Method for preparing stable isotope labeled ssdna by biological fermentation method

Abstract

The present invention relates to the technical field of DNA synthesis, and provides a method for preparing a stable isotope labeled single-stranded DNA (ssDNA) by a biological fermentation method. According to the method of the present invention, a target sequence of an ssDNA is repeatedly tandem to a high-copy-number vector, and a site of a first restriction enzyme and a site of a second restriction enzyme are respectively added at 5' and 3' ends of the target sequence, a recombinant vector is subjected to enzyme digestion to obtain an asymmetric double-stranded DNA structure, and then two ssDNAs having different lengths are obtained by means of denaturation and separation, wherein the two ssDNAs include a 15N- or 13C-labeled target ssDNA. The method of the present invention can effectively increase the yield of ssDNAs, thereby improving in-vitro synthesis efficiency of the ssDNAs. In addition, according to the present invention, a culture medium used to culture a host bacterium takes, as a unique nitrogen source, NH4Cl labeled by relatively cheap 15N, and / or 13C-labeled glucose as a unique carbon source, so that the synthesis costs can be effectively reduced.

Description

A method for preparing stable isotope-labeled ssDNA by biological fermentation

[0001] This application claims priority to a Chinese patent application filed with the Patent Office of China on September 7, 2023, with application number CN202311152733.2 and invention name “A method for preparing stable isotope-labeled ssDNA by biological fermentation”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The invention belongs to the technical field of DNA synthesis, and particularly relates to a method for preparing stable isotope-labeled ssDNA by a biological fermentation method. Background Art

[0003] Most DNA exists in a double-stranded form as a double helix, but once treated with heat or alkali, it will become a single-stranded state. Single-stranded DNA (ssDNA) refers to DNA that exists in a single-stranded state. ssDNA differs from double-stranded DNA (dsDNA) in terms of molecular fluid dynamics, absorption spectrum, base reaction properties, three-dimensional structure and function. It is worth noting that ssDNA can fold to form a three-dimensional structure and plays an important role in life processes. For example, the G-quadruplex structure is considered to be a potential target for anti-cancer drugs. Stable isotope-labeled ssDNA can facilitate the nuclear magnetic resonance analysis of the three-dimensional structure of ssDNA.

[0004] The current method for obtaining stable isotope-labeled ssDNA on the market is solid-phase synthesis, but this method is expensive. Synthesizing a 24nt, 1mg stable isotope-labeled ssDNA strand costs approximately 330,000 RMB. Furthermore, for samples with high GC content, the preparation process is prone to problems such as mismatches or secondary structures that hinder polymerase activity. Therefore, developing a universal method for preparing stable isotope-labeled ssDNA is an urgent challenge in this field.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to provide a method for preparing stable isotope labeled ssDNA by biological fermentation. The method of the present invention is a universal stable isotope 15 N and / or 13 The method of C labeling ssDNA can effectively improve 15 N and / or 13 C-labeled ssDNA in vitro synthesis efficiency and reduced synthesis costs.

[0007] The present invention provides a method for preparing stable isotope-labeled ssDNA by a biofermentation method, comprising the following steps:

[0008] 1) adding a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit;

[0009] The first restriction endonuclease and the second restriction endonuclease are two different restriction endonucleases;

[0010] 2) connecting the repeating units obtained in step 1) in series to obtain a fusion sequence;

[0011] 3) inserting the fusion sequence described in step 2) into a high-copy vector to obtain a recombinant vector;

[0012] 4) introducing the recombinant vector described in step 3) into a host bacterium to obtain a recombinant bacterium;

[0013] 5) After culturing the recombinant bacteria in step 4), extracting and purifying the recombinant vector in the recombinant bacteria; the culture medium used is 15 NH4Cl as the only nitrogen source and / or 13 C-glucose is the only carbon source;

[0014] 6) digesting the recombinant vector obtained in step 5) with a first restriction endonuclease and a second restriction endonuclease to obtain an asymmetric double-stranded DNA structure, and separating two ssDNAs of unequal lengths, one of the two ssDNAs being the target sequence;

[0015] 7) Recovering the target sequences in the two ssDNAs in step 6) to obtain stable isotope-labeled target ssDNA.

[0016] Preferably, in step 1), the first restriction endonuclease is KpnI and the second restriction endonuclease is BamHI;

[0017] Alternatively, the first restriction endonuclease is KpnI-HF and the second restriction endonuclease is BamHI-HF;

[0018] Alternatively, the first restriction endonuclease is Pst I-HF and the second restriction endonuclease is Hind III-HF;

[0019] Alternatively, the first restriction endonuclease is Kpn I-HF and the second restriction endonuclease is Hind III-HF.

[0020] Preferably, in step 6), the separation is performed by urea-denatured polyacrylamide gel electrophoresis.

[0021] Preferably, in step 6), the shorter of the two ssDNAs of unequal lengths is the target sequence.

[0022] Preferably, in the step 2), every 3 to 4 repeating units are connected in series to form a large repeating unit, and the large repeating units are further connected in series via a linker sequence.

[0023] Preferably, in step 2), the length of the fusion sequence is ≤2k.

[0024] Preferably, in step 3), the high copy vector includes pUC57.

[0025] Preferably, in step 1), the target sequence includes telomeric ssDNA, human promoter ssDNA or HIV ssDNA;

[0026] The nucleotide sequence of the telomeric ssDNA is shown in SEQ ID NO.1;

[0027] The nucleotide sequence of the human promoter ssDNA is shown in SEQ ID NO.2;

[0028] The nucleotide sequence of the HIV ssDNA is shown in SEQ ID NO.3.

[0029] Preferably, when the target sequence is telomeric ssDNA, the concatenation is 12 repeating units in series to obtain a fusion sequence;

[0030] When the target sequence is a human promoter ssDNA, the concatenation is a concatenation of 20 repeating units to obtain a fusion sequence;

[0031] When the target sequence is HIV ssDNA, the concatenation is 15 repeating units in series to obtain a fusion sequence.

[0032] Preferably, in the step 5), the culture medium 15 The concentration of NH4Cl is ≥1g / L; 13 The concentration of C-glucose is ≥4g / L.

[0033] Preferably, the step 7) further comprises: recovering another ssDNA except the target sequence.

[0034] The present invention provides a method for preparing stable isotope labeled ssDNA by biofermentation, wherein the target sequence of ssDNA is repeatedly connected in series on a high copy vector, and the site of the first restriction endonuclease and the site of the second restriction endonuclease are added to the 5' and 3' ends of the target sequence respectively. After enzyme digestion of the recombinant vector, an asymmetric double-stranded DNA structure can be obtained, and then two ssDNAs of different lengths can be separated, including 15 N and / or 13The target ssDNA is labeled with C. The method of the present invention can effectively increase the yield of ssDNA, thereby improving the efficiency of ssDNA synthesis in vitro. 15 NH4Cl as the only nitrogen source and / or 13 C-glucose is the only carbon source, which can effectively reduce the synthesis cost of stable isotope-labeled DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0036] Figure 1 shows the stable isotopes in Example 1 15 Schematic diagram of the principle of N-labeled telomeric ssDNA; A is the formation of plasmid pUC57-wtTel23c; B is the transformation of the constructed plasmid into DH5α E. coli cells for propagation; C is the DH5α E. coli cells transformed with pUC57-wtTel23c in 15 N-labeled NH4Cl was used as the sole nitrogen source in M9 medium to produce 15 N is the pUC57-wtTel23c plasmid; D is the pUC57-wtTel23c plasmid purified by treatment with restriction endonucleases KpnI and BamHI. 15 N-labeled pUC57-wtTel23c plasmid; F is the digestion product obtained in the form of asymmetric dsDNA; G is the further separation and purification of asymmetric dsDNA by urea-denatured polyacrylamide gel electrophoresis; H is the recovery and electroelution of target ssDNA to obtain target 15 N-labeled ssDNA;

[0037] Figure 2 15 Identification results of N-labeled wtTel23c; where A is 15 N-labeled wtTel23c 15 The mass spectrometry analysis results of the N labeling rate are shown in Figure 2. Reference is the reference ssDNA wtTel23c synthesized by solid phase synthesis, and NA-wtTel23c is the natural abundance isotope-labeled wtTel23c prepared by biosynthesis using the method of the present invention. 15 N-wtTel23d is 15 N-labeled wtTel23; B is the imino proton region of the 1D 1H-NMR spectrum of G4 formed by wtTel23c and the reference; C and D are the 2D 1 H- 15 N sfHMQC (SOFAST 1H-15N heteronuclear multiple quantum coherence spectroscopy: 1 H-15 The imino region of the N band-selective optimized flip-angle short-transient heteronuclear multiple quantum coherence (N) spectrum was obtained, and the reference was ssDNA with the same sequence as that of solid-phase synthesis.

