Biomarker for verifying plant callus-derived exosomes and method for isolating exosomes using same

Abstract

The present invention relates to: a biomarker for verifying plant callus-derived exosomes; a method for isolating plant callus-derived exosomes using same; a cosmetic composition; a pharmaceutical composition; and a filler.

Description

Biomarker for verification of exosomes derived from plant callus and method for isolating exosomes using the same

[0001] The present invention relates to a biomarker for verifying exosomes derived from plant callus and a method for isolating exosomes using the same.

[0002]

[0003] Exosomes are nano-sized, extracellular vesicles (extracellular vesicles) with a diameter of approximately 200 nm or less that are formed inside the cells of all living organisms and secreted outside the cells through multivesicles with phospholipid bilayer membranes. All animal, plant, and microbial cells secrete exosomes, which are the smallest units of cells and contain various cell-derived proteins, nucleic acids (DNA, messenger RNA, or micro RNA, etc.), lipids, metabolites, etc. depending on their origin. Exosomes promote skin regeneration and relieve skin inflammation, and promote the production of substances beneficial to the skin, such as collagen and hyaluronic acid. In particular, their efficacy has been proven in improving skin tone, increasing skin hydration, increasing elasticity through increased collagen synthesis, improving fine wrinkles, and improving acne and atopic dermatitis by alleviating skin inflammation.

[0004] Despite these unique advantages, research on exosomes and their applications remain limited. One reason for this is that methods for obtaining exosomes are still limited, and even these methods are inefficient, extracting only a very small fraction of the total exosome. Therefore, improving these methods is essential for research and product commercialization.

[0005] As efforts to utilize exosomes as next-generation drug delivery systems and therapeutics continue to grow, the development of mass-production and high-purity exosome purification methods is essential. While significant progress has been made in the development of kits for isolating small quantities of exosomes for diagnostic purposes, development of cell lines for mass production, process development, high-purity exosome isolation technologies, and exosome analysis technologies for quality control remain insufficient. Therefore, research and securing fundamental technologies for high-purity exosome production, isolation, and quality control technologies are urgently needed.

[0006] Exosomes contain specific genetic material and various bioactive factors, including proteins, lipids, and secondary metabolites, depending on the nature and characteristics of the cell of origin. In particular, miRNAs, noncoding nucleotides, are abundant, and their potential role as biomarkers has been suggested, along with their importance in gene regulation.

[0007] miRNAs are single-stranded, non-coding small RNAs, typically consisting of 19 to 25 nucleotides (nt). First discovered in 1993 by Professor Victor Ambros' research team in the growth-regulating mechanism of Caenorhabditis elegans larvae, miRNAs have long been recognized as simply transferring genetic information from DNA into messenger RNA (mRNA), which then travels to the ribosomes in the cytoplasm to transfer RNA (tRNA) to synthesize proteins based on the encoded amino acids.

[0008] However, miRNAs have recently been gaining attention as key regulatory factors in gene expression in most animal, plant, and viral species. Advances in biotechnology and the completion of the Human Genome Project have led to the active development of treatments for incurable diseases and cancer using gene expression regulation. In particular, research is currently underway to utilize miRNAs, which play a crucial role in gene expression regulation, to diagnose various diseases. At least 60% of human mRNAs are regulated by miRNAs, which play a crucial role in various diseases, including breast cancer, bladder cancer, diabetes, and dementia. Therefore, miRNAs play a crucial role as bioregulators in various biological systems, including blood, urine, saliva, and lesioned cells, and are actively being studied to use changes in specific miRNAs as biomarkers for target diseases.

[0009] Plants account for 82% of the Earth's biomass, and their species diversity is correspondingly high. Research on the efficacy of plant-derived exosomes is actively underway across a wide range of plants, and these exosomes exhibit specific effects based on their unique characteristics. In particular, numerous miRNAs found in plants play a crucial role in the overall signaling network, from recognizing environmental stress signals to the expression of stress-responsive genes. Furthermore, during plant growth and development, miRNAs are involved in both physiological aspects of flowering and growth regulation, as well as morphological aspects that control the formation and shape of organs such as leaves and flowers.

[0010] In Korea, existing research on exosome technology using plants has mainly focused on identifying exosomes by checking whether their size is nano-sized or their morphology is a phospholipid bilayer, as disclosed in Korean Patent Publication No. 10-2267796, “Composition for skin soothing containing exosomes derived from natural extracts as an active ingredient,” and Korean Patent Publication No. 10-2523528, “Cosmetic composition containing exosomes derived from grapefruit and camellia flowers as an active ingredient.”

[0011] Exosomes are being actively studied in various fields, including composition, functional studies, isolation and analysis, diagnosis, and treatment methods. However, the distinction between exosomes, which are extracellular vesicles released by plant cells, and endosomes, which are intracellular vesicles present within plant cells, remains unclear. Therefore, the development of biomarkers to confirm or verify exosomes is necessary, and as part of this, research and analysis of miRNAs are necessary.

[0012] Accordingly, the present inventors have proposed a specific miRNA as a biomarker for verifying plant callus-derived exosomes to verify whether the isolated exosomes are exosomes, which are extracellular vesicles released from plant cells, or endosomes, which are intracellular vesicles existing within plant cells, in the production and production of plant-derived exosomes. In addition, by providing a method for isolating plant callus-derived exosomes including a step of verifying that they are exosomes by confirming the specific miRNA as described above, the inventors have discovered that it is possible to secure quality competitiveness by clearly verifying that they are exosomes, and have completed the present invention.

[0013]

[0014] The purpose of the present invention is to provide a biomarker for verifying plant callus-derived exosomes.

[0015] Another object of the present invention is to provide a method for isolating plant callus-derived exosomes containing specific miRNA.

[0016] Another object of the present invention is to provide a cosmetic, pharmaceutical or filler composition for improving skin, comprising plant callus-derived exosomes containing specific miRNA as an active ingredient.

[0017]

[0018] In order to achieve the above purpose, the present invention provides a miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, SEQ ID NO: Provided is a biomarker for verifying plant callus-derived exosomes, characterized in that it is selected from the group consisting of gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0019] In addition, the present invention comprises a step of isolating exosomes from plant callus; a step of extracting small RNA from plant callus-derived exosomes; a step of analyzing the base sequence of the extracted small RNA to obtain sequence data of miRNA;And miRNA base sequences expressed in plant callus-derived exosomes, miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, SEQ ID NO: miR482a of SEQ ID NO: 20, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, and Provided is a method for isolating an exosome derived from plant callus, characterized in that it comprises a step of verifying that the exosome is an exosome by identifying at least one miRNA selected from the group consisting of gfc-cas-miR001, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.;

[0020] In the present invention, the step of isolating exosomes from the plant callus may include a step of isolating exosomes by culturing the plant callus in a liquid suspension, filtering the culture to separate the culture body and the culture solution, and then subjecting the culture solution to low-frequency sonication and centrifugation to obtain a supernatant extract, using a three-step purification method including tangential flow filtration (TFF), ultracentrifugation (UC), and bind-elute size-exclusion chromatography (BE-SEC), which is a size-exclusion chromatography.

[0021] In the present invention, the plant is characterized in that it is at least one species selected from the group consisting of Asteraceae, Apiaceae, Rutaceae, Rosaceae, Vitaceae, Brassicaceae, Selaginellaceae, Oleaceae, Nelumbonaceae, Araliaceae, Lamiaceae, Hypericaceae, Pedaliaceae, Ginkgoaceae, and Piperaceae.

