Zebrafish model with scn1lab gene mutation, and use thereof

Abstract

The present invention relates to a zebrafish model with a scn1lab gene mutation, and use thereof, and, more specifically, to: a zebrafish model with a scn1lab gene mutation, using a guide RNA / Cas9 system; a method for producing the mutant zebrafish model; and a method for screening for seizure-associated disease treatment drugs by using same. The zebrafish model with a scn1lab gene mutation, of the present invention, exhibits characteristics such as seizure-like behavior, color preference, electroencephalogram characteristics, abnormal expression of specific transcripts, neurotransmitter imbalance and the like, and thus can be effectively used for screening for drugs for treatment of seizure-associated diseases such as epilepsy.

Description

Zebrafish model with SCN1LAB gene mutation and its use

[0001] The present invention relates to a zebrafish model in which a mutation occurs in the scn1lab gene and its use, and more specifically, to a zebrafish model in which a mutation occurs in the scn1lab gene using a gene scissors system, a method for producing the mutant zebrafish model, and a method for screening drugs for treating epilepsy or seizure-related diseases using the same.

[0002] Transgenic animals are animals that have been artificially inducibly infused with or deleted from external genes to express a desired genetic trait. They can be useful for basic research on the role of specific genes in living organisms. By inserting or deleting genes whose function is suspected and observing their effects, the physiological functions mediated by those genes can be inferred. Furthermore, transgenic animals can serve as models for human diseases, making them invaluable for understanding the causes and progression of diseases, as well as for assessing the efficacy and side effects of potential therapeutics. Currently, transgenic mice and zebrafish with diseases such as dementia, cancer, heart disease, and genetic disorders are being developed.

[0003] Zebrafish (Danio rerio) have transparent embryos, undergo in vitro fertilization, can easily produce large quantities of fertilized eggs, and develop very rapidly, with most tissues and organs forming within a single day. Furthermore, the entire genome has been discovered and can be easily searched through zebrafish databases. As a vertebrate, their genome is similar to that of humans, making them useful for functional analysis of human genes and screening natural products and compounds for biomodulators. These advantages have led to active research on transgenic zebrafish, and zebrafish transgenic technology is readily applicable to mammalian technologies. Zebrafish embryos also have the advantage of being readily available in large numbers.

[0004] Genome editing is a technology that freely modifies the genetic information of living organisms. Advances in life sciences and the development of genome sequencing technology have enabled us to gain a broader understanding of diverse genetic information. For example, we already have a solid understanding of genes involved in the reproduction, disease, and growth of plants and animals, the genetic mutations that cause various human genetic diseases, and the production of biofuels. However, further technological advancements are essential to directly utilize these genes to improve living organisms and treat human diseases. Genome editing technology can dramatically expand the scope of its applications by altering the genetic information of animals, plants, and microorganisms, including humans. Genetic scissors, molecular tools designed to precisely cut desired genetic information, play a key role in genome editing technology. Like next-generation sequencing technology, which has advanced the field of genetic sequencing, gene scissors are becoming a key technology that expands the speed and scope of genetic information utilization and creates new industrial fields.

[0005] The gene scissors developed so far can be divided into three generations according to their sequence. The first-generation gene scissors are ZFN (Zinc Finger Nuclease), the second-generation gene scissors are TALEN (Transcription Activator-Like Effector Nuclease), and the most recently studied CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat)-Cas9 (CRISPR-associated) is a third-generation gene scissors (Crispr / Cas9, RGEN).

[0006] However, extensive research describing the optimization and validation of zebrafish models with specific gene knockouts as tools for practical drug screening using the above-mentioned genetic scissors is currently lacking.

[0007] Epilepsy is a chronic disease in which some nerve cells generate excessive electricity in a short period of time, causing repetitive seizures. It is a serious neurological disease that involves neurobiological, mental, cognitive, and social changes.

