Nucleic acid hairpin based triggered hydrogels and uses thereof

Abstract

Disclosed herein are hydrogels containing a nucleic acid based polymer matrix and optionally cargo. In certain embodiments, a CRISPR nuclease, such as Cas12a, is dispersed within the hydrogel for the purpose of selectively cleaving nucleic acid based unfolded single strands of originally crosslinked hairpins leading to hydrogel degradation. The hydrogels may be designed to respond to piconewton-scale forces, enabling potential applications in mechanically-triggered drug delivery and force sensing in cellular environments.

Description

[0001] NUCLEIC ACID HAIRPIN BASED TRIGGERED HYDROGELS AND USES THEREOF

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 583,948 filed September 20, 2023. The entirety of this application is hereby incorporated by reference for all purposes.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with government support under GM131099, AKI72452, and GM145394 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0006] INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED AS AN XML FILE VIA THE OFFICE ELECTRONIC FILING SYSTEM

[0007] The Sequence Listing associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is 23186PCT.xml. The XML file is 13,690 bytes, was created on September 19, 2024, and is being submitted electronically via the USPTO patent electronic filing system.

[0008] BACKGROUND

[0009] Self-immolative polymers (SIPs) are a class of polymers that disintegrate their polymer network upon external triggers such as chemical cues. Because SIPs release materials trapped inside the network upon degradation, they are useful for drug delivery systems and sensors. Hydrogels are a class of polymers that contain a three-dimensional network of hydrophilic polymer chains and are used for a wide variety of applications, including biosensing, drug delivery, extracellular matrix mimics for tissue engineering, cell adhesion, immunotherapy, and cancer therapy. There is a need for hydrogel materials that can self-degrade in response to mechanical force inputs, particularly at the piconewton scale relevant to cellular environments that can undergo controlled degradation in response to mechanical stimuli. Chen et al. report CRISPR-Casl2a target binding unleashes indiscriminate single-stranded DNase activity. Science, 2018, 360(6387):436-439.

[0010] Zhan et al. report comparison of bioorthogonally cross-linked hydrogels for in situ cell encapsulation. ACS Appl Bio Mater, 2019, 2, 2862-2871.

[0011] Gayet et al. report creating CRISPR-responsive smart materials for diagnostics and programmable cargo release. Nat Protoc, 2020, 15(9):3030-3063.

[0012] Xiong et al. report functional DNA regulated CRISPR-Casl2a sensors for point-of-care diagnostics of non-nucleic acid targets. JACS, 2020, 142(l):207-13.

[0013] Broughton et al. report CRISPR-Cas 12-based detection of SARS-CoV-2. Nat Biotechnol, 2020, 38(7):870-874.

[0014] Cofsky et al. report CRISPR-Cas 12a exploits R-loop asymmetry to form double-strand breaks. eLife 2020, 9:e55143.

[0015] Nalefski et al. report Kinetic analysis of Casl2a and Casl3a RNA-Guided nucleases for development of improved CRISPR-Based diagnostics. iScience, 2021, 24(9): 102996.

[0016] Barker et al. report biodegradable DNA-enabled poly(ethylene glycol) hydrogels prepared by copper-free click chemistry. Journal of Biomaterials Science, Polymer Edition, 2016, 27:1, 22- 39.

[0017] US Patent App. No. 2017 / 0260575, US Patent App. No. 2019 / 0219600 , WO 2021 / 236651, and WO 2024 / 086616.

[0018] References cited herein are not an admission of prior art.

[0019] SUMMARY

[0020] Disclosed herein are hydrogels materials containing a nucleic acid based polymer matrix. In certain embodiments, a CRISPR nuclease, e.g. Casl2a, is dispersed within the hydrogel for the purpose of selectively cleaving crosslinked hairpins. In certain embodiments, hydrogels contain a nucleic acid based polymer matrix and optionally cargo. In certain embodiments, a CRISPR nuclease, such as Casl2a, is dispersed within the hydrogel for the purpose of selectively cleaving nucleic acid based unfolded single strands of originally crosslinked hairpins leading to hydrogel degradation.

[0021] Although it is not intended that embodiments of this disclosure be limited by any particular mechanism, it is believed that when the hairpins unfolded, the nuclease cleaves the polymer accelerating degradation of the hydrogel material. In certain embodiments, the hydrogel nucleic acid based polymer matrix is designed to respond to piconewton-scale forces, enabling potential applications in mechanically-triggered drug delivery and force sensing in cellular environments.

[0022] In certain embodiments, this disclosure relates to hydrogels comprising: a polymer network of DNA crosslinks, wherein the DNA crosslinks comprise hairpin structures that unfold under applied force and a nuclease dispersed within the hydrogel; wherein the nuclease selectively cleaves the DNA crosslinks when unfolded. In certain embodiments, the hydrogels are force- triggered and unfold under an applied force, and the nuclease dispersed within the hydrogel selectively cleaves DNA crosslinks when unfolded leading to hydrogel degradation.

[0023] In certain embodiments, this disclosure relates to DNA hairpin structures and force- triggered self-immolative hydrogels incorporating such structures. In certain embodiments, a DNA hairpin structure is provided, comprising: a double-stranded stem region; a loop region connecting the 5' and 3' ends of the stem region; and at least one chemical modification that increases resistance to Casl2a cleavage.

[0024] In certain embodiments, this disclosure relates to a hydrogel comprising a polymer network, DNA crosslinks connecting portions of the polymer network, wherein the DNA crosslinks comprise hairpin structures that unfold under applied force; and a nuclease dispersed within the hydrogel, wherein the nuclease selectively cleaves the DNA crosslinks when unfolded.

[0025] In some embodiments, the loop region comprises a non-nucleotide spacer, such as a polyethylene glycol (PEG) spacer or other hydrophilic spacer. In some embodiments, the PEG spacer may comprise 6 to!2 ethylene glycol units.

[0026] In some embodiments, the chemical modification comprises one or more phosphorothioate linkages, such as at the junction between the stem region and the loop region. In some embodiments, the stem region has a GC content of at least 70%, 80%, or 90%.

[0027] In certain embodiments, the polymer network comprises polyethylene glycol (PEG). In certain embodiments, the DNA crosslinks comprise a loop region and a stem region wherein the loop region comprises a non-nucleotide spacer. In certain embodiments, the non-nucleotide spacer is a PEG spacer.

[0028] In certain embodiments, the stem region comprises nuclease-resistant modifications. In certain embodiments, the nuclease-resistant modifications comprise phosphorothioate linkages. In certain embodiments, the hydrogel further comprising cargo encapsulated within the hydrogel. In certain embodiments, the cargo comprises nanoparticles encapsulated within the polymer network. In certain embodiments, the cargo molecules comprise therapeutic agents, imaging agents, or nanoparticles. In certain embodiments, the imaging agents are fluorescent molecules, radioisotopes, or other labels.

[0029] In certain embodiments, this disclosure relates to a hydrogel comprising: a polymer network; and a plurality of the DNA hairpin structures as reported herein incorporated as crosslinkers in the polymer network. In certain embodiments, polymer network comprises polyethylene glycol (PEG). In certain embodiments, the hydrogel further comprises cargo molecules encapsulated within the polymer network.

