Genome editing of plant JAZ genes for pathogen resistance and improved fiber quality and yield

Abstract

Embodiments of the present disclosure pertain to a plant or seed that includes one or more altered JASMONATE-ZIM DOMAIN repressor (JAZ) genes. Additional embodiments of the present disclosure pertain to methods of altering one or more JAZ genes of a plant or seed by introducing one or more alterations to the one or more JAZ genes of the plant or seed. The altered plants and seeds of the present disclosure may exhibit one or more altered properties, such as jasmonic acid (JA) insensitivity, enhanced resistance to pathogens, enhanced resistance to insects, enhanced fiber yield, enhanced fiber quality, or combinations thereof.

Description

TITLEGENOME EDITING OF PLANT JAZ GENES FOR PATHOGEN RESISTANCE AND IMPROVED FIBER QUALITY AND YIELDCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 536,317, filed on September 1, 2023. The entirety of the aforementioned application is incorporated herein by reference.SEQUENCE DISCLOSURE STATEMENT

[0002] Pursuant to 37 C.F.R. § 1.834, Applicant has submitted a sequence listing in XML format (“Sequence Listing”). The name of the file containing the Sequence Listing is “AF13368.P055WO.xml”. The date of the creation of the Sequence Listing is September 2, 2024. The size of the Sequence Listing is 99,000 bytes. Applicant hereby incorporates by reference the material in the Sequence Listing.BACKGROUND

[0003] Infestation of plants and seeds by pathogens and insects remains a significant problem in agriculture. Numerous embodiments of the present disclosure aim to address the aforementioned need.SUMMARY

[0004] In some embodiments, the present disclosure pertains to a plant or seed that includes one or more altered JASMONATE-ZIM DOMAIN repressor (JAZ) genes. Additional embodiments of the present disclosure pertain to methods of altering one or more JAZ genes of a plant or seed by introducing one or more alterations to the one or more JAZ genes of the plant or seed.

[0005] The plants and seeds of the present disclosure may include various altered JAZ genes. Additionally, the methods of the present disclosure may alter various JAZ genes. For instance, in some embodiments, the one or more altered JAZ genes includes, without limitation, JAZ 7, JAZ 2. JAZ 3, JAZ 4, JAZ 5, JAZ 6, JAZ 7, JAZ 8, JAZ 9, JAZ 10, JAZ 11, JAZ 12, JAZ 13, JAZ 14, JAZ 15, JAZ 16, JAZ 17, JAZ 18, JAZ 19, JAZ 20, JAZ 21, JAZ 22, JAZ 23, JAZ 24, JAZ 25, JAZ 26, JAZ 27, JAZ 28, JAZ 29, JAZ 30, JAZ 31, JAZ 32, homologues thereof, or combinations thereof.

[0006] Various methods may be utilized to alter JAZ genes of a plant or seed. For instance in some embodiments, the introduction of the alterations occurs by a method that includes, without limitation, chemical mutation, site directed mutagenesis, irradiation, introduction of a gene editing system, or combinations thereof. In some embodiments, the introduction of the alterations includes introduction of a gene editing system. In some embodiments, the altered JAZ genes are produced by a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas nuclease (Cas) system (CRISPR / Cas system).

[0007] The altered plants and seeds of the present disclosure may be derived from various species. For instance, in some embodiments, the plants or seeds include, without limitation, cotton, com, maize, rice, soybean, wheat, N. benthamiana, Arabidopsis, tobacco, tomato, lettuce, common beans, potato, grapes, varieties thereof, or combinations thereof.

[0008] In some embodiments, the altered plants and seeds of the present disclosure exhibit one or more altered properties. In some embodiments, the altered properties include, without limitation, jasmonic acid (JA) insensitivity, enhanced resistance to pathogens, enhanced resistance to insects, enhanced fiber yield, enhanced fiber quality, or combinations thereof.DRAWINGS

[0009] FIGS. 1A-1D provide the status of 17 month-old Coker 312 embryos and regenerated plantlets from test CRISPR vectors, including sgRNA3 (FIG. 1A), sgRNA2 (FIG. IB), sgRNAl (FIG. 1C). FIG. ID shows results from a 10 month-old sgRNA4 embryogenic callus; transformation experiment.

[0010] FIGS. 2A-2B show regenerated transgenic plantlets from a test vector CR1 construct. Shown are multiple embryos at germination stage (FIG. 2A) and plantlet development after rooting stage in vitro (FIG. 2B).

[0011] FIG. 3 shows multiple embryos germinating from a vector construct CR2 JAZ-gRNA-set2.

[0012] FIG. 4 shows embryos germinating from a vector construct CR3 JAZ-gRNA-set3.

[0013] FIG. 5 shows embryogenic calli formation from a vector CR4 JAZ-gRNA-set4.

[0014] FIGS. 6A-6D show stages of empty vector control using CR5 regenerant development. FIG. 6A shows initial plant elongation in vitro. FIG. 6B shows elongated / rooted ex vitro acclimation. FIGS. 6C-6D show plants in the greenhouse for T1 seed production. There are 13 independent event regenerated plants.

