Nanocellulose production in microorganisms
By introducing inorganic carbon compounds and organic compounds with one carbon atom into chemoautotrophic microorganisms, the challenges of nanocellulose production are overcome, resulting in efficient and high-quality nanocellulose production with enhanced mechanical properties.
Patent Information
- Application Number
- PCT/US2024/060545
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-18
- Filing Date
- 2024-12-17
- Publication Date
- 2025-06-26
AI Technical Summary
Current methods for producing nanocellulose are limited by high energy and solvent inputs, scalability issues, slow growth rates, low productivity, and genetic instability in chemoautotrophic microorganisms.
Introducing inorganic carbon compounds and organic compounds with only one carbon atom into a culture medium containing chemoautotrophic microorganism cells, which convert these compounds into nanocellulose through chemosynthetic carbon-fixing reactions and anabolic biosynthesis pathways, with recombinant microorganisms expressing heterologous gene sequences for enhanced production.
This method enables efficient production of high-quality nanocellulose with desirable mechanical properties, such as high crystallinity, tensile stiffness, and water-holding capacity, while addressing the limitations of existing technologies.
Smart Images

Figure US2024060545_26062025_PF_FP_ABST
Abstract
Description
Attorney Docket No.000241-001402WO NANOCELLULOSE PRODUCTION IN MICROORGANISMS CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No.63 / 611,412, filed on December 18, 2023, which is incorporated by reference herein in its entirety. FIELD OF THE INVENTION
[0002] The invention relates to methods for production of nanocellulose, in particular production of nanocellulose in chemoautotrophic microorganisms, and nanocellulose products produced by the methods and microorganisms described herein. BACKGROUND
[0003] Cellulose is currently prepared from wood, requiring high energy and solvent inputs in a non-sustainable process. Bacterial cellulose was first described by Brown (1886) J Chem Soc Transactions (London) 49:432-439, when he found a jelly-like strong membrane on the surface of a vinegar fermentation broth. That strain was called Acetobacter xylinus, but there are other bacteria able to produce cellulose, such as Agrobacterium (Barnhart, et al. (2013) Appl Environ Microbiol 79(23)7188-202; Matthysse, et al. (2005) Mol Plant Microbe Interact.18(9):1002-10), Pseudomonas (Ude, et al. (2006) Environ Microbiol 8(11):1997-2011), Rhizobium (Ausmees, et al. (1999) Microbiology 145 (pt 5):1253-1262; Robledo, et al. (2012) Microb Cell Fact.11:125) and Sarcina (Yang, et al. (2013) Carbohydrate Polymers 92(2):2012-2017). Extracellular synthesis of high quality cellulose is carried out by many natural strains especially acetogenic bacteria like Acetobacter pasturianus and Acetobacter xylinus (now called Komagataeibacter xylinus). This is characteristic of high-acid spirit vinegar producing strains which can give 15- 20% acetic acid levels. Some bacteria are capable of synthesis of extracellular cellulose which they use as a “pellicle.” Pellicle may be made as a protective mechanism to shield bacteria from environmental stresses such as chemicals and UV radiation. The bacterial cellulose may be made by different mechanisms and have different qualities (linear or aggregated). The bacterial cellulose process has been commercialized in the Philippines using fermentation of coconut milk for the dessert nata de coco. Nanocellulose is synthesized and secreted by the gram-negative acetic acid bacteria Komagataeibacter (formerly Gluconacetobacter) xylinus, Komagataeibacter hansenii, Komagataeibacter rhaeticus, Komagataeibacter europaeus, and Komagataeibacter medellinensis. Industrialization of these organisms is limited by difficulties with scalability, slow growth, low productivity and genetic instability.
[0004] Bacterial nanocellulose (BNC) is a linear polysaccharide composed of β-D-glucopyranose monomers linked by β-1,4-glycosidic linkages. The repeating unit is the disaccharide cellobiose. In addition to plants, various microorganisms (algae, fungi, and bacteria) are also able to produce cellulose, with notable bacterial nanocellulose producers (BNC) including species of Komagataeibacter (formerly Gluconacetobacter), Acetobacter, Rhizobium, Agrobacterium,Attorney Docket No.000241-001402WO Pseudomonas, Salmonella, and Alcaligenes. BNC is distinguished from plant-based cellulose by its high purity and the lack of residual hemicellulose or lignin.
[0005] Cellulose synthases are composed of at least five polypeptides (BcsABCD and Ccp) in the bacterium K. xylinus. The genes encoding cellulose synthases are variously denoted as ces, acs, or bcs, and related proteins include, for example, cmc–ccp, bcsAB, bcsC, bcsD, and bgl. Terminal complexes span the inner and outer membranes and are usually organized in rows along the longitudinal axis of the cell.
[0006] A BcsA–BcsB heterodimer catalyzes and regulates cellulose synthesis. The structure of this complex was recently determined at 3.25-Å resolution. The glycosyltransferase domain and active site occur in the cytoplasm, and the membrane portion forms a cellulose-conducting channel. BcsA contributes eight transmembrane α-helices to this channel, whereas the periplasmic protein BcsB contributes one transmembrane α-helix that anchors this protein to the membrane.
[0007] The structure suggests a model in which cellulose is synthesized at the cytoplasmically localized active site and translocated through the cytoplasmic membrane one glucose residue at a time. The cellulose-synthesizing activity of BcsA is strongly stimulated by cyclic-di-GMP, which binds to a PilZ domain that occurs at the C-terminus of BcsA and which lies close to the glycosyltransferase active site. In K. xylinus, BcsC and BcsD are involved in cellulose secretion and crystallization.
[0008] It is possible to move genes responsible for bacterial cellulose production to other strains that do not naturally produce it, such as E. coli, etc. However, there is not presently a method to rapidly produce bacterial cellulose from CO2.
[0009] Bacterial cellulose and nanocellulose are useful in a variety of applications, including food, personal care, and production of a variety of materials. Improved methods for production of nanocellulose are needed. BRIEF SUMMARY OF THE INVENTION
[0010] Methods for producing nanocellulose in microorganisms, microorganisms for production of nanocellulose, nanocellulose produced by microorganisms, and nanocellulose products produced in microorganisms are described herein.
[0011] In one aspect, methods are provided for producing nanocellulose. The methods include introducing an inorganic carbon compound and / or an organic compound containing only carbon atom into an environment that contains chemoautotrophic microorganism cells in a culture medium that is suitable for maintaining the microorganism cells. The inorganic carbon compound and / or organic molecules containing only one carbon atom are used as a carbon source by the chemoautotrophic microorganism cells for growth and / or biosynthesis, and the inorganic carbon compound and / or organic compound containing only one carbon atom are converted into a nanocellulose product within the chemoautotrophic microorganism cells via at least one chemosynthetic carbon-fixing reaction and an anabolic biosynthesis pathway thatAttorney Docket No.000241-001402WO produces the nanocellulose. The chemosynthetic carbon-fixing reaction is at least partially driven by a chemical and / or electrochemical energy source provided by electron donors and / or electron acceptors that have been generated chemically and / or electrochemically and / or thermochemically and / or are introduced into the environment from at least one source external to the environment. The nanocellulose may be separated from the microorganism cells. For example, the nanocellulose may be secreted from the chemoautotrophic microorganism cells into the culture medium and separated from the culture medium. For example, a cloned enzyme complex may assemble in the microorganism membrane and secrete the nanocellulose. Alternatively, the cells may be lysed using a conventional cell breakage method, such as, but not limited to, homogenization, heating sonication, or bead milling, to release the nanocellulose from the microorganism cells.
[0012] In some embodiments, the chemoautotrophic microorganism cells are selected from Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter cells. For example, the microorganism cells may be oxyhydrogen microorganism cells. In some embodiments, the oxyhydrogen microorganism cells include Cupriavidus necator and / or Cupriavidus metallidurans microorganisms. For example, the oxyhydrogen microorganisms may include Cupriavidus necator DSM 531 and / or DSM 541 and / or DSM 428.
[0013] In some embodiments, the carbon source includes one or more of CO2, CO, and CH4. In some embodiments, the energy source includes or is H2and / or O2. In some embodiments, the electron donors include one or more of H2, CO, and CH4. In some embodiments, the electron donors include or are H2 and the electron acceptors include or are O2.
[0014] Nanocellulose produced by any of the methods described herein or in any of the microorganisms, e.g., recombinant microorganisms, e.g., recombinant chemoautotrophic microorganisms, described herein is also provided. In some embodiments, the nanocellulose produced by the methods or microorganisms described herein, e.g., secreted nanocellulose, is greater than about 75% crystalline. In some embodiments, the nanocellulose produced by the methods or microorganisms described herein, e.g., secreted nanocellulose, includes one or more property selected from: tensile stiffness of about 100 GPa to about 160 GPa; tensile strength of at least about 1 GPa; and water holding capacity greater than about 80%.
[0015] In some embodiments, the chemosynthetic microorganism cells are recombinant cells and at least a portion of the anabolic biosynthesis pathway that produces the nanocellulose is provided by expression of one or more heterologous gene sequence(s) in the chemosynthetic microorganisms. For example, the one or more heterologous gene sequence(s) may include a cellulose synthase gene sequence. For example, the one or more heterologous gene sequence(s) may be derived from a Komagataeibacter species, such as a Komagateibacter species selected from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, and K. medellinensis.
[0016] In another aspect, methods are provided for producing nanocellulose. The methods include introducing an inorganic carbon compound and / or an organic compound containing only carbon atom into an environment that contains chemoautotrophic microorganism cells in a cultureAttorney Docket No.000241-001402WO medium that is suitable for maintaining the microorganism cells. The chemoautotrophic microorganism cells are recombinant cells that express one or more heterologous gene sequence(s) in an anabolic biosynthesis pathway that produces nanocellulose. The inorganic carbon compound and / or organic molecules containing only one carbon atom are used as a carbon source by the chemoautotrophic microorganism cells for growth and / or biosynthesis, and the inorganic carbon compound and / or organic compound containing only one carbon atom are converted into a nanocellulose product within the chemoautotrophic microorganism cells via at least one chemosynthetic carbon-fixing reaction and the anabolic biosynthesis pathway that produces the nanocellulose. The chemosynthetic carbon-fixing reaction is at least partially driven by a chemical and / or electrochemical energy source provided by electron donors and / or electron acceptors that have been generated chemically and / or electrochemically and / or thermochemically and / or are introduced into the environment from at least one source external to the environment. The nanocellulose may be separated from the microorganism cells. For example, the nanocellulose may be secreted from the chemoautotrophic microorganism cells into the culture medium, and separated from the culture medium.