[0022] In the present invention, the plant is characterized in that it is at least one selected from the group consisting of edelweiss, purslane, and ginseng.

[0023] In the present invention, the plant is characterized in that it is at least one terrestrial plant selected from the group consisting of dicotyledons, monocotyledons, and ferns.

[0024] In the present invention, the base sequence analysis is characterized in that it is measured using the next generation sequencing (NGS) method.

[0025] In addition, the present invention provides plant callus-derived exosomes obtained by the above separation method.

[0026] In the present invention, the exosome is characterized in that it is loaded with one or more skin improvement compositions, pharmaceutical materials, and key ingredients for filler composition materials selected from vitamins, growth factors, hormones, sugar molecules, nucleic acids, lipids, and peptides.

[0027] In addition, the present invention provides miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20 ...21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and A cosmetic composition for improving skin is provided, which comprises, as an active ingredient, a plant callus-derived exosome comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0028] In the present invention, the skin improvement is characterized by at least one selected from the group consisting of skin moisturizing, whitening, elasticity, regeneration, wrinkle improvement, anti-aging, skin soothing, and anti-inflammation.

[0029] In addition, the present invention provides miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20 ...21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and A pharmaceutical composition for improving skin is provided, comprising, as an active ingredient, a plant callus-derived exosome comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0030] In addition, the present invention provides miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20 ...21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and A filler composition for improving skin is provided, which comprises, as an active ingredient, a plant callus-derived exosome comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0031]

[0032] According to the present invention, miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR477 of SEQ ID NO: 20, miR156 of SEQ ID NO: 16, miR156b of SEQ ID NO: 20, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID miR482a, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, and By confirming gfc-cas-miR001, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40, they can be utilized as biomarkers for verifying plant callus-derived exosomes.

[0033] In addition, by providing a method for isolating plant callus-derived exosomes containing specific miRNAs, it is possible to secure quality competitiveness by clearly proving that they are exosomes.

[0034] In addition, it can be used in various fields such as cosmetics and pharmaceuticals related to skin improvement purposes, including specific miRNAs in plant callus-derived exosomes.

[0035]

[0036] Figure 1 is a schematic diagram showing a method for isolating exosomes derived from plant callus.

[0037] Figure 2 is a schematic diagram of next generation sequencing (NGS) performed to identify miRNAs in plant callus and plant callus-derived exosomes.

[0038] Figures 3a to 3f show the results of analysis using a Nanoparticle Tracking Analyzer of exosomes derived from Edelweiss callus, exosomes derived from Centella asiatica callus, and exosomes derived from ginseng callus.

[0039] Specifically, FIGS. 3A and 3B are diagrams showing the particle size distribution and microscopic photographs of edelweiss stem exosomes, respectively, as a result of NTA analysis of edelweiss callus according to an embodiment of the present invention. FIGS. 3D and 3D are diagrams showing the particle size distribution and microscopic photographs of edelweiss stem exosomes, respectively, as a result of NTA analysis of ginseng callus according to an embodiment of the present invention. FIGS. 3E and 3F are diagrams showing the particle size distribution and microscopic photographs of edelweiss stem exosomes, respectively, as a result of NTA analysis of Centella asiatica callus according to an embodiment of the present invention.

[0040] Figure 4 is a graph showing the distribution of RNAs present in edelweiss callus, centella asiatica callus, and ginseng callus, and in edelweiss callus-derived exosomes, centella asiatica callus-derived exosomes, and ginseng callus-derived exosomes, based on the results of NGS-based small RNA analysis.

[0041] [Revised 17.10.2024 under Rule 91] Figures 5a to 5c are graphs showing the top miRNA families in Edelweiss callus-derived exosomes, Centella asiatica callus-derived exosomes, and Ginseng callus-derived exosomes, respectively, identified through NGS-based small RNA analysis.

[0042] Figure 6 is a graph showing a novel miRNA family in edelweiss callus-derived exosomes, purslane callus-derived exosomes, and ginseng callus-derived exosomes identified through NGS-based small RNA analysis.

[0043] [Correction under Rule 91 17.10.2024] Figures 7a and 7b show the expression patterns of miRNAs in Edelweiss callus-derived exosomes, Centella asiatica callus-derived exosomes, and Ginseng callus-derived exosomes verified through qRT-PCR (Figure 7a, A) and the electrophoresis images of each PCR product (Figure 7b, B).

[0044] Figure 8 is a graph showing the results of analysis of the expression efficacy of miRNAs FLG, COL1A1, and CER2 in plant callus-derived exosomes within skin cells.

[0045]

[0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

[0047] Throughout this specification, whenever a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise specifically stated.

[0048]

[0049] In the present invention, the term 'exosome' refers to a nano-sized small exosome with a diameter of about 200 nm or less that is formed inside the cells of all living organisms and secreted outside the cells through multivesicles of phospholipid bilayer membranes, and is used with the same meaning as extracellular vesicles.

[0050]

[0051] < Biomarkers for exosome verification, exosome isolation methods, and exosomes >

[0052]

[0053] The present invention relates to a biomarker for exosome verification, a method for isolating exosomes, and exosomes, and more specifically, to a biomarker capable of verifying exosomes derived from plant callus, including micro RNA (miRNA), a method for isolating exosomes from plant callus using the same, and exosomes isolated thereby.

[0054]

[0055] The biomarker for exosome verification of the present invention is miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR172 of SEQ ID NO: 20. miR482a, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, and It may be one selected from the group consisting of gfc-cas-miR001, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40, or a combination thereof.

[0056]

[0057] The biomarker for exosome verification of the present invention may include at least one selected from SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 31, SEQ ID NO: 36, and SEQ ID NO: 40. More preferably, the biomarker for exosome verification of the present invention may include at least one selected from SEQ ID NO: 1, SEQ ID NO: 15, and SEQ ID NO: 18, and in this case, all or each of exosomes derived from callus of edelweiss, centella asiatica, and / or ginseng, preferably edelweiss, centella asiatica, and / or ginseng, may be verified.

[0058] The miRNA molecules of the above sequence numbers 1 to 40 may each independently have a length of 10 to 50 nucleotides, preferably 17 to 23 nucleotides, but are not limited thereto.

[0059] By confirming the presence of the miRNA molecules of the above sequence numbers 1 to 40, it is possible to confirm whether plant callus-derived exosomes have been isolated. Specifically, by confirming whether one or more of the above specific miRNAs are included, it is possible to clearly prove the presence of exosomes, which are extracellular vesicles released from plant cells, and thus the miRNAs of the above sequence numbers 1 to 40 can be utilized as biomarkers for verifying plant callus-derived exosomes.

[0060] In addition, the present invention comprises a step of isolating exosomes from plant callus; a step of extracting small RNA from plant callus-derived exosomes; a step of analyzing the base sequence of the extracted small RNA to obtain sequence data of miRNA;And miRNA base sequences expressed in plant callus-derived exosomes, miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, SEQ ID NO: miR482a of SEQ ID NO: 20, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, and The present invention relates to a method for isolating an exosome derived from plant callus, characterized by including a step of verifying that the exosome is an exosome by identifying at least one miRNA selected from the group consisting of gfc-cas-miR001, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.;

[0061]

[0062] According to one embodiment of the present invention, the method for isolating exosomes from the plant callus may include a step of isolating exosomes by culturing plant callus in a liquid suspension, filtering the culture to separate the culture body and the culture solution, and then subjecting the culture solution to low-frequency sonication and centrifugation to obtain a supernatant extract, using a three-step purification method including tangential flow filtration (TFF), ultracentrifugation (UC), and bind-elute size-exclusion chromatography (BE-SEC), which is a size-exclusion chromatography.