[0015] FIG. 7 shows the T-DNA restriction map of the binary vector p201N-gRNA-cas9 engineered to express four synthetic guide RNAs to increase throughput by pairwise targeting the nearest homologue JAZ family member. gRNA: guide RNAs of four different sequences #1, 2, 3, 4.DETAILED DESCRIPTION

[0016] It is to be understood that both the foregoing general description and the following detailed description are illustrative and explanatory, and are not restrictive of the subject matter, as claimed. In this application, the use of the singular includes the plural, the word “a” or “an” means “at least one”, and the use of “or” means “and / or”, unless specifically stated otherwise. Furthermore, the use of the term “including”, as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements or components comprising one unit and elements or components that include more than one unit unless specifically stated otherwise.

[0017] The section headings used herein are for organizational purposes and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated herein by reference in their entirety for any purpose. In the event that one or more of the incorporated literature and similar materials defines a term in a manner that contradicts the definition of that term in this application, this application controls.

[0018] Infestation of plants and seeds by pathogens and insects remains a significant problem in agriculture. Moreover, current methods and systems of countering such infestations remain limited (e.g., Rock CD, Adhikari IP, Parajulee MN: JAZ genes in cotton: prospects for improvements to vegetative and fibre growth by addressing lepidoptcran herbivory resistance mechanisms. Annual Plant Reviews Online 2024, 7: 49-104). Additionally, many insects and pathogens have developed resistance against pesticides.

[0019] For instance, since its release in 2017, the third-generation stacked commercial Bt trait is increasingly under severe pressure for evolution of Helicoverpa (bollworm) resistance. Regional differences in efficacy of Bollgard®3 against lepidopteran pests, invasion of North America by Old World Bt-resistant H. armigera and increasing pesticide use are emerging issues (e.g., Kriticos DJ, Ota N, Hutchison WD, Beddow J, Walsh T, Tay WT, Borchert DM, Paula-Moreas SV, Czepak C, Zalucki MP: The potential distribution of invading Helicoverpa armigera in North America: Is it just a matter of time? PLoS ONE 2015, 10:e0119618). Future catastrophic bollworm infestations are likely across the Cotton Belt. As such, new approaches to bollworm resistance are warranted.

[0020] In sum, current methods and systems for countering infestation of plants and seeds with pathogens remain limited. Numerous embodiments of the present disclosure aim to address the aforementioned need.

[0021] In some embodiments, the present disclosure pertains to a plant or seed that includes one or more altered JASMONATE-ZIM DOMAIN repressor (JAZ) genes. Additional embodiments of the present disclosure pertain to methods of altering one or more JAZ genes of a plant or seed. In some embodiments, the method includes introducing one or more alterations to the one or more JAZ genes of the plant or seed. As set forth in more detail herein, the plants, seeds and methods of the present disclosure can include numerous variations.

[0022] Altered JAZ genes

[0023] The plants and seeds of the present disclosure may include various altered JAZ genes. Additionally, the methods of the present disclosure may alter various JAZ genes. For instance, in some embodiments, the one or more altered JAZ genes includes, without limitation, JAZ 1, JAZ 2, JAZ 3, JAZ 4, JAZ 5, JAZ 6, JAZ 7, JAZ 8, JAZ 9, JAZ 10, JAZ 11, JAZ 12, JAZ 13, JAZ 14, JAZ 15, JAZ 16, JAZ 17, JAZ 18, JAZ 19, JAZ 20, JAZ 21, JAZ 22, JAZ 23, JAZ 24, JAZ 25, JAZ 26, JAZ 27, JAZ 28, JAZ 29, JAZ 30, JAZ 31, JAZ 32, homologues thereof, or combinations thereof. In some embodiments, the one or more altered JAZ genes includes, without limitation, JAZ 5, JAZ 20, JAZ 10, JAZ 2, JAZ 12, JAZ 26, JAZ 7, JAZ 22, JAZ 15, JAZ 29, JAZ 1, JAZ 17, JAZ 4, JAZ 19, JAZ 31, JAZ 32, JAZ 6, JAZ 21, JAZ 11, JAZ 25, JAZ 3, JAZ 18, JAZ 9, JAZ 23, JAZ 16, JAZ 30, JAZ 8, JAZ 24, JAZ 13, JAZ 27, JAZ 14, JAZ 28, homologues thereof, or combinations thereof.

[0024] In some embodiments, the altered JAZ genes include one or more deletions of amino acid residues, mutations, open reading frame disruptions, open reading frame deletions, altered primary transcript splicing events, or combinations thereof. In some embodiments, the altered JAZ genes include one or more alterations on a C-terminal Jas motif. In some embodiments, the altered JAZ genes include one or more alterations on structure and / or expression of a C-terminal Jas motif. In some embodiments, the altered JAZ genes include one or more deletions on a C-terminal Jas motif.

[0025] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 1 gene. In some embodiments, the altered JAZ 1 gene is derived from SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 1. In some embodiments, the altered JAZ 1 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 1.

[0026] In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 33. In some embodiments, the altered JAZ 1 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 33.

[0027] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 2 gene. In some embodiments, the altered JAZ 2 gene is derived from SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 2. In some embodiments, the altered JAZ 2 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 2.

[0028] In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 34. In some embodiments, the altered JAZ 2 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 34.

[0029] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 3 gene. In some embodiments, the altered JAZ 3 gene is derived from SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 3. In some embodiments, the altered JAZ 3 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 3.

[0030] In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 35. In some embodiments, the altered JAZ 3 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 35.

