pooled). Dose 2 = 7.0xl08particles.DETAILED DESCRIPTION

[0029] An isolated plurality of exosomes derived from mammalian stem cells, wherein exosomes of the plurality (i) have been derived from mammalian stem cells cultured on a 3D scaffold of substantially parallel filaments, and (ii) express miR-221-5p at a level higher than (a) an exosome derived from a mammalian stem cell of a same type which has not been cultured on a 3D scaffold of substantially parallel filaments, or (b) an exosome derived from a mammalian stem cell of a same type which has been cultured on a 2D scaffold.

[0030] In embodiments, exosomes of the plurality express miR-221-5p at a level of 2. Ox or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold. In embodiments, exosomes of the plurality express miR-221 -5p at a level of 2.5x or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold. In embodiments, exosomes of the plurality express miR-221-5p at a level of 2.8xor more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold.

[0031] In embodiments, the mammalian stem cells comprise mesenchymal stem cells.

[0032] In embodiments, the mammalian stem cells comprise adipose-derived stem cells, bone marrow-derived stem cells, bursa-derived stem cells, or are tendon stem / progenitor cells.

[0033] In embodiments, the mammalian stem cells comprise adipose-derived stem cells.

[0034] In embodiment, the mammalian stem cells comprise induced pluripotent stem cells.

[0035] A system for differentiating mammalian stem cells into a tendon lineage comprising a3D scaffold comprising a plurality of filaments substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the filaments.

[0036] A system for inducing production of exosomes of the plurality described herein, from mammalian stem cells comprising a 3D scaffold comprising a plurality of filaments substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the filaments.

[0037] In embodiments, the filaments comprise polycaprolactone nanofilaments.

[0038] In embodiments, the filaments of the plurality are spaced at a minimum of 30 pm apart.

[0039] In embodiments, the filaments of the plurality are spaced 30 pm to 50 pm apart.

[0040] In embodiments, the filaments of the plurality are spaced 40 pm apart.

[0041] In embodiments, a filament of the plurality is maintained under 0.25 N to 1.0 N tension.

[0042] In embodiments, a filament of the plurality is maintained under 0.5 N tension.

[0043] In embodiments, an average diameter of a filament of the plurality is 10 nm to 20pm.

[0044] In embodiments, the systems comprise a medical grade resin to which filament ends are attached.

[0045] In embodiments, the systems further comprise a plurality of stem cells obtained from a mammalian subject present on the 3D scaffold, and a plurality of exosomes derived from said stem cells.

[0046] In embodiments, the stem cells comprise mesenchymal stem cells.

[0047] In embodiments, the mesenchymal stem cells (MSC) comprise adipose-derived stem cells, bone marrow-derived stem cells, bursa-derived stem cells, or are tendon stem / progenitor cells.

[0048] In embodiments, the systems do not comprise silk fibers or filaments.

[0049] A method of treating a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising:

[0050] obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system described herein, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to treat a connective tissue pathology or musculoskeletal pathology.

[0051] A method of treating pain associated with a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising: obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system described herein, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to treat a connective tissue pathology or musculoskeletal pathology.

[0052] A method of treating a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising administering to the subject an amount of exosomes which have been obtained from a culture of mammalian stems cells cultured on a scaffold of a system described herein, effective to treat a connective tissue pathology or musculoskeletal pathology.

[0053] A method of treating pain associated with a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising administering to the subject an amount of exosomes which have been obtained from a culture of mammalian stems cells cultured on a scaffold of a system described herein, effective to treat pain associated with a connective tissue pathology or musculoskeletal pathology.

[0054] In embodiments, the plurality of exosomes has a spread of diameters of up to about 500nm or less, and / or a mean diameter of lOOnm or less.

[0055] In embodiments, the subject from which the amount of mesenchymal stem cells are obtained, or have been obtained, is of the same species as the first mammalian subject.

[0056] In embodiments, the subject from which the amount of mesenchymal stem cells are obtained, or have been obtained, is the first mammalian subject.

[0057] In embodiments, the mammalian stems cells have been obtained from the first mammalian subject prior to the tendon being damaged or while the tendon is damaged.

[0058] In embodiments, the mammalian stems cells have been obtained from the first mammalian subject prior to the pain associated with a damaged tendon being experienced or damaged or while the pain associated with the damaged tendon exists.

[0059] In embodiments, the first mammalian subject is a human.

[0060] In embodiments, the mammalian stem cells are human stem cells.

[0061] In embodiments, the exosomes of the plurality express miR-221-5p at a level of 2. Ox or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold. In embodiments, the exosomes of the plurality express miR-221-5p at a level of 2.5x or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold. In embodiments, the exosomes of the plurality express miR-221-5p at a level of 2.8x or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold.

[0062] In embodiments, the exosomes of the plurality have an average diameter of between lOnm and 20pm.

[0063] In embodiments, the mammalian stem cells comprise adipose-derived stem cells, bone marrow-derived stem cells, bursa-derived stem cells, or are tendon stem / progenitor cells.

[0064] In embodiments, wherein the therapeutic effect is dose dependent, with the minimum exosome DOSE of 105particles suitable for humans.

[0065] In embodiments, the methods further comprise obtaining vesicles from a supernatant of the cultured mesenchymal stem cells on the scaffold.

[0066] In embodiments, the connective tissue pathology is tendinopathy.

[0067] In embodiments, the connective tissue pathology is tendinitis.

[0068] In embodiments, the connective tissue pathology is a tendon injury.

[0069] In embodiments, the administering is by intraarticular injection.

[0070] In embodiments, the administering is by intramuscular injection.

[0071] In embodiments, the musculoskeletal pathology is arthritis such as rheumatoid arthritis or osteoarthritis.

[0072] A composition comprising a sterile pharmaceutically acceptable carrier and an amount of vesicles derived from a supernatant of mesenchymal stem cells cultured on a 3D scaffold comprising a plurality of fibers substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the fibers.

[0073] A composition comprising the isolated plurality of exosomes described herein, and a sterile pharmaceutically acceptable carrier.

[0074] In embodiments, the sterile pharmaceutically acceptable carrier comprises a buffer.

[0075] In embodiments, the composition is an injectable composition.

[0076] In embodiments, the composition reduces NLRP3 expression when administered to a tendon.

[0077] In embodiments, the exosomes of the plurality have an average diameter of between lOnm and 20pm.

[0078] In embodiments, the composition is formulated for injection.

[0079] In embodiments, the composition is formulated for intratendinous injection.

[0080] A method of treating a connective tissue condition or musculoskeletal condition in a subject in need thereof, comprising administering to the subject a therapeutically-effective amount of a compound that reduces NLRP3 expression.

[0081] In embodiments, the compound reduces human NLRP3 expression.

[0082] In embodiments, the compound binds to human NLRP3 mRNA.

[0083] In embodiments, the compound is formulated in a pharmaceutical composition that comprises a pharmaceutically-acceptable carrier.

[0084] In embodiments, the administering is by injection.

[0085] In embodiments, the administering is by intratendinous injection.

[0086] In embodiments, the connective tissue condition is tendinopathy.

[0087] In embodiments, the connective tissue condition is tendinitis.

[0088] In embodiments, the connective tissue condition is a tendon injury.

[0089] In embodiments, the administering is by intraarticular injection.

[0090] In embodiments, the administering is by intramuscular injection.

[0091] In embodiments, musculoskeletal condition is arthritis such as rheumatoid arthritis or osteoarthritis.

[0092] A method of suppressing IL-17A, IL-33, HIF-loc and / or NLRP3 in a tendon of a first mammalian subject comprising: obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system as described herein, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to suppress IL-17A, IL-33, HIF-1? and / or NLRP3 in a tendon.

[0093] In embodiments, the exosomes of the plurality express miR-221-5p at a level of 2. Ox or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold. In embodiments, the exosomes of the plurality express miR-221-5p at a level of 2.5x or more than of exosomes derived from mammalian stem cell of a same type which has beencultured on a 2D scaffold. In embodiments, the exosomes of the plurality express miR-221-5p at a level of 2.8x or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold.

