Biosensor comprising a bioreference electrode

Abstract

Provided is a bioelectrochemical sensor for measuring a target substance which at least comprises: a working electrode which comprises a biosensing molecule, which can catalyze or bind to the target substance, and a reference electrode which comprises a bioreference molecule which harbors a redox species which can be electrochemically accessible to the reference electrode, thereby giving a specific redox potential but lacks a catalytic activity or binding ability to the target substance.

Description

BIOSENSOR COMPRISING A BIOREFERENCE ELECTRODE FIELD OF THE INVENTION

[0001] The invention relates to a biosensor (bioelectrochemical sensor) for sensing a target substance and a biosensing method using thereof. BACKGROUND OF THE INVENTION

[0002] Bioelectrochemical sensors and their inherent problems The boelectrochemical sensors are defined as an electrochemical sensor employing a biological material, a biologically derived material or a biomimic intimately associated with or integrated within a physicochemical transducer or transducing microsystem, thereby constructing electrochemical analytical devices.

[0003] Bioelectrochemical sensors are comprised of at least a) an electrode which is composed of biologically derived or mimicked molecules, such as enzymes, antibodies, binding proteins, or aptamers (here after “biosensing molecules”) which can catalyze or bind to the substrate (electrode 1; working electrode), and b) a reference electrode which is an electrode that has a stable and well-known redox species, thereby giving a specific redox potential (electrode 2; reference electrode). Such bioelectrochemical sensors may be comprised of an additional electrode which does not contain neither the biosensing molecules of electrode 1 or reference electrode 2, but can be used as the counter electrode where the electrode 1 will be applied a certain potential against electrode 2 which is connected to electrode 2 to proceed electrochemical reaction on electrode 1 thereby monitoring electrochemical signal created on electrode 1, which is the measure of the target sample concentration (electrode 3; counter electrode).

[0004] One of the critical issues of the bioelectrochemical sensors is the instability of the sensors. The instability of the sensors is due to the instability of biosensing molecules and the instability of reference electrodes. Considering that the biosensing molecules are biologically derived materials, the instability is an inherent issue. The variety of engineering approaches have beenconducted to improve the stability of biosensing molecules. The instability of the potential of the reference electrode toward the change of chemical and physical environment, as well as the operation stability is due to the principle and the structure of the reference electrode, which are based on the chemical species used in the electrode and the equilibrium of the redox reaction of the chemicals exist on the electrode. Especially, the in vivo instability of the potential of the reference electrodes is due to the design and structure of the reference electrode. Current reference electrodes are generally based on the chemical equilibrium between two ions, such as Ag+and Cl- with AgCl. Therefore, when tested in systems which are nonstable (such as in vivo) these dynamics may change, shifting the equilibrium, and therefore creating nonstable potentials. Therefore, continuous redox reaction on the reference electrode is the inherent issue causing the instability of the reference electrode, which will affect the change or fluctuation of the potential being applied or measured on the working electrode, being measured as the signals. However there have been limited efforts reported to mitigate the instability of reference electrodes.

[0005] Reference Electrodes All electrochemical experiments require a minimum 2 electrodes, a working and a reference electrodes. Working electrodes are where the reaction of interest will occur, applying either voltage or current to drive a reaction. This voltage, or current is both applied and measured against a stable, known reference electrode. The reference electrode must maintain a steady, and stable potential to accurately measure, or apply voltage / current over the working electrode. The potential achieved from conventional reference electrodes are derived from the Nernst equations:This shows that the potential of the cell is based on the equilibrium of chloride and silver ions, vs the AgCl complex. This electrode potential will be dependent on the chloride and silver concentration, based on their association / dissociation rates as well as the bulk concentrations of each substrate. To ensure a stable potential for in vitro experiments, reference electrodes are designed using an internal filling solution (generally 1 M KCl for Ag / AgCl) which is segmented from the bulk solution by a porous frit, limiting the diffusion of ions. This frit or “junction” isused to ensure a constant, and stable concentration of Cl around the Ag / AgCl layer, which ensures a stable equilibrium (FIG.1). This is an innate limitation for using these electrodes in vivo, where chloride, and other cations may fluctuate in concentration, shifting this equilibrium, and thereby shifting the potential measured or applied.

[0006] Open circuit potential glucose Sensor The development of an open circuit potential (OCP) glucose sensor has been a focus for the calibration or conventional chronoamperometric glucose sensors, and for the direct detection of glucose. The sensor functions by applying a known oxidative potential for the respective enzyme of interest (Glucose Dehydrogenase in the example), followed by the measurement of OCP for some period. During the OCP measurement there is no turnover of the enzyme, reaching a steady state equilibrium based on the concentration of glucose, and available enzyme for binding. The stability of using OCP has been shown to be much greater than chronoamperometric sensing. OCP has an innate limitation in requiring a stable, in vivo reference electrode with minimal drift, as the OCP is measured directly against the reference electrode. Currently available reference electrodes (primarily Ag / AgCl) do not have the stability for in vivo continuous use. SUMMARY OF THE INVENTION

[0007] To overcome the current technological limitation in the stability of the available reference electrode for bioelectrochemical sensors, we invented bioelectrochemical sensors employing at least composed of a) an electrode which is composed of biologically derived or mimicked molecules, such as enzymes, antibodies, binding proteins, or aptamers (here after “biosensing molecules”) which can catalyze or bind to the substrate (electrode 1; working electrode), and b) an electrode which is composed of biologically derived or mimicked molecules harboring redox species which can be electrochemically accessible to the electrode thereby giving a specific redox potential but not catalyzing any reaction nor binding with the target substances (here after “bioreference molecules”) which bind or react with the biosensing molecule modified on the surface of the electrode 1 (electrode 2; BioReference electrode).

[0008] Such bioelectrochemical sensors may be comprised of an additional electrode which does not contain either the biosensing molecules of electrode 1 or bioreference molecules of electrode 2, but can be used as the counter electrode, where the electrode 1 will be applied a certain potential against electrode 2 which is connected to electrode 2 to proceed an electrochemical reaction on electrode 1 thereby monitoring electrochemical signal created on electrode 1, which is the measure of the target substance concentration (electrode 3; counter electrode).