[0038] Figure 3 shows the relationship between cell-like environment and K + Comparison of sfHMQC two-dimensional spectra of wtTel23c-TMPyP4 complex in dilute solution; the dotted line spectrum represents K + The signal of wtTel23c-TMPyP4 complex in dilute solution environment; the solid line spectrum represents the signal of wtTel23c-TMPyP4 complex in cell-like environment;

[0039] Figure 4 shows the stable isotopes in Example 3 15 Schematic diagram of the N-labeled human c-Myc promoter ssDNA; the white portion of the plasmid represents the pUC57 vector sequence; the single-slashed portion represents the BsmBI restriction site; the double-slashed portion represents the tandemly repeated target gene (PU22) 20 The enlarged image shows a target gene unit PU22 (the difference from PU22C is that it has one less C base at the 5' end). The ellipsis indicates the tandem duplication of the target gene. The sequence indicated by the hollow arrow represents the double-stranded DNA sequences of varying lengths obtained by double digestion of pUC57-PU22C with Hind III-HF and Kpn I-HF. Two ssDNA sequences of varying lengths, PU22C and PU30C, were obtained by denaturing polyacrylamide gel electrophoresis and purification.

[0040] Figure 5 shows the results of gel electrophoresis and enzyme digestion of the plasmid in Example 5; wherein, A is a 1% agarose gel electrophoresis test for the purified plasmid pUC57-PU22C; B is an 8% acrylamide gel electrophoresis test for the results of step-by-step double enzyme digestion of the plasmid, where lane Hind III-HF indicates the plasmid was first digested with Hind III-HF, and lane Kpn I-HF indicates the plasmid was digested with Hind III-HF and then with Kpn I-HF; C is a 12% acrylamide gel electrophoresis test for the obtained ssDNA (PU22C), where lane Reference indicates a solid-phase synthesized ssDNA with the same sequence as PU22C;

[0041] Figure 6 shows the mutual titration of CX5461 and PU22C 1 H- 15N sfHMQC NMR spectrum; the solid line spectrum represents the free PU22C, the dotted line spectrum represents the bound PU22C, and the ratio marked in the figure is the titration ratio of PU22C and CX5461;

[0042] Figure 7 shows the mutual titration of CX5461 and PU22C. 2 J HN - 1 H- 15 N HSQC NMR spectrum; the solid line spectrum represents the free PU22C, the dashed line spectrum represents the bound PU22C, and the ratio marked in the figure is the titration ratio of PU22C to CX5461;

[0043] Figure 8 shows the stable isotopes in Example 6 15 Schematic diagram of the principle of N-labeled HIV ssDNA; the white portion of the plasmid represents the pUC57 vector sequence, the single-slashed portion represents the BsmBI restriction site, and the double-slashed portion represents the tandemly repeated target gene (LTR-III) 16 The partial enlarged image shows a target gene unit LTR-III. The ellipsis indicates the target gene repeats in tandem. The sequence indicated by the hollow arrow represents the double-stranded DNA sequence of varying lengths obtained by double digestion of pUC57-LTR-III with Pst I-HF and Hind III-HF. After urea-denatured polyacrylamide gel electrophoresis and purification, two ssDNAs of varying lengths were obtained, namely LTR-III and LTR-C.

[0044] Figure 9 shows the acquisition of 2D 1 H- 15 The fingerprint of the interaction between LTR-III G4 and the ligand Braco-19 was obtained using the N sfHMQC spectrum. The molar ratio of G4 to the ligand (G4:Braco-19) is shown in the upper left corner of the figure.

[0045] Figure 10 shows the effect of a complex cellular environment on the conformation of LTR-III G4. The concentration of the cell lysate is shown in the upper left corner of the figure. The gray spectra represent the spectral information of LTR-III G4 in the absence of cell lysate. The black spectra (A-C) represent the spectral information of LTR-III G4 obtained under conditions of different cell lysate concentrations.

[0046] Figure 11 shows the interaction between LTR-III G4 and the ligand Braco-19 in a complex cellular environment; the gray spectrum represents the spectrum signal of free LTR-III G4 under the condition of a cell concentration of 50 mg / mL; the black spectrum represents the spectrum information of the complex at different titration ratios under the condition of cell extract;

[0047] Figure 121 H- 13 C HSQC spectra characterize the CH signals of various bases. DETAILED DESCRIPTION

[0048] The present invention provides a method for preparing stable isotope-labeled ssDNA by a biofermentation method, comprising the following steps:

[0049] 1) adding a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit; the first restriction endonuclease and the second restriction endonuclease are two different restriction endonucleases;

[0050] 2) connecting the repeating units in step 1) in series to obtain a fusion sequence;

[0051] 3) inserting the fusion sequence described in step 2) into a high-copy vector to obtain a recombinant vector;

[0052] 4) introducing the recombinant vector described in step 3) into a host bacterium to obtain a recombinant bacterium;

[0053] 5) After culturing the recombinant bacteria in step 4), extracting and purifying the recombinant vector in the recombinant bacteria; the culture medium used is 15 NH4Cl as the only nitrogen source and / or 13 C-glucose is the only carbon source;

[0054] 6) digesting the recombinant vector in step 5) with a first restriction endonuclease and a second restriction endonuclease to obtain an asymmetric double-stranded DNA structure, and separating two ssDNAs of different lengths, one of which is the target sequence;

[0055] 7) Recovering the target sequence in the two ssDNAs in step 6) to obtain stable isotope-labeled target ssDNA.

[0056] The present invention first adds a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence respectively to obtain a repeating unit.

[0057] In the present invention, the length of the target sequence is preferably less than 100 nt.

[0058] In the present invention, the target sequence preferably includes telomeric ssDNA, human promoter ssDNA or HIV ssDNA; the nucleotide sequence of the telomeric ssDNA is preferably as shown in SEQ ID NO.1, specifically: 5'-tagggttagggttagggttaggg-3', named wtTel23; the nucleotide sequence of the human promoter c-Myc ssDNA is preferably as shown in SEQ ID NO.2, specifically: 5'-ctgagggtgggtagggtgggtaa-3', named PU22C; the nucleotide sequence of the HIV ssDNA is preferably as shown in SEQ ID NO.3, specifically: 5'-gggaggcgtggcctgggcgggactgggg-3', named LTR-III.

[0059] In the present invention, the first restriction endonuclease is preferably KpnI and the second restriction endonuclease is preferably BamHI; alternatively, the first restriction endonuclease is preferably KpnI-HF and the preferred second restriction endonuclease is BamHI-HF; alternatively, the first restriction endonuclease is preferably PstI-HF and the second restriction endonuclease is preferably HindIII-HF; alternatively, the first restriction endonuclease is preferably KpnI-HF and the second restriction endonuclease is preferably HindIII-HF. The restriction endonuclease cleavage efficiency of the above combination is high and can ensure that the shorter of the two ssDNAs of different lengths obtained in the subsequent scheme is the target sequence.

[0060] In the present invention, when the target sequence is telomeric ssDNA, the first restriction endonuclease is preferably KpnI and the second restriction endonuclease is preferably BamHI.

[0061] In the present invention, when the target sequence is human promoter ssDNA, the first restriction endonuclease is preferably Kpn I-HF and the second restriction endonuclease is preferably Hind III-HF.

[0062] In the present invention, when the target sequence is HIV ssDNA, the first restriction endonuclease is preferably Pst I-HF and the second restriction endonuclease is preferably Hind III-HF.

[0063] After obtaining the repeating units, the present invention connects the repeating units in series to obtain a fusion sequence.

[0064] In the present invention, every 3 to 4 repeating units are connected in series to form a large repeating unit, and the large repeating units are further connected in series through a linker sequence; the linker sequence preferably does not contain a repeating sequence and is longer than the target sequence to facilitate subsequent separation. The length of the linker sequence of the present invention is preferably 50 to 200 nt; the advantage of connecting in series through a linker sequence is that it reduces the difficulty of plasmid synthesis. The length of the fusion sequence of the present invention is preferably ≤2k, more preferably 1.3 to 2k. This length range not only meets the requirements for constructing a recombinant vector, but also can increase the number of repetitions of the target sequence to improve its yield.