[0017] In some embodiments, the one or more heterologous gene sequence(s) includes a cellulose synthase gene sequence. For example, the one or more heterologous gene sequence(s) may be derived from a Komagataeibacter species, such as a Komagateibacter species selected from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, and K. medellinensis.
[0018] In some embodiments, the one or more heterologous gene sequence(s) are inserted into the chemoautotrophic microorganism cell chromosome using phage insertion.
[0019] In embodiments of any of the methods for producing nanocellulose described herein, the nanocellulose may be further processed into a product, such as: a food or beverage product or an ingredient thereof; a personal care product; a cleaning product; a biomedical product; a textile product; a composite material; an antimicrobial product; an anti-inflammatory product; a packaging material; a container; or a substrate for incorporation or immobilization of an enzyme or other biomolecule.
[0020] In another aspect, products are provided that contain nanocellulose prepared by any of the methods or microorganisms described herein. For example, the nanocellulose containing product may be: a food or beverage product or an ingredient thereof; a personal care product; a cleaning product; a biomedical product; a textile product; a composite material; an antimicrobial product; an anti-inflammatory product; a packaging material; a container; or a substrate for incorporation or immobilization of an enzyme or other biomolecule.
[0021] In another aspect, a recombinant chemoautotrophic microorganism cell that produces nanocellulose is provided. The microorganism cell expresses one or more heterologous gene sequence(s) in an anabolic biosynthesis pathway that produces nanocellulose. In some embodiments, the recombinant chemoautotrophic microorganism cell secretes nanocellulose.
[0022] In some embodiments, the recombinant chemoautotrophic microorganism is selected from Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter cells.Attorney Docket No.000241-001402WO
[0023] For example, the one or more heterologous gene sequence(s) may include a cellulose synthase gene sequence. For example, the one or more heterologous gene sequence(s) may be derived from a Komagataeibacter species, such as a Komagateibacter species selected from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, and K. medellinensis.
[0024] In some embodiments, the one or more heterologous gene sequence(s) are inserted into the chemoautotrophic microorganism cell chromosome using phage insertion. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 shows Komagataeibacter xylinus, DSM 2315 from DSMZ growing on solid agar (15 g / L) with Gluconobacter oxydans medium.
[0026] Figure 2 shows shake flask growth appearance after 1 week.
[0027] Figure 3 shows washed cellulose from 100 ml culture through 400X phase contrast microscope.
[0028] Figure 4 shows the appearance of the lyophilized cellulose product.
[0029] Figure 5 shows a wet pellicle of cellulose (left), and a freeze dried pellicle of cellulose (right).
[0030] Figure 6 illustrates a sequential fermentation to produce cellulose from CO2.
[0031] Figure 7 illustrates direct oxyhydrogen production of cellulose from CO2.
[0032] Figure 8 schematic illustrates engineering of an oxyhydrogen microorganism strain for nanocellulose production from CO2. DETAILED DESCRIPTION
[0033] The invention provides methods for production of nanocellulose, in particular in chemoautotrophic microorganisms. In some embodiments, the chemoautotrophic microorganisms contain and express one or more heterologous gene sequence(s) in a biosynthetic pathway for production of nanocellulose. Nanocellulose produced by the microorganisms described herein, e.g., chemoautotrophic microorganisms, optionally expressing one or more heterologous gene sequence(s) for production of nanocellulose, and products containing the microorganism-produced nanocellulose, are also provided. In some embodiments, the microorganism that produces nanocellulose is a bacterial microorganism, e.g., a chemoautotrophic microorganism, e.g., selected from Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter. In some embodiments, the microorganism, e.g., a chemoautotrophic microorganism, e.g., selected from Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter, contains one or more heterologous gene sequence(s) from which is expressed one or more enzyme(s) in an anabolic biosynthetic pathway that produces nanocellulose.
[0034] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this inventionAttorney Docket No.000241-001402WO belongs. Singleton, et al., Dictionary of Microbiology and Molecular Biology, second ed., John Wiley and Sons, New York (1994), and Hale & Markham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide one of skill with a general dictionary of many of the terms used in this invention. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
[0035] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, for example, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984; Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1994); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); and Gene Transfer and Expression: A Laboratory Manual (Kriegler, 1990).
[0036] Numeric ranges provided herein are inclusive of the numbers defining the range.
[0037] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Definitions
[0038] “A,” “an” and “the” include plural references unless the context clearly dictates, thus the indefinite articles “a”, “an,”, and “the” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
[0039] The term “about” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods or in connection with a disclosed composition.
[0040] The term “amino acid” refers to a molecule containing both an amine group and a carboxyl group that are bound to a carbon, which is designated the alpha-carbon. Suitable amino acids include, without limitation, both the D- and L-isomers of the naturally occurring amino acids, as well as non-naturally occurring amino acids prepared by organic synthesis or other metabolic routes. In some embodiments, a single “amino acid” might have multiple sidechain moieties, as available per an extended aliphatic or aromatic backbone scaffold. Unless the context specifically indicates otherwise, the term amino acid, as used herein, is intended to include amino acid analogs.
[0041] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to “A and / or B,” when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without AAttorney Docket No.000241-001402WO (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0042] The term “biomass” refers to a material produced by growth and / or propagation of cells, e.g., microbial cells, e.g., bacterial cells. Biomass may contain cells and / or intracellular contents as well as extracellular material, including, but not limited to, compounds secreted by a cell.
[0043] The term “bioreactor” or “fermenter” refers to a closed or partially closed vessel in which cells, e.g., microbial cells, e.g., bacterial cells are grown and maintained. The cells may be, but are not necessarily, held in liquid suspension. In some embodiments, rather than being held in liquid suspension, cells may alternatively be grown and / or maintained in contact with, on, or within another non-liquid substrate including but not limited to a solid growth support material.
[0044] The term “carbon fixing” process, reaction or pathway refers to enzymatic reactions or metabolic pathways that convert forms of carbon that are gaseous under ambient conditions, including but not limited to CO2, CO, and / or CH4, into carbon-based biochemicals that are liquid or solid under ambient conditions, or which are dissolved into, or held in suspension in, aqueous solution.
[0045] “Carbon source” refers to the types of molecules from which a microorganism derives the carbon needed for organic biosynthesis.
[0046] “Carboxydotrophic” refers to microorganisms that can tolerate or oxidize carbon monoxide. In preferred embodiments a carboxydotrophic microorganism can utilize CO as a carbon source and / or as a source of reducing electrons for biosynthesis and / or respiration.
[0047] “Cellulose” is a polysaccharide composed of β-D-glucopyranose monomers linked by β-1,4- glycosidic linkages. The repeating unit is the disaccharide cellobiose.
[0048] “Chemoautotrophic” refers to organisms that obtain energy by the oxidation of chemical electron donors by chemical electron acceptors and synthesize all the organic compounds needed by the organism to live and grow from carbon dioxide.
[0049] In the claims, as well as in the specification, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively.
[0050] A “consortium” refers herein to two or more different species or strains of microorganisms and / or multi-cellular organisms, which are grown together, for example, grown in co-culture in the same growth medium.
[0051] The term “culturing” refers to growing a population of cells, e.g., microbial cells, e.g., bacterial cells, under suitable conditions for growth, in a liquid or solid medium.
[0052] The term “derived from” encompasses the terms “originated from,” “obtained from,” “obtainable from,” “isolated from,” and “created from,” and generally indicates that one specified material finds its origin in another specified material or has features that can be described with reference to another specified material.Attorney Docket No.000241-001402WO
[0053] “Energy source” refers to either the electron donor that is oxidized by oxygen in aerobic respiration or the combination of electron donor that is oxidized and electron acceptor that is reduced in anaerobic respiration.
[0054] As used herein, the term “expression” refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene. The process includes both transcription and translation.
[0055] As used herein, “expression vector” refers to a DNA construct containing a DNA coding sequence (e.g., gene sequence) that is operably linked to one or more suitable control sequence(s) capable of effecting expression of the coding sequence in a host. Such control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control termination of transcription and translation. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. The plasmid is the most commonly used form of expression vector. However, the invention is intended to include such other forms of expression vectors that serve equivalent functions and which are, or become, known in the art.
[0056] “Extremophile” refers to a microorganism that thrives in physically or geochemically extreme conditions (e.g., high or low temperature, pH, or high salinity) compared to conditions on the surface of the Earth or the ocean that are typically tolerated by most life forms found on or near the earth’s surface.
[0057] The term “gasification” refers to a generally high temperature process that converts carbon- based materials into a mixture of gases including hydrogen, carbon monoxide, and carbon dioxide called synthesis gas, syngas or producer gas. The process generally involves partial combustion and / or the application of externally generated heat along with the controlled addition of oxygen and / or steam such that insufficient oxygen is present for complete combustion of the carbon-based material.
[0058] “Halophile” refers to a type of extremophile that thrives in environments with very high concentrations of salt.
[0059] The term “heterologous” or “exogenous,” with reference to a polynucleotide or protein, refers to a polynucleotide or protein that does not naturally occur in a specified cell, e.g., a host cell. It is intended that the term encompass proteins that are encoded by naturally occurring genes, mutated genes, and / or synthetic genes. In contrast, the term “homologous,” with reference to a polynucleotide or protein, refers to a polynucleotide or protein that occurs naturally in the cell.
[0060] “Heterotrophic” refers to organisms that cannot synthesize all the organic compounds needed by the organism to live and grow from carbon dioxide, and which must utilize organic compounds for growth. Heterotrophic organisms cannot produce their own food and insteadAttorney Docket No.000241-001402WO obtain food and energy by taking in and metabolizing organic substances, such as plant or animal matter, i.e., rather than fixing carbon from inorganic sources such as carbon dioxide.
[0061] As used herein, the term “host cell” refers to a cell or cell line into which a recombinant expression vector for production of a polypeptide may be transfected for expression of the polypeptide. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected or transformed in vivo with an expression vector.
[0062] “Hydrogen-oxidizer” refers to a microorganism that utilizes reduced H2 as an electron donor for the production of intracellular reducing equivalents and / or in respiration.
[0063] “Hyperthermophile” refers to a type of extremophile that thrives in extremely hot environments for life, typically about 60 °C (140 °F) or higher.