[0008] Epilepsy is the most common neurological disorder, affecting approximately 0.5% to 1% of the global population. Furthermore, approximately 45 new cases are diagnosed per 100,000 people worldwide each year. In Korea, it is estimated that there are approximately 300,000 to 400,000 epilepsy patients, with approximately 20,000 new cases reported annually. Furthermore, 70% of all epilepsy cases begin in childhood and adolescence, with the incidence rate being particularly high in infancy. The incidence and prevalence follow a U-shaped pattern, peaking within the first year of life, then rapidly declining, and then rapidly increasing again in those over 60 years of age. The lifetime prevalence of experiencing seizures is 10-15%.

[0009] Among epilepsy types, epilepsy that does not respond to antiepileptic drugs developed to date is called intractable epilepsy, and accounts for approximately 20% of all epilepsy cases. Known causes of intractable epilepsy include focal cortical dysplasia (FCD), hemimegalencephaly (HME), and malformations of cortical development (MCD) such as tuberous sclerosis complex (TSC), hippocampal sclerosis (HS), or Sturge-Weber syndrome (SWS).

[0010] Intractable epilepsy does not respond to existing antiepileptic drugs, and thus the development of new drugs is required to control epilepsy.

[0011] Under these circumstances, the inventors of the present invention have made efforts to develop a human disease model that can be easily and quickly accessed, and as a result, have created a scn1lab gene mutant zebrafish model using a gene scissors system, and have completed the present invention by elucidating that the model can be applied to epilepsy and seizure-related diseases.

[0012] Accordingly, one object of the present invention is to provide a zebrafish model having a scn1lab gene mutation.

[0013] In addition, another object of the present invention is to provide a method for producing a zebrafish model having a scn1lab gene mutation.

[0014] In addition, another object of the present invention is to provide a method for screening a therapeutic agent for epilepsy or a seizure-related disease.

[0015] The terminology used herein is for the purpose of description only and should not be construed as limiting. The singular expression includes the plural expression unless the context clearly indicates otherwise. In this specification, the terms "comprises" or "has" and the like are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood to not preclude the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0016] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0017]

[0018] Hereinafter, the present invention will be described in more detail.

[0019]

[0020] According to one aspect of the present invention, the present invention provides a zebrafish model having a scn1lab gene mutation by modification of the base sequence represented by SEQ ID NO: 2 and / or a base sequence complementary thereto within the exon 2 region nucleic acid sequence of the scn1lab (sodium channel, voltage-gated, type I like, alpha b) gene.

[0021] The present invention is characterized in that it produces a zebrafish model in which a specific mutation (alteration) is induced at a specific site of the scn1lab gene using an artificial nuclease system, thereby causing a loss of function, i.e., a frame shift is caused by a specific alteration in the nucleic acid sequence of exon 2 of the scn1lab gene, thereby inactivating the scn1lab protein. Accordingly, the present invention can provide a zebrafish model useful for studying the progression and pathological mechanisms of epilepsy or seizure-related diseases, and its use.

[0022] As long as the purpose of the present invention can be achieved, the modification within the nucleic acid sequence may include deletion, substitution, insertion or inversion of one or more nucleic acids.

[0023] Preferably, the modification may be one in which a base sequence of 1 to 10 bases (bp) is inserted into exon 2 of the scn1lab gene.

[0024] The above scn1lab gene can be genetically manipulated by a gene scissors system, and the present invention provides a guide nucleic acid capable of forming a complementary bond to each target sequence (SEQ ID NO: 2) among the nucleic acid sequences of exon 2 of the scn1lab gene.

[0025] In one embodiment of the present invention, the scn1lab gene mutation of the present invention is a mutation in which a four-base sequence (CTGG) is introduced at the 175th position in the 3'-end direction from the 5'-end in the base sequence of exon 2 (SEQ ID NO: 1) of the scn1lab gene through a gene scissors system, and the scn1lab gene mutation has the base sequence of SEQ ID NO: 7.