[0030] In certain embodiments, this disclosure relates to methods of triggering release of cargo molecules from a hydrogel by contacting a hydrogel as reported herein, e g., containing cargo, with a mechanical force on the hydrogel sufficient to unfold at least a portion of the DNA hairpin structures, thereby exposing the unfolded structures to Casl2a cleavage and triggering degradation of the hydrogel. In certain embodiments, the methods further comprise detecting release of cargo molecules from the hydrogel upon degradation.

[0031] In certain embodiments, the polymer network comprises DNA crosslinks and polyethylene glycol (PEG). In certain embodiments, the DNA crosslinks comprise a loop region and a stem region. In certain embodiments, the loop region comprises a non-nucleotide spacer such as a PEG spacer. In certain embodiments, the stem region comprises nuclease-resistant modifications such as phosphorothioate linkages.

[0032] In certain embodiments, this disclosure relates to methods of triggering degradation of a hydrogel comprising: providing a hydrogel comprising a polymer network crosslinked with force- responsive DNA structures and containing a nuclease; and applying a mechanical force to the hydrogel sufficient to unfold the DNA structures, thereby exposing the DNA structures to cleavage by the nuclease.

[0033] In certain embodiments, the mechanical force is a compressive force. In certain embodiments, the force is of less than 1.0 N, 1.0 mN, or of less than 1.0 nN, or in the piconewton range. In certain embodiments, degradation of the hydrogel results in release of cargo encapsulated within the hydrogel. In certain embodiments, this disclosure relates to methods of making a force-responsive hydrogel comprising providing polymer precursors functionalized for crosslinking, providing DNA hairpin structures functionalized for crosslinking, and combining the polymer precursors, DNA hairpin structures, and a nuclease to form a hydrogel wherein the DNA hairpin structures crosslink the polymer network.

[0034] In certain embodiments, the polymer precursors comprise tetra-arm PEG functionalized with alkyne groups or cycloalkyne groups or aryl substituted with alkyne groups or aryl fused with cycloalkyne groups, e.g., dibenzocyclooctyne (DBCO) groups. In certain embodiments, the DNA hairpin structures are functionalized with azide groups.

[0035] In certain embodiments, the method further comprises encapsulating cargo within the hydrogel during formation. In certain embodiments, the nuclease is CRISPR Casl2a.

[0036] In certain embodiments, the method further comprises applying a mechanical force to the hydrogel to trigger degradation.

[0037] In certain embodiments, this disclosure relates to methods of triggered release from a hydrogel, comprising providing the hydrogel as reported herein and applying a mechanical force to the hydrogel sufficient to unfold at least a portion of the DNA hairpin structures, thereby exposing the unfolded structures to Casl2a cleavage and triggering degradation of the hydrogel. In certain embodiments, the method further comprises detecting release of cargo molecules from the hydrogel upon degradation. In certain embodiments, the mechanical force is applied by compression, stretching, or shear stress.

[0038] In certain embodiments, this disclosure relates to methods of triggered release from a hydrogel, comprising providing the hydrogel disclosed herein; and applying a mechanical force to the hydrogel sufficient to unfold at least a portion of the DNA hairpin structures, thereby exposing the unfolded structures to Cast 2a cleavage and triggering degradation of the hydrogel.

[0039] In certain embodiments, degradation kinetics of the hydrogel are tuned by varying one or more of GC content of the DNA hairpin structures, concentration of Casl2a, incubation time, and magnitude of applied force.

[0040] In certain embodiments, this disclosure relates to kits comprising a DNA hairpin structure as reported herein, a polymer for forming a hydrogel network, and instructions for incorporating the DNA hairpin structure as a crosslinker in the hydrogel network. In certain embodiments, kit further comprises one or more of Casl 2a enzyme, a guide RNA for Casl 2a; and cargo molecules for encapsulation in the hydrogel.

[0041] BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0042] Figure 1 shows a schematic of the force-triggered self-destructive hydrogel. The hydrogel composed of force-responsive DNA crosslinks and tetra PEG as the backbone polymer. DNA hairpins (HPs) are resistant to cleavage. Force-induced opening of DNAHP sites leads to CRISPR- Casl2a cleavage of the DNA. Arrows indicate the external force and the force experienced by polymer backbone, respectively. The cleavage of ssDNA crosslinks triggers the self-destruction of the hydrogel.

[0043] Figure 2 shows data from experiments that were conducted to find the optimal crosslinker for the force-triggered SDP hydrogel. Casl 2a activity on the DNA crosslinkers was quantified. First, DNA crosslinker was annealed and mixed with activated Casl2a enzyme for various time points, and then analyzed with PAGE over different incubation times or with HPLC at indicated time points. For the PAGE analysis, the intensity of the DNA crosslinker was compared at different time points with or without Casl 2a. DNA structures used for the optimizations, i) ssDNA, ii) dsDNA, iii) DNAHP, iv) locked DNAHP, v) dsDNA with PEG6 spacer, vi) dsDNAwith (PEG6)2 spacer, vii) dsDNAwith PEG6 spacer with PS modifications at the base of loop, viii) dsDNAwith (PEG6)2 spacer with PS modifications at the base of loop, ix) ssDNA linked by PEG spacer with PS modifications at the connection of ssDNA and PEG spacer. Bar graph of Casl 2a cleavage (%) of DNA structures (v-ix) in NEB r2.1 buffer at room temperature at 6 h time point.

[0044] Figure 3 illustrates the synthesis the force-responsive DNA crosslinked tetra PEG hydrogel. Synthesis of tetra PEG DBCO was conducted in anhydrous DMSO by mixing tetra PEG amine (MW = 10 000 g mol-1, n is / averages approximately 57) and DBCO NHS ester, and the final product was purified by reversed-phase HPLC.

[0045] Figure 4 illustrates the synthesis of bisazide-modified DNA crosslinkers was conducted by mixing diamine-modified DNA crosslinkers with azido PEG4 NHS ester at 70% DMSO, lx PBS and 0.1 m NaHCOa for 30 min. The product was purified by HPLC.

[0046] Figure 5 illustrates synthesis of the DNA crosslinked hydrogel synthesized by crosslinking 2.5 mm tPEG DBCO and 5.0 mm bisazide-modified DNA. The crosslinking reaction was conducted in lx NEB r2.1 buffer with an equal ratio between DBCO and azide functional groups. Figure 6 shows data from of the force-triggered self-destruction of DNA crosslinked hydrogels. The bar graph shows the degradation of hydrogels under different conditions. The bars represent the hydrogels crosslinked by the tPEG-N3 (10k). The open bar on the right shows data for the DNA harpin (HP) crosslinked hydrogel.

[0047] DETAILED DESCRIPTION

[0048] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0049] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

[0050] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0051] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of medicine, organic chemistry, biochemistry, molecular biology, pharmacology, and the like, which are within the skill of the art. Such techniques are explained fully in the literature.

[0052] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings unless a contrary intention is apparent.

[0053] As used herein, the term "about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to + / - a percentage of the specified value. In embodiments, about includes the specified value. In certain embodiments, the term “about” can include a 5 % or 10 % difference.