[0094] In embodiments, the exosomes of the methods and compositions have not been surface- modified.

[0095] Provided herein are the use of exosomes derived from mesenchymal stem cells grown on a scaffold consisting of aligned fibers, in treating musculoskeletal or connective tissue conditions, for example, tissue repair or degenerative conditions such as tendinopathy and tendon injury. For example, these exosomes described herein can be used for the treatment of tendinopathy and enhancing healing from a tendon injury. Such compositions can mitigate disease severity and relieve tendinopathy-related pain and discomfort.Tendinopathy and Tendon Injury

[0096] Tendon injuries and pathologies include conditions such as tendinopathy and tendonitis. Tendinopathy is a highly-prevalent tendon disorder. Tendinopathy is chronic tendon degeneration which is caused by tendon overuse and / or overload, leading to microscopic collagen fiber failure and a failed healing response, often resulting in tendon rupture. While tendinopathy can affect any tendon, the most common incidents include the rotator cuff tendons, the Achilles tendon, tennis elbow, and golfer’s elbow.

[0097] Tendonitis is the inflammation of a tendon. Like tendinopathy, tendonitis can occur when a tendon is overused or injured, for example, during sport or physical activities. Tendonitis is often linked to an acute injury with inflammation. Tendonitis can affect tendons in the elbow, wrist, finger, thigh, and other parts of the body. Non-limiting examples of sites of tendon injury or tendon degeneration include the rotator cuff, the Achilles, tennis elbow (tissue connecting forearm muscle to elbow), golfer’s elbow (inner side of elbow), jumper’s knee (also known as patellar tendon; tissue connecting kneecap to shinbone), swimmer’s shoulder (tissue rubbing against shoulder blade), the neck, the forearm, the shoulder, the pelvis, the hip, the hamstring, the knee, the ankle, and the foot.

[0098] Current treatment strategies for tendon injuries and degenerative conditions include administration of non-steroidal anti-inflammatory drugs (NSAIDs), corticosteroid injections, and physical therapy. However, these strategies tend to be limited to targeting only the symptomatology instead of intervening the disease. Moreover, prolonged use of NSAIDs can elevate the risk of upset stomach and gastrointestinal bleeding, while corticosteroids can deleteriously affect tendon tissue.Exosomes

[0099] Exosomes are classified as a subtype of extracellular vesicles (EVs), and are distinct from other types of EVs including apoptotic bodies and microvesicles. Exosomes are nanovesicles with a lipid bilayer secreted from many cell types. Exosomes carry contents including mRNA, microRNAs (miRNAs), proteins and lipids, and may play key roles in intercellular communication, coagulation, and waste management. Exosomes are stably present in many kinds of body fluids, including synovium fluid and blood, and in the conditioned medium of cell culture.

[0100] Exosome biogenesis starts with endocytosis, or inward budding of early endosomal membrane proteins, which can occur dependently or independently of clarthrin, a protein involved in the formation of coated vesicles. The endocytic vessels are transferred to early endosomes, which has a tube-like shape and is located near the outer edge of the cytoplasm. Early endosomes mature into late endosomes which have a spherical shape and are located closer to the nucleus. Inward budding of the endosome lumen leads to the formation of intraluminal vesicles (ILVs). Late endosomes carrying ILVs are also known as multivesicular bodies (MVBs). MVBs may fuse with the plasma membrane to release its ILVs which are then referred to as exosomes, or the MVBs may fuse with the lysosome to have its contents degraded.

[0101] Even though exosomes are secreted by a variety of cell types, as a consequence of their endosomal origin, they share some similarity in their biochemical composition. The exosome lipid bilayer consists of lipid rafts including sphingomyelin, cholesterol, ceramide, and phosphatidyl serine. While more than 4,000 exosomal proteins have been identified, exosomes are composed of common proteins such as those involved in membrane transport and fusion (Annexins, Rab GTPases), MVB biogenesis (Alix, TSG101), cytoskeletal proteins (actin, cofilin, tubulin, moesin), tetraspanins (CD9, CD63, CD81, CD82), integrins, and heat shock proteins (HSP70, HSP90). Integrins and tetraspannins play roles in adhesion and targeting. Heat shock proteins have been suggested to assist in the protein folding process and binding of antigenic peptides. Alix and TSG101 are widely used as markers for exosomes.

[0102] Exosomes also contain DNA and RNA (e.g,. messenger RNA [mRNA], microRNA [miRNA], non-coding RNA) in addition to proteins. Exosome cargo include significant amounts of mRNA, miRNA, and small non-coding RNA in the lumen of exosomes. Through intercellular communication, these biologically active ingredients may modulate gene expression and change the fate and function of recipient cells, as well as enhance physiologic function and / or mitigate pathogenesis. Transfer of these nucleic acid cargo into recipient cells by exosomes is currently an important area of research related to clinical translation. Exosomal cargo, such as proteins andRNAs, may be recruited into exosomes when membrane proteins with chaperones, and proteins with RNA binding complexes such as endosomal sorting complexes required for transport (ESCRT)-II, sort proteins and RNA into exosomes, respectively.

[0103] The surfaces of exosomes can be modified to confer cell type targeting specificity. For example, exosomal surface proteins can be modified to display a targeting motif. As another example, targeting ligands can also be conjugated to the exosome surface, or targeting ligands can be inserted into the lipid bilayer to mediate targeted delivery of exosomes to a specific site.Modulation of the NLRP3 Inflammasome

[0104] NLR family pyrin domain containing 3 (NLRP3) is a protein encoded by the NLRP3 gene in humans. NLRP3 is expressed predominantly in macrophages and as a component of the inflammasome. NLRP3 functions as a pattern recognition receptor (PRR) that recognizes pathogen- associated molecular patterns (PAMPs). For example, NLRP3 can detect products of damaged cells such as extracellular ATP and crystalline uric acid. Activated NLRP3 triggers an immune response. Mutations in the NLRP3 gene are associated with a number of organ specific autoimmune diseases. The NLRP3 inflammasome can be a potential drug target for diseases underpinned by inflammation.

[0105] Treatment of tendinopathic tendons using the methods and compositions described herein can lead to restoration of the degraded tissue microstructure and histology, increased expression of markers for tissue repair, and improved overall joint mobility, while also relieving symptoms of tendinopathy-related discomfort and pain.

[0106] In some embodiments, a pharmaceutical composition disclosed herein provides a therapeutically-effective amount of a modulator of NLRP3, for example, an inhibitor of NLRP3. A pharmaceutical composition disclosed herein can provide a therapeutically-effective amount of an inhibitor of pro-inflammatory mediators including, for example, IL-ip, IL-6, IL-8, IL- 10, and TNFa.

[0107] A pharmaceutical composition can be a combination of any pharmaceutical compounds described herein with other chemical components, such as carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, solubilizing agents, excipients, buffers, preservatives, and surface active agents. For example, a pharmaceutical composition disclosed herein is suspended in a saline solution. Pharmaceutical formulations can also include one or more additional active ingredients such as antimicrobial agents, anti-inflammatory agents, or anesthetics.

[0108] The pharmaceutical composition facilitates administration of the compound to a subject. Pharmaceutical compositions can be administered by various forms and routes including, forexample, injection, peri-tissue injection, intra-tissue injection, intratendinous injection, intraarticular, intramuscular, intravascular, subcutaneous, infusion, intravenous, enteral, oral, buccal, sublingual, rectal, parenteral, ocular, and topical administration. In some embodiments, a pharmaceutical composition disclosed herein can be administered via local injection into the pathological site of a subject. For example, a pharmaceutical composition disclosed herein can be administered via local injection into a tendon of a subject. In some embodiments, a pharmaceutical composition disclosed herein can be administered via a biocompatible substrate, e.g., an implant, scaffold, vesicle, or liposome.