[0026] "Engineered nuclease" is a general term for an artificial nuclease and / or a system containing the same that can bind to any gene and cut and damage or destroy a specific nucleic acid site, for example, a specific DNA site. The engineered nuclease is a sequence-specific endonuclease. Unless specifically stated otherwise, a "sequence-specific endonuclease" or "sequence-specific nuclease" refers to a protein that recognizes and binds to a polynucleotide, such as a target gene, at a specific nucleotide sequence and catalyzes single- or double-strand breaks in the polynucleotide. Since it can specifically recognize a specific sequence and cut a nucleic acid, it is very useful in genome editing technology. Examples include ZFN (Zinc finger protein), TALEN (transcription activator-like effector protein), and RGEN (RNA-guided endonuclease) including the CRISPR / Cas system.

[0027] The terms "modified" or "engineered" applied to nucleic acids are used interchangeably herein and refer to artificial alterations made to the nucleic acid sequences constituting a gene. Such alterations may include deletions, substitutions, insertions, or inversions of one or more nucleic acids. Modified or engineered nucleic acid sequences may exhibit alterations in the expression and / or functional activity of these nucleic acids or their expression products, such as increases, accelerations, decreases, or deletions.

[0028] The terms "damage" and "destruction" as applied to nucleic acids are used interchangeably herein to mean any genetic modification that reduces or eliminates the expression and / or functional activity of a nucleic acid or its expression product. For example, disruption of a gene is included within the scope of any genetic modification that reduces or eliminates the expression of the gene and / or the functional activity of the corresponding gene product (e.g., mRNA and / or protein). Genetic modification includes complete or partial inactivation, suppression, deletion, interruption, blockade, or downregulation of a nucleic acid (e.g., a gene).

[0029] A "target gene" refers to a nucleic acid encoding a polypeptide within a cell, unless specifically stated otherwise. A "target sequence" refers to a portion of a target gene, for example, one or more exon sequences of the target gene, an intron sequence or regulatory sequence of the target gene, or a combination of an exon and an intron sequence, an intron and a regulatory sequence, an exon and a regulatory sequence, or an exon, an intron and a regulatory sequence, unless specifically stated otherwise.

[0030] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype of seizure-like behavior.

[0031] It is preferred that the above seizure-like behavior is photosensitive seizure-like behavior.

[0032] It is preferable that the mutant zebrafish model of the present invention exhibits a yellow preference phenotype.

[0033] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype of increased theta waves of 5 to 7 Hz during electroencephalography.

[0034] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype in which mch (melanin concentrating hormone) gene expression is reduced compared to the wild type.

[0035] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype in which, compared to the wild type, the expression of a gene selected from the group consisting of tyrosinase, tyrosinase-related protein 1b, and dopachrome tautomerase is increased.

[0036] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype in which melanin synthesis is increased compared to the wild type.

[0037] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype in which serotonin is reduced compared to the wild type.

[0038] It is preferable that the mutant zebrafish model of the present invention exhibits a phenotype in which norepinephrine or dopamine is increased compared to the wild type.

[0039] The mutant zebrafish model of the present invention has epilepsy.

[0040] In addition, the present invention can provide an artificially engineered zebrafish cell, fertilized egg, or embryo comprising the artificially engineered scn1lab gene mutation. The cell, fertilized egg, or embryo comprises the scn1lab gene mutation resulting in a change in the nucleic acid sequence, and can develop into an individual having the phenotype thereof.

[0041]

[0042] In addition, according to another aspect of the present invention, the present invention provides a method for producing a scn1lab mutant zebrafish model, comprising the step of introducing a mutation into exon 2 of the scn1lab (sodium channel, voltage-gated, type I like, alpha b) gene.

[0043] The above modification can be achieved using any method known in the art as long as the purpose of the present invention can be achieved, but it is preferably induced by the CRISPR / Cas system.

[0044] In one embodiment, a method for producing a cell, fertilized egg, or embryo having a modified nucleic acid sequence of a scn1lab gene can be provided, comprising the step of injecting into a cell, fertilized egg, or embryo comprising a target genomic locus on the scn1lab gene, a guide RNA capable of complementarily binding to the target genomic locus region (i.e., a guide RNA targeting exon 2 of the scn1lab gene); and Cas9 mRNA.