[0064] The term “knallgas” refers to the mixture of molecular hydrogen and oxygen gases. A “knallgas microorganism” is a microbe that can use hydrogen as an electron donor and oxygen as an electron acceptor in respiration for the generation of intracellular energy carriers such as Adenosine-5’-triphosphate (ATP). The terms “oxyhydrogen” and “oxyhydrogen microorganism” can be used synonymously with “knallgas” and “knallgas microorganism,” respectively. Knallgas microorganisms generally use molecular hydrogen by means of hydrogenases, with some of the electrons donated from H2 that is utilized for the reduction of NAD+(and / or other intracellular reducing equivalents) and some of the electrons from H2that is used for aerobic respiration. Knallgas microorganisms generally fix CO2autotrophically, through pathways including but not limited to the Calvin Cycle or the reverse citric acid cycle [“Thermophilic bacteria”, Jakob Kristjansson, Chapter 5, Section III, CRC Press, (1992)].
[0065] The term “lysate” refers to a liquid containing a mixture and / or a solution of cell contents that result from cell lysis. In some embodiments, the methods described herein comprise a purification of chemicals or mixture of chemicals in a cellular lysate. In some embodiments, the methods comprise a purification of amino acids and / or protein in a cellular lysate.
[0066] The term “lysis” refers to the rupture of the plasma membrane and if present, the cell wall of a cell such that a significant amount of intracellular material escapes to the extracellular space. Lysis can be performed using electrochemical, mechanical, osmotic, thermal, or viral means. In some embodiments, the methods described herein comprise performing a lysis of cells or microorganisms as described herein in order to separate a chemical or mixture of chemicals from the contents of a bioreactor, e.g., from liquid culture medium in a bioreactor. In some embodiments, the methods comprise performing a lysis of cells or microorganisms described herein in order to separate an amino acid or mixture of amino acids and / or proteins from the contents of a bioreactor or cellular growth medium.
[0067] “Methanogen” refers to a microorganism that generates methane as a product of anaerobic respiration.Attorney Docket No.000241-001402WO
[0068] “Methylotroph” refers to a microorganism that can use reduced one-carbon compounds, such as but not limited to methanol or methane, as a carbon source and / or as an electron donor for their growth.
[0069] The terms “microorganism” and “microbe” mean microscopic single celled life forms, including but not limited to bacterial and fungal microorganisms.
[0070] The term “molecule” means any distinct or distinguishable structural unit of matter comprising one or more atoms, and includes for example hydrocarbons, lipids, polypeptides and polynucleotides.
[0071] “Nanocellulose” or “bacterial nanocellulose” (“BNC”), used interchangeably herein, refers to a homopolymer of β-D-glucopyranose monomers linked by β-1,4 glycosidic linkages, with cellobiose disaccharide repeating units.
[0072] “Oligopeptide” refers to a peptide that contains a relatively small number of amino-acid residues, for example, about 2 to about 20 amino acids.
[0073] The term “operably linked” refers to a juxtaposition or arrangement of specified elements that allows them to perform in concert to bring about an effect. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the coding sequence.
[0074] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0075] The term “organic compound” refers to any gaseous, liquid, or solid chemical compound that contains carbon atoms, with the following exceptions that are considered inorganic: carbides, carbonates, simple oxides of carbon, cyanides, and allotropes of pure carbon such as diamond and graphite.
[0076] “Peptide” refers to a compound (a polypeptide) consisting of two or more amino acids linked in a chain, the carboxyl group of each acid being joined to the amino group of the next by a bond of the type R-OC-NH-R’, for example, about 2 amino acids to about 50 amino acids, or 21 amino acids to about 50 amino acids.
[0077] As used herein, the term “polynucleotide” refers to a polymeric form of nucleotides of any length and any three-dimensional structure and single- or multi-stranded (e.g., single-stranded, double-stranded, triple-helical, etc.), which contain deoxyribonucleotides, ribonucleotides, and / or analogs or modified forms of deoxyribonucleotides or ribonucleotides, including modified nucleotides or bases or their analogs. Because the genetic code is degenerate, more than oneAttorney Docket No.000241-001402WO codon may be used to encode a particular amino acid, and the present invention encompasses polynucleotides which encode a particular amino acid sequence. Any type of modified nucleotide or nucleotide analog may be used, so long as the polynucleotide retains the desired functionality under conditions of use, including modifications that increase nuclease resistance (e.g., deoxy, 2’-O-Me, phosphorothioates, etc.). Labels may also be incorporated for purposes of detection or capture, for example, radioactive or nonradioactive labels or anchors, e.g., biotin. The term polynucleotide also includes peptide nucleic acids (PNA). Polynucleotides may be naturally occurring or non-naturally occurring. The terms “polynucleotide,” “nucleic acid,” and “oligonucleotide” are used herein interchangeably. Polynucleotides may contain RNA, DNA, or both, and / or modified forms and / or analogs thereof. A sequence of nucleotides may be interrupted by non-nucleotide components. One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), (O)NR2(“amidate”), P(O)R, P(O)OR’, CO or CH2(“formacetal”), in which each R or R’ is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (-- O--) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. Polynucleotides may be linear or circular or comprise a combination of linear and circular portions.
[0078] As used herein, “polypeptide” refers to a composition comprised of amino acids and recognized as a protein by those of skill in the art. The conventional one-letter or three-letter code for amino acid residues is used herein. The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non- amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also, included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
[0079] “Polysaccharide” refers to a sugar polymer that includes monosaccharide monomers polymerized through glycosidic bonds. In some embodiments, a polysaccharide refers to polymers comprising 10 or more monosaccharides. Polysaccharides, along with proteins, lipids, and nucleic acids, are the four major fractions composing most types of biomass.
[0080] The term “precursor to” or “precursor of” is an intermediate towards the production of one or more of the components of a finished product.
[0081] “Producer gas” refers to a gas mixture containing various proportions of H2, CO, and CO2, and having heat value typically ranging between one half and one tenth that of natural gas per unit volume under standard conditions. Producer gas can be generated various ways from a variety of feedstocks, including gasification, steam reforming, or autoreforming of carbon-based feedstocks. In addition to H2, CO, and CO2, producer gases can contain other constituentsAttorney Docket No.000241-001402WO including but not limited to methane, hydrogen sulfide, condensable gases, tars, and ash depending upon the generation process and feedstock. The proportion of N2in the mixture can be high or low depending on whether air is used as an oxidant in the reactor or not and if the heat for the reaction is provided by direct combustion or through indirect heat exchange.
[0082] The term “producing” includes both the production of compounds intracellularly and extracellularly, including the secretion of compounds from the cell.
[0083] A “promoter” refers to a regulatory sequence that is involved in binding RNA polymerase to initiate transcription of a gene. A promoter may be an inducible promoter or a constitutive promoter. An “inducible promoter” is a promoter that is active under environmental or developmental regulatory conditions.
[0084] “Psychrophile” refers to a type of extremophile capable of growth and reproduction in cold temperatures, typically about 10°C and lower.
[0085] The term “recombinant,” refers to genetic material (i.e., nucleic acids, the polypeptides they encode, and vectors and cells comprising such polynucleotides) that has been modified to alter its sequence or expression characteristics, such as by mutating the coding sequence to produce an altered polypeptide, fusing the coding sequence to that of another gene, placing a gene under the control of a different promoter, expressing a gene in a heterologous organism, expressing a gene at a decreased or elevated level, expressing a gene conditionally or constitutively in manner different from its natural expression profile, and the like. Generally recombinant nucleic acids, polypeptides, and cells based thereon, have been manipulated by man such that they are not identical to related nucleic acids, polypeptides, and cells found in nature. A recombinant cell may also be referred to as “engineered.”
[0086] The terms “recovered,” “isolated,” “purified,” and “separated” as used herein refer to a material (e.g., a protein, nucleic acid, or cell) that is removed from at least one component with which it is naturally associated. For example, these terms may refer to a material that is substantially or essentially free from components which normally accompany it as found in its native state, such as, for example, in an intact biological system.
[0087] The phrase “substantially free” or “essentially free” as to any given component means that such component is only present, if at all, in an amount that is a functionally insignificant amount, i.e., it does not significantly negatively impact the intended performance or function of any process or product. Typically, substantially free means less than about 1%, including less than about 0.5%, including less than about 0.1%, and also including zero percent, by weight of such component. The terms “substantially free” or “essentially free” shall mean less than 1% of a component.
[0088] “Sulfur-oxidizer” refers to microorganisms that utilize reduced sulfur containing compounds including but not limited to H2S as electron donors for the production of intracellular reducing equivalents and / or in respiration.
[0089] “Syngas” or “synthesis gas” refers to a type of gas mixture, which like producer gas contains H2and CO, but which has been more specifically tailored in terms of H2and CO content andAttorney Docket No.000241-001402WO ratio and levels of impurities for the synthesis of a particular type of chemical product, such as but not limited to methanol or fischer-tropsch diesel. Syngas generally contains H2, CO, and CO2as major components, and it can be generated through established methods including: steam reforming of methane; or through gasification of any organic, flammable, carbon-based material, including but not limited to biomass, organic matter, or peat. The hydrogen component of syngas can be increased through the reaction of CO with steam in the water gas shift reaction, with a concomitant increase in CO2in the syngas mixture.
[0090] “Thermophile” refers to a type of extremophile that thrives at relatively high temperatures for life, typically about 45 °C to about 122 °C.
[0091] “Under transcriptional control” is a term well understood in the art that indicates that transcription of a polynucleotide sequence depends on its being operably linked to an element which contributes to the initiation of or promotes transcription.
[0092] As used herein, a “vector” refers to a polynucleotide sequence designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes, and the like.
[0093] “Wild-type” refers to a microorganism as it occurs in nature.
[0094] “Yield” refers to amount of a product produced from a feed material relative to the total amount of the substance that would be produced if all of the feed substance were converted to product. For example, yield of the product may be expressed as % of the product produced relative to a theoretical yield if 100% of the feed substance were converted to the product. Methods for Nanocellulose Production
[0095] Methods are provided herein for production of nanocellulose in a microorganism. In some embodiments, the microorganism is a chemoautotrophic microorganism, such as a chemoautotrophic bacterial microorganism.