[0109] Pharmaceutical compositions disclosed herein can be administered in a local or systemic manner, for example, via injection of the compound directly into an organ, optionally in a depot or sustained release formulation. Pharmaceutical compositions can be provided in the form of a rapid release formulation, in the form of an extended release formulation, or in the form of an intermediate release formulation. A rapid release form can provide an immediate release. An extended release formulation can provide a controlled release or a sustained delayed release.

[0110] Parenteral injections can be formulated for bolus injection or continuous infusion. Pharmaceutical compositions can be in a form suitable for parenteral injection as a sterile suspension, solution, or emulsion in oily or aqueous vehicles, and can contain formulatory agents, such as suspending, stabilizing, or dispersing agents. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Suspensions of the active compounds can be prepared as oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. The suspension can also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

[0111] Pharmaceutical compositions can be formulated using one or more physiologically- acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active compounds into preparations that can be used pharmaceutically. An excipient can fill a role as simple and direct as being an inert filler, or an excipient as used herein can be part of a pH stabilizing system or coating to ensure delivery of the ingredients safely to a target tissue. Formulations can be modified depending upon the route of administration chosen. Pharmaceutical compositions comprising a compound described herein can be manufactured, for example, by mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or compression processes.

[0112] The pharmaceutical compositions can include at least one pharmaceutically-acceptable carrier, diluent, or excipient and compounds described herein as free-base or pharmaceutically- acceptable salt form. The methods and pharmaceutical compositions described herein can include the use of crystalline forms (or polymorphs), and active metabolites of these compounds having the same type of activity.

[0113] A composition disclosed herein can be produced by various methods in any quantity. For example, a compound disclosed herein can be produced in an amount of about 1 microgram, about 1 milligram, about 1 gram, about 1 kilogram, or more. Methods for the preparation of compositions comprising the compounds described herein include formulating the compounds with one or more inert, pharmaceutically-acceptable excipients or carriers to form a semi-solid or liquid composition. Semi-solid compositions include, for example, gels, suspensions, and creams. Liquid compositions include, for example, emulsions comprising a compound, or a solution containing exosomes.

[0114] Non-limiting examples of dosage forms suitable for use in the present disclosure include liquid, elixir, aerosol, inhalant, spray, gel, geltab, nanosuspension, nanoparticle, microgel, suppository troches, aqueous or oily suspensions, ointment, patch, lotion, dentifrice, emulsion, creams, drops, emulsion in hard or soft gel capsules, syrups, and any combination thereof.

[0115] A composition of the present disclosure can be, for example, an immediate release form or a controlled release formulation. An immediate release formulation can be formulated to allow the compounds to act rapidly. Non-limiting examples of immediate release formulations include readily dissolvable formulations. A controlled release formulation can be a pharmaceutical formulation that has been adapted such that drug release rates and drug release profiles can be matched to physiological and chronotherapeutic requirements or, alternatively, has been formulated to effect release of a drug at a programmed rate. Non-limiting examples of controlled release formulations include hydrogels (e.g., of synthetic or natural origin), other gelling agents (e.g., gel-forming dietary fibers) and matrix-based formulations (e.g., formulations comprising a polymeric material having at least one active ingredient dispersed through).

[0116] A controlled release formulation can be a sustained release form. A sustained release form can be formulated to sustain, for example, the compound’s action over an extended period of time. A sustained release form can be formulated to provide an effective dose of any compound described herein (e.g., provide a physiologically-effective blood profile) over about 4, about 8, about 12, about 16 or about 24 hours.

[0117] Non-limiting examples of pharmaceutically-acceptable excipients can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa. : Mack Publishing Company, 1995); Hoover, John E., Remington ’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999), each of which is incorporated by reference in its entirety.

[0118] Methods disclosed herein include administration of a compound that reduces, inhibits, or suppresses NLRP3 expression, in combination with a pharmaceutically-acceptable carrier. The carrier can be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject.

[0119] A composition described herein can be conveniently formulated into pharmaceutical compositions composed of one or more pharmaceutically-acceptable carriers. See e.g., Remington ’s Pharmaceutical Sciences, latest edition, by E.W. Martin Mack Pub. Co., Easton, PA, which discloses typical carriers, including fluid carriers, and conventional methods of preparing pharmaceutical compositions that can be used in conjunction with the preparation of formulations of the compound described herein and which is incorporated by reference herein. Such pharmaceuticals can be standard carriers for administration of compositions to humans and non-humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. Other compositions can be administered according to standard procedures. For example, pharmaceutical compositions can also include one or more additional active ingredients such as antimicrobial agents, anti-inflammatory agents, and anesthetics.

[0120] Non-limiting examples of pharmaceutically-acceptable liquid carriers include water, saline solution, Ringer’s solution, glycerol, ethanol, and dextrose solution. The pH of the solution can be from about 5 to about 8, and can be from about 7 to about 7.5. Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the compound or a pharmaceutically-acceptable salt thereof, where the matrices are in the form of shaped articles, such as films, liposomes, microparticles, and microcapsules.

[0121] Pharmaceutical compositions containing the compounds described herein can be administered for prophylactic or therapeutic treatments. Compositions can contain any number of active agents. In therapeutic applications, the compositions can be administered to a subject already suffering from a disease or condition, in an amount sufficient to cure or at least partially arrest the symptoms of the disease or condition, or to cure, heal, improve, reduce, lessen, ameliorate, or reducea likelihood of occurrence of the disease or condition. Compounds can also be administered to lessen or reduce a likelihood of developing, contracting, or worsening a condition. Amounts effective for this use can vary based on the severity and course of the disease or condition, previous therapy, the subject’s health status, weight, response to the drugs, and the judgment of the treating physician.

[0122] Multiple therapeutic agents can be administered in any order or simultaneously. If simultaneously, the multiple therapeutic agents can be provided in a single, unified form, or in multiple forms, for example, as multiple injections. The compounds can be packed together or separately, in a single package or in a plurality of packages. One or all of the therapeutic agents can be given in multiple doses. If not simultaneous, then the timing between the multiple doses can vary.

[0123] The compositions described herein can be administered before, during, or after the occurrence of a disease or condition, and the timing of administering the composition containing a compound can vary. For example, the compounds can be used as a prophylactic and can be administered continuously to subjects with a propensity to conditions or diseases to lessen or reduce a likelihood of the occurrence of the disease or condition. The compounds and compositions can be administered to a subject during or as soon as possible after the onset of the symptoms. The administration of the compounds can be initiated within the first 48 hours of the onset of the symptoms, within the first 24 hours of the onset of the symptoms, within the first 6 hours of the onset of the symptoms, or within 3 hours of the onset of the symptoms. The initial administration can be via any route practical, such as by any route described herein using any formulation described herein.

[0124] A composition described herein can be administered as soon as is practical after the onset of a disease or condition is detected or suspected, and for a length of time necessary for the treatment of the disease, such as, for example, from about 1 month to about 3 months. In some embodiments, the length of time a compound can be administered can be about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 2 months, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 3 months, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 4 months, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 5 months, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months about 23 months, about 2 years, about 2.5 years, about 3 years, about 3.5 years,about 4 years, about 4.5 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, or about 10 years. The length of treatment can vary for each subject.

[0125] Also provided herein are methods for treating a subject afflicted with a musculoskeletal or connective tissue condition with a therapeutically-effective amount of an inhibitor of NLRP3, IL- 1 P, and / or TNFa. The subject can be a human. Treatment can include treating a human in a clinical trial. A treatment can comprise administrating to a subject a therapy that suppresses expression of NLRP3.

[0126] Methods described herein include methods for the treatment of tendon damage, including damage resulting from tendon injury and tendinopathy. Treatment can include modulating or promoting healing of tendon, increasing development or proliferation of tenocytes, modulating or increase relative collagen composition or synthesis in tendon (e g., collagen I or collagen III), modulating or improving biomechanical properties of tendon (e.g. improving or increasing the tensile strength of the tendon), and relieving or reducing pain or discomfort resulting from tendon injury and tendinopathy.