[0045] The above guide RNA is designed using the sequences represented by SEQ ID NO: 3 and SEQ ID NO: 4.

[0046] The above guide RNA and Cas9 nuclease may be present in one or more vectors in the form of nucleic acid sequences, or may be present by forming a complex through binding of the guide nucleic acid and the RNA-guide endonuclease.

[0047] The above injection step can be performed in vivo or in vitro using a method known in the art.

[0048] The present invention includes all of the transformation vectors, artificial nuclease complexes for transformation, cells, and nuclear transfer embryos necessary for model production that can be obtained during the process of the method for producing the scn1lab mutant zebrafish model.

[0049] As an example, the scn1lab gene mutant construct is preferably a guide RNA / Cas9 system constructed from oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4. The specific base sequences of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4 are as follows:

[0050] Oligo 1 (SEQ ID NO: 3):

[0051] 5'-TAATACGACTCACTATATCCTGCCCGAGTCTCTCGCCGTTTTAGAGCTAGAAATAGC-3'

[0052] Oligo 2 (SEQ ID NO: 4):

[0053] 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3'

[0054] The method for introducing the above construct into a fertilized egg can be appropriately selected from among microinjection, electroporation, particle bombardment, sperm-mediated gene transfer, viral infection, direct muscle injection, insulator, and transposon techniques after preparing the gene construct. In the present invention, the microinjection method was adopted and used.

[0055]

[0056] In addition, the present invention provides a method for screening for a treatment agent for epilepsy or a seizure-related disease, comprising the following steps:

[0057] (S1) a step of treating the zebrafish model of the present invention described above with a test compound; and

[0058] (S2) A step of comparing zebrafish treated with the test compound of step (S1) with an untreated control group to determine whether symptoms have recovered.

[0059] "Seizure-related diseases" include brain-related diseases accompanied by seizures, and include, for example, stroke; encephalitis; hippocampal sclerosis; cerebral palsy and congenital malformations; seizures related to CNS infections; hypoxia; brain tumors; traumatic brain injury; vascular malformations; neurodegenerative diseases; metabolic diseases such as hypoglycemia, glycogen storage disease and pyruvate dehydrogenase deficiency; multiple sclerosis; and autoimmune diseases such as systemic lupus erythematosus, and diseases in which seizures occur of unknown cause. The zebrafish model of the present invention can be used for screening for therapeutic agents for seizures derived from seizure-related diseases.

[0060] The above seizure-related disease is preferably selected from the group consisting of stroke, hippocampal sclerosis, cerebral palsy, congenital malformation, central nervous system infection, hypoxia, brain tumor, traumatic brain injury, and neurodegenerative disease.

[0061] “Dravet Syndrome” referred to in relation to epilepsy in the present invention is also called Severe Myoclonic Epilepsy in Infancy (SMEI), Polymorphic Epilepsy in Infancy (PMEI), etc., and refers to genetic epilepsy (epilepsy) that occurs in infancy.

[0062] The above test compound may be selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, metabolites of bacteria or fungi, and bioactive molecules, but is not limited thereto.

[0063] It is preferable that the above symptom recovery is recovery of the phenotype of the zebrafish model of the present invention. The phenotype of the zebrafish model of the present invention includes seizure-like behavior, photosensitive seizure-like behavior, preference for yellow, increase in theta wave of 5 to 7 Hz in electroencephalography, decrease in mch (melanin concentrating hormone) gene expression, increase in gene expression selected from the group consisting of tyrosinase, tyrosinase-related protein 1b, and dopachrome tautomerase, increase in melanin synthesis, decrease in serotonin, and increase in norepinephrine or dopamine.

[0064] Since the method of the present invention utilizes the above-described content, description thereof is omitted to avoid excessive complexity of this specification.