[0096] In some embodiments of the methods described herein, a chemoautotrophic microorganism cell converts an inorganic carbon compound and / or an organic compound containing only one carbon atom, as a carbon source, into a nanocellulose product in an environment, for example, a bioreactor, that contains a culture medium that is suitable for maintaining the microorganism cell, for growth of the cell and production of the nanocellulose product. Carbon from the inorganic carbon compound and / or organic compound containing only one carbon atom is incorporated into the nanocellulose product via at least one chemosynthetic carbon-fixing reaction, and the nanocellulose is produced via an anabolic biosynthesis pathway within the microorganism cell. The chemosynthetic carbon-fixing reaction is at least partially driven by a chemical and / or electrochemical energy source provided by electron donors and electron acceptors. The electron donors and acceptors may be generated chemically, electrochemically, and / or thermochemically, and / or may be introduced into the environment from at least one source that is external to the environment.Attorney Docket No.000241-001402WO
[0097] The nanocellulose product may be separated from the microorganism cells and may be used to produce at least one downstream product into which the nanocellulose is incorporated. In some embodiments, the nanocellulose is secreted by a membrane bound cellulose synthase from the microorganism cells into the external medium and may be separated from the culture medium into which it is secreted, for example, by standard recovery processes for non-water soluble materials, e.g., centrifugation.
[0098] In some embodiments, the carbon source (e.g., inorganic carbon compound and / or an organic compound containing only one carbon atom) contains one or more of CO2, CO, and CH4. In some embodiments, the electron donors contain one or more of H2, CO, and CH4. In some embodiments, the electron acceptors contain O2. In some embodiments, the microorganism is an oxyhydrogen (knallgas) microorganism, and the energy source contains H2as an electron donor and O2as an electron acceptor.
[0099] The microorganism cell used for production of nanocellulose in the methods described herein may be a chemoautotrophic bacterial microorganism cell. For example, the chemoautotrophic microorganism may be, but is not limited to, a microorganism of a genus selected from Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and Xanthobacter. In some embodiments, the microorganism is a Cupriavidus microorganism, for example, Cupriavidus necator or Cupriavidus metallidurans, such as Cupriavidus necator DSM 531 or DSM 541 or DSM 428.
[0100] In some embodiments, the microorganism has been engineered for production of nanocellulose. For example, one or more heterologous gene(s) may be recombinantly introduced into the cell that encode one or more enzyme(s) in a biochemical pathway for nanocellulose production. In some embodiments, at least a heterologous cellulose synthase gene is introduced into the cell. In some embodiments, a heterologous cellulose synthase gene is introduced into the cell, and endogenous enzymes produce UDP-glucose, which is converted to nanocellulose by the heterologous cellulose synthase enzyme.
[0101] BNC is synthesized in two stages: (1) the production of β-1,4-glucan chains; and (2) the crystallization of cellulose. In some embodiments, the conversion of CO2to nanocellulose by a knallgas metabolism requires the following enzymatic steps: (a) CO2 fixation to glyceraldehyde- 3-phosphate via the Calvin Cycle; (b) glyceraldehyde-3-phosphate conversion in three enzymatic steps to glucose-6-phosphate (via fructose-1,6-bisphosphate and fructose-6- phosphate intermediates); (c) isomerization of glucose-6-phosphate to glucose-1-phosphate by phosphoglucomutase; (d) conversion of glucose-1-phosphate to uridine diphosphoglucose (UDP-glucose) by UDP-glucose pyrophosphorylase; (e) synthesis and secretion of cellulose from UDP-glucose by cellulose synthase. In certain embodiments, (a), (b), (c), and (d) are performed in the cell by endogenous enzymes, and (e) is performed by a heterologous cellulose synthase enzyme, which is expressed from a heterologous gene sequence for cellulose synthase that is recombinantly introduced into the cell.Attorney Docket No.000241-001402WO
[0102] In some embodiments, one or more heterologous gene sequence(s) may be recombinantly introduced into the microorganism cell from a species of Komagataeibacter and / or a species of Gluconacetobacter. For example, one or more gene sequences including or limited to a gene sequence that encodes a cellulose synthase enzyme may be introduced into the microorganism for production of nanocellulose. In some embodiments, the Komagataeibacter species may be K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, or K. medellinensis. In some embodiments the Gluconacetobacter species is Gluconacetobacter xylinus. In some embodiments, one or more heterologous gene sequence(s) may be recombinantly introduced into the microorganism cell from the strain Komagataeibacter xylinus DSM 2325 and / or Gluconacetobacter xylinus (Brown) ATCC 23767.
[0103] In one embodiment, a gene sequence encoding the amino acid sequence of Komagataeibacter xylinus cellulose synthase (SEQ ID NO:1) or encoding an amino sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO:1 is introduced into the microorganism: MPEVRSSTQS ESGMSQWMGK ILSIRGAGLT IGVFGLCALI AATSVTLPPE QQLIVAFVCV VIFFIVGHKP SRRSQIFLEV LSGLVSLRYL TWRLTETLSF DTWLQGLLGT MLLVAELYAL MMLFLSYFQT IAPLHRAPLP LPPNPDEWPT VDIFVPTYNE ELSIVRLTVL GSLGIDWPPE KVRVHILDDG RRPEFAAFAA ECGANYIARP TNEHAKAGNL NYAIGHTDGD YILIFDCDHV PTRAFLQLTM GWMVEDPKIA LMQTPHHFYS PDPFQRNLSA GYRTPPEGNL FYGVVQDGND FWDATFFCGS CAILRRTAIE QIGGFATQTV TEDAHTALKM QRLGWSTAYL RIPLAGGLAT ERLILHIGQR VRWARGMLQI FRIDNPLFGR GLSWGQRLCY LSAMTSFLFA VPRVIFLSSP LAFLFFGQNI IAASPLALLA YAIPHMFHAV GTASKINKGW RYSFWSEVYE TTMALFLVRV TIVTLLSPSR GKFNVTDKGG LLEKGYFDLG AVYPNIILGL IMFGGLARGV YELSFGHLDQ IAERAYLLNS AWAMLSLIII LAAIAVGRET QQKRNSHRIP ATIPVEVANA DGSIIVTGVT EDLSMGGAAV KMSWPAKLSG PTPVYIRTVL DGEELILPAR IIRAGNGRGI FIWTIDNLQQ EFSVIRLVFG RADAWVDWGN YKADRPLLSL MDMVLSVKGL FRSSGDIVHR SSPTKPLAGN ALSDDTNNPS RKERVLKGTV KMVSLLALLT FASSAQAASA PRAVAAKAPA HQPEASDLPP LPALLPATSG AAQAGAGDAG ANGPGSPTGQ PLAADSADAL VENAENTSDT ATVHNYTLKD LGAAGSITMR GLAPLQGIEF GIPSDQLVTS ARLVLSGSMS PNLRPETNSV TMTLNEQYIG TLRPDPAHPT FGPMSFEINP IFFVSGNRLN FNFASGSKGC SDITNDTLWA TISQNSQLQI TTIALPPRRL LSRLPQPFYD KNVRQHVTVP MVLAQTYDPQ ILKSAGILAS WFGKQTDFLG VTFPVSSTIP QSGNAILIGV ADELPTSLGR PQVNGPAVLE LPNPSDANAT ILVVTGRDRD EVITASKGIA FASAPLPTDS HMDVAPVDIA PRKPNDAPSF IAMDHPVRFG DLVTASKLQG TGFTSGVLSV PFRIPPDLYT WRNRPYKMQV RFRSPAGEAK DVEKSRLDVG INEVYLHSYP LRETHGLVGA VLQGVGLARP ASGMQVHDLD VPPWTVFGQD QLNFYFDAMP LARGICQSGA ANNAFHLGLD PDSTIDFSRA HHIAQMPNLA YMATVGFPFT TYADLSQTAV VLPEHPNAAT VGAYLDLMGF MGAATWYPVA GVDIVSADHV SDVADRNLLV ISTLATSGEI APLLSRSSYE VADGHLRTVS HASALDNAIK AVDDPLTAFR DRDSKPQDVD TPLTGGVGAM IEAESPLTAG RTVLALLSSD GAGLNNLLQM LGERKKQANI QGDLVVAHGE DLSSYRTSPV YTIGTLPLWL WPDWYMHNRP VRVLLVGLLG CILIVSVLAR ALARHATRRF KQLEDERRKS (SEQ ID NO:1)
[0104] In some embodiments, one or more heterologous gene sequence(s), such as, but not limited to, a gene sequence that encodes a cellulose synthase enzyme, is recombinantly introduced into the microorganism cell chromosome. (Fig.8). Recombinant microorganismsAttorney Docket No.000241-001402WO
[0105] Recombinant microorganism cells, e.g., recombinant bacterial cells, are provided herein that contain one or more heterologous gene(s) that has been recombinantly introduced into the cell. The heterologous gene(s) encode one or more enzyme(s) in an anabolic biochemical pathway for production of nanocellulose. In a nonlimiting example, the heterologous gene(s) include a polynucleotide sequence that encodes a cellulose synthase enzyme, e.g., for conversion of UDP-glucose to nanocellulose. In a nonlimiting example, the heterologous gene sequence(s) are from a species of Komagataeibacter. For example, the one or more gene sequences may be derived from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, or K. medellinensis, or may be a sequence that is at least about 80%, 85%, 90%, 95%, 98%, or 99% identical to the heterologous gene sequence, such as a gene sequence from a species of Komagataeibacter, such as K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, or K. medellinensis, and that encodes a polypeptide with an enzymatic activity for production of nanocellulose, such as a cellulose synthase enzyme. In some embodiments, the heterologous gene sequence is codon optimized for expression in the microorganism cell into which it is recombinantly introduced.
[0106] The recombinant microorganism cell may be a chemoautotrophic microorganism. In certain nonlimiting embodiments, the recombinant microorganism cell is a recombinant cell of the genus Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, or Xanthobacter. In some embodiments, the recombinant microorganism cell is a recombinant Cupriavidus cell, such as Cupriavidus necator or Cupriavidus metallidurans. In nonlimiting embodiments, the recombinant microorganism cell is a recombinant Cupriavidus necator DSM 531 or DSM 541 or DSM 428 cell. In some embodiments, the recombinant microorganism cells is a recombinant Xanthobacter cell, such as Xanthobacter autotrophicus or Xanthobacter flavus. In nonlimiting embodiments, the recombinant microorganism cell is a recombinant Xanthobacter autotrophicus DSM 431, DSM 432, DSM 1618, or DSM 2267 cell, or a recombinant Xanthobacter flavus DSM 3874 cell. Secretion of nanocellulose products
[0107] A recombinant cellulose synthase complex may assemble across the inner and outer membranes of the chemoautotrophic microorganism and catalyze the synthesis of the nanocellulose polymer and its concomitant secretion from the cell into the external medium. In some embodiments, secreted nanocellulose may be recovered from the culture medium in which the recombinant microorganisms are grown. Nanocellulose product and applications of use thereof
[0108] Nanocellulose produced by the methods described herein is provided. In some embodiments, the nanocellulose is separated from the microorganism cells in which it is produced, for example, separated from the culture medium into which it is secreted by the microorganism cells. In some embodiments, the nanocellulose is further purified, for example,Attorney Docket No.000241-001402WO up to about or at least about any of 80%, 85%, 90%, 95%, 98%, or 99% purity for use in downstream products and / or applications of use.