[0009] Embodiments include: 1) Bioelectrochemical sensors at least composed of a) an electrode which is composed of biosensing molecules, such as enzymes, antibodies, binding proteins, or aptamers which can catalyze or bind to the substrate (electrode 1; working electrode), and b) an electrode which is composed of bioreference molecules which are the biologically derived or mimicked molecules harboring redox species which can be electrochemically accessible to the electrode thereby giving a specific redox potential but not catalyzing any reaction nor binding with the target substance which will bind or react with biosensing molecule immobilized on the surface of the electrode 1 (electrode 2; BioReference electrode). 2) Bioelectrochemical sensors described in 1) with an additional electrode which does not contain either the biosensing molecules of electrode 1 or bioreference molecules of electrode 2, but can be used as the counter electrode, where the electrode 1 will be applied a certain potential against electrode 2 to proceed electrochemical reaction on electrode 1 thereby monitoring electrochemical signal created on electrode 1, which is the measure of the target substance concentration (electrode 3; counter electrode). 3) Bioelectrochemical sensors described in 1) or 2), where the biosensing molecules in working electrode are enzymes capable of transfer electron directly to the electrode (DET-type enzymes). 4) Bioelectrochemical sensors described in 1), 2), or 3) where the biosensing molecules in working electrode are the multi copper oxidases capable of transfer electron directly to the electrode.5) Bioelectrochemical sensors described in 1), 2), or 3) where the biosensing molecules in working electrode are the dehydrogenases which are modified by the redox mediator, thereby capable of transfer electron directly to the electrode (quasi-DET-type enzymes). 6) Bioelectrochemical sensors described in 1), 2), or 3) where the biosensing molecules in working electrode are the lactate dehydrogenases modified by the redox mediator, thereby capable of transfer electron directly to the electrode (quasi-DET-type LDH). 7) Bioelectrochemical sensors described in 1), 2), or 3) where the biosensing molecules in working electrode are the glucose dehydrogenases capable of transfer electron directly to the electrode (DET-type GDH). 8) Bioelectrochemical sensors described in 1), 2), or 3) where the biosensing molecules in working electrode are the glucose dehydrogenases capable of transfer electron directly to the electrode (DET-type GDH). 9) Bioelectrochemical sensors described in 1), 2), or 3) where the bioreference molecules in reference electrode are protein molecules containing redox species. 10) Bioelectrochemical sensors described in 9) where the redox species in the bioreference molecules in reference electrode are selected from heme, iron sulfur cluster, copper, flavins or quinones. 11) Bioelectrochemical sensors described in 10) where the redox species in the bioreference molecules in reference electrode are heme b or heme c-containing proteins. 12) Bioelectrochemical sensors described in 1)-3) where the bioreference molecules in reference electrode are inactivated DET-type enzymes. 13) Bioelectrochemical sensors described in 12) where the bioreference molecules in reference electrode are inactivated DET-type lactate dehydrogenases. 14) Bioelectrochemical sensors described in 12) where the bioreference molecules in reference electrode are inactivated DET-type glucose dehydrogenase. 15) Bioelectrochemical sensors described in 1) - 3) where the biosensing molecules in working electrode is the DET-type GDH comprising a catalytic subunit, an electron transfer subunit and a hitchhiker subunit such as one derived from Burkholderia cepacia (BcGDH).16) Bioelectrochemical sensors described in 1) - 12) where the biosensing molecules in working electrode is the BcGDH which is the engineered BcGDHs that are introduced mutations to enhance its thermal stability and / or substrate specificity (eBcGDHs). 17) Bioelectrochemical sensors described in 16) where the bioreference molecules in reference electrode is inactivated DET-type BcGDH. 18) Bioelectrochemical sensors described in 17) where the bioreference molecules in reference electrode is inactivated eBcGDHs. 19) Bioelectrochemical sensors described in 18) where the bioreference molecules in reference electrode is inactivated eBcGDHs selected from the following mutants i) BcGDH α-S326Q-S365Y-A472Y, γK155C / βY349C-αQYYP205C / βD383C, β-C192A- C195A, β- K343A-M386A or colloquially named: BcGDH QYY CCx2 AxxAH #2 K343A / M386A ii) BcGDH α-S326Q-S365Y-A472Y, γK155C / βY349C-αQYYP205C / βD383C, α-H476A- N519A or colloquially named: BcGDH QYY CCx2 H476A / N519A. 20) Bioelectrochemical sensors described in 1)-3) where the BioReference electrode is composed of the bioreference molecule which harbors the identical redox species as the biosensing molecule in working electrode, which interacts with electrode, to show DET-ability. (an example includes a levodopa sensor (enzymatic sensors; chronoamperometry, open circuit potential based potentiometry, transient OCP based potentiometry) using inactivated Tyrosinase which is a copper protein as the BioReference electrode, whereas working electrode is composed of levodopa dehydrogenase which is a copper protein.) 21) Bioelectrochemical sensors described in 1)-3) where the BioReference electrode is composed of the bioreference molecule which harbors the different redox species as the biosensing molecule in working electrode, which interacts with electrode, to show DET-ability. (an example includes a levodopa sensor (enzymatic sensors; chronoamperometry, open circuit potential based potentiometry, transient OCP based potentiometry) using cytochrome b562 fused glutamine binding protein was used for bioreference molecule whereas working electrode is composed of levodopa dehydrogenase.)22) Bioelectrochemical sensors described in 1)-3) where the BioReference electrode is composed of the bioreference molecule which harbors the different redox species as the biosensing molecule in working electrode, which interacts with electrode, to show DET-ability. (an example includes a levodopa sensor (enzymatic sensors; chronoamperometry, open circuit potential based potentiometry, transient OCP based potentiometry) using cytochrome b562-fused glutamine binding protein was used for bioreference molecule whereas working electrode is composed of levodopa dehydrogenase. Also an example includes a thrombin sensor (square wave voltammetry, electrochemical impedance spectroscopy, potentiometry with the extend gate field effect transistor.) when cytochrome b562 fused glutamine binding protein was used as a bioreference molecule, whereas the redox-species (e.g. PES)-modified anti-thrombin aptamer was used in the working electrode.

[0010] According to the chemically stable properties of thus employed bioreference molecules, the operational stability of the bioelectrochemical sensors employing the BioReference electrode is superior to the one employing conventionally utilized reference electrode, such as Ag / AgCl electrode.

[0011] Anticipated benefits using BioReference electrode as the reference electrode for biosensors are as follows: Benefit 1 – Stability Ag / AgCl based reference electrodes maintain a thermodynamically stable potential based on the chemical equilibrium between AgCl and Cl- + Ag+which in vitro may be stable but can vary during in vivo use. In addition, from the moment the Ag / AgCl reference electrode is inserted into a solution, Cl- will began leaching off the electrode following Fick’s law of diffusion, gradually causing a shift in potential. BioReference does not have this limitation as the molecule used to maintain a stable potential is covalently bound to an electrode, mitigating this effect. Benefit 2 – MiniaturizationWhile both conventional reference electrode, and the Biorefernce electrodes are independent to surface area, following the Nernst equation, there are practical limitations to ultra- miniaturization of Ag / AgCl electrodes due to the impact of diffusion and leaching of the Ag / AgCl electrode, whereas the BioReference can be miniaturized, both maintaining the potential equilibrium, while also not being limited due the absolute amount of a specific ion which may diffuse away. Benefit 3 – Mirroring the working electrode from chemical environmental changes If the BioReference electrode employs bioreference molecules which is an identical molecule as biosensing molecules but without catalytic activities or target binding ability, or at least molecules harboring identical redox species interacting with electrode, then any alteration which shifts the net potential should be “nulled” due to the net potential being the difference between the working and reference electrode of an electrochemical cell. Benefit 4– Mirroring the working electrode from physical environmental changes If the BioReference electrode employs bioreference molecules which is an identical molecule as biosensing molecules, but without catalytic activities or target binding ability, or at least molecules harboring identical redox species interacting with as the working electrode, then any alteration which shifts the net potential should be “nulled” due to the net potential being the difference between the working and reference electrode of an electrochemical cell. BRIEF DESCRIPTION OF DRAWINGS

[0012] FIG. 1: Scheme showing possible environmental variables which may create non-stable reference potential. FIG. 2: Chronoamperometric response of glucose with 0.2 V applied voltage with respect to a QYY CCx2 AxxAH #2 K343A / M386A immobilized to a gold electrode as a BiorReference electrode.FIG. 3A: Open circuit potential response of glucose measured 1 second after 0.2 V applied voltage with respect to a QYY CCx2 AxxAH #2 K343A / M386A immobilized to a gold electrode as a BioReference electrode. FIG. 3B: Stability of glucose sensor using open circuit potential measurement against BioReference for 1 week of continuous measurement, measured at steady state. FIG. 4: Transient open circuit potential (dOCP / dt) response of glucose measured 0.1 second after 0.2 V applied voltage with respect to a QYY CCx2 AxxAH #2 K343A / M386A immobilized to a gold electrode as a BioReference electrode. FIG. 5: Chronoamperometric response of glucose with 0.2 V applied voltage with respect to a BcGDH QYY CCx2 H476 / N519 immobilized to a gold electrode as a BioReference electrode. Using 3 different immobilization techniques. FIG. 6A: Day 0 raw OCP response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 6B: Day 3 raw OCP response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 6C: Day 7 raw OCP response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 7A: Day 0 OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 7B: Day 3 OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 7C: Day 7 OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 8A: Day 0 overnight OCP response at 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode.FIG. 8B: Day 3 overnight OCP response at 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 8C: Day 7 overnight OCP response at 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 9A: Day 0 raw transient OCP response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 9B: Day 3 raw transient OCP response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 9C: Day 7 raw transient OCP response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 10A: Day 0 traneint OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 10B: Day 3 traneint OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 10C: Day 7 traneint OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 11A: Day 0 raw CA response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 11B: Day 3 raw CA response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 11C: Day 7 raw CA response using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 12A: Day 0 CA calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 12B: Day 3 CA calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode.FIG. 12C: Day 7 CA calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 H476A / N519A BioReference electrode. FIG. 13A: Day 0 raw OCP response using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 13B: Day 3 raw OCP response using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 13C: Day 7 raw OCP response using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 14A: Day 0 OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 14B: Day 3 OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 14C: Day 7 OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 15A: Day 0 overnight OCP response at 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 15B: Day 3 overnight OCP response at 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 15C: Day 7 overnight OCP response at 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 16A: Day 0 raw transient OCP response using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 16B: Day 3 raw transient OCP response using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 16C: Day 7 raw transient OCP response using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode.FIG. 17A: Day 0 traneint OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 17B: Day 3 traneint OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 17C: Day 7 traneint OCP calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 18A: Day 0 raw CA respsone using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 18B: Day 3 raw CA respsone using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 18C: Day 7 raw CA respsone using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 19A: Day 0 CA calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 19B: Day 3 CA calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 19C: Day 7 CA calibration curves acorss 0 – 20 mM glucose using the BcGDH QYY CCx2 AxxAH #2 K343A / M386A BioReference electrode. FIG. 20: The sensitivity across 10 days using OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference, and compared to the gold standard Ag / AgCl Reference electrode. FIG. 21: The sensitivity across 10 days using transient OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference, and compared to the gold standard Ag / AgCl Reference electrode.FIG. 22: The sensitivity across 10 days using CA, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference, and compared to the gold standard Ag / AgCl Reference electrode. FIG. 23A: The sensitivity across 2 different pH values, either 6 or 8 using OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 23B: The sensitivity across 2 different pH values, either 6 or 8 Chronoamperometry (CA), with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 23C: The sensitivity across 2 different pH values, either 6 or 8 using transeint OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 24A: The sensitivity across 2 different temperature values, either 25° C and 37° C using OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 24B: The sensitivity across 2 different temperature values, either 25° C and 37° C using CA, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 24C: The sensitivity across 2 different temperature values, either 25° C and 37° C using transeint OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 25A: The sensitivity across 2 different NaCl concentrations, either 50 mM and 500 mM using OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 25B: The sensitivity across 2 different NaCl concentrations, either 50 mM and 500 mM using CA, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 25C: The sensitivity across 2 different NaCl concentrations, either 50 mM and 500 mM using transeint OCP, with either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference and compared to the gold standard Ag / AgCl Reference electrode. FIG. 26A: The CA response using levodopa dehydrogenase as the working elecotrde, and inactivated tyrosinase as the BioReference electorde. FIG. 26B: The OCP response using levodopa dehydrogenase as the working elecotrde, and inactivated tyrosinase as the BioReference electorde. FIG. 26C: The transient OCP response using levodopa dehydrogenase as the working elecotrde, and inactivated tyrosinase as the BioReference electorde. FIG. 27A: The CA response using levodopa dehydrogenase as the working elecotrde, and cytochrome b562-fused glutamine binding protein as the BioReference electorde. FIG. 27B: The OCP response using levodopa dehydrogenase as the working elecotrde, and cytochrome b562-fused glutamine binding protein as the BioReference electorde. FIG. 27C: The transient OCP response using levodopa dehydrogenase as the working elecotrde, and cytochrome b562-fused glutamine binding protein as the BioReference electorde. FIG. 28A: The SWV sweeping from -0.4 V to 0 V using 0 and 100 nM thrombin (lower versus upper). FIG. 28B: The increase in peak voltage upon the additon of 100 nM thrombin. FIG. 29A: The percent change in absolute and percent change in OCP due to effect of pH when using various reference electrodes.FIG. 29B: The percent change in absolute and percent change in CA due to effect of pH when using various reference electrodes. FIG.29C: The percent change in absolute and percent change in OCP due to effect of total ionic concentration when using various reference electrodes. FIG.29D: The percent change in absolute and percent change in CA due to effect of total ionic concentration when using various reference electrodes. DETAILED DESCRIPTION