[0065] In the present invention, when the target sequence is telomeric ssDNA, the fusion sequence is preferably obtained by serially connecting 12 repeating units; more preferably, every 3 repeating units are serially connected to form one large repeating unit.

[0066] In the present invention, when the target sequence is a human promoter ssDNA, the fusion sequence is preferably obtained by connecting 20 repeating units in series; more preferably, every 4 repeating units are connected in series to form one large repeating unit.

[0067] In the present invention, when the target sequence is HIV ssDNA, the fusion sequence is preferably obtained by serially connecting 15 repeating units to form a fusion sequence; further preferably, every 3 repeating units are serially connected to form a large repeating unit.

[0068] After obtaining the fusion sequence, the present invention inserts the fusion sequence into a high-copy vector to obtain a recombinant vector.

[0069] In the present invention, the high copy number vector preferably includes pUC57, which was purchased from Nanjing GenScript Company.

[0070] In the present invention, when the target sequence is telomeric ssDNA, the fusion sequence is preferably ligated into the pUC57 vector at the BsmBI restriction endonuclease site.

[0071] In the present invention, when the target sequence is a human promoter ssDNA, the fusion sequence is preferably ligated into the pUC57 vector at the EcoRV restriction endonuclease site.

[0072] In the present invention, when the target sequence is HIV ssDNA, the fusion sequence is preferably ligated into the pUC57 vector at the BsmBI restriction endonuclease site.

[0073] After obtaining the recombinant vector, the present invention introduces the recombinant vector into a host bacterium to obtain a recombinant bacterium.

[0074] In the present invention, the host bacteria preferably include Escherichia coli; the Escherichia coli preferably includes DH5α Escherichia coli. The mutation probability of DNA replication in DH5α Escherichia coli cells is very low, about 10 -10 , which is four orders of magnitude lower than that of high-fidelity PCR polymerase.

[0075] After obtaining the recombinant bacteria, the present invention cultured the recombinant bacteria, extracted and purified the recombinant vector in the recombinant bacteria; the culture medium used was 15 NH4Cl as the only nitrogen source and / or 13 C-glucose is the only carbon source.

[0076] In the present invention, the culture medium preferably comprises 15 NH4Cl and / or 13 C-glucose M9 culture medium. 15 NH4Cl and / or 13 C-glucose is the raw material for biological fermentation and has the advantage of low cost; 15 The concentration of NH4Cl is preferably ≥1 g / L, more preferably 1 g / L; 13 The concentration of C-glucose is preferably ≥4 g / L, more preferably 4 g / L. This concentration is the minimum amount required to ensure that the culture medium has sufficient nitrogen and carbon sources, which can save costs.

[0077] After obtaining the extracted and purified recombinant vector, the present invention uses a first restriction endonuclease and a second restriction endonuclease to enzymatically digest the extracted and purified recombinant vector to obtain an asymmetric double-stranded DNA structure, and separates two ssDNAs of different lengths, one of which is the target sequence.

[0078] In the present invention, the separation of the two ssDNAs of different lengths preferably includes separation of the two ssDNAs of different lengths by urea-denatured polyacrylamide gel electrophoresis. This method has the advantages of simple operation and low cost.

[0079] In the present invention, the urea-denatured polyacrylamine gel electrophoresis is preferably a urea-denatured polyacrylamine gel electrophoresis with a volume concentration of 12%, where 12% refers to the volume fraction of acrylamide in the polyacrylamide gel; the urea-denatured polyacrylamine gel electrophoresis preferably includes the following components based on 500 mL: 10×TBE 50 mL, 40% Acry (19:1) 150 mL, urea 210 g, and the remainder water.

[0080] After obtaining two ssDNAs, the present invention recovers the target sequence in the two ssDNAs to obtain stable isotope-labeled target ssDNAs.

[0081] If the complementary chain of the target sequence is also worthy of research, the present invention preferably further comprises recovering another ssDNA other than the target sequence, that is, recovering the complementary chain of the target sequence, so that two different ssDNA can be obtained in one preparation. 15 N and / or 13 C-labeled ssDNA.

[0082] Preparation of the present invention 15 The method of N-labeled ssDNA is a bio-fermentation synthesis method, which can synthesize stable isotopes. 15 N-labeled ssDNA has high labeling efficiency (labeling efficiency up to 96%), low synthesis cost (compared with commercial products, the cost is reduced by 90%), and high yield (1L M9 culture medium can produce 8.1g 15 N-labeled plasmid), low mutation rate (mutation rate is 10 -10 Compared with the high-fidelity PCR polymerization reaction, the mutation rate is reduced by two orders of magnitude) and other advantages. It is suitable for the synthesis of common ssDNA and ssDNA sequences rich in repetitive sequences.

[0083] In one embodiment of the present invention, when the target sequence is telomeric ssDNA, the fusion sequence is preferably obtained by concatenating 12 repeating units, with every 3 repeating units concatenated into one large repeating unit; the first restriction endonuclease is preferably KpnI and the second restriction endonuclease is preferably BamHI; the high copy vector is pUC57; the fusion sequence is connected to the pUC57 vector at the BsmBI restriction endonuclease site; the two ssDNAs of different lengths are the short target sequence wtTel23c and the long byproduct wtTel34; the nucleotide sequence of wtTel34 is shown in SEQ ID NO.4, specifically: 5'-gatccccttacccttacccttacccctaggta-3'. 15 N-labeled telomeric ssDNA can significantly reduce 2D 1 H- 15 The acquisition time of N sfHMQC spectra is greatly improved, which lays the foundation for the characterization of G quadruplex (G4) structure and its interaction with ligands in the cellular environment.

[0084] In one embodiment of the present invention, when the target sequence is a human promoter ssDNA, the fusion sequence is preferably obtained by concatenating 20 repeating units, and every 4 repeating units are concatenated into one large repeating unit; the first restriction endonuclease is preferably Kpn I-HF and the second restriction endonuclease is preferably Hind III-HF; the high copy vector is pUC57; the fusion sequence is connected to the pUC57 vector at the EcoRV restriction endonuclease site; the two ssDNAs of different lengths are respectively the short target sequence PU22C and the long PU30C sequence; the nucleotide sequence of the PU30C is as shown in SEQ ID NO.5, specifically: 5'-agctttacccaccctacccaccctcaggtac-3'. Compared with the naturally abundant human promoter sequence, the stable isotope prepared by the method of the present invention is 15 The human promoter ssDNA sequence uniformly labeled with N has the following two advantages: (1) it can improve the sensitivity of nuclear magnetic resonance detection and significantly increase the sensitivity of nuclear magnetic resonance detection. 1 H- 15 The acquisition efficiency of N 2D NMR spectrum is 99.63% because the natural abundance of nitrogen atoms is 14 It exists in the form of N, with a spin of 1 and a quadrupole moment of 2.044 fm 2 . 15 The natural abundance of nitrogen is 0.364% and its spin is 1 / 2. 14 The N abundance is very high and it also has spin, but due to the presence of a quadruple moment, the relaxation rate is fast and the spectral line is wide, making it unsuitable for two-dimensional nuclear magnetic resonance spectrum acquisition. 15 The N spectrum signal has a narrow half-peak width, which is more conducive to analyzing the precise structural information of biological macromolecules. Therefore, the nitrogen spectra of biological macromolecules usually collected are specifically 15 N NMR spectrum. So improve 15 N abundance can increase 15 N signal sensitivity, thereby improving the acquisition efficiency of the spectrum. (2) Stable isotopes 15 N-uniformly labeled human promoter sequences can be used to study the G4 topology of human promoters and their interactions with ligands in complex cellular environments. 15 N uniformly labeled human promoter G4, except that the target human promoter G4 is 15 N-labeled, and other background molecules are 15 The natural abundance of N (0.364%) exists, so the background interference of its NMR spectrum signal is small, and the target molecule can be directly collected. 15 N signal. So in situ in cells 15 When collecting N-G4 signals, 1 H- 15In the spectrum collection of N HSQC or HMQC, the background signal can be ignored and the interference of the background signal is small.