[0109] The microorganism produced nanocellulose product has desirable qualities of mechanical strength, and / or a tensile stiffness of about 100 GPa to about 160 GPa, or any of about 100 GPa to about 120 GPa, about 110 GPa, to about 130 GPa, about 125 GPa, to about 140 GPa, about 130 GPa to about 150GPa, or about 145 GPa to about 160 GPa, and / or a tensile strength of at least 1 GPa, and / or a water-holding capacity over 90% of its total weight, and / or one or more of the following characteristics: high crystallinity, biodegradability, renewability, excellent permeability, flexibility, elasticity, durability, and / or biocompatibility. In some embodiments, the nanocellulose product is greater than about 75%, 80%, 85%, 90%, or 95% crystalline.
[0110] In certain embodiments, secreted nanofibrils of cellulose range from about 200 nm to any of about 190 nm, 180 nm, 170 nm, 160 nm, 150 nm, 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm, 10 nm, or 1 mm, or any of about 200 nm to about 100 nm, about 150 nm to about 50 nm, about 100 nm to about 10 nm, or about 20 nm to about 1 nm. In certain embodiments, the crystallinity ranges from about 60% to any of about 65%, 70%, 75%, 80%, 85%, or 90%, or any of about 60% to about 75%, about 75% to about 85%, or 70% to about 90%. In certain embodiments, the cellulose has a degree of polymerization from about 2000 to any of about 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, or 8000, or any of about 2000 to about 4000, 3000 to about 5000, about 4000 to about 6000, about 5000 to about 7000, about 6000 to about 8000, about 2000 to about 5000, about 3000 to about 6000, about 4000 to about 7000, or about 5000 to about 8000. In certain embodiments, the nanofibrils are about 99% pure or higher.
[0111] The microorganism produced cellulose and / or nanocellulose product may be used in a food, beverage, or animal feed product, such as a thickening, gelling, stabilizing, or water-binding ingredient or additive. In certain embodiments, applications of cellulose produced as described herein include one or more of the following: dessert sweets, high-cellulose diet food, cheese and / or yogurt stabilizer, hotdog and / or sausage casing, candy, food texturizer, substitute for raw fish in sushi, ingredient in fruit cocktail, ice cream, sherbet, and cold soups.
[0112] In certain embodiments, specific properties of bacterial celluloses are utilized for skincare, such as high viscosity and shear thinning properties, surface functionality, dispersion stability, water-holding capacity, purity, and / or biocompatibility. In certain embodiments, cellulose produced according to the present invention is used in skincare as an emulsifier to stabilize solutions with different solubilities. In certain embodiments, strong humectant properties are used in moisturizing products such as lotions, creams, and / or masks. In certain embodiments, bacterial celluloses produced as described herein are used as formulation modifiers, moisturizers, nanofillers, additives, membranes, and / or films.
[0113] The microorganism produced nanocellulose product may be used as or incorporated into a packing material, packaging material, or container.Attorney Docket No.000241-001402WO
[0114] The microorganism produced nanocellulose product may be used in a personal care product, such as a cosmeceutical product, or in a cleaning product, such as a laundry detergent, as a constituent or encapsulation agent.
[0115] The microorganism produced nanocellulose product may be used in a biomedical product, such as a wound dressing, artificial skin, dental implant, drug delivery hemostatic material, vascular graft, scaffold for tissue engineering, biosensor, or diagnostic product. In certain embodiments, cellulose produced as described herein may be used in a pharmaceutical ingredient. In certain embodiments, cellulose produced as described herein may be used in a bacterial media,
[0116] The cellulose produced as described herein may be used in resistors in audio speakers and baffles.
[0117] Cellulose produced as described herein may be a potential replacement for traditional cellulose. In certain embodiments, cellulose produced as described herein is used as a component in the manufacture of high-grade paper or fiberglass filter sheets.
[0118] The microorganism produced nanocellulose product may be used in a textile, cloth, or fabric product, for example, as a raw material source for plant-free rayon or other fabric, and / or in fibers, thread, or yarn, e.g., incorporated into a textile cloth, or fabric. The microorganism produced nanocellulose product may be converted into viscose. The microorganism produced nanocellulose product may be used to produce an artificial silk.
[0119] The microorganism produced nanocellulose product may be converted into cellophane. The microorganism produced nanocellulose product may be converted into cellulose acetate or cellulose triacetate or nitrocellulose. Nitrocellulose produced from cellulose produced as described herein may be converted into celluloid. Celluloid produced according to the present invention may be used to fabricate artificial ivory.
[0120] The microorganism produced nanocellulose product may be used in a composite material, such as a resin, polymer, or biopolymer.
[0121] The microorganism produced nanocellulose product may be used in an active material, such as a material for chemical or enzymatic modification of another substance or material, or for immobilization of enzymes.
[0122] The microorganism produced nanocellulose product may be incorporated into a biologic product, such as an antimicrobial, anti-inflammatory, pain mediation, enzyme, or stem cell product.
[0123] The microorganism produced nanocellulose product may be incorporated into a high- performance composite material, an active fabric, or a nanostructured material.
[0124] The microorganism produced nanocellulose product may be enzymatically or chemically functionalized to improve a physical property, such as solubility in organic solvents or binding of a targeted molecule, tensile strength, crystallinity, fiber qualities, or to impart catalytic functionality.Attorney Docket No.000241-001402WO
[0125] The microorganism produced nanocellulose product may be used as a functional material substrate for enzyme incorporation or immobilization, for chemical incorporation, or for delivery of an active substance or medication, such as an antimicrobial substance or pain medication. Microorganisms
[0126] Nanocellulose as described herein is produced in one or more microorganism. The microbial organisms in which nanocellulose is produced may be photoautotrophic, heterotrophic, methanotrophic, methylotrophic, carboxydotrophic or chemoautotrophic organisms. In some embodiments, the microbial organisms include an oxyhydrogen microorganism. The microbial organisms may be wild-type, or may be genetically modified (e.g., recombinant), or a combination thereof.
[0127] In some embodiments, the microorganism is a recombinant microorganism that contains one or more heterologous gene sequence(s) for expression of one or more enzyme(s) in an anabolic biosynthetic pathway for production of nanocellulose. In some embodiments, the heterologous gene sequence(s) are derived from a species of Komagataeibacter. For example, the heterologous gene sequence(s) may be derived from Komagataeibacter xylinus, Komagataeibacter hansenii, Komagataeibacter rhaeticus, Komagataeibacter europaeus, or Komagataeibacter medellinensis.
[0128] Nanocellulose may be collected from a culture of one or more suitable microorganism, e.g., in a fermenter or bioreactor. For example, nanocellulose may be secreted into the culture medium, and then separated from the culture medium. Nanocellulose may be collected using any suitable method, such as a centrifuge, to separate the nanocellulose from the culture medium
[0129] In some embodiments, the microorganisms include a strain within the genus Cupriavidus or Ralstonia or Hydrogenobacter. In some embodiments, the microorganisms include the species Cupriavidus necator or Cupriavidus metallidurans. In some embodiments, the microorganisms include a strain of the species Cupriavidus necator, such as DSM 531 or DSM 541 or DSM 428. In some embodiments, the microorganisms include the species Cupriavidus metallidurans. In some embodiments, the microorganisms include a strain of the species Cupriavidus metallidurans DSM 2839.
[0130] In some embodiments, the microorganisms include a strain within the genus Xanthobacter. In some embodiments, the microorganisms include the species Xanthobacter autotrophicus. In some embodiments, the microorganisms include a strain of the species Xanthobacter autotrophicus, such as DSM 431, DSM 432, DSM 1618, or DSM 2267, or a strain of the species Xanthobacter flavus ,such as DSM 3874.
[0131] In some embodiments, the microorganisms include a Rhodococcus or Gordonia microorganism. In some embodiments, the microorganisms include Rhodococcus opacus. In some embodiments, the microorganisms include Rhodococcus opacus (DSM 43205) or Rhodococcus sp. (DSM 3346). In some embodiments, the microorganisms include Rhodococcus opacus; Hydrogenovibrio marinus; Rhodopseudomonas capsulata;Attorney Docket No.000241-001402WO Hydrogenobacter thermophilus; or Rhodobacter sphaeroides. In some embodiments, the microorganisms include a strain within the family burkholderiaceae.
[0132] In some embodiments, a consortium of microorganisms (i.e., two or more microorganisms grown together) is used for production of nanocellulose in the methods and compositions described herein. The consortium may include one or more of any of the microorganism species or strains described herein or one or more microorganisms having one or more microorganism traits described herein. In some embodiments, the consortium includes two or more of any of the microorganism species or strains or microorganisms described herein or two or more microorganisms having one or more microorganism traits described herein, e.g., each having one or more microorganism traits described herein.
[0133] In some embodiments, a microorganism as described herein can naturally grow on H2 / CO2and / or syngas and / or producer gas. In some embodiments, the microorganism can naturally accumulate polyhydroxyalkanoate (PHA) (e.g., polyhydroxybutyrate (PHB)) to about 50% or more of the cell biomass by weight. In some embodiments, the microorganism has a native ability to direct a high flux of carbon through the acetyl-CoA metabolic intermediate, which can lead into fatty acid biosynthesis, along with a number of other synthetic pathways, for example, PHA, e.g., PHB, synthesis, and / or amino acid biosynthesis. In some embodiments, the microorganism exhibiting these traits is a Cupriavidus microorganism, for example, Cupriavidus necator, e.g., Cupriavidus necator DSM 531 or DSM 541 or DSM 428. In some embodiments, the microorganism does not produce and / or accumulate PHA (e.g., PHB).