[0065]

[0066] In conclusion, the present inventors used gene editing technology to create a zebrafish model harboring a mutation in the scn1lab gene to develop an animal model for screening therapeutic drugs for epilepsy or other seizure-related disorders. The zebrafish scn1lab mutant exhibits traits such as seizure-like behavior, a preference for the color yellow, electroencephalographic characteristics, abnormalities in the expression of specific transcripts, and neurotransmitter imbalances, making it suitable for screening therapeutic drugs for seizure-related disorders such as epilepsy.

[0067] The zebrafish model having the scn1lab gene mutation of the present invention exhibits phenotypes such as seizure-like behavior, color preference, electroencephalographic characteristics, abnormalities in the expression of specific transcripts, and neurotransmitter imbalance, and thus can be usefully used in screening drugs for treating seizure-related diseases such as epilepsy.

[0068] Figure 1 shows the process of producing zebrafish scn1lab mutants (left) and obtaining kri111 genotype individuals (right).

[0069] Figure 2 shows the results of the seizure-like behavior evaluation of zebrafish scn1lab mutants.

[0070] Figure 3 shows the results of the seizure-like behavior evaluation of zebrafish scn1lab mutants.

[0071] Figure 4 shows the results of the evaluation of photosensitive seizure-like behavior in scn1lab mutants.

[0072] Figure 5 shows the chamber for the cheer color preference test (left) and the change in color preference of the scn1lab mutant (right).

[0073] Figure 6 shows the electroencephalogram (EEG) results using zebrafish fry (left) and the EEG results of scn1lab mutants (right).

[0074] Figure 7 shows the results of transcriptome analysis of the scn1lab mutant.

[0075] Figure 8 shows the results of neurotransmitter analysis of scn1lab mutants.

[0076] Figure 9 shows the results of the efficacy verification of fenfluramine using the scn1lab mutant.

[0077] Figure 10 shows the results of verifying the efficacy of cannabidiol using a scn1lab mutant.

[0078] Hereinafter, the present invention will be described in more detail through specific examples. The following examples describe preferred embodiments of the present invention, and the scope of the present invention is not limited by the following examples.

[0079]

[0080] Example

[0081] Example 1. Production of zebrafish scn1lab gene mutants.

[0082] 1.1. CRISPR / Cas9 method

[0083] To prepare a zebrafish model of epilepsy, the present inventors designed guide RNA to target exon 2 of the zebrafish scn1lab gene.

[0084] Briefly, the zebrafish scn1lab gene sequence (NM_001044895) was identified from the UCSC Genome Bioinformatics database (http: / genome.ucsc.edu) and the target sequence for genome editing was derived. To produce guide RNA that recognizes the scn1lab target genome sequence, oligo nucleotide 1 connecting the T7 promoter, scn1lab target, and crRNA-TracrRNA sequence was synthesized. Oligo nucleotide 2 was synthesized to complementarily bind to oligo nucleotide 1 to form double-stranded DNA. The two oligos were synthesized into double-stranded DNA, and guide RNA (single guided RNA, sgRNA) using this as a template was synthesized and purified through in vitro transcription.

[0085] The detailed base sequence is as follows:

[0086] WTscn1lab gene exon 2 (SEQ ID NO: 1); 5'-CTCCCAGAGTGACCGGAGATTAGCTGGTGCAGCTACCAGAGCAGGATGTCAATATGGCTGCTCAGCTGCTCGTTCCACCCGGACCTGACAGCTTCCGGCCCTTCCTGCCCGAGTCTCTCGCCGCTATCGAGCAACGCATCGCAGAGGAGGGTGGCCCAGAGG CCCAAAGGCGAGAGACGGCCTGATGACGACGACGAAAATGGGCCCAAACCCAACAGAGATTTGGAGGCGGGAAAACCCCTGCCGTTCATCTACGGAGATGTTCCGCCACACATGCTGTCCGTCCCGCTGGAGGACCTGGACACCTACTACAGCAACCAAAAA-3'