[0054] As used in this disclosure and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") have the meaning ascribed to them in U.S. Patent law in that they are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The term “comprising” in reference to an oligonucleotide having a nucleic acid sequence refers to an oligonucleotide that may contain additional 5’ (5’ terminal end) or 3’ (3’ terminal end) nucleotides, i.e., the term is intended to include the oligonucleotide sequence within a larger nucleic acid. "Consisting essentially of' or "consists of' or the like, when applied to methods and compositions encompassed by the present disclosure refers to compositions like those disclosed herein that exclude certain prior art elements to provide an inventive feature of a claim, but which may contain additional composition components or method steps, etc., that do not materially affect the basic and novel characteristic(s) of the compositions or methods, compared to those of the corresponding compositions or methods disclosed herein. The term “consisting of’ in reference to an oligonucleotide having a nucleotide sequence refers an oligonucleotide having the exact number of nucleotides in the sequence and not more or having not more than a range of nucleotide expressly specified in the claim. For example, “5’ sequence consisting of’ is limited only to the 5’ end, i.e., the 3’ end may contain additional nucleotides. Similarly, a “3’ sequence consisting of’ is limited only to the 3’ end, and the 5’ end may contain additional nucleotides.

[0055] The term “conjugated” refers to linking molecular entities through covalent bonds, or by other specific binding interactions, such as due to hydrogen bonding or other van der Walls forces. The force to break a covalent bond is high, e.g., about 1500 pN for a carbon-to-carbon bond. The force to break a combination of strong protein interactions is typically a magnitude less, e.g., biotin to streptavidin is about 150 pN. Thus, a skilled artisan would understand that conjugation must be strong enough to restrict the breaking of bonds in order to implement the intended results. In certain embodiments, the term conjugated is intended to include linking molecular entities that do not break unless exposed to a force of about greater than about 5, 10, 25, 50, 75, 100, 125, or 150 pN depending on the context.

[0056] The terms, "nucleic acid," or "oligonucleotide," is meant to include nucleic acids, ribonucleic or deoxyribonucleic acid, mixtures, nucleobase polymers, or analog thereof. An oligonucleotide can include native or non-native bases. In this regard, a native deoxyribonucleic acid can have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine and a ribonucleic acid can have one or more bases selected from the group consisting of uracil, adenine, cytosine, or guanine.

[0057] The term "nucleobase polymer" refers to nucleic acids and chemically modified forms with nucleobase monomers. In certain embodiments, methods and compositions disclosed herein may be implemented with nucleobase polymers comprising units of a ribose, 2’deoxyribose, locked nucleic acids (l-(hydroxymethyl)-2,5-dioxabicyclo[2.2.1]heptan-7-ol), 2'-O-methyl groups, a 3'- 3 '-inverted thymidine, phosphorothioate linkages, or combinations thereof. In certain embodiments, the nucleobase polymer may be less than 100, 50, or 35 nucleotides or nucleobases.

[0058] Nucleobase monomers are nitrogen containing aromatic or heterocyclic bases that bind to naturally occurring nucleic acids through hydrogen bonding otherwise known as base pairing. A typical nucleobase polymer is a nucleic acid, RNA, DNA, or chemically modified form thereof. A nucleobase polymer may be single or double stranded or both, e.g., they may contain overhangs. Nucleobase polymers may contain naturally occurring or synthetically modified bases and backbones. In certain embodiments, a nucleobase polymer need not be entirely complementary, e.g., may contain one or more insertions, deletions, or be in a hairpin structure provided that there is sufficient selective binding.

[0059] A "label" refers to a detectable compound or composition that is conjugated directly or indirectly to another molecule, such as an antibody or a protein, to facilitate detection of that molecule. Specific, non-limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes. A label includes the incorporation of a radiolabeled amino acid or the covalent attachment of biotinyl moieties to a polypeptide that can be detected by marked avidin (for example, streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or colorimetric methods). Various methods of labeling are known in the art and may be used. Examples of labels include, but are not limited to, the following: radioisotopes or radionucleotides (such as18F,3?S or131I) fluorescent labels (such as fluorescein isothiocyanate (FITC), rhodamine, lanthanide phosphors), enzymatic labels (such as horseradish peroxidase, betagalactosidase, luciferase, alkaline phosphatase), chemiluminescent markers, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (such as a leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), or magnetic agents, such as gadolinium chelates. In some embodiments, labels are attached by spacer arms of various lengths to reduce potential steric hindrance.

[0060] Unless stated otherwise as apparent from the following discussion, it will be appreciated that terms such as “detecting,” “receiving,” “quantifying,” “mapping,” “generating,” “registering,” “determining,” “obtaining,” “processing,” “computing,” “deriving,” “estimating,” “calculating,” “inferring” or the like may refer to the actions and processes of a computer system, or similar electronic computing device, that manipulates and transforms data represented as physical (e.g., electronic) quantities within the computer system's registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage, transmission or display devices. Embodiments of the methods described herein may be implemented using computer software. If written in a programming language conforming to a recognized standard, sequences of instructions designed to implement the methods may be compiled for execution on a variety of hardware platforms and for interface to a variety of operating systems. In addition, embodiments are not described with reference to any particular programming language. It will be appreciated that a variety of programming languages may be used to implement embodiments of the disclosure.

[0061] In some embodiments, the disclosed methods may be implemented using software applications that are stored in a memory and executed by a processor (e.g., CPU) provided on the system. In some embodiments, the disclosed methods may be implanted using software applications that are stored in memories and executed by CPUs distributed across the system. As such, the modules of the system may be a general purpose computer system that becomes a specific purpose computer system when executing the routine of the disclosure. The modules of the system may also include an operating system and micro instruction code. The various processes and functions described herein may either be part of the micro instruction code or part of the application program or routine (or combination thereof) that is executed via the operating system.

[0062] It is to be understood that the embodiments of the disclosure may be implemented in various forms of hardware, software, firmware, special purpose processes, or a combination thereof. In one embodiment, the disclosure may be implemented in software as an application program tangible embodied on a computer readable program storage device. The application program may be uploaded to, and executed by, a machine comprising any suitable architecture. The system and / or method of the disclosure may be implemented in the form of a software application running on a computer system, for example, a mainframe, personal computer (PC), handheld computer, server, etc. The software application may be stored on a recording media locally accessible by the computer system and accessible via a hard wired or wireless connection to a network, for example, a local area network, or the Internet.

[0063] It is to be further understood that because some of the constituent system components and method steps depicted in the accompanying figures may be implemented in software, the actual connections between the systems components (or the process steps) may differ depending upon the manner in which the disclosure is programmed. Given the teachings of the disclosure provided herein, one of ordinary skill in the related art will be able to contemplate these and similar implementations or configurations of the disclosure.

[0064] The clustered regularly interspaced short palindromic repeat (CRISPR) system is a prokaryotic adaptive immune system that has been modified to enable general genome engineering in a variety of organisms and cell lines. CRISPR-Cas (CRISPR associated) systems are protein- RNA complexes that use an RNA molecule (crRNA) as a guide (gRNA segment) to localize the complex to a target nucleic acid sequence via base-pairing. In the natural systems, a CRISPR associated (Cas) proteins then acts as a nuclease to cleave the targeted DNA sequence. The target sequence contains a "protospacer-adjacent motif' (PAM) oligonucleotide adjacent to the target region in order for the system to function.