[0013] <Biosensor> A biosensor (also referred to as bioelectrochemical sensor) according to one embodiment of the invention comprises: a working electrode which comprises a biosensing molecule, which can catalyze and / or bind to the target substance, and a reference electrode which comprises a bioreference molecule which harbors a redox species which can be electrochemically accessible to the reference electrode, thereby giving a specific redox potential but lacks a catalytic activity or binding ability to the target substance.

[0014] <Working electrode> The working electrode comprises a biosensing molecule, which can catalyze and / or bind to the target substance and transfer signals to the working electrode, such as electron, change of the redox potential and change of capacitance. The biosensing molecule maybe a molecule which has an ability to transfer an electron based on the reaction with the target substance (substrate) or the binding to the target substance.The biosensing molecule maybe biologically derived or mimicked molecules, such as enzymes, or target-binding proteins such as antibodies, binding proteins and target-binding aptamers.

[0016] The biosensing molecule may be an enzyme which can catalyzes the reaction with the target substance. Examples of enzymes include oxidoreductases which can catalyze the oxidation / reduction of the substrates and thereby transfer an electron to the working electrode. The oxidoreductase may be selected depending on the type of the target substance. Examples of oxidoreductases include dehydrogenases such as alcohol dehydrogenase, glutamate dehydrogenase, cholesterol dehydrogenase, aldehyde dehydrogenase, glucose dehydrogenase (GDH), cellobiose dehydrogenase, fructose dehydrogenase, sorbitol dehydrogenase, lactate dehydrogenase (LDH), malate dehydrogenase, glycerol dehydrogenase, 17B hydroxysteroid dehydrogenase, estradiol 17B dehydrogenase, amino acid dehydrogenase, glyceraldehyde 3- phosphate dehydrogenase, 3-hydroxysteroid dehydrogenase, levodopa dehydrogenase; oxidases such as glucose oxidase (GOD), galactose oxidase, bilirubin oxidase, pyruvate oxidase, D- or L- amino acid oxidase, amine oxidase, cholesterol oxidase, choline oxidase, xanthine oxidase, sarcosine oxidase, L-lactate oxidase, ascorbate oxidase, fructosyl amino acid / peptide oxidases, glycerol-3phosphate oxidase; other oxidoreductases such as diaphorase, cytochrome oxidoreductase, phenol oxidase, multicopper oxidase, tyrosinase, catalase, peroxidase, and glutathione reductase.

[0017] Among these, oxidoreductases capable of direct electron transfer with the electrode, that is, oxidoreductases capable of direct transfer of electrons generated by the enzymatic reaction to the electrode without requiring an external electron acceptor such as oxygen or synthetic electron acceptor (or mediator) are preferably used. Such oxidoreductases are also referred to as direct electron transfer (DET)-type oxidoreductases.

[0018] Examples of the oxidoreductase capable of direct electron transfer with the electrode (DET-type oxidoreductase) include oxidoreductases physiologically including a redox species (heme, iron- sulfur cluster, copper cluster, flavins and quinones etc.) involved in electron transfer with theelectrode. For example, an oxidoreductase containing an electron transfer subunit or an electron transfer domain as the redox species may be used. Examples of the electron transfer subunit include heme-containing subunits, and examples of the electron transfer domain include heme- containing domains. Examples of the heme-containing subunits and domains include subunits and domains containing heme c or heme b, more specifically, subunits and domains containing a cytochrome such as cytochrome c or cytochrome b. Examples of the enzyme containing a cytochrome-containing subunit as an electron transfer subunit include glucose dehydrogenase (GDH), sorbitol dehydrogenase (sorbitol DH), D- fructose dehydrogenase (fructose DH), D-glucoside-3-dehydrogenase, cellobiose dehydrogenase, lactate dehydrogenase, and urate oxidase. Specific examples of the glucose dehydrogenase (DET-type GDH) containing a cytochrome include cytochrome glucose dehydrogenase having an FAD-containing catalytic subunit (α- subunit) and an electron transfer (cytochrome) subunit (β-subunit) (FADGDH), wherein the FADGDH preferably further has a hitchhiker subunit (γ-subunit) (FADGDH γαβ). Examples of the FADGDH include FAD-dependent glucose dehydrogenase derived from Burkholderia cepacia, and mutants thereof. The nucleotide sequence encoding the gamma subunit, alpha subunit, and beta subunit of FADGDH from B. cepacia is shown in SEQ ID NO: 1. The amino acid sequences of the gamma subunit, alpha subunit, and beta subunit of FADGDH from B. cepacia are shown in SEQ ID NOs: 2, 3 and 4, respectively. FADGDH may contain a mutation and examples of the mutants which have a mutation to increase catalytic activity / substrate specificity of FADGDH derived from Burkholderia cepacia include FADGDH mutants such as an α-subunit mutant in which the amino acid residues at positions 472 and 475 are substituted (WO 2005 / 103248), an α-subunit mutant in which the amino acid residues at positions 326, 365, and 472 are substituted (α-S326Q-S365Y-A472Y (QYY) JP 2012-090563 A), and an α-subunit mutant in which the amino acid residues at positions 365, 326, 472, 475, 529, and the like are substituted (WO 2006 / 137283). DET-type GDH may have mutations to introduce cysteine residues in each subunit for forming inter-subunit disulfide bonds such as γK155C / βY349C-αP205C / βD383C (US2022 / 0306996A1).

[0019] Other examples of the trimeric FADGDH include FADGDHs from Burkholderia cenocepacia, Burkholderia thailandensis, Ralstonia pickettii, Ralstonia solanacearum, Burkholderia phytofirmans, Ralstonia sp., Moraxellaceae bacterium, Pseudomonasknackmussii, Yersinia nurmii, Edaphovirga cremea, Silvimonas terrae, Zymobacter palmae, Cobetia sp., Halomonas sp. and Ewingella americana, (US2022 / 0306996A1) and thus these FADGDHs, which may include mutations corresponding to those for B. cepacia as described above, can be used as DET- type GDHs in the working electrode.

[0020] Examples of the DET-type oxidoreductase also include multi copper oxidase capable of transferring electron directly to the electrode, and a specific example thereof includes a tyrosinase. Examples of the DET-type oxidoreductase include levodopa dehydrogenase as described in US patent application No. PCT / US2024 / 031682.