[0087] Target sequence within exon 2 of the scn1lab gene targeted by guide RNA (SEQ ID NO: 2): 5'-TCCTGCCCGAGTCTCTCGCC-3'

[0088] Oligo 1 (SEQ ID NO: 3):

[0089] 5'-TAATACGACTCACTATATCCTGCCCGAGTCTCTCGCCGTTTTAGAGCTAGAAATAGC-3'

[0090] Oligo 2 (SEQ ID NO: 4):

[0091] 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3'

[0092] Guide RNA (300 ng / μl) and EnGen Spy Cas9 NLS protein (M0636T, New England BioLabs) were mixed and microinjected into zebrafish one-cell stage fertilized eggs.

[0093] 1.2. Selection of zebrafish individuals with the scn1lab gene edited

[0094] Fertilized eggs microinjected with guide RNA / Cas9 were reared to adulthood and then mated with wild-type zebrafish (AB strain) to obtain fertilized eggs. For genomic DNA isolation, 5 days after fertilization, fry were reared. Twenty individuals were randomly selected and placed in a microtube. 100 μl of 50 mM NaOH was added and homogenized at 95°C for 15 minutes. 10 μl of tris-HCl (pH 8.0) solution was added, and PCR was performed using this as a template. The amplified gene sequence was 314 bp, including the guide RNA target sequence, and the two primers used here are as follows.

[0095] scn1lab ex2 FP (SEQ ID NO: 5):

[0096] 5'-CCCAGAGTGACCGGAGATTAG-3'

[0097] scn1lab ex2 RP (SEQ ID NO: 6):

[0098] 5'-TTGCTGTAGTAGGTGTCCAGG-3'

[0099] DNA fragments amplified through PCR were used to confirm genome editing using the T7 endonuclease I (M0302S, New England BioLabs) assay, and ultimately, an individual with a four-nucleotide (CTGG) insertion in exon 2 of the scn1lab gene was obtained. The genotype of this individual was designated kri111 (Fig. 1).

[0100] Therefore, the scn1lab gene mutation, in which four nucleotides (CTGG) are inserted in the target sequence (SEQ ID NO: 2) of the exon 2 region of the scn1lab gene, has the base sequence of SEQ ID NO: 7 (TCCTCTGGGCCCGAGTCTCTCGCC).

[0101] In addition, the estimation of the zebrafish Scn1lab amino acid length showed that the WT Scn1lab amino acid was 1966aa, whereas the kri111 Scn1lab amino acid was 44aa, indicating that when a mutation occurred in scn1lab exon 2, that is, when a four-base sequence (CTGG) was introduced at position 175 from the 5'-end to the 3'-end in the exon 2 sequence, a frame shift occurred.

[0102] 1.3. Acquisition of zebrafish scn1lab gene mutants

[0103] A male and female scn1lab(+ / -) pair were mated to obtain fertilized eggs, and their development was observed. From the third day after fertilization, approximately 25% of the individuals exhibited excessive melanocyte synthesis, resulting in an overall black appearance (Fig. 1).

[0104]

[0105] Example 2. Phenotypic analysis of scn1lab gene mutants

[0106] 2.1. Seizure-like behavior

[0107] Seizure-like behavior in zebrafish has been reported in a pentylenetetrazole (PTZ)-induced seizure model. To analyze the phenotype of the seizure-like behavior of scn1lab mutants, fertilized eggs obtained by mating a male and female scn1lab(+ / -) pair were reared for 6 days after fertilization. Then, individual eggs were placed in 96-well plates, and their movements were evaluated using a DanioVision (Nolus), a zebrafish behavior analysis device.

[0108] Seizure-like behaviors in zebrafish fry can be divided into three stages: a rapid increase in movement (stage 1), a whirlpool-like circling swim around the well (stage 2), and a motionless, side-lying rest (stage 3). To quantify the rapid increase in movement in stages 1 and 2, data on distance moved, moving frequency, and moving duration were generated for each instantaneous velocity step of the fry. The movement of scn1lab mutants was confirmed to increase the most compared to wild-type individuals at an instantaneous velocity of 80 mm / s, establishing this as the condition for seizure-like behavior (Figs. 2 and 3).