[0065] Among the known Cas nucleases, Casl2a (also known as Cpfl) and S. pyogenes Cas9 has been widely reported. See e.g., GenBank accession number AJI56734.1 is reported as a 939 CRISPR-associated protein from Francisella philomiragia (Casl2a). Casl2a is a single RNA- guided endonuclease. Casl2a-associated CRISPR arrays are processed into mature crRNAs without the requirement of an additional trans-activating crRNA (tracrRNA). Casl2a-crRNA complexes efficiently cleave target DNA proceeded by a short T-rich protospacer-adjacent motif (PAM) and the target sequence is typically in the 3’ direction (downstream) from the PAM sequence. See Zetsche et al. Cpfl is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 2015, 163(3):759-71. CRISPR-Casl2a (Cpf 1 ) is a class 2 type V-A enzyme that binds with a single-stranded guide CRISPR RNA (crRNA). The crRNA-loaded Casl2a can be activated using two different approaches. The first is by binding to a complementary target double stranded DNA (activator) containing a PAM sequence. Double stranded DNA lacking the PAM is a poor activator of Casl2a. Alternatively, Casl2a can be activated by binding to a complementary target single stranded activator DNA. In this case, the PAM sequence is not required to potently activate the nuclease. RNA-guided DNA binding unleashes indiscriminate single-stranded DNA (ssDNA) cleavage activity by Casl2a that completely degrades ssDNA molecules. See Chen et al. CRISPR-Casl2a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018, 360(6387): 436-439.

[0066] Nalefski et al. report kinetic analysis of Casl2a and Casl3a RNA-Guided nucleases for development of improved CRISPR-based diagnostics. iScience, 2021, 24(9): 102996. In certain embodiments, it is contemplated that for any of the compositions and methods disclosed herein the DNA nucleic acid within the hydrogel are substituted with RNAs for which use of Casl3a is substituted for Casl2a.

[0067] In certain embodiments, this disclosure relates to Casl2a-resistant DNA hairpin structures, comprising: a double- stranded stem region; a loop region connecting the 5' and 3' ends of the stem region; and at least one chemical modification that increases resistance to Casl2a cleavage.

[0068] In certain embodiments, the loop region comprises a non-nucleotide spacer. In certain embodiments, the non-nucleotide spacer is a polyethylene glycol (PEG) spacer. In certain embodiments, the PEG spacer comprises 6 to 12 ethylene glycol units. In certain embodiments, the chemical modification comprises one or more phosphorothioate linkages. In certain embodiments, the phosphorothioate linkages are located at the junction between the stem region and the loop region. In certain embodiments, the stem region has a GC content of at least 70% 80%, or 90%. In certain embodiments, the hairpin has a PEG spacer in the loop region and two phosphorothioate linkages at the junction between the stem region and the loop region.

[0069] In certain embodiments, this disclosure relates to force-triggered self-destructive hydrogels. In some embodiments, the hydrogels comprise a polymer network crosslinked with force-responsive DNA structures. The DNA crosslinks may comprise hairpin structures that unfold under applied mechanical force. A nuclease such as CRISPR Casl2a may be dispersed within the hydrogel. The nuclease selectively cleaves the DNA crosslinks when they are unfolded by force, leading to degradation of the hydrogel.

[0070] The hydrogels may be designed to respond to piconewton-scale forces, making them suitable for applications in cellular environments. Degradation of the hydrogels can result in release of encapsulated cargo, enabling potential uses in areas such as mechanically-triggered drug delivery.

[0071] In certain embodiments, components of the hydrogel system comprise a polymer network, such as tetra-arm PEG, DNA hairpin crosslinks connecting the polymer network, a CRISPR nuclease such as CRISPR Casl2a dispersed within the hydrogel, and optionally encapsulated cargo (e.g. gold nanoparticles) for release upon degradation.

[0072] The DNA hairpins serve as force sensors, undergoing a structural transition controlled by mechanical input. The nuclease provides selective degradation activated by the mechanically- induced conformational change of the DNA.

[0073] In certain embodiments, the DNA hairpins may be designed with features to minimize background cleavage in the absence of force while retaining force-responsiveness. For example, the hairpins may incorporate non-nucleotide spacers in the loop region and nuclease-resistant modifications in the stem region.

[0074] The polymer network provides the structural framework of the hydrogel. In some embodiments, the polymer network comprises polyethylene glycol (PEG). PEG-based polymers may be used due to their biocompatibility and ability to form robust covalently crosslinked networks.

[0075] In certain implementations, tetra-arm PEG (tPEG) is used. The tPEG may have a molecular weight of about 10,000 g / mol. The tPEG may be functionalized with reactive groups to enable crosslinking, such as dibenzocyclooctyne (DBCO) groups or other alkyne groups.

[0076] In some embodiments, the DNA hairpin crosslinks connect portions of the polymer network and provide force-responsiveness to the hydrogel. In certain embodiments, hairpins comprise a stem region that is double-stranded at equilibrium and having a single-stranded loop region connecting the double-stranded strands by covalent bonds.

[0077] In some embodiments, the loop region comprises a non-nucleotide spacer such as a PEG spacer. The PEG spacer may increase stability of the hairpin structure in the absence of force. In some embodiments, the stem region may comprise nuclease-resistant modifications such as phosphorothioate linkages. These modifications may be incorporated at the base of the stem near the loop to minimize non-force-triggered cleavage. In some embodiments, the DNA hairpins may be functionalized at both ends to enable crosslinking to the polymer network. For example, the hairpins may be modified with azide groups for click chemistry reactions with DBCO- functionalized polymers.

[0078] A nuclease enzyme dispersed within the hydrogel provides for selective degradation of unfolded DNA crosslinks. In some embodiments, the nuclease is CRISPR Casl2a. The Casl2a selectively cleaves single-stranded DNA while having minimal activity against double-stranded DNA. This selectivity enables Casl2a to cleave the DNA hairpins when unfolded by force, while leaving folded hairpins largely intact. The concentration of nuclease may be optimized to achieve a desired balance between force-triggered degradation and background degradation in the absence of force.

[0079] The hydrogels may encapsulate cargo for release upon degradation. In some implementations, gold nanoparticles are used as a model cargo; however other cargo such as therapeutic agents or detectable agents are contemplated. The gold nanoparticles may be about 100 nm in diameter and may be surface-functionalized, for example with thiolated PEG. Release of the nanoparticles can be monitored to assess hydrogel degradation, for example by UV-vis spectroscopy. Other types of cargo may be encapsulated depending on the intended application, such as cells or therapeutic agents for drug delivery. In certain embodiments, the therapeutic agents are small molecules, proteins, antibodies, anti-inflammatory agents, antimicrobial agents, antibiotics, antiviral agents, or anti-cancer agents.

[0080] In some embodiments, the hydrogels are synthesized by combining the following components tetra-PEG-DBCO, bisazide-modified DNA hairpins, CRISPR Casl2a nuclease, encapsulated cargo (e.g. gold nanoparticles) and a buffer solution. In some embodiments, the tetra- PEG-DBCO and bisazide-DNA may be mixed and incubated briefly to allow initial gelation. The Casl2a nuclease may then be added and allowed to disperse throughout the forming gel. In some implementations, the hydrogel precursor solution is placed on a solid surface, e.g., modified glass slide and incubated at 37°C for about 10 minutes to complete gelation.

[0081] To trigger degradation, mechanical force is applied to the hydrogel to unfold the DNA hairpin crosslinks. In some embodiments, a compressive force is used. In some embodiments, the hydrogel may be sandwiched between two glass slides with spacers to control the gel thickness. Force may be applied by clamping or weighting the glass slides. The applied strain may be quantified by measuring the hydrogel area before and after compression. The hydrogel volume and spacer thickness may be optimized to achieve reproducible strain application.