[0031] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 4 gene. In some embodiments, the altered JAZ 4 gene is derived from SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 4. In some embodiments, the altered JAZ 4 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 4.

[0032] In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 36. In some embodiments, the altered JAZ 4 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 36.

[0033] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 5 gene. In some embodiments, the altered JAZ 5 gene is derived from SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 5. In some embodiments, the altered JAZ 5 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 5.

[0034] In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 37. In some embodiments, the altered JAZ 5 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 37.

[0035] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 6 gene. In some embodiments, the altered JAZ 6 gene is derived from SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 6. In some embodiments, the altered JAZ 6 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 6.

[0036] In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 38. In some embodiments, the altered JAZ 6 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 38.

[0037] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 7 gene. In some embodiments, the altered JAZ 7 gene is derived from SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 7. In some embodiments, the altered JAZ 7 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 7.

[0038] In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 39. In some embodiments, the altered JAZ 7 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 39.

[0039] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 8 gene. In some embodiments, the altered JAZ 8 gene is derived from SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 8. In some embodiments, the altered JAZ 8 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 8.

[0040] In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 40. In some embodiments, the altered JAZ 8 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 40.

[0041] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 9 gene. In some embodiments, the altered JAZ 9 gene is derived from SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 9. In some embodiments, the altered JAZ 9 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 9.

[0042] In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 41. In some embodiments, the altered JAZ 9 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 41.

[0043] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 10 gene. In some embodiments, the altered JAZ 10 gene is derived from SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 10. In some embodiments, the altered JAZ 10 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 10.

[0044] In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 42. In some embodiments, the altered JAZ 10 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 42.

[0045] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 11 gene. In some embodiments, the altered JAZ 11 gene is derived from SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 11. In some embodiments, the altered JAZ 11 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 11.

[0046] In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 43. In some embodiments, the altered JAZ 11 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 43.

[0047] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 12 gene. In some embodiments, the altered JAZ 12 gene is derived from SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 12. In some embodiments, the altered JAZ 12 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 12.

[0048] In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 44. In some embodiments, the altered JAZ 12 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 44.

[0049] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 13 gene. In some embodiments, the altered JAZ 13 gene is derived from SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 13. In some embodiments, the altered JAZ 13 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 13.

[0050] In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 45. In some embodiments, the altered JAZ 13 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 45.

[0051] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 14 gene. In some embodiments, the altered JAZ 14 gene is derived from SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 14. In some embodiments, the altered JAZ 14 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 14.

[0052] In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 46. In some embodiments, the altered JAZ 14 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 46.

[0053] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 15 gene. In some embodiments, the altered JAZ 15 gene is derived from SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 15. In some embodiments, the altered JAZ 15 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 15.

[0054] In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 47. In some embodiments, the altered JAZ 15 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 47.

[0055] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 16 gene. In some embodiments, the altered JAZ 16 gene is derived from SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 16. In some embodiments, the altered JAZ 16 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 16.

[0056] In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 48. In some embodiments, the altered JAZ 16 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 48.

[0057] In some embodiments, the one or more altered JAZ genes includes an altered JAZ J 7 gene. In some embodiments, the altered JAZ 17 gene is derived from SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 17. In some embodiments, the altered JAZ 17 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 17.

[0058] In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 49. In some embodiments, the altered JAZ 17 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 49.

[0059] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 18 gene. In some embodiments, the altered JAZ 18 gene is derived from SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 18. In some embodiments, the altered JAZ 18 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 18.

[0060] In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 50. In some embodiments, the altered JAZ 18 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 50.

[0061] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 19 gene. In some embodiments, the altered JAZ 19 gene is derived from SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 19. In some embodiments, the altered JAZ 19 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 19.

[0062] In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 51. In some embodiments, the altered JAZ 19 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 51.

[0063] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 20 gene. In some embodiments, the altered JAZ 20 gene is derived from SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 20. In some embodiments, the altered JAZ 20 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 20.

[0064] In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 52. In some embodiments, the altered JAZ 20 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 52.

[0065] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 21 gene. In some embodiments, the altered JAZ 21 gene is derived from SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 21. In some embodiments, the altered JAZ 21 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 21.

[0066] In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 53. In some embodiments, the altered JAZ 21 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 53.

[0067] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 22 gene. In some embodiments, the altered JAZ 22 gene is derived from SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 22. In some embodiments, the altered JAZ 22 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 22.

[0068] In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 54. In some embodiments, the altered JAZ 22 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 54.

[0069] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 23 gene. In some embodiments, the altered JAZ 23 gene is derived from SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 23. In some embodiments, the altered JAZ 23 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 23.

[0070] In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 55. In some embodiments, the altered JAZ 23 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 55.

[0071] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 24 gene. In some embodiments, the altered JAZ 24 gene is derived from SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 24. In some embodiments, the altered JAZ 24 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 24.

[0072] In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 56. In some embodiments, the altered JAZ 24 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 56.

[0073] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 25 gene. In some embodiments, the altered JAZ 25 gene is derived from SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 25. In some embodiments, the altered JAZ 25 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 25.

[0074] In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 57. In some embodiments, the altered JAZ 25 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 57.

[0075] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 26 gene. In some embodiments, the altered JAZ 26 gene is derived from SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 26. In some embodiments, the altered JAZ 26 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 26.

[0076] In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 58. In some embodiments, the altered JAZ 26 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 58.