[0127] Non-limiting examples of possible subjects for administration include the following. Subjects are mammalian and can be humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, and swine; domestic animals such as rabbits, dogs, and cats; and laboratory animals including rats, mice, and guinea pigs. A subject can be of any age. Subjects can be, for example, elderly adults, adults, adolescents, preadolescents, children, toddlers, and infants.

[0128] Subjects described herein in need of treatment can include subjects having reduced expression of miR-122-5p and / or subjects having elevated expression of NLRP3, IL-ip, and / or TNFa, as compared to subjects not in need of treatment for a musculoskeletal or connective tissue condition.

[0129] Non-limiting examples of musculoskeletal or connective tissue conditions include tendinopathy, tendinitis, tenosynovitis, tendon injury, acute tendon injury, chronic tendon injury, a tendon condition, a cartilage injury, a ligament condition, a soft tissue condition, a joint condition, a muscle condition, a bone condition, osteoporosis, osteoarthritis, arthritis, rheumatoid arthritis, gout, fibromyalgia syndrome, systemic lupus erythematosus, Sjogren’s syndrome, an autoimmune condition, and a non-autoimmune condition.

[0130] Provided herein are methods for treating a subject afflicted with a pain associated with a musculoskeletal or connective tissue condition with a therapeutically-effective amount of an inhibitor of NLRP3, IL-ip, and / or TNFa.Activity Assays

[0131] Histological assays, e.g., tendon histology assays, can be used to assess therapeutic effectiveness of a compound herein. For example, the Movin scoring system can be used to classify the histopathology of tendinopathy. Variables included in the Movin scale are: (1) fiber structure; (2) fiber arrangement; (3) rounding of the nuclei; (4) regional variations in cellularity; (5) increased vascularity; (6) decreased collagen stainability; (7) hyalinization; and (8) glycosaminoglycan (GAG) content. Each variable is scored between 0 and 3, with 0 being normal, 1 slightly abnormal, 2 abnormal, and 3 markedly abnormal. Hematoxylin and eosin (H&E) staining can be used to assess the first seven variables. Alcian blue staining can be used to assess GAG content. The total semi quantitative histologic score can vary between 0 (normal tendon) and 24 (the most severe abnormality detectable).

[0132] Biological activity of a compound described herein can also be assessed by measuring expression levels of the target mRNA and downstream effectors. For example, miR-221-5p activity can be evaluated by measuring expression of NLRP3, Col I, Col III, IL-ip, and TNFa.

[0133] Nociception (pain) and mechanical sensibility assays can be used to assess therapeutic effectiveness of a compound herein. For example, the Von Frey assay that uses small pieces of nylon rod (known as Von Frey hairs or filaments) to test a rodent’s sensitivity to a mechanical stimulus. In this test, the animal stands on an elevated mesh platform, and the Von Frey hairs are inserted through the mesh to poke the animal’s hindpaw. The animal normally reacts by withdrawing or shaking of the paw. The force at which this response occurs is known as the paw withdrawal threshold (PWT). An increased PWT can indicate increased sensibility to the stimulus due to alleviation tendinopathy pain symptoms.EXAMPLES

[0134] Scaffold fabrication automation using fine filament winding technology.

[0135] A system based on high-precision, digitally controlled fine filament winding technology has been fabricated. The winding action driven by multiaxial servomotors advances the fiber, e.g. silk, from its source spool at the supply end to the receiving spool (Fig. 1 A). The receiving spool is a specialized 8-sided cylindrical device designed using CAD modeling software and produced using SLA 3D printing technology (Form 3; Formlabs, Somerville, MA) for geometric precision. The key components of the device are removable unit scaffold frames arranged in a 4 x 8 formation around the cylinder (4 frames / face x 8 faces) resulting in 32 frames (Fig. IB). In thisfashion, machine-made scaffolds are created as the silk is winded circumferentially around the spool and traverses across the spool with every revolution, covering the width of the unit frames. Upon securing the ends of the silk fibers on the unit frames, the scaffolds can be removed and are ready for processing prior to placement in cell culture.

[0136] As a specialized feature of this winding system, the fiber advances from the source spool to the receiving spool through a series of pulleys instrumented with various transducer arrays to detect position, monitor distance and spacing, and maintain tension based on user inputs (Fig. 1 A). This capability is essential to creating a scaffold with prescribed physical properties, such as fiber tension, spacing and orientation, intended to emulate the unique microenvironment that delivers the physical cues required for therapeutic exosome production.

[0137] Here, we emphasized the importance of selecting materials that are biocompatible and structurally stable. In particular, we 3D printed the unit scaffold using a medical grade resin that offers high structural integrity and meets various ISO standards of biocompatibility. The sizing of the unit frames was determined by maximizing the footprint in the chambers of a 4-well plate or 8- well plate, and optimizing to fit around a cylindrical geometry ideal for winding. The fiber layout characteristics were based on previous prototype scaffolds. Four lanes of silk fibers of 50 fibers width allow for accuracy and ease of pipetting (Fig. 1C). Up to approximately 20pL of cell containing medium can be laid on each lane without medium dripping to the bottom of the well. The entire system is scalable for ramp up fabrication of the scaffolds. Compared to the prototype scaffolds, the machine-made scaffold fabrication system is faster in production, creates more scaffolds per run, offers more consistency in scaffold parameters, is highly reproducible, and promotes more robust scaffold construction.

[0138] Exosomes were produced using mesenchymal stem cells grown on prototype and machine-made 3D scaffolds with silk fibers. Machine-made scaffold successfully produced exosomes with consistency in 8-well culture plate (Fig. 2A, B). The exosomes isolated from prototype and machine-made scaffolds were subjected to characterization by nanoparticle tracking analysis (NTA) via Nanosight. Exosome samples from prototype and machine-made scaffolds exhibited size profiles within range of exosome size.8Three runs of exosomes produced by prototype 3D scaffold displayed mean size of 230nm, mode of 144nm, and standard deviation of 138nm. Three runs of Ex3D produced by machine-made 3D scaffold displayed mean size of 78 nm, mode of 60nm, and standard deviation of 46nm. Interestingly, exosomes from machine-made 3D scaffold exhibited a more consistent size, with narrower spread (Fig. 2C, D).

[0139] Electrospun PCL fiber scaffold technology.

[0140] Entirely synthetic scaffolds were next produced. The scaffolds incorporated electrospinning technology developed for applications in tissue and organ regeneration by an industry leader (Nanofiber Solutions, Dublin, OH)9-11to deposit polycaprolactone (PCL) nanofibers aligned unidirectionally on the unit frames.

[0141] To characterize the identity of exosomes generated using adipose derived stem cells (ADSCs) or bone marrow derived mesenchymal stem cells (BM-MSCs) seeded on silk versus electrospun PCL scaffolds, we analyzed a variety of exosomal markers by Western blotting. The analysis provided evidence that exosomes derived from the different cell sources seeded on different scaffolds are consistently enriched in all exosomal makers tested, thus establishing the robustness of this exosomes production methodology. See Fig. 3.

[0142] Identification of miR-221-5p as a novel putative miRNA in exosomes (Ex3D)

[0143] miRNAs have been identified as potential mediators for the biological effects of exosomes.12,13To determine the mechanisms underlying the potential therapeutic effect of the produced exosomes, we used a genome-wide (miRNA) microarray to identify differentially elevated miRNA in Ex3D, exosomes derived from stem cells grown on 3D scaffolds (e.g., ADSC-Silk) compared to Ex2D, exosomes derived from stem cells grown on 2D scaffolds. The array identified a spectrum of miRNAs with known or predicted functions in suppressing expression of genes that are critical for tendinopathy, including those encoding for mediators and effectors related to inflammation, stress response and apoptosis (Fig. 4D). Of note, these include miRNAs that suppress key inflammatory mediators involved in early tendinopathy (e.g. Illa, 1133, Hifla46-48) and several known or putative miRNAs that suppress NLRP3 (NLR Family Pyrin Domain Containing 3), a master regulator of inflammatory processes.14'16Interestingly, several miRNA that suppress NF-KB, an effector of NLRP3,17were also identified. Via a database search (TargetScan), we identified that miR-221-5p is up-regulated 2.84-fold in Ex3D vs Ex2D and putatively binds to NLRP3 3’-UTR and may inhibit NLRP3 expression. Alignment of miR-221-5p from rat and human sequences revealed conservation between the two species (Fig. 4E, top). The predicted alignment sequences of miR- 221-5p include positions on the 3’UTR of NLRP3 (Fig. 4E, bottom). Real-time PCR confirmed expression of miR-221-5p was significantly elevated in Ex3D compared to that in Ex2D derived from human and rat (Fig. 4F).