[0021] Direct electron transfer-type oxidoreductases also include an oxidoreductase which is modified with a redox species and is capable of electron transfer with the electrode (quasi-DET-type enzymes). The above-exemplified oxidoreductases can be modified with a redox species. The redox species may be a compound having no catalytic action which receives an electron from an oxidoreductase to undergo reduction, followed by reoxidization at the electrode. Examples of the redox species include quinone compounds (for example, 1,4-naphthoquinone, vitamin K3, 9,10-phenanthrenequinone, 1,2-naphthoquinone, p-xyloquinone, methylbenzoquinone, 2,6- dimethylbenzoquinone, sodium 1,2-naphthoquinone-4-sulfonate, 1,4-anthraquinone, tetramethylbenzoquinone, and thymoquinone), phenylenediamine compounds (for example, N,N-dimethyl-1,4-phenylenediamine and N,N,N’,N’-tetramethyl-1,4-phenylenediamine), 1- methoxy-PMS (1-methoxy-5-methylphenazinium methylsulfate), PES (phenazine ethosulfate), coenzyme Q0, AZURE A chloride, phenosafranin, 6-aminoquinoxaline, and tetrathiafulvalene. Examples of the method for the modification of the oxidoreductase with the redox species include a method in which the redox species is chemically bound to the enzyme (Biosensors and Bioelectronics 2020, 151, 111974). For example, the method may be a method in which afunctional group such as succinimide is introduced to the redox species, and the functional group is then reacted with an amino group of the enzyme to introduce the redox species to the enzyme. An Example of quasi-DET-type enzyme include a lactate dehydrogenase modified by the redox mediator such as PES, thereby capable of transfer electron directly to the electrode (quasi-DET- type LDH) (Biosens Bioelectron.2020 Mar 1:151:111974).

[0022] The biosensing molecule may also be a target substance-binding molecule such as a binding protein, an antibody and an aptamer including nucleotide aptamer and peptide aptamer which is modified with a redox species. A nucleotide aptamer may be a DNA aptamer or RNA aptamer. Known aptamers include ant-thrombin aptamer, etc. Examples of the redox species are as described above. Specific examples include a PES-modified antibody which recognizes a target substance and a PES-modified aptamer which binds to a target substance.

[0023] The modification with a redox species can be performed by a conventional method including chemical reaction with a reactive group such as amino group and / or a carboxylic group of a target substance-binding molecule such as an antibody, peptides and nucleic acid molecule.

[0024] The working electrode comprises an electrode material and biosensing molecule bound to the electrode material. The electrode material may be a metallic material such as gold (Au), platinum (Pt), silver (Ag), and palladium (Pd) or a carbon material. The electrode may be provided on an insulating substrate formed with an insulating material, wherein examples of the insulating material include resins (plastics) such as thermoplastic resins including polyetherimide (PEI), polyethylene terephthalate (PET), and polyethylene (PE), as well as polyimide resins and epoxy resins; glasses; ceramics; and papers.

[0025] The working electrode is prepared, for example, as follows.First, a metal layer which functions as an electrode is formed on one side of an insulating substrate. For example, a metal layer having a desired thickness is formed by depositing a metallic material, by physical vapor deposition (PVD, for example, sputtering) or chemical vapor deposition (CVD), on one side of an insulating substrate in the form of a film having a predetermined thickness. Instead of the metal layer, an electrode layer made of a carbon material may be formed. To the surface of the thus obtained electrode layer, a biosensing molecule is bound.

[0026] The biosensing molecule may be chemically or physically bound to the electrode material. The biosensing molecule may be directly bound to the electrode or bound to the electrode via a linker molecule such as a monolayer-forming molecule (JP 2017-211383 A). For example, in cases where a monolayer-forming molecule is used, the monolayer-forming molecule is first bound onto the electrode. Thereafter, by reacting a reactive functional group of the monolayer-forming molecule with an amino group or a carboxyl group of a biosensing molecule, the biosensing molecule can be immobilized on the electrode through the monolayer- forming molecule. In cases where the biosensing molecule is immobilized onto the electrode using a conductive polymer or a cross-linking agent, the biosensing molecule and the reagent such as a conductive polymer or a cross-linking reagent may be added onto the electrode to prepare a working electrode.

[0027] <BioReference electrode> The BioReference electrode (simply referred to as a reference electrode) comprises a bioreference molecule which harbors a redox species but lacks a catalytic activity or binding ability to the target substance.

[0028] The redox species is a molecule which can be electrochemically accessible to the reference electrode, thereby giving a specific redox potential. Example of a redox species include hemesuch as heme b and heme c, iron-sulfur cluster, copper cluster, flavins and quinones, as described above.

[0029] The bioreference molecule in the reference electrode harbors such a redox species but lacks a catalytic activity or binding ability to the target substance. Thereby, the bioreference molecule gives a specific redox potential to the reference electrode but the reference electrode does not show any change in an electrical state depending on the target substance.

[0030] The phrase “lacks a catalytic activity or a binding ability to the target substance” includes cases where the molecule originally does not have a catalytic activity or a target-binding ability and the cases where the molecule has been modified to inactivate the catalytic activity or the binding activity. Here, the phrase “lacks a catalytic activity or target-binding ability” includes the case where the molecule has no (zero) activity and the case where the molecule has very low activity (substantially zero), for example, the activity is less than 1 / 100 as compared to the original molecule before inactivation treatment or inactivation modification such as a mutation.

[0031] Examples of a bioreference molecule include a protein molecule such as an enzyme molecule which contains the redox species but lacks a catalytic activity or binding ability to the target substance. Examples of an enzyme molecule which contains the redox species include oxidoreductases which contain redox species as described above. Among them, DET-type enzymes including DET-type oxidoreductases such as DET-type dehydrogenases can be preferably used, and a DET- type glucose dehydrogenase (GDH), for example, DET-type GDH comprises a catalytic subunit, an electron transfer subunit and a hitchhiker subunit can be preferably used.

[0032] As a bioreference molecule, a protein molecule such as an enzyme molecule which contains the redox species lacks a catalytic activity. Here, a protein molecule such as an enzyme molecule which contains the redox species lacks a catalytic activity due to an inactivation. Inactivation can be achieved by a heat treatment or chemical treatment. Namely, a bioreference molecule may be a heat-inactivated DET-type enzymes. Alternatively, inactivation can be performed by introducing a mutation into the protein. Such a mutation includes a mutation into a catalytic site or a substrate binding site of the enzyme and a mutation which destroys a structure of the enzyme required for the catalytic activity. Namely, a bioreference molecule may be a DET- type enzymes having a mutation to inactivate the catalytic activity.

[0033] Inactivated DET-type GDH may comprise mutations selected from the following mutations: i) C192A-C195A in β subunit Cysteine at position 192 and cysteine at position 195 in β subunit (SEQ ID NO: 4) are both mutated to alanine. ii) K343A-M386A in β subunit Lysine at position 343 and methionine at position 386 in β subunit (SEQ ID NO: 4) are both mutated to alanine. iii) H476A-N519A in α subunit Histidine at position 476 and asparagine at position 519 in α subunit (SEQ ID NO: 3) are both mutated to alanine.

[0034] In another embodiment, as a bioreference molecule, a protein molecule such as an enzyme molecule which contains the redox species lacks a catalytic activity, will be prepared by inactivation of active enzyme by heat treatment or by the exposure to high ionic strength, or by chaotropic reagent which inactivates enzyme but keeps redox species in the enzyme molecule.

[0035] In another embodiment, the bioreference molecule is a redox species-modified biomolecule which does not have a catalytic activity or substrate binding ability. Here, same kind of redox species as described above may be used in this embodiment and phenazine ethosulfate, ferrocene or methylene blue can be preferably used. The biomolecule which does not have a catalytic activity or substrate binding ability includes a non-enzyme protein molecules such as albumin and glutamine binding protein, antibodies which are not capable to binding to target substance recognized by the biosensing molecules on the working electrode, and nucleotide (DNA or RNA) which are modified with redox species, which are not capable to binding to target substance recognized by the biosensing molecules on the working electrode. Examples of a bioreference molecule include a PES-modified albumin and a PES modified polynucleotide which does not bind to the target substance.

[0036] The modification of such a non-enzyme molecule with a redox species can be performed by a conventional method such as chemical reaction to a reactive group such as an amino group and / or a carboxylic group of the protein molecule or the nucleotide molecule.

[0037] The reference electrode comprises an electrode material and the bioreference molecule bound to the electrode material. The electrode material may be a metallic material such as gold (Au), platinum (Pt), silver (Ag), and palladium (Pd) or a carbon material. The electrode may be provided on an insulating substrate formed with an insulating material, wherein examples of the insulating material include resins (plastics) such as thermoplastic resins including polyetherimide (PEI), polyethylene terephthalate (PET), and polyethylene (PE), as well as polyimide resins and epoxy resins; glasses; ceramics; and papers.