[0077] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 27 gene. In some embodiments, the altered JAZ 27 gene is derived from SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 27. In some embodiments, the altered JAZ 27 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 27.

[0078] In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 59. In some embodiments, the altered JAZ 27 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 59.

[0079] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 28 gene. In some embodiments, the altered JAZ 28 gene is derived from SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 28. In some embodiments, the altered JAZ 28 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 28.

[0080] In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 60. In some embodiments, the altered JAZ 28 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 60.

[0081] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 29 gene. In some embodiments, the altered JAZ 29 gene is derived from SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 29. In some embodiments, the altered JAZ 29 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 29.

[0082] In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 61. In some embodiments, the altered JAZ 29 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 61.

[0083] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 30 gene. In some embodiments, the altered JAZ 30 gene is derived from SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 30. In some embodiments, the altered JAZ 30 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 30.

[0084] In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 62. In some embodiments, the altered JAZ 30 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 62.

[0085] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 31 gene. In some embodiments, the altered JAZ 31 gene is derived from SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 31. In some embodiments, the altered JAZ 31 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 31.

[0086] In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 63. In some embodiments, the altered JAZ 31 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 63.

[0087] In some embodiments, the one or more altered JAZ genes includes an altered JAZ 32 gene. In some embodiments, the altered JAZ 32 gene is derived from SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 99% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 95% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 90% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 85% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 80% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 75% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 70% sequence identity to SEQ ID NO: 32. In some embodiments, the altered JAZ 32 gene is derived from a sequence with at least 65% sequence identity to SEQ ID NO: 32.

[0088] In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide of SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 99% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 95% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 85% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 80% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 75% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 70% sequence identity to SEQ ID NO: 64. In some embodiments, the altered JAZ 32 gene is derived from a gene encoding a polypeptide with at least 65% sequence identity to SEQ ID NO: 64.

[0089] Alteration of JAZ genes[00901 Alteration of JAZ genes may occur at various stages of a plant or seed. For instance, in some embodiments, the introduction of the alterations occurs at a seedling stage of a plant. In some embodiments, the introduction of the alterations occurs within cells of somatic embryos of a plant. In some embodiments, the introduction occurs in tissue culture prior to somatic embryo development and subsequent germination into seedlings. In some embodiments, the introduction of the alterations occurs at an adult stage of a plant.

[0091] Various methods may be utilized to alter JAZ genes of a plant or seed. For instance in some embodiments, the introduction of the alterations occurs by a method that includes, without limitation, chemical mutation, site directed mutagenesis, irradiation, introduction of a gene editing system, or combinations thereof. In some embodiments, the introduction of the alterations includes introduction of a gene editing system.

[0092] In some embodiments, the altered JAZ genes are produced by a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas nuclease (Cas) system (CRISPR / Cas system). (E.g. , as described in Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E: A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337:816-821). In some embodiments, the CRISPR / Cas system includes at least one Cas nuclease and at least one guide RNA. In some embodiments, the Cas nuclease includes, without limitation, class 2 of Cas nucleases, Cas 9, Cas , Casd>2, Cpfl, or combinations thereof. In some embodiments, the altered JAZ genes are produced by a CRISPR / Cas9 system.

[0093] Altered plants and seeds

[0094] The altered plants and seeds of the present disclosure may be derived from various species. For instance, in some embodiments, the plants or seeds include, without limitation, cotton, com, maize, rice, soybean, wheat, N. benthamiana, Arabidopsis, tobacco, tomato, lettuce, common beans, potato, grapes, varieties thereof, or combinations thereof. In some embodiments, the plants or seeds include cotton.

[0095] In some embodiments, the altered plants or seeds of the present disclosure include a plant deposited under NCIMB No. . In some embodiments, the altered plants or seeds of the present disclosure include a cotton plant, seed, or plant pail of a cotton cultivar where a representative sample of the plant was deposited under NCIMB No. .

[0096] In some embodiments, the altered plants and seeds of the present disclosure exhibit one or more altered properties. In some embodiments, the altered properties include, without limitation, jasmonic acid (JA) insensitivity, enhanced resistance to pathogens, enhanced resistance to insects, enhanced fiber yield, enhanced fiber quality, or combinations thereof.

[0097] In some embodiments, the altered plant or seed includes cotton. In some embodiments, the altered cotton demonstrates enhanced cotton fiber quality. In some embodiments, the altered cotton demonstrates enhanced cotton fiber yield.

[0098] In some embodiments, the altered properties include enhanced resistance to insects. In some embodiments, the insects include, without limitation, arthropod pests, arthropod herbivores, USDA APHIS National Priority and Federal Program pests Oxycarenus hyalinipennis (cotton seed bug), Spodoptera litura (cotton leafworm), Thaumatotibia leucotreta (false codling moth), pink bollworm Pectinophora gossypiella, bollworms, boll weevil Anthonomus grandis, com ear worms, fall armyworm Spodoptera frugiperda, Lepidopteran herbivory, Helicoverpa zea, Helicoverpa armigera, or combinations thereof.

[0099] Additional Embodiments

[0100] Reference will now be made to more specific embodiments of the present disclosure and experimental results that provide support for such embodiments. However, Applicant notes that the disclosure below is for illustrative purposes only and is not intended to limit the scope of the claimed subject matter in any way.