[0085] In one embodiment of the present invention, when the target sequence is HIV ssDNA, the fusion sequence is preferably obtained by concatenating 15 repeating units, and every 3 repeating units are concatenated into one large repeating unit; the first restriction endonuclease is preferably Pst I-HF and the second restriction endonuclease is preferably HindⅢ-HF; the high copy vector is pUC57; the fusion sequence is connected to the pUC57 vector at the BsmBI restriction endonuclease site; the two ssDNAs of different lengths are the short target sequence LTR-III and the long byproduct LTR-C; the nucleotide sequence of the LTR-C is as shown in SEQ ID NO.6, specifically: 5'-gatcccccagtcccgcccaggccacgcctccctgca-3'; the nucleotide sequence of the LTR-III is as shown in SEQ ID NO.3, specifically: 5'-gggaggcgtggcctgggcgggactgggg-3'. Stable isotopes prepared by the method of the present invention 15 N-uniformly labeled HIV ssDNA sequence LTR-III can improve the sensitivity of nuclear magnetic resonance signal acquisition and can be used in traditional 15 In addition, the stable isotope prepared by the method of the present invention 15 Uniformly N-labeled HIV ssDNA can also be used for NMR studies of HIV LTR-III G4 structure and its interaction with ligands in the complex environment of cell extracts, providing a new platform for drug screening targeting HIV LTR-III G4 in complex cellular environments.

[0086] In the present invention, wtTel34, PU30C and LTR-C, these ssDNAs are rich in C bases, which can fold to form a functional i-motif structure and are also used for nuclear magnetic resonance studies of the i-motif structure and its interaction with ligands.

[0087] To further illustrate the present invention, a method for preparing stable isotope-labeled ssDNA by a biofermentation method provided by the present invention is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0088] In the embodiment of the present invention, the high copy number vector pUC57 was purchased from Nanjing GenScript Co., Ltd., and the fusion sequence was synthesized by Nanjing GenScript Co., Ltd.

[0089] Example 1 Stable Isotopes 15 Preparation method of N-labeled telomeric ssDNA

[0090] The experimental principle of plasmid design is shown in Figure 1. The target sequence of this embodiment is telomeric ssDNA. This sequence was designated as wtTel23.

[0091] The overall design of the plasmid is used to obtain 15 N-labeled ssDNA. To increase the yield of the target ssDNA, two different restriction endonuclease sites, Kpn I and BamH I, were added to the 5' and 3' ends of the target sequence (in bold), respectively, to obtain a repeating unit. The nucleotide sequence of the repeating unit is shown in SEQ ID NO. 7, specifically: The repeating units were connected in series 12 times to obtain a fusion sequence (the nucleotide sequence is shown in SEQ ID NO.8, specifically:

[0092] Every three repeating units were connected to a linker with a random sequence to facilitate plasmid construction. The fusion sequence was ligated in series at the BsmBI restriction endonuclease site into the pUC57 vector to form the plasmid pUC57-wtTel23c (see Figure 1A). The constructed plasmid was transformed into DH5α E. coli cells for propagation (see Figure 1B). DH5α E. coli cells transformed with pUC57-wtTel23c were grown in the presence of 15 N-labeled NH4Cl was used as the sole nitrogen source in M9 medium to produce 15 N-labeled pUC57-wtTel23c plasmid (see C in Figure 1). Purified plasmid was treated with restriction endonucleases KpnI and BamHI. 15 N-labeled pUC57-wtTel23c plasmid (see D and E in Figure 1). An asymmetric double-stranded DNA structure was generated by double digestion with BamH I and Kpn I. Two ssDNAs of different lengths were separated by urea-denatured polyacrylamide gel electrophoresis, namely: wtTel23c: 5'-tagggttagggttagggttaggg-3'; wtTel34: 5'-gatccccttacccttacccttacccctaggta-3'. The digestion product was obtained in the form of asymmetric dsDNA (see F in Figure 1). The asymmetric dsDNA was further separated and purified by urea-denatured polyacrylamide gel electrophoresis (45 cm × 35 cm) (see G in Figure 1). The target ssDNA was recovered and electroeluted to obtain the target 15 N-labeled ssDNA. (See H in Figure 1).

[0093] Methods and solutions:

[0094] 1. Amplify the stable isotope-labeled plasmid using labeled M9 medium

[0095] Select a single colony and culture it in 5 mL of TB medium (37°C). After 5 h, transfer 5 mL of the bacterial solution into 50 mL of TB medium. After 3 h, collect the bacteria by centrifugation and transfer the bacteria into 150 mL of 1 g / L TB medium. 15 Cultivate overnight in M9 medium containing NH4Cl, take 50mL of overnight culture solution and add it to 400mL of 15 To fresh M9 medium containing NH4Cl, add chloramphenicol at a final concentration of 11.5 mg / mL when the OD is approximately 1.0. Continue incubating at 37°C for 9 h. Harvest the cells by centrifugation and wash with STE buffer for purification.

[0096] 2. Large-scale plasmid extraction and purification

[0097] Since the large-scale plasmid extraction kits on the market could not meet the experimental requirements, the buffer solution required for large-scale plasmid extraction was prepared according to the recipe in the Molecular Cloning Book (3rd Edition).

[0098] The buffer solutions used in the following experimental steps all use water as the solvent. The formula is shown below, and the amount is suitable for 2LM9 cultured bacteria.

[0099] STE buffer: 10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA pH 8.0, autoclaved, pre-cooled to 4°C before use;

[0100] S1 solution: 25 mM Tris-HCl pH 8.0, 50 mM glucose, 10 mM EDTA pH 8.0, sterilized at high temperature, used at room temperature;

[0101] S2: Prepare fresh each time, 0.2M NaOH, 1% m / V SDS, use at room temperature;

[0102] S3 solution: 3M KAc, 2M HAc, pre-cool at 4°C before use;

[0103] Isopropyl alcohol: Use at room temperature;

[0104] 70% ethanol in water (70% ethanol): Precool to 4°C before use;

[0105] 4M NaCl: autoclaved;

[0106] 40% PEG 6000: autoclaved;

[0107] TE 10 / 0.1: 10 mM Tris-HCl pH 8.0, 0.1 mM EDTA, autoclaved;

[0108] TE 10 / 50: 10 mM Tris-HCl pH 8.0, 50 mM EDTA, autoclaved;

[0109] 3M NaAc: pH 5.2.

[0110] 2.1 Plasmid extraction

[0111] (1) Resuspend the cells in 60 mL of pre-cooled S1 solution, slowly add 120 mL of S2, gently invert to mix, and let stand at room temperature for 3 to 5 minutes until the mixture becomes uniform and transparent with high viscosity and a stringy appearance. Then add 210 mL of pre-cooled S3 solution and shake in the same direction until the liquid phase is not separated.

[0112] (2) Incubate on ice for 10 min.

[0113] (3) Centrifuge at 7500 rpm for 20 min and filter with a membrane to remove large precipitates.

[0114] (4) Add 0.52 times the volume of isopropanol and let it stand at room temperature for 15 minutes.

[0115] (5) Collect the precipitate by centrifugation and add an appropriate amount of pre-cooled 75% ethanol to wash the precipitate.

[0116] (6) Centrifuge to remove the ethanol solution and evaporate to remove the residual ethanol.

[0117] (7) Add an appropriate volume of TE10 / 50 to dissolve the precipitate.

[0118] (8) Add 160 μL of RNase A (25 mg / mL) and digest at 37°C overnight.

[0119] (9) Detect RNA hydrolysis using 1% agarose gel electrophoresis.

[0120] 2.2.8 Plasmid purification

[0121] (1) Add 1 / 5 volume of 4M NaCl and 2 / 5 volume of 40% PEG6000, and place at 37°C for 5 minutes.

[0122] (2) Incubate on ice for 1 hour.

[0123] (3) Centrifuge at 13000 rpm for 30 min, collect the precipitate, and wash it with 70% ethanol.

[0124] (4) Remove the ethanol, evaporate the residual ethanol, and dissolve the precipitate in an appropriate volume of TE10 / 0.1.

[0125] (5) Add 1 / 5 volume of phenol-chloroform (25:24:1), mix well, centrifuge at 13000 rpm for 30 min, and remove the organic phase.

[0126] (6) Repeat step (4) until no more white precipitate appears at the interface between the two phases (generally repeat 2 to 3 times).