[0038] The reference electrode is prepared, for example, as follows.First, a metal layer which functions as an electrode is formed on one side of an insulating substrate. For example, a metal layer having a desired thickness (for example, about 30 nm) is formed by depositing a metallic material, by physical vapor deposition (PVD, for example, sputtering) or chemical vapor deposition (CVD), on one side of an insulating substrate in the form of a film having a predetermined thickness (for example, about 100 μm). Instead of the metal layer, an electrode layer made of a carbon material may be formed. To the surface of the thus obtained electrode layer, a bioreference molecule is bound.

[0039] The bioreference molecule may be chemically or physically bound to the electrode material. The bioreference molecule may be directly bound to the electrode or bound to the electrode via a linker molecule such as a monolayer-forming molecule (JP2017-211383A). For example, in cases where a monolayer-forming molecule is used, the monolayer-forming molecule is first bound onto the electrode. Thereafter, by reacting a reactive functional group of the monolayer-forming molecule with an amino group or a carboxyl group of the bioreference molecule, the bioreference molecule can be immobilized on the electrode through the monolayer- forming molecule. In cases where the bioreference molecule is immobilized onto the electrode using a conductive polymer or a cross-linking agent, the bioreference molecule and the reagent such as a conductive polymer or a cross-linking reagent may be added onto the electrode to prepare the BioReference electrode.

[0040] <Combination of the biosensing molecule and the bioreference molecule in the biosensor> The combination of the biosensing molecule in the working electrode and the bioreference molecule in the reference electrode is not limited and any combination can be selected.

[0041] In one embodiment, an inactivated molecule which corresponds to the biosensing molecule in the working electrode can be selected as the bioreference molecule in the reference electrode.Specifically, in one embodiment, the biosensor includes a DET-type GDH and inactivated DET- type GDH. In another embodiment, the biosensor includes a DET-type LDH such as redox species-modified LDH and inactivated DET-type LDH such as inactivated redox species-modified LDH. In another embodiment, the biosensor includes a tyrosinase and inactivated tyrosinase. In another embodiment, the biosensor includes a levodopa dehydrogenase and inactivated levodopa dehydrogenase. In another embodiment, the biosensor includes a PES-modified anti-thrombin aptamer and PES- modified oligonucleotide lacking thrombin-binding ability. In another embodiment, the biosensor includes a PES-modified anti-thrombin antibody and PES- modified polypeptide lacking thrombin-binding ability.

[0042] Furthermore, the bioreference molecule in the reference electrode may be selected independently from the biosensing molecule in the working electrode, and thus the bioreference molecule in the reference electrode may be derived from a molecule different from the biosensing molecule in the working electrode. For example, DET-type oxidoreductase such as DET-type GDH can be used as the biosensing molecule and inactivated tyrosinase can be used as the bioreference molecule. For example, DET-type oxidoreductase such as DET-type GDH can be used as the biosensing molecule and redox species-modified non-binding polypeptide such as albumin or cytochrome b562 fused glutamine binding protein can be used as the bioreference molecule. For example, tyrosinase can be used as the biosensing molecule and inactivated DET-type dehydrogenase can be used as the bioreference molecule. For example, tyrosinase can be used as the biosensing molecule and redox species-modified non- binding polypeptide such as albumin or cytochrome b562 fused glutamine binding protein can be used as the bioreference molecule.For example, PES-modified LDH can be used as the biosensing molecule and inactivated tyrosinase can be used as the bioreference molecule. For example, PES-modified LDH can be used as the biosensing molecule and inactivated DET- type dehydrogenase can be used as the bioreference molecule. For example, PES-modified LDH can be used as the biosensing molecule and redox species- modified non-binding polypeptide such as albumin or cytochrome b562 fused glutamine binding protein can be used as the bioreference molecule. For example, levodopa dehydrogenase can be used as the biosensing molecule and inactivated DET-type dehydrogenase can be used as the bioreference molecule. For example, levodopa dehydrogenase can be used as the biosensing molecule and inactivated tyrosinase can be used as the bioreference molecule. For example, levodopa dehydrogenase can be used as the biosensing molecule and redox species-modified non-binding polypeptide such as albumin or cytochrome b562 fused glutamine binding protein can be used as the bioreference molecule. For example, levodopa dehydrogenase can be used as the biosensing molecule and redox species-modified non-binding polynucleotide can be used as the bioreference molecule. For example, redox species-modified anti-thrombin aptamer can be used as the biosensing molecule and inactivated tyrosinase can be used as the bioreference molecule. For example, redox species-modified anti-thrombin aptamer can be used as the biosensing molecule and inactivated DET-type dehydrogenase can be used as the bioreference molecule. For example, redox species-modified anti-thrombin aptamer can be used as the biosensing molecule and redox species-modified non-binding polypeptide such as albumin or cytochrome b562 fused glutamine binding protein can be used as the bioreference molecule. For example, redox species-modified anti-thrombin aptamer can be used as the biosensing molecule and redox species-modified non-binding polynucleotide can be used as the bioreference molecule.For example, redox species-modified antibody can be used as the biosensing molecule and inactivated tyrosinase can be used as the bioreference molecule. For example, redox species-modified antibody can be used as the biosensing molecule and inactivated DET-type dehydrogenase can be used as the bioreference molecule. For example, redox species-modified antibody can be used as the biosensing molecule and redox species-modified non-binding polypeptide such as albumin or cytochrome b562 fused glutamine binding protein can be used as the bioreference molecule.

[0043] <Counter electrode> Such bioelectrochemical sensors may be comprised of an additional electrode which does not contain either the biosensing molecules as used in the working electrode or bioreference molecules as used in the reference electrode, but can be used as the counter electrode. In such a three-electrode system, the working electrode, which is connected to the reference electrode, is applied a certain potential with respect to the reference electrode to proceed electrochemical reaction on the working electrode thereby monitoring electrochemical signal created on the working electrode, which is the measure of the target substance concentration. The counter electrode maybe a metal electrode such as platinum electrode and the like.

[0044] <Application of the biosensor> The biosensor can be used for measuring a target substance. Target substance to be measured is not limited and examples thereof include substrates of enzymes such as oxidoreductases and substances such as antigen which binds to an antibody or aptamer binding substances. Specific examples of target substances as substrates of oxidoreductases include glucose, cholesterol, ethanol, sorbitol, fructose, cellobiose, lactate, uric acid. Samples used for measurement are not limited as long as they contain the measuring target substance exemplified above and examples thereof include a blood sample, a urine sample, a sweat sample, an interstitial fluid sample or a saliva sample, a culture medium, an environmental water and the like.

[0045] Depending on the type of the enzyme, the biosensor of the present invention can be used as a glucose sensor, cholesterol sensor, ethanol sensor, sorbitol sensor, fructose sensor, cellobiose sensor, lactate sensor, uric acid sensor, or the like.

[0046] Such bioelectrochemical sensors will be subjected for the following electrochemical analytical methods to detect the concentration of the target monitoring.

[0047] 1. Amperometric methods; the methods are based on target analyses by the catalytic current observed when the target substances are oxidized or reduced by the biosensing molecules on the working electrode when a specific potential is applied versus the reference electrode.

[0048] 2. Potentiometric methods; the methods are based on target analyses by the catalytic reaction or the binding of target substances on the recognition events by the biosensing molecules on the working electrode where the potential of the surface of the working electrode will be changed, which will be detected as the difference of the potential of the reference electrode.

[0049] 3. Voltammetric methods; the methods are based on target analyses by the catalytic reaction or the binding of target substances on the recognition events by the biosensing molecules on th working electrode, which will be monitored by the change in the redox current by altering applied potential on to the working electrode, where the potential will be applied versus the reference electrode.