[0101] Example 1. CRISPR-Cas9 genome editing of cotton JAZ genes for Helicoverpa zea andH. armigera herbivory resistance

[0102] Identification and functional significance of lepidopteran herbivory resistance genes to date is limited to the model plant Arabidopsis . However, the evidence is compelling that orthologous cotton JAZ genes, as evolutionarily conserved resistance effectors, if subjected to genome-editing, can work to create practical herbivory resistance alleles for adoption in elite breeding programs (e.g., Chen C-Y, Liu Y-Q, Song W-M, Chen D-Y, Chen F-Y, Chen X-Y, Chen Z-W, Ge S-X, Wang C-Z, Zhan S et al'. An effector from cotton bollworm oral secretion impairs host plant defense signaling. Proc Natl Acad Sci USA 2019, 116: 14331-14338; Sun H, Chen L, Li J, Hu M, Ullah A, He X, Yang X, Zhang X: The JASMONATEZIM-domain gene family mediates JA signaling and stress response in cotton. Plant Cell Physiol 2017, 58:2139-2154; Li W, Xia X- C, Han L-H, Ni P, Yan J-Q, Tao M, Huang G-Q, Li X-B: Genome-wide identification and characterization of JAZ gene family in upland cotton (Gossypium hirsuium). Sci Rep 2017, 7 : 2788. DOI: 10.1038 / s41598-017-03155-4; Garrido-Bigotes A, Valenzuela-Riffo F, Figueroa CR: Evolutionary analysis of JAZ proteins in plants: an approach in search of the ancestral sequence. hit J Mol Sci 2019, 20:5060).

[0103] In fact, plants have evolved complex non-linear signal transduction networks involving cross-regulation of endogenous hormonal (e.g., jasmonic acid, a pest resistance effector) and environmental stress response pathways. In particular, plants have a deeply conserved defense response to pests: Jasmonic acid (JA) hormone signaling mediated by transcriptional repressors called JASMONATE-ZIM-DOMAIN / JAZ (e.g.. Chini A, Fonseca S, Chico JM, Fernandez-Calvo P, Solano R: The ZIM domain mediates homo- and heteromeric interactions between Arabidopsis JAZ proteins. Plant J 2009, 59:77-87).

[0104] Prior work teaches that deleting or disrupting the Jas motif of JAZ genes results in JA insensitivity and increased resistance to pathogens, including arthropod herbivores (e.g., Guo Q, Yoshida Y, Major IT, Wang K, Sugimoto K, Kapali G, Havko NE, Benning C, Howe GA: JAZ repressors of metabolic defense promote growth and reproductive fitness in Arabidopsis. Proc Natl Acad Sci USA 2018, 115:E10768-E10777; Zhang L, Yao J, Withers J, Xin X-F, Banerjee R, Fariduddin Q, Nakamura Y, Nomura K, Howe GA, Boland W et al: Host target modification as a strategy to counter pathogen hijacking of the jasmonate hormone receptor. Proc Natl Acad Sci USA 2015, 112:14354-14359).

[0105] Therefore Applicant has employed Clustered Regularly Interspaced Short Palindromic Repeats / Cas9 (CRISPR) technology to disrupt the Jas motif of all 32 pairwise upland cotton JAZ family members in four parallel ongoing experiments (e.g. , Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E: A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337:816-821). This genome- wide approach is practical because the 32 JAZ paralogues in tetrapioid cotton can be targeted in subfamily gene octets by four synthetic guide vector constructs, each with eight A+D genome targets.

[0106] The JAZ-Jas knockout lines can be characterized early in the regeneration process at the molecular level for Jas motif mutant alleles, then for JA accumulation and exogenous JA- inducibility of JAZ transcripts. Transgenic events available can be assayed for feeding preference and insect performance by laboratory and greenhouse assays with H. zea.

[0107] A central component of JA signaling is the gene product CORONATINE INSENSITIVE1 / COI1, which is the F-box subunit of SCFCOI1, a member of the Skip / Cullin / F- box (SCF) family of multi-protein E3 ubiquitin ligases involved in targeted proteolysis of JAZs (e.g., Xie D-X, Feys BF, James S, Nieto-Rostro M, Turner JG: COU An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 1998, 280: 1091-1094). The cognate substrates of SCFCOI1 are members of the JAZ family, which function as hetero- and homodimers through ZIM / TIFY domain interactions (e.g., Chini A, Fonseca S, Chico JM, Fernandez- Calvo P, Solano R: The ZIM domain mediates homo- and heteromeric interactions between Arabidopsis JAZ proteins. Plant J 2009, 59:77-87). On the other hand, the canonical “degron” sequence EPIAR of the C-tcrminal JAZ-Jas motif, like the co-rcccptor COI1, is highly conserved along the evolutionary scale from lower to flowering plants. Gene structures and phylogenetic ordering of 32 Gossypium hirsutum JAZs cluster into six groups (e.g., Monte I, Ishida S, Zamarreno AM, Hamberg M, Franco-Zorrilla JM, Garcfa-Casado G, Gouhier-Darimont C, Reymond P, Takahashi K, Garcia-Mina JM et al: Eigand-receptor co-evolution shaped the jasmonate pathway in land plants. Nat Chem Biol 2018, 14:480-488; Garrido-Bigotes A, Valenzuela- Riffo F, Figueroa CR: Evolutionary analysis of JAZ proteins in plants: an approach in search of the ancestral sequence. Int J Mol Sci 2019, 20:5060; Sun H, Chen E, Ei J, Hu M, Ullah A, He X, Yang X, Zhang X: The JASMONATE ZIM-domain gene family mediates JA signaling and stress response in cotton. Plant Cell Physiol 2017, 58:2139-2154; Li W, Xia X-C, Han L-H, Ni P, Yan J-Q, Tao M, Huang G-Q, Li X-B: Genome-wide identification and characterization of JAZ gene family in upland cotton Gossypium hirsutum). Sci Rep 2017, 7: 2788. DOI: 10.1038 / s41598-017-03155-4).