[0063]

[0064] FIG. 1 is a schematic diagram illustrating in more detail a method for isolating exosomes derived from plant callus through an embodiment of the present invention, but the scope of the present invention is not limited thereto. First, plants introduced in vitro are prepared (S1). The plants introduced in vitro may be introduced in vitro using a plant cell tissue culture technique, but are not limited thereto. Thereafter, callus is induced from each plant to secure a superior cell line (S2). A step of creating a culture environment in which exosomes can be released from the callus into the culture medium for the secured superior cell line may further be included (S3). This step is a liquid suspension culture using an air-injected bioreactor (3D CALLUSPHERE). TM ) may be used to create a culture environment in which exosomes can be released from callus into the culture medium, but is not limited thereto. Liquid suspension culture (3D CALLUSPHERE TM) is a suspension culture technology of plant cells, which is a sterile 3D callus culture system that injects air at an appropriate flow rate through an air pump in a bioreactor, which is a cell culture device made of glass, so that the cells float without stagnating and are cultured smoothly, and the gas accumulated in the culture device through respiration can be discharged through an exhaust port. Thereafter, a step of separating a suspension culture body and a suspension culture liquid may be further included (S4). In one example of the present invention, this step may be by filtration, and specifically, it may be a step of separating a callus culture body and a culture liquid through a 100 to 400 um mesh of a liquid suspension culture body cultured for about 4 to 6 weeks while maintaining the supply of air including oxygen using an air pump at 0.2 to 0.4 vvm.

[0065] Hereinafter, the treatment process of the separated suspension culture is described in detail (S5a). Specifically, the suspension culture is subjected to physical stimulation of the cell membrane through low-frequency ultrasound (S5b), and then centrifuged at 1,500 to 2,000 x g for 20 to 30 minutes using a centrifuge (S5c). Only the supernatant is collected to separate and remove cell residues. The supernatant extract is then used for pure exosome extraction and concentration using Hybrid-Exotech. TM The process is performed (S5d). Hybrid-Exotech TMThe process is a three-step process. Step 1 is tangential flow filtration (TFF) using a 300 kDa annular porous membrane filter. It disperses and circulates the material using continuous hydraulic pressure to concentrate and purify it by 5 to 10 times the initial starting volume based on particle size or molecular weight. Step 2 is a secondary purification using ultracentrifugation at 100,000 to 150,000 x g for 90 min on the exosomes concentrated and purified by TFF. Finally, step 3 is a tertiary purification that collects only pure nano-sized exosomes by removing non-extracellular vesicles and large proteins through bind-elute size-exclusion chromatography (BE-SEC) according to molecular size and molecular weight. A total of 3 stages of Hybrid-Exotech TM The exosomes derived from plant callus culture obtained through the process are separated from the final plant callus-derived exosomes after the sterilization process is completed by filtering, for example, with a 0.22 μm filter (S5e). Meanwhile, the callus culture obtained through the culture is subjected to RNA extraction and miRNA analysis for comparative analysis with exosome-derived miRNAs (S5h).

[0066] The present invention performs miRNA analysis in plant callus, preferably in exosomes derived from plant callus, most preferably in exosomes obtained from a cell suspension culture of plant callus, and among the expressed miRNAs, miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR398, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 3 ... A method for isolating plant callus-derived exosomes can be provided through a step of verifying that the exosomes are exosomes by checking whether the exosomes include at least one selected from the group consisting of gfc-lal-miR004, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0067]

[0068] According to one embodiment of the present invention, the plant may be at least one selected from the group consisting of Asteraceae, Apiaceae, Rutaceae, Rosaceae, Vitaceae, Brassicaceae, Selaginellaceae, Oleaceae, Nelumbonaceae, Araliaceae, Lamiaceae, Hypericaceae, Pedaliaceae, Ginkgoaceae, and Piperaceae.

[0069] Additionally, the plant may be at least one terrestrial plant selected from the group consisting of dicotyledons, monocotyledons, and ferns. In one example of the present invention, the plant may be at least one selected from the group consisting of edelweiss, purslane, and ginseng, but is not limited thereto.

[0070] According to one embodiment of the present invention, the base sequence analysis may be measured using a next generation sequencing (NGS) method.

[0071] Figure 2 is a schematic diagram showing a next generation sequencing (NGS)-based small RNA sequence analysis method and a method for miRNA verification performed for miRNA analysis in plant callus or plant callus-derived exosomes.

[0072] First, small RNAs from plant callus or plant callus-derived exosomes were extracted. Small RNAs from plant callus samples were extracted using the XENO-Plant small RNA Purification kit (Xenohelix, Korea), and small RNAs from plant callus-derived exosomes were extracted using the XENO-EVARI kit (Xenohelix, Korea). NGS library construction and analysis for small RNA analysis were performed. Using the XENO-Libera library kit (Xenohelix, Korea), 3' and 5' adapters were ligated to both ends, cDNA was generated by reverse transcription, and then amplified. The produced library was sequenced using the miniseq sequencing system (NextSeq500, Illumina). Raw data were stored in FastQC v0.11. 9 was used to check the quality, and adapter sequences and low-quality 3' end sequences were removed (quality score < 22) using Cutadapt v 2.8, and read lengths were trimmed to 18–30 bases. The identified miRNAs were confirmed by calculating the number of aligned reads for each sample and the RPTM (Reads Per Ten Million) value. The obtained miRNA candidates were analyzed using the existing miRNA database, miRBase. If there was a mismatch of up to 2 base sequences, they were named as previously reported conserved or known miRNAs, and if there was a mismatch of 2 or more bases, they were named as unreported novel potential miRNAs. Each miRNA was validated through quantification, target gene prediction, and differential expression.

[0073] In the method for isolating exosomes derived from plant callus from the above miRNA, it is possible to verify whether the isolated exosomes are exosomes, which are extracellular vesicles released from plant cells, or endosomes, which are intracellular vesicles existing within plant cells, so the quality competitiveness is excellent.

[0074] In addition, the present invention relates to plant callus-derived exosomes obtained by the above separation method.

[0075] The above exosome may be loaded with one or more skin improvement compositions, pharmaceutical materials, and key ingredients for filler composition materials selected from vitamins, growth factors, hormones, sugar molecules, nucleic acids, lipids, and peptides.

[0076]

[0077] < Cosmetic composition for skin improvement, pharmaceutical composition and filler composition, and method using the same >

[0078]

[0079] The present invention relates to a method for treating miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20 ... miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and The present invention relates to a cosmetic composition for improving skin and a method for improving skin, comprising, as an active ingredient, a plant callus-derived exosome comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0080] In order to predict whether the above miRNA directly targets and regulates gene expression in heterologous humans, miRNA targets were predicted on the miRDB site (https: / mirdb.org / ). As a result, genes related to wound healing, skin moisturizing, whitening, elasticity, regeneration, wrinkle improvement, anti-aging, skin soothing, and inflammation were targeted, predicting a skin improvement effect.

[0081] According to one embodiment of the present invention, the skin improvement may be at least one selected from the group consisting of skin moisturizing, whitening, elasticity, regeneration, wrinkle improvement, anti-aging, skin soothing, and anti-inflammation.

[0082] In addition, the present invention provides miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20 ...21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and The present invention relates to a pharmaceutical composition for improving skin and a method for improving / treating skin, comprising as an active ingredient a plant callus-derived exosome containing at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

[0083] In addition, the present invention provides miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20 ...21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and The present invention relates to a filler composition for skin improvement comprising, as an active ingredient, a plant callus-derived exosome comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40, and a method for skin improvement using the same.