[0082] A library of DNA structures was screened to identify properties that would minimize background cleavage by Casl2a while maintaining force-responsiveness. Structures tested included single-stranded DNA, double-stranded DNA, conventional DNA hairpins, and modified hairpins. DNA structures (100 nM) were incubated with activated Casl2a (100 pM) in reaction buffer at room temperature. Aliquots were taken at various timepoints and analyzed by polyacrylamide gel electrophoresis and HPLC to quantify DNA cleavage.

[0083] The experiments indicated that single-stranded DNA showed the highest cleavage rate, double-stranded DNA was most resistant to cleavage, conventional DNA hairpins showed intermediate cleavage rates, incorporating a PEG spacer in the hairpin loop increased stability, adding phosphorothioate modifications near the hairpin base further reduced cleavage. Based on these results, a DNA hairpin design was selected incorporating a PEG4 spacer in the loop and phosphorothioate modifications at the base for use as the hydrogel crosslinker.

[0084] Hydrogels were synthesized by combining 2.5 mM tetra-PEG-DBCO (10 kDa), 5.0 mM bisazide-modified DNA hairpin crosslinker, NEB 2.1 reaction buffer, gold nanoparticles (100 nm diameter, PEG-coated). The precursors were mixed, and 30 pL was immediately transferred to a modified glass slide. The hydrogel was allowed to form for 10 minutes at 37°C. Gelation was confirmed visually and by rheology. Time sweep experiments showed rapid gelation, with storage modulus (G) and loss modulus (G") reaching stable values within 1 minute.

[0085] Hydrogels made with DNA hairpin crosslinks showed approximately 2-fold higher stiffness compared to those made with linear single-stranded DNA crosslinks of the same contour length. This difference was attributed to the more compact structure of the folded hairpins. The mechanical properties of the hydrogels could be tuned by modifying the GC content of the DNA hairpin stems. Increasing GC content from 0% to 100% resulted in an increase in hydrogel stiffness from about 68 Pa to about 200 Pa.

[0086] To demonstrate force-triggered degradation, hydrogels were synthesized with the addition of 8 pM CRISPR Casl2a nuclease. The hydrogels were sandwiched between two glass slides with 200 pm spacers. Three conditions were tested: 1) no Casl2a, with applied force 2) with Casf2a, no applied force and 3) with Casl2a and applied force. Force was applied by clamping the glass slides. Hydrogels were incubated at 37°C for 3 hours. Degradation was assessed by release of encapsulated gold nanoparticles, quantified by UV-vis spectroscopy. The experimental results indicate that both the presence of Cast 2a and application of force are required for rapid and complete hydrogel degradation. The partial degradation observed with Casl2a alone may be due to background cleavage from transient unfolding of the DNA hairpins. Force-triggered degradation was further validated by rheology experiments. Hydrogels containing Casl2a showed a sudden drop in measured force after a period of slow relaxation when compressed, indicating rapid degradation of the gel structure.

[0087] In certain embodiments, this disclosure contemplates hydrogels comprising Casl2a and crosslinked DNA with hairpins and uses thereof. In certain embodiments, the hydrogels are force- triggered and unfold under an applied force. Casl2a dispersed within the hydrogel selectively cleaves DNA crosslinks when unfolded, leading to hydrogel degradation. The hydrogels may be designed to respond to pi conewton- scale forces, enabling potential applications in mechanically- triggered drug delivery and force sensing in cellular environments.

[0088] The force-triggered self-destructive hydrogels described herein offer several potential advantages. (1) Selective degradation: The hydrogels selectively degrade in response to mechanical force inputs, enabling targeted release of encapsulated cargo. (2) Tunable response: The force sensitivity and degradation kinetics can be tuned by modifying properties of the DNA crosslinks, such as GC content and chemical modifications. (3) Biocompatibility: The use of DNA and PEG-based materials offers potential biocompatibility for biomedical applications. (4) Piconewton force sensitivity: The hydrogels can respond to forces in the piconewton range, relevant to cellular environments. (5) Programmability: The DNA-based design allows for programmable and modular engineering of the hydrogel properties. (6) Rapid degradation: Under appropriate conditions, the hydrogels can undergo rapid self-destruction upon force application. (7) Cargo release: The degradation mechanism enables release of encapsulated cargo in response to mechanical stimuli.

[0089] The force-triggered self-destructive hydrogels described herein may find use in various applications. (1) Drug delivery: The hydrogels could enable mechanically-triggered release of therapeutic agents. This may be useful for targeting drug delivery to disease sites where cells exert unusually high traction forces or regions of elevated shear flow. (2) Biosensing: The force- responsive degradation could be used to detect and quantify mechanical forces in biological systems. (3) Tissue engineering: The hydrogels may serve as dynamic scaffolds that respond to cellular forces during tissue development or regeneration. (4) Smart materials: The force-triggered degradation mechanism could be incorporated into other material systems to create mechanically- responsive smart materials.

[0090] Casl2a-Resistant DNA Hairpin Substructure Sequences

[0091] Locked HP for PAGE

[0092] TACCGCACAGATGCGTTATTTTATTTTATTTTTTAATAAAATAAAATAAAAGAGCGCCA CGTAG (SEQ ID NO: 1)

[0093] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 1, and uses in methods disclosed herein.

[0094] Locking strand for locked HP

[0095] CTACGTGGCGCTCTTCGCATCTGTGCGGTA(SEQ ID NO: 2)

[0096] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO:2, and uses in methods disclosed herein.

[0097] DNA HP (80% GC content)

[0098] GGCCCGACGTGCGACCGGCGTCGCACGTCGGGCC (SEQ ID NO: 3)

[0099] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO:3, and uses in methods disclosed herein. dsDNA sequence 1

[0100] GCCGCCCGGCGGGCCGGGCGCCGGCCCGCG (SEQ ID NO: 4)

[0101] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NON, and uses in methods disclosed herein. dsDNA sequence 2

[0102] CGCGGGCCGGCGCCCGGCCCGCCGGGCGGC (SEQ ID NO: 5) In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO:5, and uses in methods disclosed herein. ssDNA

[0103] CTGTCCTGACGTGCTTCGTCCTGACGTGCGGCTC (SEQ ID NO: 6)

[0104] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO:6, and uses in methods disclosed herein.

[0105] DNA HP with PEG6 Spacer

[0106] GGCCTGACGTGCGGC (SEQ ID NO: 7)(PEG6) GCCGCACGTCAGGCC(SEQ ID NO: 8)

[0107] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 7 and SEQ ID NO: 8, and uses in methods disclosed herein.

[0108] DNA HP with (PEG6)2 Spacer

[0109] GGCCTGACGTGCGGC(SEQ ID NO: 7) (PEG6)(PEG6) GCCGCACGTCAGGCC(SEQ ID NO: 8)

[0110] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 7 and SEQ ID NO: 8, and uses in methods disclosed herein.

[0111] PS DNA HP with PEG6Spacer

[0112] GGCCTGACGTGCGGC*(SEQ ID NO: 7) (PEG6)*GCCGCACGTCAGGCC

[0113] (SEQ ID NO: 8)

[0114] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 7 and SEQ ID NO: 8, and uses in methods disclosed herein. In certain embodiments, SEQ ID NO: 7 and SEQ ID NO: 8 are covalently connected by a flexible spacer, e.g., polyethylene glycol spacer and optionally contains a phosphorothioate (PS) bond, i.e., substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of the 3’ C and 5’G.