[0127] (7) Add 1 / 5 volume of chloroform and isoamyl alcohol (24:1), mix well, and centrifuge to remove the organic phase.

[0128] (8) Add 1 / 10 volume of 3M NaAc pH=5.2 and 2.5 times volume of pre-cooled anhydrous ethanol.

[0129] (9) Mix well and place at -20℃ overnight.

[0130] (10) The precipitate was collected by centrifugation and dried until there was no ethanol smell. The precipitate was dissolved in an appropriate volume of sterile water, and the UV absorption spectrum was detected to record the A260 / A280 ratio.

[0131] 3. Use two restriction endonucleases to perform double enzyme digestion of the plasmid to obtain the target double-stranded DNA

[0132] To a 200 μL PCR tube, add 23 μL of deionized water, 5 μL of 10×NEB cutsmart buffer (1×NEB cutsmart buffer, 50 mM KAC, 20 mM Tris-HAC, 10 mM Mg(AC)2, 100 μg / ml BSA, pH = 7.9 @ ​​25°C), 20 μL of plasmid solution (concentration: 200 ng / μL), 2 μL of Kpn I (20 U), and 2 μL of BamHI (20 U). Mix thoroughly. Incubate in a 37°C water bath for 4 h. Analyze enzyme digestion efficiency using 8% native-PAGE. For double-enzyme digestion reactions, the optimal plasmid concentration should be 1000 ng / μL.

[0133] 4. Isolation and Purification of Target ssDNA

[0134] (1) Separate the two single strands of the target double-stranded DNA (wtTel23c and wtTel34) using 12% urea-denaturing polyacrylamide gel electrophoresis. Electrophoresis was performed using a JY-CX2B large vertical electrophoresis tank (35 cm × 45 cm) at a constant power of 75 W for 8 h. Electrophoresis was performed in a biochemical incubator at a constant temperature of 30°C.

[0135] (2) Cut the target ssDNA band, pass the gel block through a syringe, and crush it into small particles. Add an appropriate volume of TE10 / 0.1 and soak it in a 50℃ water bath overnight (or use an electroelution device to elute the DNA).

[0136] (3) The soaked liquid was filtered through a 0.2 μm filter membrane (if electroelution was used, the liquid in the sample pool was directly aspirated), and then concentrated through a 3K ultrafiltration tube. Ultrafiltration was performed multiple times with water to finally obtain ssDNA. The naturally abundant ssDNA prepared in this experiment was named NA-wtTel23c. 15 N-labeled ssDNA is named 15 N-wtTel23c.

[0137] (4) Preparation of urea-denatured polyacrylamine gel electrophoresis.

[0138] Example 2

[0139] In order to verify that the target ssDNA (wtTel23c) obtained by E. coli amplification was consistent with the chemically synthesized ssDNA sample of the same sequence, mass spectrometry, 2D 1 H-NMR and 2D 1 H- 15 High performance liquid chromatography-mass spectrometry (LC-MS) was used to determine the molecular weight and 15 N-wtTel23c 15 The experimental results are shown in Figure 2, (A to C in Figure 2) are the reference sample (reference) synthesized by solid phase, the non-labeled wtTel23c (NA-wtTel23c) prepared in this experiment, and the 15 N-labeled-wtTel23c( 15 The mass spectrum of the solid-phase synthesized reference sample (NA-wtTel23c) showed a relative molecular weight of 7559.94, while the sequence-identical NA-wtTel23c had a relative molecular weight of 7640.89, a difference of 80.95. This is due to the fact that both the 5' and 3' termini of the solid-phase synthesized wtTel23c terminate in hydroxyl groups, while NA-wtTel23c, obtained using restriction endonucleases, has a phosphate group at its 5' terminus and a hydroxyl group at its 3' terminus. Compared to the solid-phase synthesized reference sample, the NA-wtTel23c molecule has one additional P atom, three O atoms, and one H atom. The sum of these atoms' relative atomic masses is 79.97, thus the molecular weight of the biosynthesized NA-wtTel23c is consistent with expectations.

[0140] 15 The relative molecular mass of N-wtTel23c is 7733.92, which is 93.02 higher than that of NA-wtTel23c. This is because the vast majority (99.6%) of nitrogen atoms in the NA-wtTel23c sequence are 14 N, and 15 The majority of nitrogen atoms in the N-wtTel23c sequence are 15 N atoms, the number of nitrogen atoms in the wtTel23c sequence is 97, and NA-wtTel23c is 15 The theoretical difference between the relative molecular weights of N-wtTel23c is 96.61, while the experimental difference between the relative molecular weights of the two is 93.02, indicating that 15 The tagging rate of N-wtTel23c sequence was 96.28%. 15 The N labeling rate calculation formula refers to Equation 1.

[0141] Note: In formula 1, N represents the number of nitrogen atoms in the wtTel23c sequence, i.e., 97.

[0142] Atomic-resolution NMR was used to characterize the stacking of G bases in the G4 structure formed by the ssDNA folding obtained in this experiment. The experimental results are shown in Figure 2B. The sample obtained in this experiment (wtTel23c) and the reference sample (reference) exhibit 12 high-resolution signal peaks and several minor peaks in the 10-12 ppm imino proton region, indicating that the fine structure of the G4 structure formed by the ssDNA folding obtained in this experiment is consistent with that of the reference sample. 1 H- 15 N sfHMQC is a fast two-dimensional spectrum acquisition technology that is widely used in the study of biomacromolecules. This technology can significantly improve the signal-to-noise ratio per unit time in heteronuclear correlation experiments. 15 The signal of N-wtTel23c sample. 15 N-labeled ssDNA samples with a concentration as low as 0.2 mM can be obtained in just 7 minutes under the same spectral acquisition conditions. 1 H- 15 N sfHMQC 2D spectrum (C in Figure 2), while for the natural abundance NA-wtTel23c sample, the concentration was as high as 2.0 mM, and the 1 H- 15 The N sfHMQC two-dimensional spectrum still takes 18 hours (D in Figure 2). 15 N-labeled DNA samples can significantly shorten the spectrum acquisition time, improve the signal-to-noise ratio per unit time, and lay the foundation for the study of complex biological systems.

[0143] The wtTel23c-TMPyP4 complex obtained under dilute solution conditions and cell-like environment 1 H- 15 The N sfHMQC 2D spectra show significant differences (as shown in Figure 2). For example, in the spectra obtained in the cell-like environment, the G21 signal indicated by the arrow is clearly retained but absent in the dilute solution. This suggests that the binding mechanism of TMPyP4 to telomeric G4 in the cell-like environment is significantly different from that in the dilute solution.

[0144] Example 3 Stable Isotopes 15 Preparation method of N-labeled human promoter c-Myc ssDNA sequence

[0145] The experimental principle of plasmid design is shown in Figure 4 , with c-Myc promoter DNA as the target sequence, 5′-ctgagggtgggtagggtgggtaa-3′, named PU22C.

[0146]

[0147] method:

[0148] (one) 15 Preparation of N-PU22C ssDNA:

[0149] 1. Amplify the stable isotope-labeled plasmid using labeled M9 medium

[0150] Select a single clone and culture it in 5 mL TB medium (37°C). After 5 h, transfer 5 mL of the bacterial solution into 50 mL TB medium. After 3 h, centrifuge and collect the bacteria. Transfer the bacteria into 150 mL of TB medium. 15 Cultivate overnight in M9 medium containing NH4Cl, take 50mL of overnight culture solution and add it to 400mL of 15 To fresh M9 medium containing NH4Cl, add chloramphenicol at a final concentration of 11.5 mg / mL when the OD is approximately 1.0. Continue incubating at 37°C for 9 h. Harvest the cells by centrifugation and wash with STE buffer for purification.

[0151] 2. Large-scale plasmid extraction and purification

[0152] Since the large-scale plasmid extraction kits on the market could not meet the experimental requirements, the buffer solution required for large-scale plasmid extraction was prepared according to the recipe in the Molecular Cloning Book (3rd Edition).

[0153] 3. Use two restriction endonucleases to perform double enzyme digestion of the plasmid to obtain the target double-stranded DNA

[0154] To a 200 μL PCR tube, add 23 μL of deionized water, 5 μL of 10×NEB cutsmart buffer (1×NEB cutsmart buffer, 50 mM KAC, 20 mM Tris-HAC, 10 mM Mg(AC)2, 100 μg / ml BSA, pH = 7.9 @ ​​25°C), 20 μL of plasmid solution (concentration: 200 ng / μL), 2 μL of Kpn I (20 U), and 2 μL of Hind III (20 U). Mix thoroughly. Incubate in a 37°C water bath for 4 h. Analyze enzyme digestion efficiency using 8% native-PAGE. For double-enzyme digestion reactions, the optimal plasmid concentration should be 1000 ng / μL.