[0144] In testing whether miR-221-5p targets NLPR3, we found protein expression of NLRP3 was significantly reduced in human tenocytes transfected with miR-221-5p mimic, compared to that transfected with scramble miRNA in the presence of IL-ip (Fig. 4G), and suppressed relative gene expression of targets known to be downstream of NLRP3, largely mimicking the effect of Ex3D (Fig.4H). Further bioinformatic analysis predicted that miR-221-5p inhibits expression of genes involved in tendinopathy including HMGB1, IGTB1, LAMC1 and ADAMTS4 by binding to the respective mRNA targets (Fig. 41). Suppression of ITGB 1 by miR-221-5p was confirmed by Western blot (Fig. 4J). Together, this suggests that miR-221-5p is a strong therapeutic candidate for tendinopathy.

[0145] Efficacy on tendinopathy of exosomes derived from human BM-MSCs cultured on synthetic scaffolds incorporating electrospun PCL nanofibers.

[0146] To further advance the development of the manufacturing process of exosomes (Ex3D) derived from stem cells grown on 3D scaffolds, we conducted a study using xeno-free developmentgrade human bone marrow-derived mesenchymal cells (BM-MSCs), cultured with developmentgrade media with GMP -grade analogues. The BM-MSCs were seeded onto synthetic 3D PCL scaffolds, which incorporated electrospinning technology (Nanofiber Solutions, Dublin, OH)9'11to deposit PCL nanofibers aligned unidirectionally on the unit frames. Excitingly, Ex3D produced by this method (BM-MSC-PCL) achieved levels of yield, quality and potency, consistent with Ex3D produced in earlier studies using ADSCs grown on 3D silk scaffolds (ADSC-Silk) based on: 1) expression of known exosome size and protein markers (data not shown); 2) level of miR-221-5p, indicator of active ingredient of the exosomes (Fig. 5A) and level of suppression of NLRP3 and HMGB1 in tenocytes cultured in vitro (potency assay) (Fig. 5B-5D), and 4) efficacy of therapeutic exosomes on tendinopathy was also confirmed in a nude rat model of tendinopathy (in vivo validation) (Fig. 5E-5G). This study validates that Ex3D produced from BM-MSCs cultured on synthetic scaffolds with PCL nanofibers have therapeutic efficacy as previously produced therapeutic exosomes, while being more consistent in spread of diameters.

[0147] Therapeutic exosomes mitigate histologic features of tendinopathy.

[0148] ADSCs and TSPCs were derived from male and female subjects aged 60-80 years old.ADSCs were isolated from the infrapatellar fat pad of patients undergoing knee replacement surgery. TSPCs were isolated from the human biceps tendon of patients undergoing shoulder replacement surgery. ADSCs and TSPCs (passage 1 [Pl] or P2) were cultured on 3D silk scaffolds in 4ml serum- free medium or cultured on regular cell culture dishes, and their respective exosomes from 3D scaffold (Ex3D) and control exosomes from 2D culture (Ex2D), were collected via ultracentrifugation.

[0149] Sprague Dawley rats (male and female, 5-8-months-old, Charles River) were subjected to a 2-week training period to allow their adaption to decline treadmill running. The rats were then subjected to 4 weeks of downhill overuse treadmill activity (17m / min, Ihr / day, 5 days / week, 10° decline) to induce atendinopathic condition.18'23At four weeks following downhill overuse treadmillrunning, at a stage of mild tendinopathy,19exosomes (Ex3D) derived from TSPCs and ADSCs grown on 3D silk scaffolds at 3.5xl08particles (dose 1) (Ex3D-T-l and Ex3D-A-l, respectively) or 7xl08particles (dose 2) (Ex3D-T-2 and Ex3D-A-2, respectively), approximately equivalent to 1 pg or 2 pg of total protein using the FluoroCet exosome quantification kit, in 10 pl phosphate buffered saline (PBS), control exosomes (Ex2D) at 3.5xl08particles in lOpl PBS derived from TSPCs and ADSCs grown in 2D cultures (Ex2D-T and Ex2D-A, respectively), or placebo control (lOpl PBS) were injected once into the midsubstance of the right and left supraspinatus tendons of gender-matched rats. After injection, the rats were subjected to four more weeks of downhill overuse treadmill running and then sacrificed. Sham controls rats maintained regular cage activity instead of treadmill running and were injected with lOpl PBS. The supraspinatus-humerus units from the right shoulder were fixed in formalin and processed for histology.

[0150] Consistent with a study characterizing the overuse-induced tendinopathy model,19the supraspinatus tendon of placebo-treated rats exhibited histologic features of tendinopathy, including increased cellularity, collagen disorganization with fibers that are less aligned with respect to the longitudinal axis of the tendon, and a more rounded cell shape (Fig. 8A). Placebo-treated animals also exhibited increased cleavage of type I collagen (Fig. 8A, 8B), the predominant collagen in native mature tendons, a higher modified Movin score indicating increased tendon damage (Fig. 8B), and a reduced collagen (Col) Fill ratio (Fig. 8D), indicating inferior tendon matrix quality that is associated with scar or immature tendon. In contrast, the supraspinatus tendons from the rats treated with both doses of Ex3D derived from TSPCs (Ex3D-T-l and Ex3D-T-2) and from ADSCs (Ex3D-A-l and Ex3D-A-2) exhibited: 1) improved tendon histology (Fig. 8A), 2) a lower modified Movin score (Fig. 8B), 3) decreased cleavage of collagen type I (Fig. 8A, 8C), and 3) increased intensity of type I / III collagen (Fig. 8D). Ex2D derived from TSPCs or ADSCs (Ex2D-T and Ex2D-A) did not exert a significant therapeutic effect. No significant differences were detected between males and females, and the results for the animals in both genders were pooled. Of note, the efficacy of Ex3D derived from ADSCs (Ex3D-A-l and Ex3D-A-2) in mitigating pathologic changes of tendinopathy was similar to that of Ex3D derived from TSPCs (Ex3D-A-l and Ex3D-A-2), suggesting ADSCs are an appropriate cell source for the production of Ex3D.

[0151] Therapeutic exosomes improve mechanical properties of tendinopathic tendons.

[0152] The left shoulders from the animals in the study hereinabove were dissected and processed for biomechanical testing. The humerus was potted in polymethylmethacrylate and the attached supraspinatus tendon was gripped and held in a custom fixture, at a 30° testing angle (representing 60° abduction angle, illustrated in24), with the supraspinatus tendon aligned axiallywith the actuator shaft.25Samples were subjected to a mechanical testing protocol consisting of a preload to 1 N followed by a 10 second hold, ten preconditioning cycles (1-5 N at 1% strain / s), and finally with a ramp to failure at O.lmm / s. As there was no significant difference between the two doses of Ex3D-T (Ex3D-T-l and Ex3D-T-2) and Ex3D-A (Ex3D-A-l and Ex3D-A-2); the two doses were pooled for the analysis. Placebo-injected rats subjected to overuse running exhibited a reduced maximum load (Fig. 9A) and a reduction in tissue modulus (Fig. 9B).19The supraspinatus tendons injected with Ex3D-T and Ex3D-A had a higher maximum load (Fig. 9A) and tissue modulus (Fig. 9B) compared to that treated with placebo. There was no significant difference between these two mechanical property parameters of the supraspinatus tendons treated with Ex3D derived from ADSCs (Ex3D-A) and TSPCs (Ex3D-T).