[0084]

[0085] Preferably, the skin improvement cosmetic composition, pharmaceutical composition and filler composition of the present invention may include at least one selected from SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 31, SEQ ID NO: 36 and SEQ ID NO: 40. More preferably, the skin improvement cosmetic composition, pharmaceutical composition and filler composition of the present invention may include at least one selected from SEQ ID NO: 1, SEQ ID NO: 15 and SEQ ID NO: 18.

[0086]

[0087] In one specific example, the cosmetic composition, pharmaceutical composition and filler composition for skin improvement of the present invention can be used for the purposes of cosmetics, pharmaceuticals or quasi-drugs, and can be used for skin moisturizing, whitening, elasticity, regeneration, wrinkle improvement, anti-aging, skin soothing and anti-inflammation, etc.

[0088]

[0089] In addition, the cosmetic composition, pharmaceutical composition and filler composition for skin improvement of the present invention may additionally include pharmaceutically or cosmetically acceptable ingredients.

[0090] When the skin improvement cosmetic composition, pharmaceutical composition and filler composition of the present invention are used in the above cosmetics, the components included in the conventional cosmetics may include, but are not limited to, purified water, oil, wax, fatty acid, fatty acid alcohol, fatty acid ester, surfactant, humectant, thickening agent, antioxidant, viscosity stabilizer, chelating agent, buffer and lower alcohol as carriers, excipients or diluents.

[0091]

[0092] In addition, the formulation of the cosmetic including the skin-improving cosmetic composition, pharmaceutical composition and filler composition of the present invention can be manufactured into any formulation commonly manufactured in the industry, and can take the form of a solution, emulsion, viscous mixture, etc., and preferably can be one formulation selected from the group consisting of paste, milky lotion, cream, gel, powder, spray, solution, emulsion, suspension, pack, foundation, lotion, cosmetic water and cleansing formulation containing a surfactant. More specifically, the cosmetic composition includes one formulation selected from the group consisting of skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutritional lotion, cream, massage cream, nutritional cream, moisture cream, hand cream, foundation, essence, nutritional essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser.

[0093] In addition, when the composition of the present invention is used in the pharmaceutical, it can be used in the form of a solid, semi-solid, solution, emulsion, dispersion, micelle, liposome, etc.

[0094] According to one specific example of the present invention, the cosmetic composition, pharmaceutical composition and filler composition for skin improvement may be in any one formulation selected from the group consisting of a liquid, a gel, a solid, a patch, an injection, an infusion, or a spray.

[0095]

[0096] The preferred dosage of the cosmetic composition, pharmaceutical composition and filler composition for skin improvement of the present invention varies depending on the condition and weight of the subject (patient), the degree of disease, the form of the drug, the route and period of administration, but can be appropriately selected by a person skilled in the art.

[0097] The dosage of the cosmetic composition, pharmaceutical composition, and filler composition for skin improvement of the present invention may be appropriately selected by those skilled in the art, taking into account the administration method, the age, sex, and weight of the recipient, the severity of the disease, etc. For example, the dosage of the cosmetic / pharmaceutical composition of the present invention may be 0.001 to 1000 mg / kg for adults. It may be administered once a day or in divided doses, but is not limited thereto.

[0098]

[0099] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, as the gist of the present invention is not limited by them.

[0100]

[0101] <Example 1> Preparation of plant-derived callus and exosomes

[0102] 1-1. Isolation of Edelweiss-derived callus cultures (La-C) and exosomes (La-EV)

[0103] Edelweiss seeds (purchased from Chilternseeds, UK) were soaked in 70% ethanol for 1 minute to remove contaminants, then soaked in a 50% bleach solution containing 0.01% Tween-20 as a surfactant for 20 minutes, and then washed at least three times with sterile distilled water. The washed seeds were then dried with sterilized filter paper to remove surface moisture, and then sown on MS (Murashige and Skoog, 1952) solid medium containing 30 g / L sucrose and 4 g / L gelatin without the addition of hormones for germination. Germination was induced at 25°C±2°C for one week under light conditions (4000 lux). After germination, growth was maintained under light / dark conditions (16 hr / 8 hr). After 2 to 3 months of germination, the leaves of the plants were cut into 4*4 mm pieces using a sterilized mass, and then cultured in the dark on MS medium containing 0.5 mg / L of the cytokinin hormone 6-benzylaminopurine (6-BA) and 0.3 mg / L of the auxin hormone 2,4-dichlorophenoxyacetic acid (2,4-D) for callus induction. Callus induction in each explant was confirmed under a microscope, and then subcultured 3 to 4 times at 4-week intervals to select superior cell lines. The Edelweiss (Leontopodium alpinum, La) callus cultures introduced in vitro after securing superior cell lines were subjected to liquid suspension culture (3D CALLUSPHERE) for exosome extraction. TM ) was performed. Liquid suspension culture (3D CALLUSPHERE TM) is a suspension culture technology for plant cells. It is a sterile 3D callus culture system that injects air at an appropriate flow rate through an air pump in a bioreactor, a cell culture vessel made of glass, so that the cells float without stagnation and are cultured smoothly, and the gas accumulated in the culture vessel through respiration can be discharged through the exhaust port. The culture medium used was MS liquid medium containing 0.5 mg / L 6-BA (6-Benzylaminopurine), 0.3 mg / L 2,4-D (2,4-dichlorophenoxyacetic acid), a plant growth hormone for Edelweiss callus growth, and 3% sucrose as a carbon source. The air supply including oxygen using an air pump was maintained at 0.2 to 0.4 vvm, and the culture was performed under temperature conditions of 23±2℃ for approximately 6 weeks. 3D CALLUSPHERE TM Edelweiss callus suspension cultures were cultured through a 200 mesh screen to separate the callus culture and the culture medium. The callus culture (La-C) was subjected to callus-derived small RNA extraction. Meanwhile, to produce edelweiss culture-derived exosomes (La-EV), the edelweiss callus culture obtained through a 200 mesh screen was subjected to physical stimulation of the cell membrane through low-frequency ultrasound at 20-25 kHz for about 30 minutes. Afterwards, the supernatant was centrifuged at 1,500-2,000xg for 20-30 minutes using a centrifuge, and only the supernatant was taken to separate and remove cell residues. The supernatant extract was then used for pure exosome extraction and concentration using Hybrid-Exotech. TM The process was carried out. Hybrid-Exotech TMThe process is a three-step process. Step 1 is tangential flow filtration (TFF) using a 300 kDa annular porous membrane filter. It disperses and circulates the material using continuous hydraulic pressure to concentrate and purify it by 5-10 times the initial starting volume based on particle size or molecular weight. Step 2 is a secondary purification using ultracentrifugation at 100,000-150,000xg for 90 minutes on the exosomes concentrated and purified by TFF. Finally, step 3 is a tertiary purification that collects only pure nano-sized exosomes by removing non-extracellular vesicles and large proteins through bind-elute size-exclusion chromatography (BE-SEC) according to molecular size and molecular weight. A total of 3 stages of Hybrid-Exotech TM The exosomes derived from the Edelweiss callus culture obtained through the process were filtered through a 0.22 μm filter to produce the final Edelweiss callus-derived exosomes (Ed-EV) after completing the sterilization process.