[0155] 4. Isolation and Purification of Target ssDNA

[0156] (1) Separate the two single strands of the target double-stranded DNA (wtTel23c and wtTel34) using 12% urea-denaturing polyacrylamide gel electrophoresis. Electrophoresis was performed using a JY-CX2B large vertical electrophoresis tank (35 cm × 45 cm) at a constant power of 75 W for 8 h. Electrophoresis was performed in a biochemical incubator at a constant temperature of 30°C.

[0157] (2) Cut the target ssDNA band, pass the gel block through a syringe, and crush it into small particles. Add an appropriate volume of TE10 / 0.1 and soak it in a 50℃ water bath overnight (or use an electroelution device to elute the DNA).

[0158] (3) The soaked liquid was filtered through a 0.2 μm filter membrane (if electroelution was used, the liquid in the sample pool was directly aspirated), and then concentrated through a 3K ultrafiltration tube. The buffer was changed several times with water ultrafiltration to finally obtain ssDNA. The naturally abundant ssDNA prepared in this example was named NA-PU22C. 15 N-labeled ssDNA is named 15 N-PU22C.

[0159] (2) Preparation of G4s samples

[0160] (1)PU22C: ctgagggtgggtagggtgggtaa

[0161] (2)K + Buffer solution: 2.5 mM K3PO4, 7.5 mM KCl, pH = 6.0

[0162] (3) 15 Preparation of N-labeled G4s (PU22C): prepared by the above method 15 N stable isotope labeled ssDNA was dissolved in K + In a buffer solution, it was heated at 95°C for 10 min, gradually cooled to 4°C, and balanced at this temperature for 0.5 h to form a stable G4s structure.

[0163] (4) Preparation of non-labeled G4s: Dissolve the purchased DNA sample powder in deionized water and ultrafilter three times to remove inorganic salt ions and organic solvents such as triethylamine in the sample as much as possible. + Annealing was performed under buffer solution conditions, heating at 95°C for 10 min, gradually cooling to 4°C, and equilibrating at this temperature for 0.5 h to form stable G4s.

[0164] Example 4 Nuclear Magnetic Field Experiment

[0165] 1. 1 H- 15 N sfHMQC experiment

[0166] In the 200 μL prepared in advance, 15 10% v / v deuterated water (D2O) was added to the N-labeled PU22C sample in a total volume of 220 μL, resulting in a final DNA concentration of 0.2 mM. The sample was placed in a Shigemi NMR tube and the NMR experiment was performed on a 700 MHz Bruker spectrometer equipped with a cryogenic probe. The sampling temperature of the experiment was 298 K. 1 H- 15 The N sfHMQC spectrum was acquired with 400 sampling points in the direct dimension and 40 sampling points in the indirect dimension. The direct spectral width was 12 ppm, centered at 10.5 ppm. The indirect spectral width was 6 ppm, centered at 144 ppm. A total of 16 scans were performed. Topspin software was used for NMR data acquisition, and carar software was used for data processing.

[0167] 2. 2 J HN 1 H- 15 N HSQC selectivity experiments

[0168] The NMR experiments were performed on a 700 MHz Bruker spectrometer equipped with a cryogenic probe. The sampling temperature was 298 K. 1 H- 15 The N HSQC spectrum had 1408 sampling points in the direct dimension and 128 sampling points in the indirect dimension. The spectral width in the direct dimension was 20 ppm. The center position of the spectrum was determined by the selected region. The cumulative number of scans was 80. 15 N bandwidth-selective HSQC pulse sequence ( 15 N-band-selective 1 H- 15 N HSQC). 15 N-selective pulse excitation achieves excitation within a certain frequency range through soft pulse or shaped pulse (Q3 shape pulse).

[0169] Example 5

[0170] (1) Example 3 prepared 15 Preparation and characterization of N-PU22C ssDNA

[0171] A crude plasmid extract was obtained using alkaline lysis, and the extracted plasmid was purified using phenol-chloroform and other steps. The purified plasmid was examined by agarose gel electrophoresis. As shown in Figure 5, A, the purified plasmid exhibited three bands, representing, in ascending order, the apparent molecular weights of supercoiled, circular, and linear plasmids. The central band was the most abundant, indicating that the purified plasmid (pUC57-PU22C) was primarily circular. The apparent molecular weight of pUC57-PU22C on the gel was consistent with expectations. Optimization of the double-enzyme digestion conditions revealed that both Kpn I-HF and Hind III-HF restriction enzymes could simultaneously digest pUC57-PU22C. Furthermore, during the optimization process, it was discovered that Kpn I-HF digestion prevented Hind III-HF from effectively carrying out the next enzymatic digestion step. However, digestion with Hind III-HF followed by Kpn I-HF effectively yielded the target double-stranded DNA (Figure 5, B). This may be due to the different binding abilities of the two enzymes for double-stranded DNA. The target double-stranded DNA generated after double enzyme digestion was purified by urea-denatured polyacrylamide gel electrophoresis (35 cm x 45 cm). The target ssDNA band was recovered by gel excision, and the purified ssDNA sample was obtained by electroelution. Using a ssDNA sample of the same sequence prepared by solid-phase synthesis as a reference, 12% acrylamide gel electrophoresis revealed that the molecular weight of the PU22C sample prepared in this example was consistent with that of the solid-phase synthesized PU22C sample.

[0172] (II) Interaction between PU22C and CX5461

[0173] PU22C is a G4s structure of the cancer-related c-Myc promoter. The clinical drug CX5461 can specifically bind to the G4s structure and is currently undergoing phase I clinical trials for BRCA1 / 2-deficient tumors, but the structure of the CX5461-G4s complex is unknown. Therefore, exploring the interaction between CX5461 and G4s is of great scientific significance. PU22C and CX5461 were titrated at different molar ratios. The one-dimensional NMR spectrum of the bound PU22C had poor resolution, and the information obtained about the complex was limited. 1 H- 15The N sfHMQC two-dimensional nuclear magnetic resonance spectrum characterizes the interaction between CX5461 and PU22C. As shown in Figure 6, the two-dimensional nuclear magnetic spectrum can collect the change process of the spectrum signal. When the molar concentration is low (PU22C:CX5461=1:1), the spectrum signal becomes broader, and as the concentration of CX5461 increases (PU22C:CX5461=1:2), the spectrum signal is enhanced. This shows that the binding of PU22C and CX5461 belongs to a medium exchange rate on the NMR time scale. When the concentration of CX5461 is increased to 1:3, the spectrum no longer changes significantly, indicating that the interaction between PU22C and CX5461 reaches the titration end point at 1:2. At the titration end point, 8 independent imino proton signals are displayed on the spectrum, which may be a phenomenon of signal overlap. Using 2 J HN - 1 H- 15 The N sfHMQC NMR spectrum was characterized in the same manner. The results, shown in Figure 7, show significant changes in the signals of the G and A bases after drug binding. The signal of base A15 remained unchanged before and after titration, while the signals of the other A bases (A6, A24, and A25) shifted significantly. This indicates that A15 is not involved in the binding site of CX5461. A15 is located in the loop region of the G4s structure, while the other A bases are located at the 5' and 3' ends of the G4s structure, respectively. This suggests that CX5461 binds to the 5' and 3' ends of PU22C at a 1:2 binding ratio. This is similar to the binding pattern of quindoline-i and c-Myc G4s (see [Liu, W., Lin, C., Wu, G., Dai, J., Chang, TC and Yang, D. (2019) Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition. Nucleic Acids Res, 47, 11931-11942.]).

[0174] In the traditional G4s structure analysis method, the H8 of the A and G bases is associated with the protons on the sugar ring through NOE signals to analyze the protons inside the bases and the proton signals of the adjacent bases. However, there are many signals, and signal attribution is difficult to perform, or the NOE signal is partially lost due to spatial distance or angle problems, making it impossible to perform the next step of association. This is the bottleneck problem encountered by the current NMR technology in analyzing the G4 structure. 15N-labeled human promoter c-Myc ssDNA sequence, which was achieved through 15 The N spectrum editing method selectively excites the signals of specific proton regions, which can obtain the proton signals of specific regions (such as the proton signals of imino groups), greatly simplify the spectrum signals, and improve the efficiency of spectrum signal analysis.