[0108] CRISPR genome-edited transgenic Gossypium hirsutum lines can be generated and directed to genome-wide deletions in the C-terminal Jas motif of all 32 JAZ genes. FIGS. 1A-1D show current status of transgenic regenerants.

[0109] Additionally, Applicant has been successful in using binary plasmid p201N-cas9 to engineer recombinant synthetic guide CRISPR vectors to genome edit the grapevine genome (e.g., Jacobs T, LaFayette P, Schmitz R, Parrott W: Targeted genome modifications in soybean with CRISPR / Cas9. BMC Biotechnology 2015, 15:16). Table 1 shows the best guide targets for the Jas motif of all G. hirsutum JAZ loci, predicted using the online tool CRISPR-P 2.0 (e.g., Lei Y, Lu L, Liu H-Y, Li S, Xing F, Chen L-L: CRISPR-P: A web tool for synthetic single-guide RNA design of CRISPR-system in plants.” Mol Plant, 2014, 7(9): 1494-1496. doi: 10.1093 / mp / ssu044).Phytozo Guide sequence, incl. PAM Sun et «Z.r|[ sgRN Perfect allo-homologue target; mel3 subgroup A (microhomol score); predicted off“Gohir. group targets; allohomologue” ID*D06G07 TTCTCTTCTCAAGGAACCGGT JAZ2 (I) 1 JAZ10 (0.4137); 41 A06G0787500 GG (SEQ ID NO: 65) 400D08G26 TCAACAGCTAAACCGAGCCA JAZ26 (I)&1 JAZ12 (0.7545); 51 A08G2467400 CGG (SEQ ID NO: 66) 300D05G03 GGACAGGGAAGGAGCTGCAG JAZ20 (I)&1 JAZ5 (0.4806); 70 A05G0346200 CGG (SEQ ID NO: 67) 800A10G05 TACCAACTGATCAACCACCA JAZ15 (II)&1 JAZ29 (0.3684); 109 D10G0576000 AGG (SEQ ID NO: 68) 900A05G13 TGAAAACAAATCATCTCACG JAZ7 (II)&2 JAZ22 (0.4957); 228 D05G1419000 AGG (SEQ ID NO: 69) 200A01G02 CCGTTGTAAAAAATCGTCAA JAZ1 (III) 2 JAZ17 (0.5625); 72 D01G0191000 CGG (SEQ ID NO: 70) 500A03G15 ATGCAGATTTGCCAATCGCC JAZ4 (III)® 2 JAZ19 (0.4676); 19 D02G1741500 CGG (SEQ ID NO: 71 ) 500A01G18 ACCCAATCAACAACAAGCCG JAZ32 (III)&2 1 mm JAZ31 (0.63); 67 D01G1743201* TGG (SEQ ID NO: 72) 350*D07G01 TGGTCCATCAACACCAAAAA JAZ25 (IV)&3 JAZ11 (0.4393); 412 A07G0188200 TGG (SEQ ID NO: 73) 400D05G03 CTTCTCAAAAAATCGCTGAA JAZ21 (IV) 3 JAZ8A(0.5161); 108 A05G1479000 GGG (SEQ ID NO: 74) 700A05G03 SEQ ID NO: 74 JAZ6 (IV) 3 JAZ8A(0.5161); 1087500A05G14 CCATGAAGAGATCGCTTCAA JAZ8 (VI) 3 JAZ24$(0.5971); 105 D05G1507700 CGG (SEQ ID NO: 75) 200A10G04 ATGAACGACTAAGGACTCCG JAZ14 (VI)&3 JAZ28$(0.6903); 22 D10G0421900 AGG (SEQ ID NO: 76) 800D09G07 TTAGGGCTACATAATCGAGA JAZ27 (VI)&4 JAZ13 (0.7755); 65 A09G0777300 CGG (SEQ ID NO: 77) 300A12G27 TTATGCCATCAGATGCAAGA JAZ16 (V)&4 JAZ30 (0.6756); 91 D12G2700200 GGG (SEQ ID NO: 78) 600A01G14 CTTCTCCAAAAACCGAGCCA JAZ3 (V)® 4 JAZ18 (0.4822); 275 D01G1418700 AGG (SEQ ID NO: 79) 300A05G30 SEQ ID NO: 79 JAZ9 (V) 4 JAZ3 / 18 (0.4822); 2899100D05G30 CTTCTCCAAAAACCAAGCCA JAZ23 (V) 4 1mm JAZ3 / 9 / 18, 2 mm JAZ30(0. 9900 AGG (SEQ ID NO: 80) 5); 380+G. hirsutum v2.1, https: / / phytozoroe-irext.jgLdoe.gov / I Sun H, Chen L, Li J, Hu M, Ullah A, He X, Yang X, Zhang X. “The JASMONATE ZIM-domain gene family mediates JA signaling and stress response in cotton.” Plant Cell Physiol 2017, 58:2139-2154.&3’ composite target downstream flanking Jas intron; ® 5’ composite upstream of Jas* no Jas motif; stop codon in exon4 (Jas motif in exons5 / 6). Guides directed to conserved ZIM domain, aa 73-106A2 mismatches (mm) JAZ11 / 25;$1 mm last nt. JAZ14 / 28, JAZ8 / 24Table 1. Synthetic guide sequences designed for CRISPR editing of the Jas motif of all 32 GhJAZ genes. Prioritized candidates were chosen based on dearth of canonical off targets, and higher seed microhomology scores. Underlined guide residues confer specificity versus other near homologue targets.