[0115] PS DNA HP with (PEG6)2 Spacer

[0116] GGCCTGACGTGCGGC*(SEQ ID NO: 7) (PEG6)(PEG6) *GCCGCACGTCAGGCC(SEQ ID NO: 8) In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 7 and SEQ ID NO: 8, and uses in methods disclosed herein. In certain embodiments, SEQ ID NO: 7 and SEQ ID NO: 8 are covalently connected by a flexible spacer, e.g., polyethylene glycol spacer and optionally contains a phosphorothioate (PS) bond, i.e., substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of the 3’ C and 5’G.

[0117] PS ssDNA

[0118] CTGTCCTGACGTGCT*(SEQ ID NO: 9) (PEG6) *CCTGACGTGCGGCTC (SEQ ID NO: 10)

[0119] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 9 and SEQ ID NO: 10, and uses in methods disclosed herein. In certain embodiments, SEQ ID NO: 9 and SEQ ID NO: 10 are covalently connected by a flexible spacer, e g., polyethylene glycol spacer and optionally contains a phosphorothioate (PS) bond, i.e., substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of the 3’ T and 5’C.

[0120] Bisamine modified, PS ssDNA

[0121] / 5AmMC6 /

[0122] CTGTCCTGACGTGCT*(SEQ ID NO: 9) (PEG6) *CCTGACGTGCGGCTC (SEQ ID NO: 10) / 3AmM0 /

[0123] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 9 and SEQ ID NO: 10, and uses in methods disclosed herein. In certain embodiments, SEQ ID NO: 9 and SEQ ID NO: 10 are covalently connected by a flexible spacer, e.g., polyethylene glycol spacer and optionally contains a phosphorothioate (PS) bond, i.e., substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of the 3’ T and 5’C.

[0124] Bisamine modified 80% GC HP Spacer

[0125] / 5AmMC6 /

[0126] GGCCTGACGTGCGGC* (SEQ ID NO:7) (PEG6) *GCCGCACGTCAGGCC (SEQ ID NO: 8) / 3AmM0 /

[0127] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 7 and SEQ ID NO: 8, and uses in methods disclosed herein. In certain embodiments, SEQ ID NO: 7 and SEQ ID NO: 8 are covalently connected by a flexible spacer, e g., polyethylene glycol spacer and optionally contains a phosphorothioate (PS) bond, i.e., substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of the 3’ C and 5’G.

[0128] Bisamine modified 100% GC HP

[0129] / 5AmMC6 /

[0130] GGCCCGCCGGGCGGC* (SEQ ID NO: 11)(PEG6) *GCCGCCCGGCGGGCC(SEQ ID NO: 12) / 3AmM0 /

[0131] In certain embodiments, this disclosure contemplates compositions comprising the nucleic acids comprising SEQ ID NO: 11 and SEQ ID NO: 12, and uses in methods disclosed herein. In certain embodiments, SEQ ID NO: 11 and SEQ ID NO: 12 are covalently connected by a flexible spacer, e.g., polyethylene glycol spacer and optionally contains a phosphorothioate (PS) bond, i.e., substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of the 3’ C and 5’G.

[0132] Force-Triggered Self-Destructive Hydrogels

[0133] Piconewton (pN) force-triggered self-destruction is distinguished from more classical force-induced polymer degradation where cavitation, ball-milling, or other forms of mechanical input are used to cleave covalent bonds using greater than 1 nN to N magnitude forces. For reference, typical C— C bonds have energies of about 100 kcal mol-1 which requires about 10 nN forces to drive bond scissure. In contrast, pN forces applied at a distance of about 7 nm is about 1 kcal mol-1 at the scale of H-bond energies. Hence, designing materials that can self-degrade with pN force inputs is a fundamental design challenge.

[0134] Hydrogels are polymers that contain a 3D network of hydrophilic polymer chains and are used for a wide variety of applications, including biosensing, drug delivery, extracellular matrix mimics for tissue engineering, cell adhesion, immunotherapy, and cancer therapy. Disclosed herein are DNA linkages introducing into hydrogel networks to encode a force-triggered self-destructive response. To create a force-triggered SDP using the DNA-linked hydrogel, two primary elements were utilized (1) a well-defined force-sensor domain that undergoes a structural transition that is controlled mechanically and (2) a selective degradation reaction that is exclusively activated by mechanically induced conformational changes. To satisfy these two criteria, DNA hairpins were used as the force sensor element and CRISPR Casl2a nuclease as the selective degradation system that is activated when DNA hairpins are unfolded under mechanical strain. DNA HPs unfold when 3' and 5' ends of the DNA HPs are pulled apart with an external force. CRISPR-Casl2a was tested for its ability to create a force-triggered SDP.

[0135] A force-responsive SDP was designed as shown in Figures 3-5, where the tetra PEG (tPEG) hydrogel is crosslinked using force-responsive DNA HPs that remain folded at equilibrium in the absence of external force. Although it is not intended that embodiments of this disclosure be limited by any particular mechanism, it is contemplated that when the force experienced by DNA HPs exceeds a threshold, DNA HPs unfold, and the cryptic Casl2a-vulnerable ssDNA sites become exposed. Because of this conformational change, Casl2a actively cleaves the ssDNA sites, leading to the breakage of the crosslinks and ultimately hydrogel self-destruction. A library of chemically modified HPs was screened to identify properties that would minimize the background cleavage. Hydrogels were formed by crosslinking tetra-PEG DBCO with bisazide-modified DNA. Force-triggered self-destruction of the hydrogel were characterized by measuring the degradation in response to external force first by applying a static force and then second by applying dynamic force using rheology. In both approaches, it was observed that hydrogels containing force-sensitive DNA HPs showed selective degradation under externally applied force and that hydrogel degradation highly depended on the enzyme concentration, incubation time, and the DNA sequence for the crosslinker.

[0136] It was unexpected that, DNA HPs hybridized with the locking strand (T-shaped HP) exhibited more rapid cleavage compared to the DNA HP. It was further decided to further refine the DNA HP structure and avoid the T-shaped design. DNA HPs showed greater degradation compared to that of dsDNA, likely due to the single-stranded loop domain in the DNA HP. Cleaved products were analyzed using denaturing AGE indicating hydrolysis was preferred at the stemloopjunction. PAGE showed that the HP was mainly cleaved into two ssDNA fragments regardless of the nucleobase composition of the HP To minimize this undesired cleavage of the HP (leakage reaction), the loop domain was replaced with two different-sized PEG loops (PEGe and (PEGe)?) and two phosphorothioate (PS) modifications were introduced at the base of PEG loop connecting the dsDNA stem,

[0137] Multiple different DNA structures were tested to identify an optimum DNA crosslinker. HPLC automated injection was performed after 1, 3, 6, 9, 12, 18, and 24 h. The integrated area under the peak in the chromatogram at 260 nm of the reaction mixture provided a quantitative readout of the trans cleavage activity of the Casl2a enzyme. The amount of intact DNA decreased over time due to enzyme cleavage. It was also observed that the amount of intact activator dsDNA decreased over time due to cis cleavage activity of the enzyme. By normalizing the area under the peak for samples treated with Casl2a to that of samples lacking Casl2a, the extent of hydrolysis and the cleavage rate (kobs) we were able to be quantify. The DNA cleavage efficiency was determined after 6 h of incubation (Figure 1).