[0109] 2.2. Photosensitive seizure-like behavior

[0110] The photosensitive seizure-like behavior of scn1lab gene mutants at the same time was evaluated by quantifying the behavioral pattern after stimulating them alternately in light and darkness for 10 minutes in a zebrafish behavior analysis device. Normal zebrafish fry showed no change in movement under light conditions, but showed an anxiety response with increased movement under dark conditions and gradually adapted to it. scn1lab gene mutants showed an increase in movement the moment the light response was applied, and the response under dark conditions tended to be slightly lower than that of normal individuals. These results show that scn1lab gene mutants showed an increase in photosensitive seizure-like behavior compared to normal individuals (Fig. 4).

[0111] 2.3. Color Preference Test

[0112] Zebrafish are known to recognize and prefer colors from the fry stage, and a color preference test can be used to infer an individual's cognitive ability. This test can be utilized to evaluate disease models, drugs, and toxic substances. While normal fry tended to prefer blue over yellow, scn1lab mutants showed a higher preference for yellow. This suggests that the individual's inherent color preference is abnormal in scn1lab mutants (Fig. 5).

[0113] 2.4. Electroencephalogram (EEG)

[0114] One method for diagnosing epilepsy is electroencephalography (EEG). In a seizure-induced model in zebrafish fry, an increase in the 5-7 Hz theta waves, which define seizure symptoms, has been reported. EEG studies of scn1lab mutants also revealed an increase in the frequency and duration of seizure-related waves compared to normal individuals (Fig. 6).

[0115]

[0116] Example 3. Transcriptome analysis of scn1lab gene mutants

[0117] To explore the disease-causing mechanisms in scn1lab mutants, transcriptome analysis was performed. 659 genes were identified with statistically significant changes between normal and mutant individuals. 147 genes were increased in the mutants, and 512 genes were decreased.

[0118] In particular, it was confirmed through transcriptome analysis and real-time PCR that mch (melanin concentrating hormone), known as an appetite-regulating hormone, was reduced in the mutant (two genes, pmch and pmchl, exist in zebrafish). In addition, the expression of enzymes related to melanin synthesis, such as tyrosinase (tyr), tyrosinase-related protein 1b (trp1b), and dopachrome tautomerase (dct), was significantly increased in the mutant. This is consistent with the fact that the mutant appears black due to excessive melanin synthesis (Fig. 7).

[0119]

[0120] Example 4. Neurotransmitter analysis in Dravet syndrome caused by scn1lab gene mutations.

[0121] Neurotransmitters are representative endogenous substances that regulate emotional and behavioral responses in the brain nervous system, and representative ones include glutamate (GLU), gamma-aminobutyric acid (GABA), serotonin (5-HT), norepinephrine (NE), dopamine (DA), and histamine (HA). Among them, GABA and serotonin are known to exhibit stabilizing effects and antiepileptic effects in the nervous system, and an increase in the amount of serotonin (5-HT) in the body by a serotonin reuptake inhibitor has also been identified as a therapeutic mechanism in an animal model of Dravet Syndrome. Five days after fertilization, 30 zebrafish fry of wild type and scn1lab gene mutant models were collected in a test tube, 120 μL of distilled water was added, and a homogenate was prepared using an ultrasonicator. Afterwards, 120 μL of methanol containing 0.1% formic acid was added to extract neurotransmitters in zebrafish fry, centrifuged for 10 minutes to collect the supernatant, and the neurotransmitters were simultaneously analyzed using liquid chromatography-mass spectrometry (LC-MS / MS), and the results are shown in Figure 8.

[0122] As shown in Fig. 8, in the scn1lab gene mutant zebrafish fry model, a tendency toward a decrease in serotonin (5-HT), which plays a role in stabilizing the nervous system, was confirmed, and a significant increase in norepinephrine (NE) and dopamine (DA), which are associated with excessive motility, was confirmed. Through this, it was confirmed that an imbalance of neurotransmitters appeared in the scn1lab gene mutant model according to the present invention.