[0175] Example 6 Stable Isotopes 15 Preparation method of N-labeled HIV ssDNA sequence LTR-III

[0176] The experimental principle of plasmid design is shown in Figure 8 , with HIV LTR-III DNA as the target sequence, 5′-gggaggcgtggcctgggcgggactgggg-3′, named LTR-III.

[0177] To increase the yield of the target DNA, two different restriction endonuclease sites, Pst I-HF and Hind III-HF, were added to the 5' and 3' ends of the target sequence, respectively, to generate a repeating unit. The nucleotide sequence of the repeating unit is shown in SEQ ID NO. 11, specifically: ctgcagggaggcgtggcctgggcgggactgggggatcc. The repeating unit was repeated 15 times in series to generate a fusion sequence (the nucleotide sequence is shown in SEQ ID NO. 12, specifically: ), with unrelated sequences added between every four repeats of the target sequence within the fusion sequence. The fusion sequence was then constructed into the high-copy vector pUC57. Double digestion with Pst I-HF and Hind III-HF generated an asymmetric double-stranded DNA structure. Separation by urea-denaturing polyacrylamide gel electrophoresis yielded two ssDNA fragments of unequal length: 5'-gggaggcgtggcctgggcgggactgggg-3' (LTR-III) and 3'-acgtccctccgcaccggacccgccctgaccccctag-5' (LTR-C). The tandem target DNA sequence and linker sequence (1370 bp) were then digested with BsmBI to generate sticky ends and ligated to construct a plasmid named pUC57-LTR-III.

[0178] method:

[0179] (one) 15 Preparation of N-LTR-III ssDNA:

[0180] 1. Amplify the stable isotope-labeled plasmid using labeled M9 medium

[0181] Select a single clone and culture it in 5 mL TB medium (37°C). After 5 h, transfer 5 mL of the bacterial solution into 50 mL TB medium. After 3 h, centrifuge to collect the bacteria and transfer the bacteria into 150 mL of TB medium. 15 Cultivate overnight in M9 medium containing NH4Cl, take 50mL of overnight culture solution and add it to 400mL of 15 To fresh M9 medium containing NH4Cl, add chloramphenicol at a final concentration of 11.5 mg / mL when the OD is approximately 1.0. Continue incubating at 37°C for 9 h. Harvest the cells by centrifugation and wash with STE buffer for purification.

[0182] 2. Large-scale plasmid extraction and purification

[0183] Since the large-scale plasmid extraction kits on the market could not meet the experimental requirements, the buffer solution required for large-scale plasmid extraction was prepared according to the recipe in the Molecular Cloning Book (3rd Edition).

[0184] 3. Use two restriction endonucleases to perform double enzyme digestion of the plasmid to obtain the target double-stranded DNA

[0185] To a 200 μL PCR tube, add 23 μL of deionized water, 5 μL of 10×NEB cutsmart buffer (1×NEB cutsmart buffer, 50 mM KAc, 20 mM Tris-HAc, 10 mM Mg(Ac)2, 100 μg / ml BSA, pH = 7.9 @ ​​25°C), 20 μL of plasmid solution (concentration: 200 ng / μL), 2 μL of Kpn I (20 U), and 2 μL of Hind III (20 U). Mix thoroughly. Incubate in a 37°C water bath for 4 h. Analyze enzyme digestion efficiency using 8% native-PAGE. For double-enzyme digestion reactions, the optimal plasmid concentration should be 1000 ng / μL.

[0186] 4. Isolation and Purification of Target ssDNA

[0187] (1) Separate the two single strands of the target double-stranded DNA (wtTel23c and wtTel34) using 12% urea-denaturing polyacrylamide gel electrophoresis. Electrophoresis was performed using a JY-CX2B large vertical electrophoresis tank (35 cm × 45 cm) at a constant power of 75 W for 8 h. Electrophoresis was performed in a biochemical incubator at a constant temperature of 30°C.

[0188] (2) Cut the target ssDNA band, pass the gel block through a syringe, and crush it into small particles. Add an appropriate volume of TE10 / 0.1 and soak it in a 50℃ water bath overnight (or use an electroelution device to elute the DNA).

[0189] (3) The soaked liquid was filtered through a 0.2 μm filter membrane (if electroelution was used, the liquid in the sample pool was directly aspirated), and then concentrated through an ultrafiltration tube with a molecular weight cutoff of 3K. The buffer was changed several times by ultrafiltration with water to finally obtain ssDNA. The naturally abundant ssDNA prepared in this experiment was named NA-LTR-III. 15 N-labeled ssDNA is named 15 N-LTR-III.

[0190] (2) Preparation of G4 samples

[0191] (1)LTR-III: 5'-gggaggcgtggcctgggcgggactgggg-3'

[0192] (2)K + Buffer solution: 20 mM K3PO4, 70 mM KCl, pH = 7.0

[0193] (3) 15 Preparation of N-labeled G4 (LTR-III): Prepared by the above method 15 N stable isotope labeled ssDNA was dissolved in K + In a buffer solution, it was heated at 95°C for 10 min, gradually cooled to 4°C, and balanced at this temperature for 0.5 h to form a stable G4 structure.

[0194] (4) Preparation of non-labeled G4: Dissolve the purchased DNA sample powder in deionized water and ultrafilter three times to remove inorganic salt ions and organic solvents such as triethylamine in the sample as much as possible. + Annealing was performed under buffer solution conditions, heating at 95°C for 10 min, gradually cooling to 4°C, and equilibrating at this temperature for 0.5 h to form stable G4.

[0195] Example 7 Experimental Method of sfHMQC Nuclear Magnetic Resonance Experiment

[0196] 200 μL prepared in advance in Example 6 15 10% v / v heavy water (D2O) was added to the N-labeled LTR-III sample in a total volume of 220 μL, resulting in a final DNA sample concentration of 0.2 mM. The sample was placed in a Shigemi NMR tube and the NMR experiment was performed on a 700 MHz Bruker spectrometer equipped with a cryogenic probe. The sampling temperature of the experiment was 298 K. 1 H- 15The number of sampling points in the direct dimension of the N sfHMQC spectrum is 400, and the number of sampling points in the indirect dimension is 40. The spectral width in the direct dimension is 12 ppm, and the center position of the spectrum is 10.5 ppm. The spectral width in the indirect dimension is 6 ppm, and the center position of the spectrum is 144 ppm. The cumulative number of scans is 16. 1 H- 15 The number of scans for N sfHMQC spectra was increased to 2048. Topspin software was used for NMR data acquisition, and cara software was used for data processing.

[0197] Example 8

[0198] 1. 15 N-labeled LTR-III ssDNA can be used to obtain the fingerprint of LTR-III G4 and its interaction with ligands

[0199] The formation of LTR-III G4 structure is usually characterized by NMR using a single specific site base. 15 N mark, through 15 The N-filtered spectroscopy method is used to identify H1 proton signals one by one. For example, in the structural analysis of LTR-III G4, the 15 G bases of LTR-III G4 were identified at a single site. 15 N mark, then pass 15 The N-filtered spectroscopy method obtains a single H1 proton signal, which allows the identification of each of the 15 G bases in LTR-III G4. The advantage of this method is that the signal is single and the identification is clear. However, the obvious disadvantage is that multiple single sites are required. 15 The N-labeled samples were collected for NMR spectra, and the fingerprint of LTR-III G4 could not be obtained. 15 N-labeled LTR-III G4 has a stable isotope 15 The uniform labeling of N can obtain the two-dimensional nuclear magnetic resonance fingerprint of LTR-III G4 through a single spectrum acquisition. The structure of LTR-III G4 is different from the traditional G4 structure. In addition to the three-layer G four-plane, there are three pairs of classic GC base pairing. 15High-resolution structural information can be obtained from the acquisition of two-dimensional sfHMQC spectra of N-labeled LTR-III G4. The 2D NMR spectra clearly reveal the evolution of the spectral signals. As shown in Figure 9A, when the system is free of Braco-19 (1:0), the sfHMQC spectra clearly show proton signals (10-12 ppm) from the non-canonical Hoogetin-like hydrogen bonds N7-H1...O6 of G4 and the canonical Watson-Crick-like hydrogen bonds G4 form (12-13 ppm). Titration of the ligand Braco-19 under these conditions reveals significant changes in the LTR-III G4 spectral signals with the addition of Braco-19 at titration ratios ranging from 1:0.5 to 1:1.5 (Figures 9B-D). At a titration ratio of 1:1.5, the spectrum showed no significant signal change compared to the 1:1 spectrum, indicating that the titration of LTR-III G4 with Braco-19 reached its endpoint at a 1:1 ratio. Significant signal changes were observed in both the GC three-base pairing region (12-13 ppm) and the G4 region (10-12 ppm), indicating that the ligand likely bound to the interface between the G four-plane and the GC base pairing.