[0138] Single stranded DNA (ssDNA) displayed the greatest cleavage rate (kobs) when treated with Casl2a compared to the panel of tested DNA structures. dsDNA and DNA HPs showed more resistance to Casl2a cleavage compared to that of ssDNA. It was discovered that the PEG loop significantly increased Casl2a resistance compared to that of conventional all-DNA HPs. The introduction of PS linkages along with the PEGe loop showed 16% cleavage after 6 h of incubation. In contrast, all DNA HP showed 36% cleavage at the same time point, thus indicating that these chemical modifications half the leakage of the assay. This increase in Casl2a resistance agrees with the PAGE data, which showed preferential cleavage at the base of the loop in all DNA HP. Two different sizes of PEG loops were tested as the length may affect the duplex stability at the base of loop structure and thus the stability against Cast 2a cleavage. The difference in the cleavage rate (kobs) of PEGe and (PEGe)? is insignificant, suggesting that both linker offers sufficient flexibility to stabilize the stem-loop structure avoiding cleavage at the nucleotides proximal to the loop. PS modified HP with PEGe and (PEGe)2 loop showed kobs = 0.060 h-1 and 0.066 h-1, respectively. The DNA HP design integrating phosphorothioate (PS) modifications at the junction with an internal PEGe loop was chose as the DNA crosslinker for the SDP as this afforded an approximately fivefold differential in Cast 2a cleavage rate when comparing the HP to the unstructured linear DNA. Future optimization using locked nucleic acids and other chemical modification is contemplated to enhance this differential.

[0139] It is contemplated that one can generate hydrogels that integrate this optimized force- responsive DNA HP as the crosslinkers. Different types of DNA-linked hydrogels were first evaluated, and it was decided to employ PEG-based polymers because of their greater stretchability and biocompatibility compared to that of polyacrylamide hydrogels. The DNA HP was specifically crosslinked with tetra-PEG (tPEG) macromolecules. Initial work to generate hydrogels by coupling tPEG with activated NHS-esters to bisamine-modified DNA were unsuccessful. The strain promoted azide-cyclooctyne click reaction between tPEG-DBCO and bisazide- functionalized DNA was used. As illustrated in Figure 3, tPEG-DBCO was synthesized by NHS reaction and purified using HPLC. The degree of DBCO-functionalization (DOF) of the tPEG macromolecule was evaluated by the absorbance at 307 nm of the conjugated DBCO (DOF = 3.77 ± 0.13) which showed a fairly pure monomer following purification. Note that tPEG-DBCO degrades slowly in solution and the partially degraded tPEG DBCO can significantly affect the crosslinking density and thus storage modulus (G’). Therefore, after synthesis, the product was lyophilized, aliquoted, and stored at -80 °C until needed. Azide-modified DNA crosslinkers were synthesized as shown in Figure 4. The formation of the bisazide modified DNA crosslinker was confirmed using ESI mass spectrometry.

[0140] Two types of hydrogels were synthesized by mixing 2.5 mm tPEG-DBCO with 5.0 mm bisazide DNA HP crosslinker or ss-DNA in NEB r2.1 buffer (containing recombinant Albumin). Both DNA crosslinkers were of identical length and composed of 30 nucleotides with a 6 ethylene glycol linker inserted in the middle. The ssDNA crosslinker simply scrambled one arm of the stem to denature the parent HP crosslinker. Qualitatively, the formation of the DNA HP hydrogel was confirmed using a pipette tip. Withholding the DNAHP crosslinker led the tip to sink to the bottom of the tube; in contrast, the sample containing both DNA HP crosslinker and tPEG formed a gel, which prevented the tip from sinking.

[0141] Quantitative characterization of the mechanical properties of the DNA crosslinked gel was performed using rheology. In the time sweep experiment, the two precursors were mixed and then recording G’ and G" using a parallel-plate rheometer was immediately started. The time sweep data showed that the gelation kinetics were rapid, and the crossover point of G’ and G" was not likely observable because the hydrogel formed during the approximately 1 min deadtime between mixing of the precursors and initiating data collection. It was observed that gels synthesized from linear ssDNA crosslinkers were significantly softer (G’max = 63.7 Pa at t = 50 min) compared to identically prepared hydrogels employing the DNA HPs (G’max = 107.3 Pa at t = 50 min). Hydrogel stiffness is directly related to the chain length of the crosslinkers. Although the ssDNA and HP crosslinkers have the same contour length (about 24 nm), the equilibrium length of the hairpin crosslinks is effectively the width of the DNA duplex (about 2 nm) which is significantly smaller than the estimated mean end-to-end length of the ssDNA (about 5-7 nm). Accordingly, the hydrogel crosslinked with HPs showed twofold greater stiffness. Because the molecular scale structure of DNA changes the macroscale hydrogel stiffness, experiments were performed to determine whether the molecular scale DNA HP stability affects the macroscale mechanical properties of the DNA-linked hydrogel. Two other DNAHPs with 100% and 0% GC content were used to synthesize the hydrogels. It was observed that, when the 100% GC content HP is used, the stiffness of the hydrogel was increased to 200.0 Pa. In contrast, when the 0% GC content HP is used, the stiffness of the hydrogel decreased to 67.5 Pa. These results indicate that the macroscale stiffness of the hydrogel reflects the molecular scale HP stability, which can be tuned by GC content of the DNA HP. The frequency sweep shows the stability of the hydrogel over the tested frequency range of 0.01-100 Hz exhibits classic hydrogel behavior.

[0142] Experiments were performed to demonstrate force-induced hydrogel degradation. Hydrogels were sandwiched between two glass slides to apply compressive forces that stretch the polymer network. This was achieved by forming the hydrogel in between two hydrophobic glass slides that were pretreated with a 2% solution of dimethyldichlorosilane and pressed to spread the gel into a thin film. Note that functionalizing the glass surface with dimethyldichlorosilane was important to reduce hydrogel adhesion to the substrate. Subsequently, it was an aim to measure and maximize the applied strain to the hydrogel. A 200 pm spacer was introduced between the glass slides, and then the strain was quantified by measuring the hydrogel 2D area before and after sandwiching with the second glass slide. The optimal volume of the hydrogel for a 200 pm spacer was investigated by tuning the total amount of material and measuring the strain. It was found that about 30 pL volume offered maximal strain which was used in all subsequent measurements. To determine the reproducibility of the strain measurement, the hysteresis in deformation of the hydrogel after five cycles of compression and relaxation was quantified. Hysteresis was insignificant (less than 5% change) regardless of whether radial or area strain was quantified. The smaller hydrogel volumes produced greater hysteresis. Thirty (30) pL was identified as the optimum volume for testing force-induced destruction experiments.