[0050] 4. Impedimetric methods; the methods are based on target analyses by the catalytic reaction or the binding of target substances on the recognition events by the biosensing molecules on the working electrode which will be monitored by the change in the impedance by altering appliedpotential on to the working electrode, where the potential will be applied versus reference electrode. Examples

[0051] Example 1: Construction of BcGDH mutants for BioReference electrode Burkholderia cepacia Glucose dehydrogenase harboring a 3Fe-4S iron sulfur cluster and covalently bound Flavin adenine dinucleotide(FAD) coenzyme. This enzyme has mutations within the catalytic(α) subunit at positions α-S326Q-S365Y-A472Y which decreases its activity towards maltose while maintaining its activity towards glucose.[1] This enzyme also has mutations within the small subunit, γ, the catalytic subunit, α, and the electron transfer subunit,β, which harbors three heme-c moieties which are responsible for the direct electron transfer, DET, ability of this enzyme. These mutations include: γK155C / βY349C-αQYYP205C / βD383C, which increases the thermal stability of this enzyme up to 70°C[2]. The additional mutations made to this enzyme are within the electron transfer subunit, β, which are responsible for the 2ndheme binding motif of CxxCH and two additional mutations which impede the electron transfer proximal to the 3rdheme. Mutations to positions β-C192A-C195A were made to eliminate this enzyme’s ability to covalently bind the 2ndheme through the cysteine residues which are mutated to alanine[2]. In addition, this enzyme has mutation at the β-K343A-M386A which will impede the ability of the electron to further transfer from these residues which are proximal to the 2ndheme binding site. This enzyme should remain in the reduced state as it is able to oxidize glucose but does not have the ability to transfer the electron internally and therefore cannot provide DET ability to the electrode. The full enzyme structure is named: BcGDH α-S326Q-S365Y-A472Y, γK155C / βY349C-αQYYP205C / βD383C, β-C192A-C195A, β-K343A-M386A or colloquially named: BcGDH QYY CCx2 AxxAH #2 K343A / M386A

[0052] Example 2: Construction of BcGDH mutants for BioReference electrode Burkholderia cepacia glucose dehydrogenase harboring a 3Fe-4S iron sulfur cluster and covalently bound Flavin adenine dinucleotide(FAD) coenzyme. This enzyme has mutations within the catalytic(α) subunit at positions α-S326Q-S365Y-A472Y which decreases its activitytowards maltose while maintaining its activity towards glucose.[1] This enzyme also has mutations within the small subunit, γ, the catalytic subunit, α, and the electron transfer subunit,β, which harbors three heme-c moieties which are responsible for the direct electron transfer, DET, ability of this enzyme. These mutations include: γK155C / βY349C-αQYYP205C / βD383C, which increases the thermal stability of this enzyme up to 70°C[2]. The additional mutations made to this enzyme are within the catalytic, α, subunit which are the catalytic active sites. Mutations to positions α-H476A-N519A were made to eliminate this enzymes activity as it can no longer perform the catalytic reaction which oxidizes glucose to gluono-δ-lactone[3]. This enzyme should remain in the oxidized state as it does not have sufficient catalytic turnover of glucose to receive its electron. The full enzyme structure is named: BcGDH α-S326Q-S365Y-A472Y, γK155C / βY349C-αQYYP205C / βD383C, α-H476A-N519A or colloquially named: BcGDH QYY CCx2 H476 / N519.

[0053] Table 1: Ru-MTT activities of the two example enzymes which may be used as BioReference electrodes for biosensing.

[0054] Table 2: Potentiometric drift comparing the example enzyme which may be used as BioReference electrodes, Ag / AgCl, and Bovine Serum albumin.

[0055] The BioReference electrode described above may leverage an inactive enzyme, such as glucose dehydrogenase (QYY CCx2 AxxAH #2 K343A / M386A described in Example 1), which is mutated to be unable to transfer electrons between the heme and electrode, remaining in a reduced state.

[0056] A biosensor using direct electron transfer GDH (QYY double cc mutant) immobilized to the working electrode, and a catalytically inactive glucose dehydrogenase immobilized to a gold electrode as a BioReference electrode to apply an overpotential, and measure current in a glucose dependent manner (FIG. 2).

[0057] A biosensor using direct electron transfer GDH (QYY double cc mutant) immobilized to the working electrode, and a catalytically inactive glucose dehydrogenase immobilized to a gold electrode as a BioReference electrode to measure a potential difference between in a glucose dependent manner. The BioRefernce electrode may maintain a stable potential for open circuit potential measured for over 60 hours. (FIG. 3A and FIG. 3B).

[0058] A biosensor using direct electron transfer GDH (QYY double cc mutant) immobilized to the working electrode, and a catalytically inactive glucose dehydrogenase immobilized to a gold electrode as a BioReference electrode to measure a transient potential difference between in a glucose dependent manner (FIG.4).

[0059] The BioReference electrode described above may leverage an inactive enzyme, such as glucose dehydrogenase (BcGDH QYY CCx2 H476 / N519 described in Example 2), which is mutated to be unable to transfer electrons between the heme and electrode, remaining in a reduced state.

[0060] A biosensor using direct electron transfer GDH (QYY double cc mutant) immobilized to the working electrode, and BcGDH QYY CCx2 H476 / N519 immobilized to a gold electrode as aBioReference electrode to apply an overpotential, and measure current in a glucose dependent manner (FIG.5 and Table 3).

[0061] BcGDH QYY CCx2 H476 / N519 may be immobilized using a conductive polymer such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS) at a 1:1 ratio

[0062] BcGDH QYY CCx2 H476 / N519 may be immobilized using a conductive polymer mixed with a nanomaterial such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS) and ketjen black mixed at a 1:1 ratio

[0063] BcGDH QYY CCx2 H476 / N519 may be immobilized by drop casting mixed with nanomaterials such as ketjen black, followed by vapor deposition using 25% glutaraldehyde.

[0064] Table 3: Chronoamperometric slope, and correlation to glucose using each of the different BioReference designs and builds.

[0065] Example 3: When using BioReference electrode which used catalytically inactivated BcGDH (BcGDH; BcGDH α-S326Q-S365Y-A472Y, γK155C / βY349C, αP205C / βD383C, α- H476A-N519A, colloquially named: BcGDH QYY CCx2 H476A / N519A.) as a bioreference molecule. Methods:The working electrode was fabricated by first polishing 2 mm gold disk electrodes using aluminum oxide slurry with 0.3 and 0.05 μm particles. Electrodes were then chemically cleaned using piranha acid (3:1 ratio of sulfuric acid to hydrogen peroxide) for 1 hour, and finally electrode where electrochemical cleaned by running cyclic voltammetry in 50 mM potassium hydroxide for 15 cycles between -0.2 and -1.2 V at 50 mV / sec. Electrodes were stores in acetone until further use. To immobilize BcGDH QYY CCx2, electordes were first soaked overnight in 100 μM dithiobis(succinimidyl hexanoate) (DHS), following which electrodes were soaked in 0.014 mg / mL of BcGDH QYY CCx2 overnight. The BioReference electrode was fabricated in an identical fashion, apart from swapping out BcGDH QYY CCx2 for BcGDH QYY CCx2 H476A / N519A.

[0066] Electrochemical testing was performed in a 100 mM potassium phosphate buffer, using a platinum counter electrode, at room temperature, pH 7.4 unless specified otherwise. Glucose was serially added to a 10 mL cell from 0 – 20 mM, during which several electrochemical techniques were performed. Electrochemical tests were performed by cycling between chronoamperometry (CA) and open circuit potential (OCP), during which the transient OCP was also found. This cycle was repeated for each glucose concentration using the following settings: CA was performed by holding 0.2 V over the working electrode for 30 seconds. The final 5 seconds for CA was averaged for each glucose concentration, and fitted to a calibration curve, providing the slope or sensitivity across the tested range of glucose. OCP was measured directly after CA for 60 seconds, during which the final 5 seconds were averaged, and recorded for each glucose concentration tested. Similarly, the slope or sensitivity was found for each calibration curve. The transient OCP was found by taking the empirical derivative of OCP, and the first two points were recorded and averaged for each glucose concentration providing the slope or sensitivity across the tested range of glucose. These slopes were then analyzed over several days to address the sensors stability when using a BioReference electrodes. Ag / AgCl was used as a positive control for all working electrodes.

[0067] Results using BcGDH QYY CCx2 for BcGDH QYY CCx2 H476A / N519A BioReferenceFIGs. 6A-12C demonstrate using BcGDH QYY CCx2 H476A / N519A as the BioReference for OCP, transient OCP and CA over a 7-day period, with sufficient signal across all seven days.

[0068] Example 4: When using BioReference electrode which used BcGDH deficient in intramolecular electron transfer ability within electron transfer subunit, but keeping DET- ability with electrode (QYY CCx2 AxxAH #2 K343A / M386A) as a bioreference molecule. Methods: The working electrode was fabricated by first polishing 2 mm gold disk electrodes using aluminum oxide slurry with 0.3 and 0.05 μm particles. Electrodes were then chemically cleaned using piranha acid (3:1 ratio of sulfuric acid to hydrogen peroxide) for 1 hour, and finally electrode where electrochemical cleaned by running cyclic voltammetry in 50 mM potassium hydroxide for 15 cycles between -0.2 and -1.2 V at 50 mV / sec. Electrodes were stores in acetone until further use. To immobilize BcGDH QYY CCx2, electordes were first soaked overnight in 100 μM dithiobis(succinimidyl hexanoate) (DHS), following which electrodes were soaked in 0.014 mg / mL of BcGDH QYY CCx2 overnight. The BioReference electrode was fabricated in an identical fashion, apart from swapping out BcGDH QYY CCx2 for BioReference electrode with a mutant BcGDH deficient in the inter-molecular electron transfer within electron transfer subunit; BcGDH α-S326Q-S365Y-A472Y, γK155C / βY349C, αP205C / βD383C, β-C192A- C195A, β-K343A / M386A or colloquially named: BcGDH QYY CCx2 AxxAH #2 K343A / M386A.