[0104]

[0105] 1-2. Isolation of callus cultures (Ca-C) and exosomes (Ca-EV) derived from the plant

[0106] To introduce the fresh bottle gourd (Seoul Floriculture) into the laboratory, the leaves were soaked in 95% ethanol for 1 minute, disinfected with a disinfectant solution (50% bleach + 0.1% Tween-20) for 20 minutes, and then washed 3-4 times with sterilized distilled water. The disinfected bottle gourd leaves were cut into 4 x 4 mm pieces using a sharp knife and cultured in the dark at 23±2℃ on MS solid medium containing 1.0 mg / L of 6-benzylaminopurine (6-BA), 0.3 mg / L of 2,4-D (2,4-dichlorophenoxyacetic acid), 3% sucrose, and 4 g / L of gelatin to induce callus. After callus induction, superior cell lines were selected through subculture at 4-week intervals. The callus cultures of Centella asiatica (Ca) from the selected superior cell lines were cultured in liquid suspension in a liquid medium from which gelatin was removed (3D CALLUSPHERE). TM ) was performed. Liquid suspension culture (3D CALLUSPHERE TM ) is a suspension culture technology for plant cells. It is an aseptic 3D callus culture system that injects air at an appropriate flow rate through an air pump in a bioreactor, a cell culture vessel made of glass, so that the cells float without stagnation and are cultured smoothly, and the gas accumulated in the culture vessel through respiration can be discharged through the exhaust port. The culture medium used was MS liquid medium containing 1.0 mg / L 6-BA (6-Benzylaminopurine), 0.3 mg / L 2,4-D (2,4-dichlorophenoxyacetic acid), and 3% sucrose as a carbon source for plant growth of Centella asiatica callus. The air supply including oxygen using an air pump was maintained at 0.2 to 0.4 vvm, and the culture was performed under temperature conditions of 23±2℃ for approximately 6 weeks. 3D CALLUSPHERE TMThe callus suspension culture cultured through was separated from the callus culture and the culture medium through a 200 mesh screen. The callus culture (Ca-C) was subjected to callus-derived small RNA extraction. Meanwhile, to produce exosomes (Ca-EV) derived from the culture of the callus obtained through the 200 mesh screen, the cell membrane was physically stimulated through low-frequency ultrasound at 20-25 kHz for about 30 minutes. After centrifugation at 1,500-2,000 x g for 20-30 minutes using a centrifuge, only the supernatant was taken to separate and remove cell residues. For pure exosome extraction and concentration, Hybrid-Exotech TM The process was carried out. Hybrid-Exotech TM The process is a three-step process. Step 1 is tangential flow filtration (TFF) using a 300 kDa annular porous membrane filter. It disperses and circulates the material using continuous hydraulic pressure to concentrate and purify it by 5-10 times the initial starting volume based on particle size or molecular weight. Step 2 is a secondary purification using ultracentrifugation at 100,000-150,000xg for 90 minutes on the exosomes concentrated and purified by TFF. Finally, step 3 is a tertiary purification that collects only pure nano-sized exosomes by removing non-extracellular vesicles and large proteins through bind-elute size-exclusion chromatography (BE-SEC) according to molecular size and molecular weight. A total of 3 stages of Hybrid-Exotech TM The exosomes derived from the callus culture obtained through the process were filtered through a 0.22 μm filter to produce the final exosomes derived from callus (Ca-EV) after completing the sterilization process.

[0107]

[0108] 1-3. Isolation of ginseng-derived callus cultures (Pg-C) and exosomes (Pg-EV)

[0109] Ginseng (Panax ginseng, Pg) roots purchased for in-vitro introduction were used to induce callus. The purchased ginseng roots were thoroughly washed in running water and soaked in 95% ethanol for 1 minute. After disinfection with a disinfectant solution (50% bleach + 0.1% Tween-20) for 20 minutes, they were washed 3–4 times with sterilized distilled water. The disinfected ginseng roots were cut into 4 × 4 mm pieces using a sharp knife and plated on a solid medium containing 2 mg / L of the growth hormone IBA (Indole-butyric acid), 3% sucrose, and 4 g / L of gelatin. After callus induction under dark conditions, subcultures were performed at 4-week intervals to select superior cell lines. The selected ginseng callus cultures were used for exosome extraction using a liquid suspension culture (3D CALLUSPHERE). TM ) was performed. Liquid suspension culture (3D CALLUSPHERE TM ) is a suspension culture technology for plant cells. It is a sterile 3D callus culture system that injects air at an appropriate flow rate through an air pump in a bioreactor, a cell culture vessel made of glass, so that the cells float without stagnation and are cultured smoothly, and the gas accumulated in the culture vessel through respiration can be discharged through the exhaust port. The culture medium used was MS liquid medium containing 2 mg / L IBA (Indole-butyric acid), an auxin-based plant growth hormone for ginseng callus growth, and 3% sucrose as a carbon source. The air supply including oxygen using an air pump was maintained at 0.2 to 0.4 vvm, and the culture was performed under temperature conditions of 23±2℃ for approximately 6 weeks. 3D CALLUSPHERE TMThe ginseng callus suspension cultures cultured through the 200 mesh screen were separated from the callus cultures and the culture medium. The callus cultures (Pg-C) were subjected to callus-derived small RNA extraction. Meanwhile, to produce ginseng culture-derived exosomes (Pg-EV), the ginseng callus cultures obtained through the 200 mesh screen were subjected to physical stimulation of the cell membrane through low-frequency ultrasound at 20-25 kHz for about 30 minutes. After centrifugation at 1,500-2,000 x g for 20-30 minutes using a centrifuge, only the supernatant was collected to separate and remove cell residues. For pure exosome extraction and concentration, Hybrid-Exotech TM The process was carried out. Hybrid-Exotech TM The process is a three-step process. Step 1 is tangential flow filtration (TFF) using a 300 kDa annular porous membrane filter. It disperses and circulates the material using continuous hydraulic pressure to concentrate and purify it by 5 to 10 times the initial starting volume based on particle size or molecular weight. Step 2 is a secondary purification using ultracentrifugation at 100,000 to 150,000 x g for 90 minutes on the exosomes concentrated and purified by TFF. Finally, step 3 is a tertiary purification to collect only pure nano-sized exosomes by removing non-extracellular vesicles and large proteins through bind-elute size-exclusion chromatography (BE-SEC) according to molecular size and molecular weight. A total of 3 stages of Hybrid-Exotech TM The exosomes derived from ginseng callus culture obtained through the process were filtered through a 0.22 μm filter to produce the final ginseng callus-derived exosomes (Pg-EV) that completed the sterilization process.

[0110]

[0111] <Experimental Example 1> Analysis of exosomes derived from plant callus

[0112] The particle size and concentration of the plant callus-derived exosomes obtained in Example 1 were measured using a nanoparticle tracking analyzer (ZetaView TWIN, Particle Metrix, Germany).

[0113] Sample nameParticle size (nm)Concentration (Particles / mL)Edelweiss callus-derived exosomes (La-EV)141.31.3x10 11 Callus-derived exosomes (Ca-EV) 133.41.3x10 10 Ginseng callus-derived exosomes (Pg-EV) 116.12.8x10 10

[0114] As a result, as shown in Table 1 and Figure 3, the particle sizes were confirmed to be 141.3 nm for exosomes derived from edelweiss callus, 133.4 nm for exosomes derived from purslane callus, and 116.1 nm for exosomes derived from ginseng callus, and all were confirmed to be nano-sized below 150 nm.