[0134] In some nonlimiting embodiments, the microorganisms include Corynebacterium autotrophicum. In some nonlimiting embodiments, the microorganisms include Corynebacterium autotrophicum and / or Corynebacterium glutamicum. In some embodiments, the microorganisms include Hydrogenovibrio marinus. In some embodiments, the microorganisms include Rhodopseudomonas capsulata, Rhodopseudomonas palustris, or Rhodobacter sphaeroides.
[0135] In some embodiments, the microorganisms or protein product thereof includes one or more of the following genera: Cupriavidus, Rhodococcus, Hydrogenovibrio., Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter.
[0136] In some embodiments, the microorganisms include a microorganism of the class Actinobacteria. In some embodiments, the microorganisms include a microorganism of the suborder corynebacterineae (corynebacterium, gordoniaceae, mycobacteriaceae and nocardiaceae). In some embodiments, the microorganisms include a microorganism of the family of Nocardiaceae. In some embodiments, the microorganisms include a microorganism drawn from one or more of the following classifications: Corynebacterium, Gordonia, Rhodococcus, Mycobacterium and Tsukamurella. In some embodiments, the microorganisms include a microorganism of the genus Rhodococcus, such as Rhodococcus opacus, Rhodococcus aurantiacus; Rhodococcus baikonurensis; Rhodococcus boritolerans; Rhodococcus equi; Rhodococcus coprophilus; Rhodococcus corynebacterioides; Nocardia corynebacterioides (synonym: Nocardia corynebacterioides); Rhodococcus erythropolis; Rhodococcus fascians; Rhodococcus globerulus; Rhodococcus gordoniae; Rhodococcus jostii;Attorney Docket No.000241-001402WO Rhodococcus koreensis; Rhodococcus kroppenstedtii; Rhodococcus maanshanensis; Rhodococcus marinonascens; Rhodococcus opacus; Rhodococcus percolatus; Rhodococcus phenolicus; Rhodococcus polyvorum; Rhodococcus pyridinivorans; Rhodococcus rhodochrous; Rhodococcus rhodnii; (synonym: Nocardia rhodnii); Rhodococcus ruber (synonym: Streptothrix rubra); Rhodococcus sp. RHA1; Rhodococcus triatomae; Rhodococcus tukisamuensis; Rhodococcus wratislaviensis (synonym: Tsukamurella wratislaviensis); Rhodococcus yunnanensis; or Rhodococcus zopfii. In some embodiments, the microorganisms include Rhodococcus opacus strain DSM 43205 or DSM 43206. In some embodiments, the microorganisms include strain Rhodococcus sp. DSM 3346.
[0137] In some embodiments, the microorganisms include an oxyhydrogen or knallgas strain. In some embodiments, the microorganisms include one or more of the following knallgas microorganisms: Aquifex pyrophilus, Aquifex aeolicus, or other Aquifex sp.; Cupriavidus necator or Cupriavidus metallidurans or other Cupriavidus sp.; Corynebacterium autotrophicum or other Corynebacterium sp.; Gordonia desulfuricans, Gordonia polyisoprenivorans, Gordonia rubripertincta, Gordonia hydrophobica, Gordonia westfalica, or other Gordonia sp.; Nocardia autotrophica, Nocardia opaca, or other Nocardia sp.; purple non-sulfur photosynthetic bacteria, including but not limited to, Rhodobacter sphaeroides, Rhodopseudomonas palustris, Rhodopseudomonas capsulata, Rhodopseudomonas viridis, Rhodopseudomonas sulfoviridis, Rhodopseudomonas blastica, Rhodopseudomonas spheroides, Rhodopseudomonas acidophila, or other Rhodopseudomonas sp.; Rhodobacter sp., Rhodospirillum rubrum, or other Rhodospirillum sp.; Rhodococcus opacus or other Rhodococcus sp.; Rhizobium japonicum or other Rhizobium sp.; Thiocapsa roseopersicina or other Thiocapsa sp.; Pseudomonas facilis, Pseudomonas flava, Pseudomonas putida, Pseudomonas hydrogenovora, Pseudomonas hydrogenothermophila, Pseudomonas palleronii, Pseudomonas pseudoflava, Pseudomonas saccharophila, Pseudomonas thermophile, or other Pseudomonas sp.; Hydrogenomonas pantotropha, Hydrogenomonas eutropha, Hydrogenomonas facilis, or other Hydrogenomonas sp.; Hydrogenobacter thermophiles, Hydrogenobacter halophilus, Hydrogenobacter hydrogenophilus, or other Hydrogenobacter sp.; Hydrogenophilus islandicus or other Hydrogenophilus sp.; Hydrogenovibrio marinus or other Hydrogenovibrio sp.; Hydrogenothermus marinus or other Hydrogenothermus sp.; Helicobacter pylori or other Helicobacter sp.; Xanthobacter autotrophicus, Xanthobacter flavus, or other Xanthobacter sp.; Hydrogenophaga flava, Hydrogenophaga palleronii, Hydrogenophaga pseudoflava, or other Hydrogenophaga sp.; Bradyrhizobium japonicum or other Bradyrhizobium sp.; Ralstonia eutropha or other Ralstonia sp.; Alcaligenes eutrophus, Alcaligenes facilis, Alcaligenes hydrogenophilus, Alcaligenes latus, Alcaligenes paradoxus, Alcaligenes ruhlandii, or other Alcaligenes sp.; Amycolata sp.; Aquaspirillum autotrophicum or other Aquaspirillum sp.; Arthrobacter strain 11 / X, Arthrobacter methylotrophus, or other Arthrobacter sp.; Azospirillum lipoferum or other Azospirillum sp.; Variovorax paradoxus or other Variovorax sp.; Acidovorax facilis, or other Acidovorax sp.; Bacillus schlegelii, Bacillus tusciae, other Bacillus sp.; Calderobacterium hydrogenophilum or other Calderobacterium sp.; Derxia gummosa or otherAttorney Docket No.000241-001402WO Derxia sp.; Flavobacterium autothermophilum or other Flavobacterium sp.; Microcyclus aquaticus or other Microcyclus sp.; Mycobacterium gordoniae or other Mycobacterium sp.; Paracoccus denitrificans or other Paracoccus sp.; Persephonella marina, Persephonella guaymasensis, or other Persephonella sp.; Renobacter vacuolatum or other Renobacter sp.; Seliberia carboxydohydrogena or other Seliberia sp., Streptomycetes coelicoflavus, Streptomycetes griseus, Streptomycetes xanthochromogenes, Streptomycetes thermocarboxydus, and other Streptomycetes sp.; Thermocrinis ruber or other Thermocrinis sp.; Wautersia sp.; cyanobacteria including but not limited to Anabaena oscillarioides, Anabaena spiroides, Anabaena cylindrica, or other Anabaena sp., and Arthrospira platensis, Arthrospira maxima, or other Arthrospira sp.; green algae including but not limited to Scenedesmus obliquus or other Scenedesmus sp., Chlamydomonas reinhardii or other Chlamydomonas sp., Ankistrodesmus sp., and Rhaphidium polymorphium or other Rhaphidium sp. In some embodiments, a consortium of microorganisms that includes an oxyhydrogen microorganism, such as any of the above oxyhydrogen microorganisms, is used for production of protein product as described herein.
[0138] In some embodiments, the microorganisms include one or more of the following genera: Cupriavidus; Xanthobacter; Dietzia; Gordonia; Mycobacterium; Nocardia; Pseudonocardia; Arthrobacter; Alcanivorax; Rhodococcus; Streptomyces; Rhodopseudomonas; Rhodobacter; and Acinetobacter; or a consortium of microorganisms that includes one or more of these microorganism genera.
[0139] In some embodiments, the microorganisms includes one or more of the following: Arthrobacter methylotrophus DSM 14008; Rhodococcus opacus DSM 44304; Rhodococcus opacus DSM 44311; Xanthobacter autotrophicus DSM 431; Rhodococcus opacus DSM 44236; Rhodococcus ruber DSM 43338; Rhodococcus opacus DSM 44315; Cupriavidus metallidurans DSM 2839; Cupriavidus necator DSM 531; Cupriavidus necator DSM 541; Rhodococcus aetherivorans DSM 44752; Gordonia desulfuricans DSM 44462; Gordonia polyisoprenivorans DSM 44266; Gordonia polyisoprenivorans DSM 44439; Gordonia rubripertincta DSM 46039; Rhodococcus percolatus DSM 44240; Rhodococcus opacus DSM 43206; Gordonia hydrophobica DSM 44015; Rhodococcus zopfii DSM 44189; Gordonia westfalica DSM 44215, Xanthobacter autotrophicus DSM 1618; Xanthobacter autotrophicus DSM 2267; Xanthobacter autotrophicus DSM 3874; Streptomycetes coelicoflavus DSM 41471; Streptomycetes griseus DSM 40236; Streptomycetes sp. DSM 40434; Streptomycetes xanthochromogenes DSM 40111; Streptomycetes thermocarboxydus DSM 44293; Rhodobacter sphaeroides DSM 158. In some embodiments, the microorganisms include a consortium of microorganisms that includes one or more of these microorganism strains, or one or more of any of the microorganism genera or species disclosed herein.
[0140] A number of different microorganisms have been characterized that are capable of growing on carbon monoxide as an electron donor and / or carbon source (i.e., carboxydotrophic microorganisms). In some cases, carboxydotrophic microorganisms can also use H2 as an electron donor and / or grow mixotrophically. In some cases, the carboxydotrophicAttorney Docket No.000241-001402WO microorganisms are facultative chemolithoautotrophs [Biology of the Prokaryotes, edited by J Lengeler, G. Drews, H. Schlegel, John Wiley & Sons, Jul 10, 2009, which is incorporated herein by reference in its entirety]. In some embodiments, the microorganisms or product thereof includes one or more of the following carboxydotrophic microorganisms: Acinetobacter sp.; Alcaligenes carboxydus or other Alcaligenes sp.; Arthrobacter sp.; Azomonas sp.; Azotobacter sp.; Bacillus schlegelii or other Bacillus sp.; Hydrogenophaga pseudoflava or other Hydrogenophaga sp.; Pseudomonas carboxydohydrogena, Pseudomonas carboxydovorans, Pseudomonas compransoris, Pseudomonas gazotropha, Pseudomonas thermocarboxydovorans, or other Pseudomonas sp.; Rhizobium japonicum or other Rhizobium sp.; and Streptomyces G26, Streptomyces thermoautotrophicus, or other Streptomyces sp. In some embodiments, the microorganisms or product thereof includes a consortium of microorganisms that includes carboxydotrophic microorganisms, such as one or more of the above carboxydotrophic microorganisms. In certain embodiments, a carboxydotrophic microorganism that is capable of chemolithoautotrophy is used. In certain embodiments, a carboxydotrophic microorganism that is able to utilize H2as an electron donor in respiration and / or biosynthesis is used.