[0069] Electrochemical testing was performed in a 100 mM potassium phosphate buffer, using a platinum counter electrode, at room temperature, pH 7.4 unless specified otherwise. Glucose was serially added to a 10 mL cell from 0 – 20 mM, during which several electrochemical techniques were performed. Electrochemical tests were performed by cycling between chronoamperometry (CA) and open circuit potential (OCP), during which the transient OCP was also found. This cycle was repeated for each glucose concentration using the following settings: CA was performed by holding 0.2 V over the working electrode for 30 seconds. The final 5 seconds forCA was averaged for each glucose concentration, and fitted to a calibration curve, providing the slope or sensitivity across the tested range of glucose. OCP was measured directly after CA for 60 seconds, during which the final 5 seconds were averaged, and recorded for each glucose concentration tested. Similarly, the slope or sensitivity was found for each calibration curve. The transient OCP was found by taking the empirical derivative of OCP, and the first two points were recorded and averaged for each glucose concentration providing the slope or sensitivity across the tested range of glucose. These slopes were then analyzed over several days to address the sensors stability when using BioReference electrodes. Ag / AgCl was used as a positive control for all working electrodes.

[0070] Results using BcGDH QYY CCx2 for the working electrode and BcGDH QYY CCx2 AxxAH #2 K343A / M386A as the BioReference FIGs. 13A-19C demonstrate using BcGDH QYY CCx2 AxxAH #2 K343A / M386A as the BioReference for OCP, transient OCP and CA over a 7-day period, with sufficient signal across all seven days.

[0071] Results of Sensor’s stability and interference results using BcGDH QYY CCx2 for the working electrode and either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference FIGs. 20-25C show the sensitivity of the biosensor.

[0072] To investigate the sensors stability using either the BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference sensitivity or slope derived from calibration curves (like ones in FIGs. 19A-19C) was plotted across ten days and comparted to the gold standard Ag / AgCl reference electrode. The rate of decay in sensitivity is a function of both the working and reference electrode and depicts that the BioReference is as stable over the 10 period if not more stable then a standard Ag / AgCl reference electrode.

[0073] The impact of interfering environments (ions, temperature and pH) on either the BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as the BioReference was investigated using sensitivity or slope derived from calibration curves (like ones in FIGs. 19A -19C) was plotted across various environmental changes. pH was altered between 6 and 8, temperature was tested at 25° C and 37° C, and total ion concentration was investigated at 50 and 500 mM NaCl. All tests were performed in 100 mM potassium phosphate buffer, using a platinum counter electrode, and compared to Ag / AgCl as a positive control.

[0074] FIGs. 6A – 19C demonstrate the proof of concept, showing that an inactive enzyme or protein may be used to maintain a stable potential, and paired with a working electrode to measure glucose from 0 – 20 mM. This was then extended to 10 days and compared to Ag / AgCl. FIGs. 20 – 22 show that either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A are comparable to Ag / AgCl as a reference electrode over the 10 days. Demonstrating less than or equivalent stability for OCP, transient OCP and CA. To understand how the BioReference can be leveraged in various environmental, and physical solutions, temperature, pH and ionic concentrations were all altered while using either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as BioReference electrode and compared to Ag / AgCl. FIGs. 23A-25C show the results of this work, demonstrating equivalent response, and stability to Ag / AgCl over a broad pH, temperature, and ionic concentration.

[0075] To further compare the efficacy of the BioReference electrode using either BcGDH QYY CCx2 AxxAH #2 K343A / M386A or BcGDH QYY CCx2 H476A / N519A as compared to Ag / AgCl we analyzed the absolute percent change in CA and OCP upon the variations of the localenvironment. Shifting the pH from 6 – 8, and the ionic concentration of NaCl from 50 – 500 mM. The results of this analysis are captured in FIGs. 29A-29D.

[0076] Example 5: This is the case when BioReference electrode employs the molecule which harbors the identical redox species which interacts with electrode, to show DET-ability. In this case this is a copper atom. Levodopa sensor (enzymatic sensors; chronoamperometry, open circuit potential based potentiometry, transient OCP based potentiometry) using inactivated Tyrosinase as the BioReference electrode.

[0077] Methods: The working electrode was fabricated by first polishing 2 mm gold disk electrodes using aluminum oxide slurry with 0.3 and 0.05 μm particles. Electrodes were then chemically cleaned using piranha acid (3:1 ratio of sulfuric acid to hydrogen peroxide) for 1 hour, and finally electrode where electrochemical cleaned by running cyclic voltammetry in 50 mM potassium hydroxide for 15 cycles between -0.2 and -1.2 V at 50 mV / sec. Electrodes were stores in acetone until further use. To immobilize levodopa dehydrogenase, electrodes were first soaked overnight in 100 μM dithiobis(succinimidyl hexanoate) (DHS), following which electrodes were soaked in 0.014 mg / mL of levodopa dehydrogenase overnight. BioReference electrode was fabricated in an identical fashion, apart from swapping out levodopa dehydrogenase for tyrosinase (mushroom origin, purchased from Millipore Sigma (MA, USA)), which was then inactivated using heat treatment of 50° C for 30 minutes.

[0078] Electrochemical testing was performed in a 100 mM potassium phosphate buffer, using a platinum counter electrode, at room temperature, pH 7.4 unless specified otherwise. Levodopa was serially added to a 10 mL cell from 0 – 20 μM, during which several electrochemical techniques were performed. Electrochemical tests were performed by cycling between chronoamperometry (CA) and open circuit potential (OCP), during which the transient OCP wasalso found. This cycle was repeated for each levodopa concentration using the following settings: CA was performed by holding 0.3 V over the working electrode for 30 seconds. The final 5 seconds for CA was averaged for each levodopa concentration, and fitted to a calibration curve, providing the slope or sensitivity across the tested range of levodopa. OCP was measured directly after CA for 60 seconds, during which the final 5 seconds were averaged, and recorded for each levodopa concentration tested. Similarly, the slope or sensitivity was found for each calibration curve. The transient OCP was found by taking the empirical derivative of OCP, and the first two points were recorded and averaged for each levodopa concentration providing the slope or sensitivity across the tested range of levodopa. These slopes were then analyzed over several days to address the sensors stability when using BioReference electrodes.

[0079] The results are shown in FIGs.26A-26C.

[0080] Example 6: This is the case when BioReference electrode employs the molecule which harbors different redox species from the biosensing molecule employed in the working electrode, which interacts with electrode, to show DET-ability. In this case this is cytochrome b562. Levodopa sensor (enzymatic sensors; chronoamperometry, open circuit potential based potentiometry, transient OCP based potentiometry) using cytochrome b562-fused glutamine binding protein as the BioReference electrode.

[0081] Methods: The working electrode was fabricated by first polishing 2 mm gold disk electrodes using aluminum oxide slurry with 0.3 and 0.05 μm particles. Electrodes were then chemically cleaned using piranha acid (3:1 ratio of sulfuric acid to hydrogen peroxide) for 1 hour, and finally electrode where electrochemical cleaned by running cyclic voltammetry in 50 mM potassium hydroxide for 15 cycles between -0.2 and -1.2 V at 50 mV / sec. Electrodes were stores in acetone until further use. To immobilize levodopa dehydrogenase, electordes were first soaked overnightin 100 μM dithiobis(succinimidyl hexanoate) (DHS), following which electrodes were soaked in 0.014 mg / mL of levodopa dehydrogenase overnight. BioReference electrode was fabricated in an identical fashion, apart from swapping out levodopa dehydrogenase for cytochrome b562-fused glutamine binding protein (SEQ ID NO: 6).

[0082] Expression vector was constructed by inserting the gene sequence (SEQ ID NO: 5) for cytochrome b562 fused glutamine binding protein (QBP) in NdeI-HindIII site of pET30c vector. Escherichia coli (E.coli) BL21 (DE3) was transformed with the expression vector, and the transformant was cultured aerobically in 3 mL LB medium containing 50 μg / ml kanamycin at 37˚C overnight as a pre-cultivation. Then 1 mL of pre-culture was inoculated in 100 mL ZYP- 5052 medium with 50 μg / ml kanamycin and cultured at 25˚C at 100 rpm for 30 hours. The cells were harvested by centrifugation at 5,000g for 10 min. Cells were disrupted by sonication, and the supernatant after the centrifugation (14,000g, 20min) and ultra-centrifugation (50,000g, 45min) was collected as crude sample and was subjected to the Ni-affinity chromatography. The fractions containing target molecule were collected as purified cytochrome b562 fused QBP sample, and used for bioreference molecule.