[0115]

[0116] Meanwhile, the BCA (Bicinchoninic Acid) assay was performed for protein quantification. 20 ㎕ of each plant callus-derived exosome sample obtained in Example 1 and 180 ㎕ of the BCA sample were mixed in a 96-well plate and reacted at 37℃ for 1 hour while blocking light with foil. Afterwards, the absorbance was measured at a wavelength of 562 nm using a Microplate reader equipment (BioTek). The protein concentration through the measured absorbance was analyzed through a standard curve of absorbance using bovine serum albumin (BSA), a standard protein substance provided with the reagent. The concentration of the sample protein using each exosome was calculated by multiplying the number of particles by 10 billion (1.0x10 10 The concentration was adjusted to 100 particles / mL and then measured. The XENO-EVARI kit (Xenohelix, Korea) was used to extract small RNA in exosomes.

[0117] Sample name Protein concentration (ug / 1.0x10 10 particles / mL)small RNA concentration (ng / ul)Edelweiss callus-derived exosomes (La-EV)1,50050.1Plantago lucidum callus-derived exosomes (Ca-EV)1,70045.8Ginseng callus-derived exosomes (Pg-EV)1,30043.3

[0118]

[0119] As a result, as shown in Table 2, 100 billion exosomes (1.0x10 10The concentration of protein in the exosomes (particles / mL) was 1700 ug in the exosomes derived from Centella asiatica callus (Ca-EV), 1500 ug in the exosomes derived from Edelweiss callus (La-EV), and 1300 ug in the exosomes derived from Ginseng callus (Pg-EV). The protein content in the exosomes was the highest in the exosomes derived from Centella asiatica callus (Ca-EV). In addition, as a result of extracting small RNA for miRNA analysis from each sample, it was confirmed that the overall small RNA was 43-50 ng / ul, and after a purity test with a Bioanalyzer (Agilent 2100, USA), these were used as samples for small RNA sequence analysis.

[0120]

[0121] <Experimental Example 2> Extraction and sequence analysis of small RNA from plant tissue cultures, callus and exosomes.

[0122] Small RNAs were extracted from Edelweiss callus (La-C) and exosomes (La-EV), Centella asiatica callus (Ca-C) and exosomes (Ca-EV), and ginseng callus (Pg-C) and exosomes (Pg-EV) obtained from Example 1. Small RNAs were extracted from plant callus samples using the XENO-Plant small RNA Purification kit (Xenohelix, Korea), and small RNAs were extracted from exosomes using the XENO-EVARI kit (Xenohelix, Korea). NGS library construction and analysis for small RNA analysis were performed. Using the XENO-Libera library kit (Xenohelix, Korea), 3' and 5' adapters were ligated to both ends, cDNA was generated by reverse transcription, and then amplified. The generated library was sequenced using the miniseq sequencing system (Illumina). Raw data were stored in FastQC v0.11. The quality was checked using 9, and adapter sequences and low-quality 3' end sequences were removed (quality score<22) using Cutadapt v 2.8, and read length was trimmed to 18-30 bases. The identified miRNAs were confirmed by calculating the number of aligned reads for each sample and the RPTM (Reads Per Ten Million) value.

[0123]

[0124] Sequence numbermiRNA expression plant base sequence sequenceLength(nt)Sequence number 1miR156CommonUGACAGAAGAGAGUGAGCACC21Sequence number 2miR156bCentella asiatica, ginsengUGACAGAAGAGAGUGAGCACA21Sequence number 3miR157EdelweissUUGACAGAAGAUAGAGAGCAC21Sequence number 4miR159EdelweissUUGGACUGAAGGGAGCUCCC20Sequence number 5miR162EdelweissCUCAACUUCAAGCAAAGCUU20Sequence number 6miR166Edelweiss, centella asiaticaUCGGACCAGGCUUCAUUCCCC21Sequence number 7miR167Centella asiaticaUCAGGUCAUCUUGCAGCUUCA21Sequence number 8miR168Centella asiatica, ginsengUCGCUUGGUGCAGGUCGGGAC21Sequence number 9miR169EdelweissUGUAAUCCUUAGCUUUGUGGUU22Sequence number 10miR171Edelweiss, Centella asiaticaUGAUUGAGCCGUGCCAAUAUC21Sequence number 11miR172Centella asiaticaAGAUGAUUUAUAUGUUACUG20Sequence number 12miR319EdelweissGCUGCUUUACAAUGUCUCUAU21Sequence number 13miR393Centella asiaticaUCCAAAGGGAUCGCAUUGAUC21Sequence number 14miR395Centella asiaticaCUGAAGUGUUUGGGGGAACU20Sequence number 15miR396CommonUUCCACAGCUUUCUUGAACU20Sequence number 16miR397Edelweiss, Centella asiaticaUCAUUGAGUGCAGCGUUGAUG21Sequence number 17miR398Edelweiss, GinsengCAUGUGUUCUCAUGUCACACC21Sequence number 18miR408CommonUUCCACAGCUUUCUUGAACU20Sequence number 19miR477EdelweissAUCUCCCUCAAAGGCUUCCAA21Sequence number 20miR482aCentella asiaticaGGUGUGGCGUCUCUGGGGAGG21Sequence number 21miR482bCentella asiaticaUUUCCUAUUCCACCCAUCCCAU22Sequence number 22miR827Centella asiatica,GinsengUUAGAUGACCAUCAACAAACU21Sequence number 23miR1311EdelweissUCAGAGUUUUGCCAGUUCCGCC22Sequence number 24miR1511EdelweissAACCAGGCUCUGAUACCAUG20Sequence number 25miR1515Centella asiaticaUCAUUUUUGCGUGCAAUGAUCC22Sequence number 26miR3701EdelweissUAAACAGUGCCCACCCUUCAUC22Sequence number 27miR4407EdelweissCAGAGGAAGCAGCACUUGUACC22Sequence number 28miR4415EdelweissAAGUUGUGAUGAGAAUCAAUG21Sequence number 29miR6024EdelweissUUUUAGCAAGAGUUGUUUUACC22Sequence number 30miR6300EdelweissGUCGUUGUAGUAUAGUGG18Sequence number 31gfc-lal-miR001EdelweissAACAGGAAUUUCGGCUCUGAUA22Sequence number 32gfc-lal-miR002EdelweissAGGGAGCUCCCUUCAGUCCAA21Sequence number 33gfc-lal-miR003EdelweissGUUGAAGAGUCAUUGUGGCCC21Sequence number 34gfc-lal-miR004EdelweissUCGGUUUUGAUUAUUCUACU20Sequence number 35gfc-lal-miR005EdelweissUCUAUGGGUUUGUUGAUUGCC21Sequence number 36gfc-cas-miR001Centella asiaticaGGUGUGGCGUCUCUGGGGAGG21Sequence number 37gfc-cas-miR002Peony UUGGUCGGUGGUCUAUGUCACA22Sequence number 38gfc-cas-miR003Peony UCUGAAAGAUUGUUUGUGGGG21Sequence number 39gfc-cas-miR004Peony UAGAAAACUCAUAAUCGACU20Sequence number 40gfc-pgi-miR001Ginseng CUGCGCUCCGAUUCGUC20,

[0125]