[0200] 2. Based on 15 N-labeled LTR-III G4 to study the effects of complex cellular environments on LTR-III G4 conformation

[0201] Under dilute solution conditions, ligand molecules may bind to the interface between the G tetraplane and the GC base pairing. However, proteins, metabolites, small molecules, and crowded environments in the cellular environment may affect the conformation of LTR-III G4. Whether the unique conformation of LTR-III G4 exists in the cellular environment remains unknown. 15 N-labeled LTR-III G4 with stable isotope 15The advantage of uniform N labeling allows direct structural information of LTR-III G4 in complex cellular environments. Fingerprints of LTR-III G4 in cell-like environments were collected at concentrations of 0 mg / mL (gray spectra in Figure 10, A-C), 25 mg / mL, 50 mg / mL, and 75 mg / mL (black spectra in Figure 10, A-C). With increasing cell extract concentration, the signals in some of these spectra did not change significantly. In the spectra obtained at an appropriate cell extract concentration of 50 mg / mL (Figure 10, B), the signals in the GC three-base pairing region (12-13 ppm) and the G4 region (10-12 ppm) remained unchanged, indicating that the unique conformation of LTR-III G4 persists in the cellular environment and may serve as a specific site of action for drugs targeting LTR-III G4. Furthermore, at a cell extract concentration of 75 mg / mL, the spectral signals weakened or even disappeared, due to an increase in nonspecific interactions with the increasing cell extract concentration.

[0202] 3. Based on 15 N-labeled LTR-III G4 samples directly provide information on the interaction between LTR-III G4 and its ligand Braco-19 in a complex cellular environment.

[0203] Studying the interaction between LTR-III G4 and the ligand Braco-19 in a cellular setting, and obtaining relevant binding site information, is crucial for the rational design of G4 ligands. In-cell NMR technology, unaffected by background interference, allows for clear signal acquisition of target molecules within the complex cellular environment, making it suitable for evaluating interactions between G4 and ligand molecules in this cellular setting. To achieve optimal spectral resolution, the authors investigated the interaction between LTR-III G4 and the ligand Braco-19 at a cell-like concentration of 50 mg / mL. The results are shown in Figure 11. The gray background represents the spectral signal of free LTR-III G4 at a cell concentration of 50 mg / mL; the black spectrum represents the spectral information of the complex at different titration ratios in cell extracts. The black spectrum signal changes significantly with increasing ligand concentration, demonstrating that the ligand Braco-19 selectively interacts with LTR-III G4 in cell extracts. When the titration ratio range is 1:0.5 to 1:1.5 (A to C in FIG11 ), when the titration ratio is 1:1.0, the black spectrum no longer changes significantly, indicating that the titration endpoint is reached when the titration ratio is 1:0. When the titration ratio is 1:0 (B in FIG11 ), the spectrum information of the bound LTR-III G4 (black spectrum) and the spectrum of the free LTR-III G4 (gray spectrum) are superimposed and compared, and it can be seen that the signals of the GC three-base pairing region (12 to 13 ppm) and the G4 region (10 to 12 ppm) have changed significantly, indicating that in the cell environment, the ligand molecule is likely to bind to the interface connection between the G four-plane and the GC base pairing. Through the present invention, 15 The study of N-labeled LTR-III G4 can further prove that it is valuable to develop targeted drugs at the interface connection between the G tetraplane of LTR-III G4 and the GC base pairing, and provide important guidance for the rational design of drugs targeting LTR-III G4.

[0204] Example 9 Preparation of Stable Isotopes 13 C-labeled PU22C

[0205] Stable isotopes 13 Preparation of C-labeled PU22C was similar to that in Example 3. 15 The preparation method of N-labeled PU22C is similar, the only difference is 15 M9 medium was replaced with fresh M9 medium containing NH4Cl. 15 N-NH4Cl and 13C-glucose was used as the sole nitrogen source and the sole carbon source in M9 medium. The purification method of ssDNA was the same. By collecting the HSQC spectrum signal, the CH bond signal of each base can be obtained, as shown in Figure 12. 13 Selective excitation of C nuclei can achieve selective collection of CH signals, simplify the signals of NMR spectra, and promote NMR studies of nucleic acids.

[0206] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for preparing stable isotope labeled ssDNA by biological fermentation, characterized in that: The following steps are involved: 1) adding a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit; The first restriction endonuclease and the second restriction endonuclease are two different restriction endonucleases; 2) connecting the repeating units obtained in step 1) in series to obtain a fusion sequence; 3) inserting the fusion sequence in step 2) into a high copy vector to obtain a recombinant vector; 4) introducing the recombinant vector described in step 3) into a host bacterium to obtain a recombinant bacterium; 5) After culturing the recombinant bacteria in step 4), extracting and purifying the recombinant vector in the recombinant bacteria; the culture medium used in the culture is 15 NH4Cl as the sole nitrogen source and / or 13 C-glucose is the only carbon source; 6) using the first restriction endonuclease and the second restriction endonuclease to digest the recombinant vector obtained in step 5) to obtain an asymmetric double-stranded DNA structure, and separating and obtaining two ssDNAs of different lengths, one of the two ssDNAs being the target sequence; 7) Recovering the target sequence in the two ssDNAs in step 6) to obtain a stable isotope-labeled target ssDNA.

2. The method according to claim 1, characterized in that: In the step 1), the first restriction endonuclease is KpnI and the second restriction endonuclease is BamHI; Alternatively, the first restriction endonuclease is KpnI-HF and the second restriction endonuclease is BamHI-HF; Alternatively, the first restriction endonuclease is Pst I-HF and the second restriction endonuclease is Hind III-HF; Alternatively, the first restriction endonuclease is Kpn I-HF and the second restriction endonuclease is Hind III-HF.

3. The method according to claim 1, characterized in that: In the step 6), the separation is performed by urea-denatured polyacrylamide gel electrophoresis.

4. The method according to claim 1 or 3, characterized in that: In the step 6), the shorter one of the two ssDNAs of different lengths is the target sequence.

5. The method according to claim 1, characterized in that In the step 2), every 3 to 4 repeating units are connected in series to form a large repeating unit, and the large repeating units are connected in series via a linker sequence.

6. The method according to claim 1 or 5, characterized in that: In the step 2), the length of the fusion sequence is ≤2k.

7. The method according to claim 1, characterized in that In the step 3), the high copy vector includes pUC57.

8. The method according to claim 1, characterized in that In the step 1), the target sequence includes telomeric ssDNA, human promoter ssDNA or HIV ssDNA; The nucleotide sequence of the telomeric ssDNA is shown in SEQ ID NO.1; The nucleotide sequence of the human promoter ssDNA is shown in SEQ ID NO.2; The nucleotide sequence of the HIV ssDNA is shown in SEQ ID NO.

3.

9. The method according to claim 8, characterized in that When the target sequence is telomeric ssDNA, the concatenation in step 2) is a concatenation of 12 repeating units to obtain a fusion sequence; When the target sequence is a human promoter ssDNA, the tandem connection is a connection of 20 repeating units to obtain a fusion sequence; When the target sequence is HIV ssDNA, the concatenation is 15 repeating units in series to obtain a fusion sequence.

10. The method according to claim 1, characterized in that In the step 5), the culture medium 15 The concentration of NH4Cl is ≥1g / L; 13 C-glucose concentration ≥4g / L.

11. The method according to claim 1, characterized in that The step 7) further comprises: recovering another ssDNA except the target sequence.

12. Use of the stable isotope-labeled ssDNA obtained by the method according to any one of claims 1 to 11 in preparing a product for screening drugs targeting HIV LTR-III G4.

Images