[0110] Synthetic oligonucleotides have been synthesized that overlap with the U6 promoter sequence in p201N-cas9 to yield p201N-gRNA-cas9 binary vectors using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). Applicant has successfully fused four sgRNAs in a binary vector to target eight JAZ genes simultaneously (Table 1; FIG. 7).

[0111] After Coker312 somatic embryogenesis from Agrobacterium co-cultivation and plant regeneration (FIGS. 1A-1D), the events can be subjected to molecular’ analysis to confirm the T- DNA integration e.g., Umbeck P, Johnson G, Barton K, Swain W: Genetically transformed cotton (Gossypium hirsutum L.) plants. Bio / Technology 1987, 5:263-266; Firoozabady E, Deboer DL, Merlo DJ, Halk EL, Amerson LN, Rashka KE, Murray EE: Transformation of cotton (Gossypium hirsutum L.) by Agrobacterium tumefaciens and regeneration of transgenic plants. Plant Molecular Biology 1987, 10: 105-116).FIGS. 1A-1D show recent images of regenerated transgenic plantlets in process. The existence of viable regenerants for guide sets CR1 and CR2 at this stage is evidence several candidate targets are non-lethal when mutated.

[0112] FIGS. 2A-2B and 3 show multiple embryos in germination phase from experiment #2 test vectors CR1 and CR2 guide sets #1 and #2, respectively, corresponding to targets of gene structural groups I, II and III (e.g., Sun H, Chen L, Li J, Hu M, Ullah A, He X, Yang X, Zhang X: The JASMONATE ZIM-domain gene family mediates JA signaling and stress response in cotton. Plant Cell Physiol 2017, 58:2139-2154).

[0113] FIG. 4 shows second temporal transformation experiments with test vector construct CR3, JAZ gene structural subgroups IV and VI, on embryo format on media. FIG. 5 shows embryogenic calli formation from a vector CR4 JAZ-gRNA-set4.

[0114] FIGS. 6A-6D show stages of empty vector control using CR5 regenerant development. FIG. 6A shows initial plant elongation in vitro. FIG. 6B shows elongated / rooted ex vitro acclimation. FIGS. 6C-6D show plants in the greenhouse for T1 seed production. There are 13 independent CR5 vector regenerated events producing seeds that serve as negative controls for functional characterization of CR1- CR4 gRNA guide sets 1-4 regenerant events.

[0115] Without further elaboration, it is believed that one skilled in the art can, using the description herein, utilize the present disclosure to its fullest extent. The embodiments described herein are to be construed as illustrative and not as constraining the remainder of the disclosure in any way whatsoever. While the embodiments have been shown and described, many variations and modifications thereof can be made by one skilled in the art without departing from the spirit and teachings of the invention. Accordingly, the scope of protection is not limited by the description set out above, but is only limited by the claims, including all equivalents of the subject matter of the claims. The disclosures of all patents, patent applications and publications cited herein are hereby incorporated herein by reference, to the extent that they provide procedural or other details consistent with and supplementary to those set forth herein.

Claims

WHAT IS CLAIMED IS:

1. A plant or seed comprising one or more altered JASMONATE-ZIM DOMAIN repressor (JAZ) genes.

2. The plant or seed of claim 1, wherein the one or more altered JAZ genes is selected from the group consisting of JAZ 7, JAZ 2, JAZ 3, JAZ 4, JAZ 5, JAZ 6, JAZ 7, JAZ 8, JAZ 9, JAZ 10, JAZ 11, JAZ 12, JAZ 13, JAZ 14, JAZ 15, JAZ 16, JAZ 17, JAZ 18, JAZ 19, JAZ 20, JAZ 21, JAZ 22, JAZ 23, JAZ 24, JAZ 25, JAZ 26, JAZ 27, JAZ 28, JAZ 29, JAZ 30, JAZ 31, JAZ 32, homologues thereof, or combinations thereof.

3. The plant or seed of claim 1, wherein the one or more altered JAZ genes comprises one or more alterations on a C-terminal Jas motif.

4. The plant or seed of claim 1, wherein the one or more altered JAZ genes comprises one or more deletions, one or more mutations, one or more open reading frame disruptions, one or more open reading frame deletions of amino acid residues, one or more altered primary transcript splicing events, or combinations thereof.

5. The plant or seed of claim 1, wherein the plant or seed exhibits one or more altered properties.

6. The plant or seed of claim 5, wherein the one or more altered properties are selected from the group consisting of jasmonic acid (JA) insensitivity, enhanced resistance to pathogens, enhanced resistance to insects, enhanced fiber yield, enhanced fiber quality, or combinations thereof.