[0143] To detect hydrogel destruction, 100 nm diameter gold nanoparticles (AuNP) that were stabilized using 5000 g mol-1 molecular weight (MW) PEGn-SH were doped in and trapped within the network. Without the Casl2a in the hydrogel, the introduction of an external mechanical force did not induce hydrogel degradation. This was confirmed by observing that the AuNPs remain bound within the gel, confirming that the gel remained intact. To test hydrogel self-destruction, Casl2a enzyme we introduced to the precursor solution before the gelation. When the Casl2a enzyme was introduced and the gel was allowed to incubate at zero force for 3 h at 37 °C, and partial self-destruction of the hydrogel was observed. The slow self-destruction of the hydrogel in the absence of external force suggests leakage of the assay which is likely due to dynamic breathing, or transient unfolding, of the DNAHP. Such, unfolding events are believed to be due to thermal fluctuations. Casl2a activity was tested on hydrogels synthesized using DNA HPs with different GC content. While the hydrogels crosslinked with ssDNA and 0% GC DNA HP show complete self-destruction 30 min, both hydrogels crosslinked with 80% and 100% GC DNA HP show resistance to the Cast 2a activity under zero external force. Compared to the 80% GC DNA HP crosslinked hydrogel, 100% GC DNAHP crosslinked hydrogel shows 17% less AuNP release to the buffer at 3 h. This indicates that thermal breathing of the DNA HP contributes to selfdestruction of DNA HP crosslinked hydrogels. In contrast, with the introduction of both Casl2a and external force, it was observed near complete AuNP release supporting self-destruction of the hydrogel after 3 h of incubation at 37 °C. This force-induced self-destruction validates the hypothesis that external force application to the hydrogel induces the opening of the DNA HP crosslinkers inside the hydrogel, triggering Casl2a cleavage of DNA crosslinker, ultimately leading to hydrogel self-destruction.

[0144] To quantify the self-destruction of the hydrogel, the amount of AuNP release to the buffer was measured by the absorbance at 535 nm using a UV-vis spectrometer. Different hydrogels were tested for force-induced self-destruction. See Figure 6. The hydrogels are composed of tPEG- DBCO and three different crosslinkers, including tPEG-azide (no self-destruction control: bisPEG- tPEG hydrogel), linear ssDNA (self-destruction control: ssDNA hydrogel), and force-responsive DNA hairpin (HP hydrogel). The AuNPs inside non-self-destructive bisPEG-tPEG hydrogel did not diffuse into the buffer solution regardless of the presence of external force and Cast 2a. In contrast, AuNPs trapped within ssDNA hydrogels were released into solution when Casl2a is present, regardless to the application of external force. Another notable observation was that ssDNA hydrogel degradation without force was more rapid (30 min) compared to the hydrogel degradation with force (2 h). When the external force is absent, the HP hydrogel shows a significantly lower self-destruction rate compared with ssDNA hydrogel, while when the external force is applied, HP hydrogel shows a comparable self-destruction rate with that of the ssDNA hydrogel. This difference between the presence and absence of external force indicates that the DNA HP opening induced by external force exposes cryptic ssDNA sites which can be cleaved by Casl2a. To quantify the rate of force-triggered self-destruction, the hydrogel self-destruction was recorded in the presence or absence of external force and Casl2a enzyme (8 and 0.8 pm) at each time point. Notably, while the self-destruction kinetics was slowed by decreasing the Casl2a concentration, the undesired self-destruction without the external force was greatly suppressed when the 0.8 pm Casl2a was used.

[0145] Force-induced hydrogel degradation was validated using rheology measurements. Specifically, time-dependent stress relaxation of ssDNA, 80% GC content HP, and 100% GC content HP crosslinked hydrogels with and without Casl2a enzyme were used to quantify the force-induced hydrogel self-destruction. When Casl2a is absent, the stress in the hydrogel decays in a constant manner and reaches its plateau at about 15% of the maximum load regardless of the crosslinker used. In contrast, when the Casl2a enzyme is present, the measured force applied to the hydrogels initially follows a slow and constant decay, but after a certain time point, the measured force suddenly drops to zero. The initial relaxation is believed to be caused by the normal hydrogel relaxation behavior, while the sudden drop in stress is believed to be the result of Casl2a self-destruction of the gel.

[0146] For better comparison between the gels that included Casl2a and those without Casl2a, the polymer stress (normal force) was normalized and overlayed the force relaxation curves of the hydrogel synthesized with 80% GC content HP. In the absence of Casl2a, the gel showed slower initial relaxation rates compared to that of the same hydrogel containing Casl2a enzyme. This difference in initial relaxation rates suggests that, while there is no acute force drop, Casl2a cleaves the polymer network continuously during the application of external force which leads to a decrease in hydrogel elasticity over time.

[0147] The force relaxation plots were compared for gels synthesized using ssDNA and 80% and 100% GC content HPs. Complete loss of stress was found at about 50, about 65, and about 80 min, for the ssDNA, 80% GC HP and 100% GC HP, respectively, indicating that the molecular stability of the HP dictates its response to macroscopic forces and associated force-triggered destruction. The normal force of ssDNA crosslinked hydrogel (about 1.0 N) was much lower than the other gels (about 1.6 N). The normal force was normalized to each maximum force for 80% and 100% GC HP crosslinked hydrogels. Interestingly, 80% GC HP crosslinked hydrogel showed much faster initial relaxation compared with that of 100% GC HP crosslinked hydrogel. This reflects the thermodynamic stability of HP folding where higher GC content leads to more stable folding conformation, which protects the crosslinkers from Casl2a cleavage.

Claims

CLAIMSWhat is claimed is:

1. A Casl2a-resistant DNA hairpin structure, comprising: a double-stranded stem region; a loop region connecting the 5' and 3' ends of the stem region; and at least one chemical modification that increases resistance to Casl2a cleavage.

2. The DNA hairpin structure of claim 1, wherein the loop region comprises a non-nucleotide spacer.

3. The DNA hairpin structure of claim 2, wherein the non-nucleotide spacer is a polyethylene glycol (PEG) spacer.

4. The DNA hairpin structure of claim 3, wherein the PEG spacer comprises 6 to 12 ethylene glycol units.

5. The DNA hairpin structure of claim 1, wherein the chemical modification comprises one or more phosphorothioate linkages.

6. The DNA hairpin structure of claim 5, wherein the phosphorothioate linkages are located at the junction between the stem region and the loop region.

7. The DNA hairpin structure of claim 1, wherein the stem region has a GC content of at least 80%.

8. The DNA hairpin structure of claim 1, comprising a PEG spacer in the loop region and two phosphorothioate linkages at the junction between the stem region and the loop region.

9. A hydrogel comprising: a polymer network; anda plurality of the DNA hairpin structures as in any of claims 1-8 incorporated as crosslinkers in the polymer network.

10. The hydrogel of claim 9, wherein the polymer network comprises polyethylene glycol (PEG).

11. The hydrogel of claim 9, further comprising a CRISPR nuclease.

12. The hydrogel of claim 9, wherein the CRISPR nuclease Casl2a.

13. The hydrogel of claim 9, further comprising cargo molecules encapsulated within the polymer network.

14. The hydrogel of claim 13, wherein the cargo molecules comprise therapeutic agents, imaging agents, or nanoparticles.

15. A method of triggered degradation of a hydrogel, comprising: providing the hydrogel of any of claims 9-14; and applying a mechanical force to the hydrogel sufficient to unfold at least a portion of the hairpin structures, thereby exposing the unfolded structures to CRISPR nuclease cleavage and triggering degradation of the hydrogel.

16. The method of claim 15, wherein the mechanical force is applied by compression.

17. The method of claim 15, wherein the hydrogel comprises a cargo molecule and further releasing of the cargo molecule from the hydrogel upon degradation.

18. The method of claim 17, wherein the cargo molecule is a therapeutic agent.

19. The method of claim 18, wherein the therapeutic agent is an anti-inflammatory agent, antibacterial agent, antiviral agent, or anticancer agent.

Images