[0141] In some embodiments, the microorganisms include obligate and / or facultative chemoautotrophic microorganisms, such as one or more of the following: Acetoanaerobium sp.; Acetobacterium sp.; Acetogenium sp.; Achromobacter sp.; Acidianus sp.; Acinetobacter sp.; Actinomadura sp.; Aeromonas sp.; Alcaligenes sp.; Alcaliqenes sp.; Aquaspirillum sp.; Arcobacter sp.; Aureobacterium sp.; Bacillus sp.; Beggiatoa sp.; Butyribacterium sp.; Carboxydothermus sp.; Clostridium sp.; Comamonas sp.; Cupriavidus sp.; Dehalobacter sp.; Dehalococcoide sp.; Dehalospirillum sp.; Desulfobacterium sp.; Desulfomonile sp.; Desulfotomaculum sp.; Desulfovibrio sp.; Desulfurosarcina sp.; Ectothiorhodospira sp.; Enterobacter sp.; Eubacterium sp.; Ferroplasma sp.; Halothibacillus sp.; Hydrogenobacter sp.; Hydrogenomonas sp.; Leptospirillum sp.; Metallosphaera sp.; Methanobacterium sp.; Methanobrevibacter sp.; Methanococcus sp.; Methanococcoides sp.; Methanogenium sp.; Methanolobus sp.; Methanomicrobium sp.; Methanoplanus sp.; Methanosarcina sp.; Methanospirillum sp.; Methanothermus sp.; Methanothrix sp.; Micrococcus sp.; Nitrobacter sp.; Nitrobacteraceae sp., Nitrococcus sp., Nitrosococcus sp.; Nitrospina sp., Nitrospira sp., Nitrosolobus sp.; Nitrosomonas sp.; Nitrosospira sp.; Nitrosovibrio sp.; Nitrospina sp.; Oleomonas sp.; Paracoccus sp.; Peptostreptococcus sp.; Planctomycetes sp.; Pseudomonas sp.; Ralstonia sp.; Rhodobacter sp.; Rhodococcus sp.; Rhodocyclus sp.; Rhodomicrobium sp.; Rhodopseudomonas sp.; Rhodospirillum sp.; Shewanella sp.; Siderococcus sp.; Streptomyces sp.; Sulfobacillus sp.; Sulfolobus sp.; Thermothrix sp., Thiobacillus sp.; Thiomicrospira sp.; Thioploca sp.; Thiosphaera sp.; Thiothrix sp.; Thiovulum sp.; sulfur-oxidizers; hydrogen- oxidizers; iron-oxidizers; acetogens; and methanogens; consortiums of microorganisms that include chemoautotrophs; chemoautotrophs native to at least one of hydrothermal vents, geothermal vents, hot springs, cold seeps, underground aquifers, salt lakes, saline formations, and soils; and extremophiles selected from one or more of thermophiles, hyperthermophiles,Attorney Docket No.000241-001402WO acidophiles, halophiles, and psychrophiles. In some embodiments, the microorganisms, or protein product thereof includes a consortium of microorganisms that includes chemoautotrophic microorganisms, such as one or more of the above chemoautotrophic microorganisms.
[0142] In some embodiments, the microorganisms include extremophiles that can withstand extremes in various environmental parameters, such as temperature, radiation, pressure, gravity, vacuum, desiccation, salinity, pH, oxygen tension, and / or chemicals. Such microorganisms include hyperthermophiles, such as Pyrolobus fumarii; thermophiles, such as Synechococcus lividis; mesophiles and psychrophiles, such as Psychrobacter, and / or extremely thermophilic sulfur-metabolizers such as Thermoproteus sp., Pyrodictium sp., Sulfolobus sp., and Acidianus sp.; radiation tolerant organisms such as Deinococcus radiodurans; pressure tolerant microorganisms including piezophiles or barophiles; desiccant tolerant and anhydrobiotic microorganisms including xerophiles, such as Artemia salina; microbes and fungi; salt tolerant microorganisms including halophiles, such as Halobacteriacea and Dunaliella salina; pH tolerant microorganisms including alkaliphiles, such as Natronobacterium, Bacillus firmus OF4, Spirulina spp., and acidophiles such as Cyanidium caldarium and Ferroplasma sp; gas tolerant microorganisms, e.g., tolerant to pure CO2, including Cyanidium caldarium; and metal tolerant microorganisms (metalotolerants), such as Ferroplasma acidarmanus and Ralstonia sp.
[0143] In certain embodiments, the microorganism includes a cell line selected from eukaryotic plants, algae, cyanobacteria, green-sulfur bacteria, green non-sulfur bacteria, purple sulfur bacteria, purple non-sulfur bacteria, extremophiles, yeast, fungi, proteobacteria, engineered organisms thereof, and synthetic organisms. In certain embodiments, Spirulina is utilized.
[0144] In certain embodiments, the microorganisms include green non-sulfur bacteria, which include but are not limited to the following genera: Chloroflexus, Chloronema, Oscillochloris, Heliothrix, Herpetosiphon, Roseiflexus, and Thermomicrobium.
[0145] In certain embodiments, the microorganisms include green sulfur bacteria, which include but are not limited to the following genera: Chlorobium, Clathrochloris, and Prosthecochloris.
[0146] In certain embodiments, the microorganisms thereof include purple sulfur bacteria, which include but are not limited to the following genera: Allochromatium, Chromatium, Halochromatium, Isochromatium, Marichromatium, Rhodovulum, Thermochromatium, Thiocapsa, Thiorhodococcus, and Thiocystis.
[0147] In certain embodiments, the microorganisms include purple non-sulfur bacteria, which include but are not limited to the following genera: Phaeospirillum, Rhodobaca, Rhodobacter, Rhodomicrobium, Rhodopila, Rhodopseudomonas, Rhodothalassium, Rhodospirillum, Rodovibrio, and Roseospira.
[0148] In some embodiments, the microorganisms include a methanotroph and / or a methylotroph. In some embodiments, the microorganism is in the genus Methylococcus. In some embodiments, the microorganism is Methylococcus capsulatus. In some embodiments, the microorganism is a methylotroph. In some embodiments, the microorganism is in the genus Methylobacterium. In some embodiments, the microorganisms include one or more of theAttorney Docket No.000241-001402WO following species: Methylobacterium zatmanii; Methylobacterium extorquens; Methylobacterium chloromethanicum.
[0149] In some embodiments, the microorganisms include a hydrogen-oxidizing chemoautotroph and / or a carboxydotroph and / or a methylotroph and / or methanotroph.
[0150] In certain embodiments, the microorganisms include microorganisms that can grow heterotrophically, utilizing multi-carbon organic molecules as carbon sources, such as, but not limited to sugars, for example, but not limited to, glucose and / or fructose and / or sucrose. In some embodiments, the microorganism is capable of growing on untreated crude glycerol and / or glucose and / or methanol and / or acetate as the sole electron donor(s) and carbon source(s). In some embodiments, the microorganism is able to grow mixotrophically, for example, mixotrophic growth on an organic carbon source and an inorganic energy source (e.g., inorganic electron donor). In certain such embodiments, the inorganic electron donor is hydrogen.
[0151] In certain embodiments, the microorganisms include one or more of eukaryotic plants, algae, cyanobacteria, green-sulfur bacteria, green non-sulfur bacteria, purple sulfur bacteria, purple non-sulfur bacteria, extremophiles, archaea, yeast, fungi, proteobacteria, engineered organisms thereof, and synthetic organisms.
[0152] In some embodiments, the microorganisms comprise or consist of gram-positive bacteria. In other embodiments, the microorganisms comprise or consist of gram-negative bacteria.
[0153] In certain embodiments, the microorganisms include naturally occurring and / or non- genetically modified (non-GMO) microorganisms and / or non-pathogenic and / or are grown in specific environmental conditions provided by the bioprocesses that are absent from the surrounding environment.
[0154] In certain embodiments, the microorganisms or consortium of microorganisms are isolated from environmental samples and enriched with desirable microorganisms using methods known in the art of microbiology, for example, growth in the presence of targeted electron donors, including, but not limited to, one or more of: H2, CO, syngas and / or methane, and / or electron acceptors including, but not limited to, one or more of O2, nitrate, ferric iron, and / or CO2, and / or environmental conditions (e.g., temperature, pH, pressure, dissolved oxygen (DO), salinity, the presence of various impurities and pollutants, etc.).
[0155] In certain embodiments, the microorganisms or consortium of microorganisms include yeast, such as, but not limited to, one or more of the following: Candida humilis; Candida milleri; Debaryomyces hansenii; Kazachstania exigua (Saccharomyces exiguous); Saccharomyces cerevisiae; Saccharomyces florentinus; Torulaspora delbrueckii; Trichosporon beigelli; and / or include fungi, such as, but not limited to, one or more of the following: Aspergillus oryzae; Aspergillus sojae; Fusarium venenatum A3 / 5; Neurospora intermedia var. oncomensis; Rhizopus oligosporus; Rhizopus oryzae; Aspergillus luchuensis; and / or include bacteria, such as, but not limited to, I one or more of the following: Bacillus amyloliquefaciens; Bacillus subtilis; Bifidobacterium animalis (lactis); Bifidobacterium bifidum; Bifidobacterium breve; Bifidobacterium longum; Lactobacillus acidophilus; Lactobacillus brevis; Lactobacillus casei;Attorney Docket No.000241-001402WO Lactobacillus delbrueckii subsp. Bulgaricus; Lactobacillus fermentum; Lactobacillus helveticus; Lactobacillus kefiranofaciens; Lactobacillus lactis; Lactobacillus plantarum; Lactobacillus rhamnosus; Lactobacillus reuteri; Lactobacillus sakei; Lactobacillus sanfranciscensis; Lactococcus lactis (Streptococcus lactis, Streptococcus lactis subsp. Diacetylactis); Leuconostoc; Leuconostoc carnosum; Leuconostoc cremoris; Leuconostoc mesenteroides; Pediococcus; Propionibacterium freudenreichii; Arthrospira (Spirulina) platensis; Streptococcus faecalis; Streptococcus thermophilus.