[0153] Therapeutic exosomes may relieve tendinopathy-related pain.

[0154] The von Frey26,27and open field assays were carried out to determine the effect of Ex3D-T and Ex3D-A on mitigating symptoms of pain. The von Frey assay, a test of mechanical nociception or sensitivity to mechanical stimuli,26,27revealed that animals treated with placebo or control exosomes exhibited a reduced paw withdrawal threshold (PWT) in their front paws compared to that of sham animals (Fig. 10). As animals showed no difference between the low and high doses of Ex3D-T (Ex3D-T-l and Ex3D-T-2) and Ex3D-A (Ex3D-A-l and Ex3D-A-2), the two doses were pooled for the analysis. There was a significant difference between Ex3D-T or Ex3D-A vs. placebo (p<Q.Q5, Fig. 10), suggesting that Ex3D may exert a palliative effect in mitigating the overuse- induced response to mechanical stimuli. In the open field assay, a test used to evaluate general locomotor activity levels, rats in all the experimental groups showed no significant difference in the distance traveled in an open area in one 10-minute window at the end of the study (p>Q.Q5, not shown). This is likely due to the limitation of the assay which is based on a single 10-minute evaluation window and / or a sample size that was not large enough to detect significant differences (n=6 / group).

[0155] No general toxicity response detected with therapeutic exosomes treatment in rats.

[0156] All the animals survived and did not exhibit any abnormal clinical signs during the study. We also evaluated the toxicity of Ex3D-T and Ex3D-A by subjecting blood samples to complete blood count and blood chemistry analysis. There are no significant differences in the parameters measured between the Ex3D-treated rats compared to that in the sham controls (data not shown).

[0157] Therapeutic exosomes suppresses key pathways that are critical for tendinopathy pathogenesis and its effects are mediated by its carried differentially elevated miRNA.

[0158] In a separate study, we elucidated some of the mechanisms underlying the potential therapeutic effects of Ex3D. The results of these studies strongly suggest that Ex3D exerts its therapeutic effect in tendinopathy by suppressing key pathway mediators such as IL-17A, IL-33, HIF- la and NLRP3 that are critical for early tendinopathy pathogenesis, chronic inflammation and pain.16'22These actions of Ex3D are mediated by, at least in part, its carried active ingredients such as miRNAs that suppress their corresponding pathway mediators [e.g., miR-769-3p (IL-17AR16), miR- 135a-3p (IL-3317), and miR-221-5p (NLRP321’22). These miRNAs are novel or differentially elevated in Ex3D compared to the control exosomes (Ex2D) derived from the ADSCs or TSPCs in 2D culture (data not shown).

[0159] The minimal and optimal effective dose of 3D-scaffold derived exosomes

[0160] ADSCs (female and male, 23 years old and 53 years old, respectively, passage 1) were seeded on the 3D silk scaffolds in DMEM with 10% HPL. After three days of culture, the medium was changed to DMEM with 10% exosome-free FBS. A total of 3xl09therapeutic exosomes (“Ex3D”) were produced in this manner, quantified by the Fluorocet kit. Nude rats (female and male, 3 months old) were subjected to one 10 pl intratendinous injection of collagenase type IA (Sigma #C5894, 0.015 mg / pl in PBS) into the right Achilles tendon under direct visualization. One week after the collagenase injection, rats were randomly assigned to experimental groups and subjected to one intratendinous injection of one of the following into the right Achilles tendon: 1) 3xl06particles ofEx3D, 2) 3xl07particles of Ex3D, 3) 3xl08particles of Ex3D, all suspended in lOpl in PBS, or 4) PBS (vehicle control). The injections of therapeutic exosomes were sex-matched. A sham group (injection of PBS instead of collagenase, followed by a PBS injection a week later) served as an additional control. Two weeks after treatment, the rats were sacrificed. The right limb was dissected and fixed in formalin for histologic analysis. A modified Movin score, a semi-quantitative histologic scoring system that grades the severity of tendinopathy, was used to assess each sample.

[0161] As expected, vehicle-treated rats exhibited a significantly higher Movin score compared to sham animals (Fig. 6A, B). The lowest dose of Ex3D tested (106particles) resulted in a significantly lower Movin score compared to that treated with vehicle. The two doses of Ex3D at sequentially higher orders of magnitude (107and 108particles) exhibited a further improvement in Movin score, and there was no significant difference in Movin score between the treatment with 107and 108particles of Ex3D (Fig. 6A, B). This suggests that Ex3D at 106particles is the minimal effective dose, and Ex3D at 107and 108particles is within the optimal effective dose range. There were no significant differences detected between males vs. females, so the data for both sexes were pooled. In determining the effect of Ex3D on tendon histology, we found that Ex3D at the 107and108particle doses, significantly reduced the cleavage of type I collagen, compared to that treated with vehicle (Fig. 6A, B). The ratio of collagen (Col) Fill was unchanged across all the groups tested (data not shown).

[0162] The optimal dosing schedule, which incorporates repeating dose arms, was determined by injecting the optimal dose of therapeutic exosomes (107particles) into the tendinopathic Achilles tendon one week after the collagenase inj ection. Using the same animal model described in the dosefinding study, Ex3D was injected once every 4 weeks (total of 4 injections), once every 8 weeks (total of 2 injections), and once for 16 weeks. Animals in the vehicle group received an injection of PBS once for 16 weeks. Animals were sacrificed 16 weeks after the initial injection and processed for histologic evaluation. As expected, animals in the vehicle group exhibited a significantly higher Movin score compared to sham animals (Fig. 6C, D). Ex3D injected at increasing frequency trended toward increasing improvement of the Movin Score, and a statistically significant reduction of the Movin score was observed in animals receiving therapeutic exosomes injection every 4 weeks compared to those receiving vehicle or therapeutic exosomes injection every 8 or 16 weeks (Fig. 6C, D). This suggests that Ex3D injection every 4 weeks is the optimal dosing schedule.

[0163] Therapeutic exosomes mitigate tendinopathy-related pain

[0164] The von Frey assay, a test of mechanical nociception or sensitivity to mechanical stimuli, was carried out at baseline prior to the collagenase injection, and at the end of the study, prior to sacrifice. The von Frey assay showed that animals treated with vehicle exhibited a reduced paw withdrawal threshold (PWT) in their hind limb compared to that of sham animals. In contrast, rats treated with Ex3D (108particles) significantly mitigated this pain-related behavior (Fig. 7), suggesting that therapeutic exosomes exert a palliative effect in mitigating mechanical nociception in tendinopathic animals.

[0165] No adverse effects with therapeutic exosomes

[0166] The animals in the tendinopathy-related pain studies above were subject to clinical observations throughout the study. These observations did not reveal any adverse effects with Ex3D treatment. Body weight gain was consistent across all experimental groups. Hematological, serum biochemical analysis, and urinalysis in the therapeutic exosomes-treated animals did not indicate any toxicity related to Ex3D treatment (data not shown). This suggests that there are no adverse effects with the tested doses of Ex3D.