[0083] Electrochemical testing was performed in a 100 mM potassium phosphate buffer, using a platinum counter electrode, at room temperature, pH 7.4 unless specified otherwise. Levodopa was serially added to a 10 mL cell from 0 – 20 μM, during which several electrochemical techniques were performed. Electrochemical tests were performed by cycling between chronoamperometry (CA) and open circuit potential (OCP), during which the transient OCP was also found. This cycle was repeated for each levodopa concentration using the following settings: CA was performed by holding 0.3 V over the working electrode for 30 seconds. The final 5 seconds for CA was averaged for each levodopa concentration, and fitted to a calibration curve, providing the slope or sensitivity across the tested range of levodopa. OCP was measured directly after CA for 60 seconds, during which the final 5 seconds were averaged, and recorded for each levodopa concentration tested. Similarly, the slope or sensitivity was found for each calibration curve. The transient OCP was found by taking the empirical derivative of OCP, andthe first two points were recorded and averaged for each levodopa concentration providing the slope or sensitivity across the tested range of levodopa.

[0084] The results are shown in FIGs.27A-27C.

[0085] Example 7: This is the another case when BioReference electrode employs the molecule which harbors different redox species from the biosensing molecule employed in the working electrode, which interacts with electrode, to show DET-ability. In this case this is cytochrome b562. Thrombin sensor (enzymatic sensors; chronoamperometry, open circuit potential based potentiometry, transient OCP based potentiometry) using PES- modified anti-thrombin aptamer as the working electrode and inactivated Tyrosinase as the BioReference electrode.

[0086] Methods: The working electrode was fabricated by first polishing 2 mm gold disk electrodes using aluminum oxide slurry with 0.3 and 0.05 μm particles. Electrodes were then chemically cleaned using piranha acid (3:1 ratio of sulfuric acid to hydrogen peroxide) for 1 hour, and finally electrode where electrochemical cleaned by running cyclic voltammetry in 50 mM potassium hydroxide for 15 cycles between -0.2 and -1.2 V at 50 mV / sec. Electrodes were stores in acetone until further use. As an ani-thrombin aptamer, the oligonucleotide (5′ SH-(CH2)6- TAAGTTCATCTCCCCGGTTGGTGTGGTTGGT (SEQ ID NO: 7)-NH33′) purchased from IDT (Coralville, IA, USA) was used and modified with PES. To immobilize PES-modified anti- thrombin aptamer (Sensors 2022, 22(5), 1760; doi.org / 10.3390 / s22051760), electrodes were first soaked overnight in 1 μM TCEP and 0.1 μM of PES-modified anti-thrombin aptamer overnight. Electrode were blocked using 10 mM 6-mercapto hexanol in potassium buffer saline. BioReference electrodes were first soaked overnight in 100 μM dithiobis(succinimidylhexanoate) (DHS), following which electrodes were soaked in 0.014 mg / mL of Tyrosinase, which was then inactivated using 50° C for 30 minutes.

[0087] Electrochemical testing was performed in a 100 mM potassium phosphate buffer, using a platinum counter electrode, at room temperature, pH 7.4 unless specified otherwise.100 nM thrombin was added to a 10 mL cell during which square wave voltammetry was tested at 100 Hz, with a 25 mV step, between -0.4 and 0 V. Results are shown in FIGs. 28A-28B.

[0088] The contents of all publications including patents and patent applications as well as non-patent documents cited in the present description are hereby incorporated by reference to the same extent as if all contents were clearly described.

[0089] References 1. Yamashita, Y.; Ferri, S.; Huynh, M.L.; Shimizu, H.; Yamaoka, H.; Sode, K. Direct Electron Transfer Type Disposable Sensor Strip for Glucose Sensing Employing an Engineered FAD Glucose Dehydrogenase. Enzyme and Microbial Technology 2013, 52, 123–128, doi:10.1016 / j.enzmictec.2012.11.002. 2. Okuda-Shimazaki, J.; Yoshida, H.; Lee, I.; Kojima, K.; Suzuki, N.; Tsugawa, W.; Yamada, M.; Inaka, K.; Tanaka, H.; Sode, K. Microgravity Environment Grown Crystal Structure Information Based Engineering of Direct Electron Transfer Type Glucose Dehydrogenase. Commun Biol 2022, 5, 1334, doi:10.1038 / s42003-022-04286-9. 3. Yoshida, H.; Sakai, G.; Mori, K.; Kojima, K.; Kamitori, S.; Sode, K. Structural Analysis of Fungus-Derived FAD Glucose Dehydrogenase. Sci Rep 2015, 5, 13498, doi:10.1038 / srep13498.

Claims

Claims 1. A bioelectrochemical sensor for measuring a target substance which at least comprises: a working electrode which comprises a biosensing molecule, which can catalyze and / or bind to the target substance, and a reference electrode which comprises a bioreference molecule which harbors a redox species which can be electrochemically accessible to the reference electrode, thereby giving a specific redox potential but lacks a catalytic activity or binding ability to the target substance.

2. The bioelectrochemical sensor of claim 1, wherein the redox species in the reference electrode is selected from the group consisting of heme, iron sulfur cluster, copper, flavins and quinones.

3. The bioelectrochemical sensor of claim 1, wherein the bioreference molecule in the reference electrode is a protein molecule which contains the redox species but lacks a catalytic activity or binding ability to the target substance.

4. The bioelectrochemical sensor of claim 3, wherein the protein molecule in the reference electrode is a heme b- or heme c-containing protein.

5. The bioelectrochemical sensor of claim 3, wherein the protein molecule is inactivated to lack a catalytic activity or binding ability to the target substance.

6. The bioelectrochemical sensor of claim 3, wherein the bioreference molecule in the reference electrode harbors identical redox species as the biosensing molecules used in working electrode, but lacks a catalytic activity or binding ability to the target substance.

7. The bioelectrochemical sensor of claim 5, wherein the bioreference molecule in the reference electrode is an inactivated direct electron transfer (DET)-type enzyme.

8. The bioelectrochemical sensor of claim 7, wherein the bioreference molecule in the reference electrode is an inactivated DET-type glucose dehydrogenase (GDH).

9. The bioelectrochemical sensor of claim 8, wherein the inactivated DET-type GDH comprises a catalytic subunit, an electron transfer subunit and a hitchhiker subunit.

10. The bioelectrochemical sensor of claim 9, wherein the inactivated DET-type GDH comprising mutations selected from the group consisting of: i) C192A-C195A in β subunit ii) K343A-M386A in β subunit, and iii) H476A-N519A in α subunit.

11. The bioelectrochemical sensor of claim 1, wherein the bioreference molecule in the reference electrode is a biomolecule which lacks a catalytic activity or binding ability to the target substance and is modified with the redox species.

12. The bioelectrochemical sensor of claim 1, wherein the biosensing molecule in the working electrode is selected from the group consisting of enzymes, antibodies, binding proteins, or aptamers.

13. The bioelectrochemical sensor of claim 12, wherein the biosensing molecule in the working electrode is an enzyme capable of transfer electron directly to the electrode.

14. The bioelectrochemical sensor of claim 12, wherein the biosensing molecule in the working electrode is the multi copper oxidase capable of transfer electron directly to the electrode.

15. The bioelectrochemical sensor of claim 12, wherein the biosensing molecules in the working electrode is a dehydrogenase modified with a redox mediator, thereby being capable of transfer electron directly to the electrode.

16. The bioelectrochemical sensor of claim 15, wherein the dehydrogenase modified with a redox mediator is a lactate dehydrogenase modified by the redox mediator, thereby capable of transfer electron directly to the electrode.

17. The bioelectrochemical sensor of claim 12, wherein the biosensing molecules in the working electrode is a glucose dehydrogenase capable of transfer electron directly to the electrode (DET- type GDH).

18. The bioelectrochemical sensor of claim 17, wherein the biosensing molecules in the working electrode is a DET-type GDH comprising a catalytic subunit, an electron transfer subunit and a hitchhiker subunit.

19. The bioelectrochemical sensor of claim 12, wherein the biosensing molecules in the working electrode is an enzyme which can oxidize levodopa and have DET-ability.

20. The bioelectrochemical sensor of claim 12, wherein the biosensing molecules in the working electrode is a redox-species- modified aptamer.

21. The bioelectrochemical sensor according to claim 1, further comprising an additional electrode which does not contain the biosensing molecule of the working electrode or the bioreference molecule of the reference electrode, as a counter electrode.

22. A biosensing method comprising using the bioelectrochemical sensor according to claim 1.

23. The biosensing method of claim 22, wherein the biosensing is performed by amperometric method, potentiometric method, voltammetric method or impedometric method.

Images