[0123]

[0124] Example 5. Verification of drug efficacy using scn1lab gene mutants.

[0125] 5.1. Fenfluramine (Fintepla)

[0126] Fenfluramine is a serotonergic drug known to be used as an anti-seizure agent in Dravet syndrome and Lennox-Gastaut syndrome. When scn1lab mutants were exposed to 250 μM fenfluramine, an effective concentration, seizure-like behavior was suppressed. However, at the same concentration, movement in normal individuals also tended to be reduced (Fig. 9).

[0127] 5.2. Cannabidiol (Epidiolex)

[0128] Cannabidiol, a plant-based cannabinoid, is a component of cannabis and is used as a treatment for epilepsy. When exposed to an effective concentration of 10 μM cannabidiol, seizure-like behavior was reduced in scn1lab mutants. Furthermore, exposure to the same concentration in normal individuals had no effect (Figure 10).

Claims

1. A zebrafish model having a scn1lab gene mutation due to a modification of the base sequence represented by SEQ ID NO. 2 and / or a base sequence complementary thereto within the exon 2 region nucleic acid sequence of the scn1lab (sodium channel, voltage-gated, type I like, alpha b) gene.

2. In paragraph 1, A zebrafish model, characterized in that the modification in the nucleic acid sequence comprises deletion, substitution, insertion or inversion of one or more nucleic acids.

3. In paragraph 2, The above variant is a zebrafish model characterized by the insertion of 1 to 10 base sequences (bp) into exon 2 of the scn1lab gene.

4. In paragraph 1, A zebrafish model characterized in that the above scn1lab gene mutation comprises the base sequence of sequence number 7.

5. In paragraph 1, A zebrafish model characterized in that the above zebrafish model has epilepsy.

6. In paragraph 1, The above zebrafish model is a zebrafish model characterized in that the expression level of the mch (melanin concentrating hormone) gene or its protein is reduced compared to the wild type.

7. In paragraph 1, The above zebrafish model is a zebrafish model characterized in that, compared to the wild type, the expression level of one or more genes or proteins thereof selected from the group consisting of tyr (tyrosinase), trp1b (tyrosinase-related protein 1b) and dct (dopachrome tautomerase) is increased.

8. In paragraph 1, The above zebrafish model is a zebrafish model characterized by a reduced serotonin level compared to the wild type.

9. In paragraph 1, The above zebrafish model is a zebrafish model characterized by increased levels of norepinephrine or dopamine compared to the wild type.

10. A method for producing a scn1lab mutant zebrafish model, comprising the step of introducing a mutation into exon 2 of the scn1lab (sodium channel, voltage-gated, type I like, alpha b) gene.

11. In paragraph 10, A manufacturing method, characterized in that the above modification is induced by a CRISPR / Cas system.

12. In paragraph 11, The method comprises the steps of generating a guide RNA targeting exon 2 of Cas9 mRNA and scn1lab gene; and A manufacturing method, characterized by comprising a step of injecting the Cas9 mRNA and the guide RNA into a zebrafish cell, fertilized egg or embryo.

13. In paragraph 12, A manufacturing method characterized in that it is designed using the sequences represented by the above guide RNA sequence number 3 and sequence number 4.

14. A method for screening for a treatment for epilepsy or seizure-related diseases, including the following steps: (S1) A step of treating a test compound to a zebrafish model according to any one of claims 1 to 9; and (S2) A step of comparing zebrafish treated with the test compound of step (S1) with an untreated control group to determine whether symptoms have recovered.

15. In paragraph 14, A screening method, characterized in that the above seizure-related disease is at least one selected from the group consisting of stroke, hippocampal sclerosis, cerebral palsy, congenital malformation, central nervous system infection, hypoxia, brain tumor, traumatic brain injury, and neurodegenerative disease.

Images