[0167] REFERENCESMaharam E, Yaport M, Villanueva NL, et al. Rho / Rock signal transduction pathway is required for MSC tenogenic differentiation. Bone Res. 2015;3: 15015. Jelinsky SA, Lake SP, Archambault JM, Soslowsky LJ. Gene expression in rat supraspinatus tendon recovers from overuse with rest. Clin Orthop Relat Res. 2008;466(7): 1612-1617. Ganguly P, El-Jawhari JJ, Giannoudis PV, Burska AN, Ponchel F, Jones EA. Age-related Changes in Bone Marrow Mesenchymal Stromal Cells: A Potential Impact on Osteoporosis and Osteoarthritis Development. Cell Transplant. 2017;26(9): 1520-1529. Alt EU, Senst C, Murthy SN, et al. Aging alters tissue resident mesenchymal stem cell properties. Stem Cell Res. 2012;8(2):215-225. Tucker JJ, Riggin CN, Connizzo BK, et al. Effect of overuse-induced tendinopathy on tendon healing in a rat supraspinatus repair model. J Orthop Res. 2015. Soslowsky LJ, Thomopoulos S, Tun S, et al. Neer Award 1999. Overuse activity injures the supraspinatus tendon in an animal model: a histologic and biomechanical study. J Shoulder Elbow Surg. 2000;9(2):79-84. Reuther KE, Thomas SJ, Evans EF, et al. Returning to overuse activity following a supraspinatus and infraspinatus tear leads to joint damage in a rat model. J Biomech. 2013;46(l 1): 1818-1824. Reuther KE, Thomas SJ, Sarver JJ, et al. Effect of return to overuse activity following an isolated supraspinatus tendon tear on adjacent intact tendons and glenoid cartilage in a rat model. J Orthop Res. 2013;31(5):710-715. Archambault JM, Jelinsky SA, Lake SP, Hill AA, Glaser DL, Soslowsky LJ. Rat supraspinatus tendon expresses cartilage markers with overuse. J Orthop Res. 2007;25(5):617-624. Attia M, Huet E, Gossard C, Menashi S, Tassoni MC, Martelly I. Early events of overused supraspinatus tendons involve matrix metalloproteinases and EMMPRIN / CD147 in the absence of inflammation. Am J Sports Med. 2013;41(4):908-917. Maffulli N, Longo UG, Franceschi F, Rabitti C, Denaro V. Movin and Bonar scores assess the same characteristics of tendon histology. Clin Orthop Relat Res. 2008;466(7): 1605-1611. Newton MD, Davidson AA, Pomajzl R, Seta J, Kurdziel MD, Maerz T. The influence of testing angle on the biomechanical properties of the rat supraspinatus tendon. J Biomech. 2016;49(16):4159-4163. Bell R, Taub P, Cagle P, Flatow EL, Andarawis-Puri N. Development of a mouse model of supraspinatus tendon insertion site healing. J Orthop Res. 2015;33(l):25-32.Bonin RP, Bories C, De Koninck Y. A simplified up-down method (SUDO) for measuring mechanical nociception in rodents using von Frey filaments. Mol Pain. 2014;10:26. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 1994;53(l):55-63. Millar NL, Akbar M, Campbell AL, et al. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy. Scientific reports. 2016;6:27149. Millar NL, Gilchrist DS, Akbar M, et al. MicroRNA29a regulates IL-33 -mediated tissue remodelling in tendon disease. Nat Commun. 2015;6:6774. Tang C, Chen Y, Huang J, et al. The roles of inflammatory mediators and immunocytes in tendinopathy. J Orthop Translat. 2018;14:23-33. Millar NL, Murrell GA, Mclnnes IB. Inflammatory mechanisms in tendinopathy - towards translation. Nat Rev Rheumatol. 2017; 13(2): 110-122. Millar NL, Reilly JH, Kerr SC, et al. Hypoxia: a critical regulator of early human tendinopathy. Ann Rheum Dis. 2012; 71(2): 302-310. Chen Q, Zhou J, Zhang B, Chen Z, Luo Q, Song G. Cyclic Stretching Exacerbates Tendinitis by Enhancing NLRP3 Inflammasome Activity via F-Actin Depolymerization. Inflammation. 2018;41(5): 1731-1743. Thankam FG, Roesch ZK, Dilisio MF, et al. Association of Inflammatory Responses and ECM Disorganization with HMGB1 Upregulation and NLRP3 Inflammasome Activation in the Injured Rotator Cuff Tendon. Scientific reports. 2018;8(1): 8918. Xin H, Li Y, Chopp M. Exosomes / miRNAs as mediating cell-based therapy of stroke. Front Cell Neurosci. 2014;8:377. Cobelli NJ, Leong DJ, Sun HB. Exosomes: biology, therapeutic potential, and emerging role in musculoskeletal repair and regeneration. Ann N Y Acad Sci. 2017; 1410(1): 57-67. Shen HH, Yang YX, Meng X, et al. NLRP3: A promising therapeutic target for autoimmune diseases. Autoimmun Rev. 2018. Inouye BM, Hughes FM, Jr., Sexton SJ, Purves JT. The Emerging Role of Inflammasomes as Central Mediators in Inflammatory Bladder Pathology. Curr Urol. 2018; 1 l(2):57-72. Wang C, Xu CX, Alippe Y, et al. Chronic inflammation triggered by the NLRP3 inflammasome in myeloid cells promotes growth plate dysplasia by mesenchymal cells. Sci Rep. 2017;7(l):4880.Kinoshita T, Imamura R, Kushiyama H, Suda T. NLRP3 mediates NF-kappaB activation and cytokine induction in microbially induced and sterile inflammation. PLoS One.2015;10(3):e0119179. Chamorro-Petronacci C, Perez-Sayans M, Padin-Iruegas ME, Marichalar-Mendia X, Gallas- Torreira M, Garcia Garcia A. Differential expression of snoRNAs in oral squamous cell carcinomas: new potential diagnostic markers. J Enzyme InhibMed Chem. 2018;33(l):424- 427. Jelinsky SA, Rodeo SA, Li J, Gulotta LV, Archambault JM, Seeherman HJ. Regulation of gene expression in human tendinopathy. BMC Musculoskelet Disord. 2011 ; 12: 86. Cai X, Cai M, Lou L. Identification of differentially expressed genes and small molecule drugs for the treatment of tendinopathy using microarray analysis. Mol Med Rep. 2015; 1 l(4):3047- 3054. Zhao G, Zhang J, Nie D, et al. HMGB 1 mediates the development of tendinopathy due to mechanical overloading. PLoS One. 2019;14(9):e0222369. El Khoury LY, Rickaby R, Samiric T, Raleigh SM. Promoter methylation status of the TIMP2 and ADAMTS4 genes and patellar tendinopathy. J Sci Med Sport. 2018;21(4):378-382. Corps AN, Jones GC, Harrall RL, Curry VA, Hazleman BL, Riley GP. The regulation of aggrecanase ADAMTS-4 expression in human Achilles tendon and tendon-derived cells. Matrix Biol. 2008;27(5):393-401. Han N, Rao SS, Johnson J, et al. Hydrogel-electrospun fiber mat composite coatings for neural prostheses. Front Neuroeng. 2011 ;4:2. Nagarajan S, Belaid H, Pochat-Bohatier C, et al. Design of Boron Nitride / Gelatin Electrospun Nanofibers for Bone Tissue Engineering. ACS Appl Mater Interfaces. 2017;9(39):33695- 33706. Veleva AN, Heath DE, Johnson JK, et al. Interactions between endothelial cells and electrospun methacrylic terpolymer fibers for engineered vascular replacements. J Biomed Mater Res A. 2009;91(4): 1131-1139.

Claims

CLAIMSWhat is claimed:

1. An isolated plurality of exosomes derived from mammalian stem cells, wherein exosomes of the plurality (i) have been derived from mammalian stem cells cultured on a 3D scaffold of substantially parallel filaments, and (ii) express miR-221-5p at a level higher than (a) an exosome derived from a mammalian stem cell of a same type which has not been cultured on a 3D scaffold of substantially parallel filaments, or (b) an exosome derived from a mammalian stem cell of a same type which has been cultured on a 2D scaffold.2 The isolated plurality of exosomes of Claim 1, wherein exosomes of the plurality express miR-221-5p at a level of 2. Ox or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold.3 The isolated plurality of exosomes of Claim 1 or 2, wherein the mammalian stem cells comprise mesenchymal stem cells.4 The isolated plurality of exosomes of Claim 1, 2 or 3, wherein the mammalian stem cells comprise adipose-derived stem cells, bone marrow-derived stem cells, bursa-derived stem cells, or tendon stem / progenitor cells.5 The isolated plurality of exosomes of Claim 1 or 2, wherein the mammalian stem cells comprise induced pluripotent stem cells.6 A system for differentiating mammalian stem cells into a tendon lineage comprising a 3D scaffold comprising a plurality of thermoplastic polyester filaments substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the filaments.7 A system for inducing production of exosomes of the plurality of any of Claims 1 to 5, from mammalian stem cells comprising a 3D scaffold comprising a plurality of thermoplastic polyesterfilaments substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the filaments.