[0126] As a result, as shown in Figs. 4 to 6, the entire sequencing results were classified into Chloroplast, CDS, tRNA, rRNA, ncRNA, and miRNA precursor based on the genomic sequence database or miRNA database of each plant, and those with unknown functions were classified as Unclassified. Referring to Fig. 4, about 50 to 60% of the sequences in all plants were classified as unclassified with unknown functions. In addition, CDS indicating gene function was high in ginseng callus, Centella asiatica callus, and Centella asiatica callus-derived exosomes, and in the case of edelweiss, which has almost no gene database, it showed low levels in both edelweiss callus and edelweiss callus-derived exosomes. Each miRNA was confirmed to be a miRNA through the existing miRNA database miRBase (www.mirbase.org). As a result, it was found that callus-derived miRNAs were present in greater numbers than exosome-derived miRNAs in general, and about 5 to 10% of them were found to be commonly present in exosomes. This varies from plant to plant, and in the case of edelweiss, where the existing genome sequencing database is insufficient, the largest number of miRNAs was secured, with about 200 callus-based miRNAs previously reported, and 45 miRNAs in exosomes. Among these, about 40 miRNAs with more than 90% sequence identity with previously reported ones and 5 novel miRNAs that did not match were identified. In the case of Centella asiatica, about 70 callus-based miRNAs were identified, and among them, 26 previously reported miRNAs and 4 novel miRNAs existing in exosomes were identified.In the case of ginseng, although the genome database was larger than that of edelweiss and centella asiatica, the number of miRNAs was secured, the lowest at 30, and among these, only 8 miRNAs, including 1 novel miRNA, were identified as existing in exosomes.

[0127] [Revised 17.10.2024 under Rule 91] Figures 5a to 5c are graphs showing the top miRNA families in Edelweiss callus-derived exosomes, Centella asiatica callus-derived exosomes, and Ginseng callus-derived exosomes identified through NGS-based small RNA analysis. The top 20 conserved miRNA families highly expressed in Edelweiss callus-derived exosomes and Centella asiatica callus-derived exosomes are shown, while in the case of Ginseng callus-derived exosomes, the number of miRNAs is small overall, showing only 7.

[0128]

[0129] <Experimental Example 3> miRNA verification using qRT-PCR

[0130] To verify the expression level of novel miRNAs specifically expressed in each plant in Edelweiss callus-derived exosomes (La-EV), Centella asiatica callus-derived exosomes (Ca-EV), and Panax ginseng callus-derived exosomes (Pg-EV), which were identified through NGS-based small RNA analysis, qRT-PCR was performed. For miRNA detection, Stem-loop RT-PCR was used, in which the Stem-Loop Reverse Primer (SLP) was designed to form a hairpin and have a 3' overhang complementary to the miRNA. For PCR amplification, a miRNA-specific forward primer with a 5' adapter and a Universal Reverse Primer (URP) was designed. Mir-X miRNA qRT-PCR TB Green TMUsing a kit, cDNA synthesis of miRNA and qRT-PCR were performed. The qRT-PCR reaction conditions included denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds for amplification. U6 snRNA was provided as an internal normalization control within the kit. Relative gene expression levels were calculated using the delta-delta Ct method (ddCt). All reactions were repeated three times for each target.

[0131] [Revised 17.10.2024 under Article 91 of the Rules] As a result, as shown in Figs. 7a and 7b, it was confirmed that the miRNAs of each Edelweiss callus-derived exosome (La-EV), Centella asiatica callus-derived exosome (Ca-EV), and Ginseng callus-derived exosome (Pg-EV) were expressed 2.0 to 3.5 times in a plant-specific manner. Similarly, when the PCR products were electrophoresed on a 2% agarose gel, it was confirmed visually that the expression was increased compared to U6, which was used as a control.

[0132]

[0133] <Experimental Example 4> Confirmation of the Skin Improvement Effect of Plant Callus Exosome-Derived MiRNAs

[0134] The expression levels of exosome-specific miRNAs were analyzed through RNA sequencing of Edelweiss callus-derived exosomes, Centella asiatica callus-derived exosomes, and ginseng callus-derived exosomes. As a result, among the miRNAs, commonly expressed miR156 (SEQ ID NO: 1), miR396 (SEQ ID NO: 15), and miR408 (SEQ ID NO: 18), gfc-lal-miR001 (SEQ ID NO: 31) specific to Edelweiss callus-derived exosomes, gfc-cas-miR001 (SEQ ID NO: 36) specific to Centella asiatica callus-derived exosomes, and gfc-pgi-miR001 (SEQ ID NO: 40) specific to ginseng callus-derived exosomes were used to confirm their functions in human skin cells. Mimic oligomers of miR156, miR396, miR408, gfc-lal-miR001, gfc-cas-miR001, and gfc-pgi-miR001 were synthesized, and double-stranded RNA oligonucleotide microRNA mimic (IDT, USA) was used as a control. Human epidermal keratinocytes (HaCaT) and human dermal fibroblasts (HDF) were used as cell lines for the experiment. To inject and express miRNAs into each cell line, miR156, miR396, miR408, gfc-lal-miR001, gfc-cas-miR001, gfc-pgi-miR001, and microRNA mimic (miR-Con) were introduced into the cells at a concentration of 10 nM using lipofectamine (Invitrogen). After 48 hours, the change in cell viability (proliferation rate compared to miR-Con) was measured using WST-1 analysis.

[0135] Differentiated cell proliferation rate (%) HaCaTHDFmiR-Con100100miR156 (SEQ ID NO: 1)120125miR396 (SEQ ID NO: 15)132132miR408 (SEQ ID NO: 18)129129gfc-lal-miR001 (SEQ ID NO: 31)130131gfc-cas-miR001 (SEQ ID NO: 36)119125gfc-pgi-miR001 (SEQ ID NO: 40)128130

[0136]

[0137] As a result, as shown in Table 4, transfection of each miRNA at a concentration of 10 nM in the proliferation of HaCaT and HDF cells confirmed cell proliferation of approximately 20-30% compared to miR-Con (control) without toxicity.

[0138]

[0139] In addition, after culturing the transfected cells in a 37℃ incubator containing 25% CO for about 48 hours, RNA was isolated using 1 mL of Trizol reagent. Then, cDNA (C1000 Thermal Cycler, Bio-Rad, USA) was synthesized from the isolated RNA using oligo-dT and reverse transcriptase. To select target genes, miRDB, a website that can predict miRNA targets, was used for analysis within the human genome, and the moisturizing-related gene FLG (Filaggrin), the regeneration and aging-related gene COL1A1 (Collagen Type I alpha 1), and the skin barrier-related gene CER2 (Ceramide synthase 2) were identified. Therefore, the expression level of the target gene was finally evaluated by performing a chain polymerase reaction in a real-time PCR machine using a mixture of each target gene-specific primer and the cyanine dye CyberGreen (SYBR Green qPCR Master Mix, Applied Biosystems, USA). The primer sequences are shown in Table 5 below, and the gene expression level was finally analyzed through correction for the β-actin gene.