7. The plant or seed of claim 5, wherein the one or more altered properties comprises enhanced resistance to insects.

8. The plant or seed of claim 7, wherein the insects are selected from the group consisting of arthropod pests, arthropod herbivores Oxycarenus hyalinipennis (cotton seed bug), Spodoptera litura (cotton leafworm), Thaumatotibia leucotreta (false codling moth), pink boll worm Pectinophora gossypiella, bollworms, boll weevil Anthonomus grandis, com ear worms, fall armyworm Spodoptera frugiperda, Lepidopteran herbivory, Helicoverpa zea, Helicoverpa armigera, or combinations thereof.

9. The plant or seed of claim 1, wherein the plant or seed is selected from the group consisting of cotton, com, maize, rice, soybean, wheat, N. benthamiana, Arabidopsis, tobacco, tomato, lettuce, common beans, potato, grapes, varieties thereof, or combinations thereof.

10. The plant or seed of claim 1, wherein the plant or seed comprises cotton.

11. The plant or seed of claim 10, wherein the cotton demonstrates enhanced cotton fiber quality.

12. The plant or seed of claim 10, wherein the cotton demonstrates enhanced cotton fiber yield.

13. A method of altering one or more JASMONATE-ZIM DOMAIN repressor (JAZ) genes of a plant or seed, wherein the method comprises: introducing one or more alterations to the one or more JAZ genes of the plant or seed.

14. The method of claim 13, wherein the one or more altered JAZ genes is selected from the group consisting of JAZ 1, JAZ 2, JAZ 3, JAZ 4, JAZ 5, JAZ 6, JAZ 7, JAZ 8, JAZ 9, JAZ 10, JAZ 11, JAZ 12, JAZ 13, JAZ 14, JAZ 15, JAZ 16, JAZ 17, JAZ 18, JAZ 19, JAZ 20, JAZ 21, JAZ 22, JAZ 23, JAZ 24, JAZ 25, JAZ 26, JAZ 27, JAZ 28, JAZ 29, JAZ 30, JAZ 31, JAZ 32, homologues thereof, or combinations thereof.

15. The method of claim 13, wherein the one or more alterations comprises one or more alterations on a C-terminal Jas motif of one or more JAZ genes.

16. The method of claim 13, wherein the one or more alterations comprises one or more deletions, one or more mutations, one or more open reading frame disruptions, one or more open reading frame deletions of amino acid residues, one or more altered primary transcript splicing events, or combinations thereof.

17. The method of claim 13, wherein the introduction of the one or more alterations occurs at a seedling stage of a plant.

18. The method of claim 13, wherein the introduction of the one or more alterations occurs within cells of somatic embryos of a plant.

19. The method of claim 18, wherein the introduction occurs in tissue culture prior to somatic embryo development and subsequent germination into seedlings.

20. The method of claim 13, wherein the introduction of the one or more alterations occurs at an adult stage of a plant.

21. The method of claim 13, wherein the introduction of the one or more alterations occurs by a method selected from the group consisting of chemical mutation, site directed mutagenesis, irradiation, introduction of a gene editing system, or combinations thereof.

22. The method of claim 13, wherein the introduction of the one or more alterations comprises introduction of a gene editing system.

23. The method of claim 22, wherein the gene editing system comprises a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas nuclease (Cas) system (CRISPR / Cas system) to the plant or seed, wherein the CRISPR / Cas system comprises at least one Cas nuclease and at least one guide RNA.

24. The method of claim 23, wherein the Cas nuclease is selected from the group consisting of class 2 of Cas nucleases, Cas 9, Cas . CasO2, Cpfl, or combinations thereof.

25. The method of claim 23, wherein the CRISPR / Cas system comprises a CRISPR / Cas9 system.

26. The method of claim 13, wherein the plant or seed exhibits one or more altered properties.

27. The method of claim 26, wherein the one or more altered properties are selected from the group consisting of jasmonic acid (JA) insensitivity, enhanced resistance to pathogens, enhanced resistance to insects, enhanced fiber yield, enhanced fiber quality, or combinations thereof.

28. The method of claim 26, wherein the one or more altered properties comprises enhanced resistance to insects.

29. The method of claim 28, wherein the insects are selected from the group consisting of arthropod pests, arthropod herbivores, Oxycarenus hyalinipennis (cotton seed bug), Spodoptera litura (cotton leafworm), Thaumatotibia leucotreta (false codling moth), pink bollworm Pectinophora gossypiella, bollworms, boll weevil Anthonomus grandis, corn ear worms, fall army worm Spodoptera frugiperda, Lepidopteran herbivory, Helicoverpa zea, Helicoverpa armigera, or combinations thereof.

30. The method of claim 13, wherein the plant or seed is selected from the group consisting of cotton, com, maize, rice, soybean, wheat, N. benthamiana, Arabidopsis, tobacco, tomato, lettuce, common beans, potato, grapes, varieties thereof, or combinations thereof.

31. The method of claim 13, wherein the plant or seed comprises cotton.

32. The method of claim 31, wherein the cotton demonstrates enhanced cotton fiber quality.

33. The method of claim 31, wherein the cotton demonstrates enhanced cotton fiber yield.

Images