8. The system of Claim 6 or 7, wherein the thermoplastic polyester filaments comprise poly caprolactone nanofilaments.9 The system of Claims 6, 7 or 8, wherein the filaments of the plurality are spaced at a minimum of 30 pm apart.10 The system of any of Claims 6 to 9, wherein the filaments of the plurality are spaced 30 pm to 50 pm apart.11 The system of any of Claims 6 to 10, wherein the filaments of the plurality are spaced 40 pm apart.12 The system of any of Claims 6 to 11, wherein a filament of the plurality is maintained under 025 N to 1.0 N tension.13 The system of any of Claims 6 to 12, wherein a filament of the plurality is maintained under 0 5 N tension.14 The system any of Claims 6 to 13, wherein an average diameter of a filament of the plurality is 10 nm to 20 pm.15 The system of any of Claims 6 to 14, comprising a medical grade resin to which filament ends are attached.16 The system of any of Claims 6 to 15, further comprising a plurality of stem cells obtained from a mammalian subject present on the 3D scaffold, and a plurality of exosomes derived from said stem cells.17 The system of any of Claims 6 to 16, wherein the stem cells comprise mesenchymal stem cells.

18. The system of Claim 17, wherein the mesenchymal stem cells (MSC) comprise adipose- derived stem cells, bone marrow-derived stem cells, bursa-derived stem cells, or are tendon stem / progenitor cells.

19. The system of any of Claims 6 to 18, which does not comprise silk fibers or filaments.

20. A method of treating a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising: i. obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; ii. culturing the mesenchymal stem cells on the scaffold of a system of any of Claims 6 to 19, so as to produce a plurality of exosomes; and iii. administering to the first mammalian subject an amount of the plurality of exosomes effective to treat a connective tissue pathology or musculoskeletal pathology.

21. A method of treating pain associated with a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising: i. obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; ii. culturing the mesenchymal stem cells on the scaffold of a system of any of Claims 6 to 19, so as to produce a plurality of exosomes; and iii. administering to the first mammalian subject an amount of the plurality of exosomes effective to treat a connective tissue pathology or musculoskeletal pathology.

22. A method of treating a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising administering to the subject an amount of exosomes which have been obtained from a culture of mammalian stems cells cultured on a scaffold of a system of any of Claims 6 to 19, effective to treat a connective tissue pathology or musculoskeletal pathology.

23. A method of treating pain associated with a connective tissue pathology or musculoskeletal pathology in a first mammalian subject comprising administering to the subject an amount of exosomes which have been obtained from a culture of mammalian stems cells cultured on ascaffold of a system of any of Claims 6 to 19, effective to treat pain associated with a connective tissue pathology or musculoskeletal pathology.

24. The method of any of Claims 20 to 23, wherein the plurality of exosomes has a spread of diameters of about 200nm or less, and / or a mean diameter of lOOnm or less.

25. The method of any of Claims 20 to 24, wherein the subject from which the amount of mesenchymal stem cells are obtained, or have been obtained, is of the same species as the first mammalian subject.

26. The method of any of Claims 20 to 25, wherein the subject from which the amount of mesenchymal stem cells are obtained, or have been obtained, is the first mammalian subject.

27. The method of Claim 26, wherein the mammalian stems cells have been obtained from the first mammalian subject prior to the tendon being damaged or while the tendon is damaged.

28. The method of Claim 26, wherein the mammalian stems cells have been obtained from the first mammalian subject prior to the pain associated with a damaged tendon being experienced or damaged or while the pain associated with the damaged tendon exists.

29. The methods of any of Claims 20 to 28, wherein the first mammalian subject is a human.

30. The methods of any of Claims 20 to 29, wherein the mammalian stem cells are human stem cells.

31. The method of Claim 30, wherein the exosomes of the plurality express miR-221-5p at a level of 2. Ox or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold.

32. The method of any of Claims 20 to 31, wherein the exosomes of the plurality have an average diameter of between lOnm and 20pm.

33. The method of any of Claims 20 to 32, wherein the mammalian stem cells comprise adipose- derived stem cells, bone marrow-derived stem cells, bursa-derived stem cells, or are tendon stem / progenitor cells.

34. The method of any of Claims 20 to 33, wherein the therapeutic effect is dose dependent, with the minimum exosome dose of IO3particles suitable for humans.

35. The method of any of Claims 20 to 23, further comprising obtaining vesicles from a supernatant of the cultured mesenchymal stem cells on the scaffold.

36. The method of any of Claims 20 to 35, wherein the connective tissue pathology is tendinopathy.

37. The method of any of Claims 20 to 35, wherein the connective tissue pathology is tendinitis.

38. The method of any of Claims 20 to 35, wherein the connective tissue pathology is a tendon injury.

39. The method of any of Claims 20 to 38, wherein the administering is by intraarticular injection.

40. The method of any of Claims 20 to 38, wherein the administering is by intramuscular injection.

41. The method of any of Claims 20 to 38, wherein the musculoskeletal pathology is arthritis such as rheumatoid arthritis or osteoarthritis.

42. A composition comprising a sterile pharmaceutically acceptable carrier and an amount of vesicles derived from a supernatant of mesenchymal stem cells cultured on a 3D scaffold comprising a plurality of fibers substantially aligned in a parallel manner along their longitudinal axes and held under tension in a longitudinal direction of the fibers.

43. A composition comprising the isolated plurality of exosomes of any of Claims 1 to 5, and a sterile pharmaceutically acceptable carrier.

44. The composition of Claim 42 or 43, wherein the sterile pharmaceutically acceptable carrier comprises a buffer.

45. The composition of Claim 42, 43 or 44, which is an injectable composition.

46. The composition of any of Claims 42 to 45, wherein the composition reduces NLRP3 expression when administered to a tendon.

47. The composition of any of Claims 43 to 44, wherein the exosomes of the plurality have an average diameter of between lOnm and 20p.m.

48. The composition of any of Claims 42 to 47, wherein the composition is formulated for injection.

49. The composition of any of Claims 42 to 48, wherein the composition is formulated for intratendinous injection.

50. A method of treating a connective tissue condition or musculoskeletal condition in a subject in need thereof, comprising administering to the subject a therapeutically-effective amount of a compound that reduces NLRP3 expression.

51. The method of Claim 50, wherein the compound reduces human NLRP3 expression.

52. The method of Claim 50, wherein the compound binds to human NLRP3 mRNA.

53. The method of Claim 50, wherein the compound is formulated in a pharmaceutical composition that comprises a pharmaceutically-acceptable carrier.

54. The method of Claim 50, wherein the administering is by injection.

55. The method of Claim 50, wherein the administering is by intratendinous injection.

56. The method of Claim 50, wherein the connective tissue condition is tendinopathy.

57. The method of Claim 50, wherein the connective tissue condition is tendinitis.

58. The method of Claim 50, wherein the connective tissue condition is a tendon injury.

59. The method of Claim 50, wherein the administering is by intraarticular injection.

60. The method of Claim 50, wherein the administering is by intramuscular injection.

61. The method of Claim 50, wherein the musculoskeletal condition is arthritis such as rheumatoid arthritis or osteoarthritis.

62. A method of suppressing IL-17A, IL-33, HIF-la and / or NLRP3 in a tendon of a first mammalian subject comprising: obtaining, or having obtained, an amount of mesenchymal stem cells from a mammalian subject; culturing the mesenchymal stem cells on the scaffold of a system of any of Claims 6 to 19, so as to produce a plurality of exosomes; and administering to the first mammalian subject an amount of the plurality of exosomes effective to suppress IL-17A, IL-33, HIF-la and / or NLRP3 in a tendon.

63. The method of Claim 62, wherein the exosomes of the plurality express miR-221-5p at a level of 2. Ox or more than of exosomes derived from mammalian stem cell of a same type which has been cultured on a 2D scaffold.

Images