[0140] Classification UniProt ID Name Direction Base sequence Sequence number 41 and 42 P20930FLG ForwardGCTGAAGGAACTTCTGGAAAAGGReverseGTTGTGGTCTATATCCAAGTGATC Sequence number 43 and 44 Q96G23CER2 ForwardGCCTTGCTCTTCCTCATCGTTCReverseTGCTTGCCACTGGTCAGGTAGA Sequence number 45 and 46 P02452COL1A1 ForwardGATTCCCTGGACCTAAAGGTGCReverseAGCCTCTCCATCTTTGCCAGCA Sequence number 47 and 48 P60709 β-actin (ACTB) ForwardCACCATTGGCAATGAGCGGTTCReverseAGGTCTTTGCGGATGTCCACGT

[0141]

[0142] As a result, as shown in Fig. 8, when the commonly expressed miR156 of SEQ ID NO. 1, miR396 of SEQ ID NO. 15, and miR408 of SEQ ID NO. 18 and the miRNA mimics of each plant-specific miRNA sequence, gfc-lal-miR001 of SEQ ID NO. 31 specific to Edelweiss callus-derived exosomes, gfc-cas-miR001 of SEQ ID NO. 36 specific to Centella asiatica callus-derived exosomes, and gfc-pgi-miR001 of SEQ ID NO. 40 specific to ginseng callus-derived exosomes, were transfected, the levels of FLG (Filaggrin), COL1A1 (Collagen Type I alpha 1), and CER2 (Ceramide synthase 2) were generally 1.2 to 1.5 times higher than in the case of the microRNA mimic (miR-Con) transfected with an oligonucleotide that does not overlap at all with the miRNA sequence of the present invention. It was confirmed that the expression increased up to 3.4 times. This means that miR156 of SEQ ID NO. 1 according to the present invention showed about 3 times higher expression in CER2 and COL1A1, miR396 of SEQ ID NO. 15 showed the highest expression rate of 2.1 times in CER2, and miR408 of SEQ ID NO. 18 showed the highest expression rate of 3.4 times in COL1A1. gfc-lal-miR001 of SEQ ID NO. 31 showed the same expression pattern as miR156 of SEQ ID NO. 1, but showed a 1.5-fold increase in FLG, but about 3 times higher expression in CER2 and COL1A1. gfc-cas-miR001 of SEQ ID NO. 36 and gfc-pgi-miR001 of SEQ ID NO. 40 showed about 2-3 times increased expression in FLG, CER2, and COL1A1.That is, it means that an isolated miRNA nucleic acid molecule comprising the sequence of miR156 of SEQ ID NO: 1, miR396 of SEQ ID NO: 15, and miR408 of SEQ ID NO: 18, gfc-lal-miR001 of SEQ ID NO: 31, gfc-cas-miR001 of SEQ ID NO: 36, gfc-pgi-miR001 of SEQ ID NO: 40 or an antisense nucleic acid molecule thereof according to the present invention can effectively regulate the expression of FLG, COL1A1, and CER2. In addition, it was confirmed that an isolated miRNA nucleic acid molecule comprising the sequence of miR156 of SEQ ID NO: 1, miR396 of SEQ ID NO: 15, and miR408 of SEQ ID NO: 18, gfc-lal-miR001 of SEQ ID NO: 31, gfc-cas-miR001 of SEQ ID NO: 36, gfc-pgi-miR001 of SEQ ID NO: 40 or an antisense nucleic acid molecule thereof according to the present invention can effectively regulate the expression of one or more of FLG, COL1A1, and CER2.

[0143]

[0144] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0145]

[0146] According to the present invention, miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR477 of SEQ ID NO: 20, miR156 of SEQ ID NO: 16, miR156b of SEQ ID NO: 20, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID miR482a, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, and By confirming gfc-cas-miR001, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40, they can be utilized as biomarkers for verifying plant callus-derived exosomes.

Claims

1. miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20, miR482b of SEQ ID NO: 21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and A biomarker for verifying plant callus-derived exosomes, characterized in that it comprises at least one selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO:

40.

2. In paragraph 1, A biomarker for verifying plant callus-derived exosomes, characterized in that it comprises at least one selected from the group consisting of sequence number 1, sequence number 15, and sequence number 18.

3. Step of isolating exosomes from plant callus; Step for extracting small RNA from plant callus-derived exosomes; A step of obtaining miRNA sequence data by analyzing the base sequence of the extracted small RNA; and miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, and SEQ ID NO: 10, which are expressed in plant callus-derived exosomes from the base sequence of miRNA. miR482a of SEQ ID NO: 20, miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, and A method for isolating an exosome derived from plant callus, characterized in that it comprises a step of verifying that it is an exosome by identifying at least one miRNA selected from the group consisting of gfc-cas-miR001, gfc-cas-miR002 of SEQ ID NO: 37, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO:

40.

4. In paragraph 3, The step to verify that it is an exosome by checking the miRNA is: A method for isolating an exosome derived from plant callus, characterized in that it comprises a step of verifying that it is an exosome by identifying at least one miRNA selected from the group consisting of sequence number 1, sequence number 15, and sequence number 18.

5. A method for isolating exosomes derived from plant callus, characterized in that in paragraph 3, the plant is at least one selected from the group consisting of Asteraceae, Apiaceae, Rutaceae, Rosaceae, Vitaceae, Brassicaceae, Selaginellaceae, Oleaceae, Nelumbonaceae, Araliaceae, Lamiaceae, Hypericaceae, Pedaliaceae, Ginkgoaceae, and Piperaceae.

6. In paragraph 4, A method for isolating exosomes derived from plant callus, characterized by verifying whether the exosomes are derived from callus of edelweiss, purslane, and ginseng.

7. A method for isolating exosomes derived from plant callus, characterized in that, in the second paragraph, the base sequence analysis is measured using a next generation sequencing (NGS) method.

8. An exosome derived from plant callus obtained by any one of the separation methods of clauses 2 to 7.

9. miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20, miR482a of SEQ ID NO: 21 miR482b, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and A cosmetic composition for improving skin, comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO:

40.

10. A cosmetic composition for skin improvement, characterized in that in paragraph 9, the skin improvement is at least one selected from the group consisting of skin moisturizing, whitening, elasticity, regeneration, wrinkle improvement, anti-aging, skin soothing, and anti-inflammation.

11. In paragraph 9, A cosmetic composition for improving skin comprising one or more miRNAs selected from SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 31, SEQ ID NO: 36, and SEQ ID NO:

40.

12. miR156 of SEQ ID NO: 1, miR156b of SEQ ID NO: 2, miR157 of SEQ ID NO: 3, miR159 of SEQ ID NO: 4, miR162 of SEQ ID NO: 5, miR166 of SEQ ID NO: 6, miR167 of SEQ ID NO: 7, miR168 of SEQ ID NO: 8, miR169 of SEQ ID NO: 9, miR171 of SEQ ID NO: 10, miR172 of SEQ ID NO: 11, miR319 of SEQ ID NO: 12, miR393 of SEQ ID NO: 13, miR395 of SEQ ID NO: 14, miR396 of SEQ ID NO: 15, miR397 of SEQ ID NO: 16, miR398 of SEQ ID NO: 17, miR408 of SEQ ID NO: 18, miR477 of SEQ ID NO: 19, miR482a of SEQ ID NO: 20, SEQ ID NO: miR482b of SEQ ID NO: 21, miR827 of SEQ ID NO: 22, miR1311 of SEQ ID NO: 23, miR1511 of SEQ ID NO: 24, miR1515 of SEQ ID NO: 25, miR3701 of SEQ ID NO: 26, miR4407 of SEQ ID NO: 27, miR4415 of SEQ ID NO: 28, miR6024 of SEQ ID NO: 29, miR6300 of SEQ ID NO: 30, gfc-lal-miR001 of SEQ ID NO: 31, gfc-lal-miR002 of SEQ ID NO: 32, gfc-lal-miR003 of SEQ ID NO: 33, gfc-lal-miR004 of SEQ ID NO: 34, gfc-lal-miR005 of SEQ ID NO: 35, gfc-cas-miR001 of SEQ ID NO: 36, and A method for improving skin, comprising administering to a subject a cosmetic composition comprising at least one miRNA selected from the group consisting of gfc-cas-miR002, gfc-cas-miR003 of SEQ ID NO: 38, gfc-cas-miR004 of SEQ ID NO: 39, and gfc-pgi-miR001 of SEQ ID NO: 40.

Images