[0156] The nanocellulose product may be produced by a consortium of different species of microorganisms. The consortium may optionally include multi-cellular organisms. In some embodiments, the consortium includes one or more of: an oxyhydrogen microorganism; a carboxydotroph; a methanotroph; a methylotroph; a chemoautotroph; a photoautotroph; and a heterotroph. Microbial cultures
[0157] Any suitable methods may be used to culture the microorganisms. The microorganism may be grown under any suitable conditions, in an environment that is suitable for growth of the microorganisms and production of biomass and the nanocellulose product described herein. In some embodiments, the microorganisms are grown in a reactor in which agitation is minimized and gas mass transfer is maintained. In some embodiments, organic nutrients are produced from CO2in a bioreactor in which agitation and / or gas mass transfer is maximized, and the organic nutrients are then fed to another bioreactor in which agitation is minimized and gas mass transfer is maintained.
[0158] In some embodiments, the microorganism may be grown in autotrophic culture conditions, heterotrophic culture conditions, or a combination of autotrophic and heterotrophic culture conditions. A heterotrophic culture may include a suitable source of carbon and energy, such as one or more sugar (e.g., glucose, fructose, sucrose, etc.). An autotrophic culture may include C1 chemicals such as carbon monoxide, carbon dioxide, methane, methanol, formate, and / or formic acid, and / or mixtures containing C1 chemicals, including, but not limited to various syngas compositions or various producer gas compositions, e.g., generated from low value sources of carbon and energy, such as, but not limited to, lignocellulosic energy crops, crop residues, bagasse, saw dust, forestry residue, or food, through the gasification, partial oxidation, pyrolysis, or steam reforming of said low value carbon sources, that can be used by an oxyhydrogen microorganism or hydrogen-oxidizing microorganism or carbon monoxide oxidizing microorganism as a carbon source and an energy source. Suitable methods and apparatus for culturing the microorganisms and generating a biomass for use in the present methods are described, e.g., in PCT Application Nos. US2010 / 001402, US2011 / 034218, US2013 / 032362, US2014 / 029916, US2017 / 023110, US2018 / 016779, US2022 / 029657, and U.S. Patent No. 9,157,058, each of which is hereby incorporated by reference herein in its entirety. In some embodiments, the organism may be grown photosynthetically in a bioreactor, in a hydroponicsAttorney Docket No.000241-001402WO system, in a greenhouse, or in a cultivated field, or may be collected from waste or natural sources.
[0159] The liquid cultures used to grow microorganism cells described herein can be housed in culture vessels known and used in the art. In some embodiments, large scale production in a bioreactor vessel can be used to produce large quantities of a desired molecule and / or biomass. In certain embodiments, the desired molecule is a cellulose polymer and / or the biomass comprises cellulose.
[0160] In certain embodiments, bioreactor vessels are used to contain, isolate, and / or protect the culture environment. The culture vessels include those that are known to those of ordinary skill in the art of large scale microbial culturing. Such culture vessels include but are not limited to one or more of the following: airlift reactors; biological scrubber columns; bubble columns; stirred tank reactors; continuous stirred tank reactors; counter-current, upflow, expanded-bed reactors; digesters and in particular digester systems, for example, such known in the art of bioremediation; filters including but not limited to trickling filters, rotating biological contactor filters, rotating discs, soil filters; fluidized bed reactors; gas lift fermenters; immobilized cell reactors; loop reactors; membrane biofilm reactors; pachuca tanks; packed-bed reactors; plug- flow reactors; static mixers; trickle bed reactors; and / or vertical shaft bioreactors.
[0161] Microbial culturing aimed at the commercial production of biomass and / or organic compounds, e.g., cellulose product as described herein may be performed in bioreactors at large scale (e.g., 500 L, 1,000 L 5,000 L, 10,000 L, 50,000 L, 100,000 L, 1,000,000 L bioreactor volumes and higher).
[0162] In certain embodiments, chemoautotrophic and / or heterotrophic and / or carboxydotrophic and / or methanotrophic and / or methylotrophic microorganisms are grown in a liquid media inside a bioreactor using methods described herein.
[0163] In some embodiments, the bioreactor containing the microorganisms is constructed of opaque materials that keep the culture in near or total darkness. Bioreactors constructed out of opaque materials such as steel and / or other metallic alloys and / or reinforced concrete and / or fiberglass and / or various high strength plastic materials can be designed to have large working volumes. In some embodiments, fermenters constructed of steel or other metallic alloys that are 50,000 liters and greater in volume are utilized. In some embodiments, bioreactors capable of containing positive headspace pressures above ambient pressure are utilized. In some embodiments, egg-shape or cylindrical digesters or vertical shaft bioreactors 3,000,000 liters and greater in volume are utilized. In some embodiments, the bioreactor comprising the microorganism does not allow light to penetrate part or most or all of its contained liquid volume. In certain non-limiting embodiments, the microorganism used in the CO2-fixation step is not photosynthetic. In certain non-limiting embodiments, the bioreactor design does not confine the culture in thin layers or have transparent walls so as to have light available to all parts, as is generally necessary with photosynthesis. In some embodiments, the microorganism is cultured without significant or any exposure to light. In certain such embodiments, net CO2 consumption still occurs in the absence of light due to chemoautotrophic metabolism and conditions. InAttorney Docket No.000241-001402WO certain embodiments, converting electricity to artificial light is not required in a biological system for CO2capture and conversion.
[0164] In certain embodiments, the lack of light dependence facilitates continuous CO2capture operations, day and night, year-round, in all weather conditions, without the need for any artificial lighting.
[0165] In some embodiments, the microorganisms are grown and maintained in a medium containing a gaseous carbon source, such as but not limited to syngas, producer gas, or gas mixtures containing H2and CO2, in the absence of light; where such growth is known as chemoautotrophic growth.
[0166] In some embodiments, syngas, for example, generated from gasification of organic matter is utilized by the microorganisms for chemoautotrophic growth. The organic matter may be, for example, from an agricultural source (e.g., corn stover, bagasse).
[0167] In some embodiments, CO2and / or air that goes through a direct air capture unit is utilized by the microorganisms for chemoautotrophic growth. Non-limiting examples of direct air capture may be found in U.S. Publication No.2017 / 0106330 and Keith, D., et al. (2018) Joule 2(8):1573- 1594, which are incorporated by reference herein in their entireties. In some embodiments, CO2is provided from an industrial source, and optionally may be concentrated via a gas separation procedure, thereby resulting in high concentration CO2. In certain embodiments, the CO2fed into the bioreactor is food grade.
[0168] In certain embodiments, an increase in system capacity is met by vertical scaling, rather than only scaling horizontally. This is in contrast to phototrophic approaches using algae, cyanobacteria, or higher plants for CO2capture. Although various vertical farming schemes have been proposed for photosynthetic systems, practically and economically speaking, phototrophic systems must expand horizontally, for example in shallow ponds or photobioreactors in the case of algae. This results in large geographic footprints and many negative environmental impacts.
[0169] An algal or higher plant system grown with artificial lighting is challenged by inefficient utilization of light energy, and by inefficient conversion of electrical energy to light energy. In certain embodiments, a comparable algal or high-plant culture grown under artificial lighting will require more electrical power than the CO2capture and / or biomass and / or cellulose production system described herein, in terms of CO2capture and / or biomass and / or cellulose production. In certain embodiments, a comparable algal or higher-plant culture grown under artificial lighting will require at least ten times more electrical power than the CO2 capture and / or biomass and / or cellulose production system described herein, in terms of power per unit CO2capture and / or per unit biomass and / or cellulose production. For algae or higher-plants grown on artificial lighting, the heat rejection requirement is almost in direct proportion to the electrical input. In certain embodiments of the methods described herein, the heat rejection requirements are lower than for a comparable algal or higher plant system in terms of CO2capture and / or biomass and / or cellulose production, when grown on artificial lighting. In certain embodiments, the heat rejection requirements are at least ten times lower than for a comparable algal or higher plantAttorney Docket No.000241-001402WO system, in terms of CO2 capture and / or biomass and / or cellulose production when grown on artificial lighting.
[0170] In an exemplary but nonlimiting embodiment, a bioreactor containing nutrient medium is inoculated with production cells. Generally, there will follow a lag phase prior to the cells beginning to double. After the lag phase, the cell doubling time decreases and the culture goes into the logarithmic phase. The logarithmic phase is eventually followed by an increase of the doubling time that, while not intending to be limited by theory, is thought to result from either a mass transfer limitation, depletion of nutrients including nitrogen or mineral sources, or a rise in the concentration of inhibitory chemicals, or quorum sensing by the microbes. The growth slows down and then ceases when the culture enters the stationary phase. In certain embodiments, there is an arithmetic growth phase preceding the stationary phase. In order to harvest cell mass or cellulose, the culture in certain embodiments is harvested in the logarithmic phase and / or in the arithmetic phase and / or in the stationary phase.
[0171] The bioreactor or fermenter is used to culture cells through the various phases of their physiological cycle. A bioreactor is utilized for the cultivation of cells, which may be maintained at particular phases in their growth curve. The use of bioreactors is advantageous in many ways for cultivating chemoautotrophic growth. For certain embodiments, cell mass, which is used to produce cellulose, is grown to high densities in liquid suspension. Generally, the control of growth conditions, including control of dissolved carbon dioxide, oxygen, and other gases such as hydrogen, as well as other dissolved nutrients, trace elements, temperature and pH, is facilitated in a bioreactor. For certain embodiments, cell mass, which is used to produce cellulose, amino acids, peptides, proteins, hydrolysates, extracts, or whole cell products, is grown to high densities and / or grown at high productivities, in liquid suspension within a bioreactor.
[0172] Nutrient media, as well as gases, can be added to the bioreactor as either a batch addition, or periodically, or in response to a detected depletion or programmed set point, or continuously over the period the culture is grown and / or maintained. For certain embodiments, the bioreactor at inoculation is filled with a starting batch of nutrient media and / or one or more gases at the beginning of growth, and no additional nutrient media and / or one or more gases are added after inoculation. For certain embodiments, nutrient media and / or one or more gases are added periodically after inoculation. For certain embodiments, nutrient media and / or one or more gases are added after inoculation in response to a detected depletion of nutrient and / or gas. For certain embodiments, nutrient media and / or one or more gases are added continuously after inoculation.
[0173] For certain embodiments, the added nutrient media does not contain any organic compounds.
[0174] In certain embodiments, a small amount of microorganism cells (i.e., an inoculum) is added to a set volume of culture medium; the culture is then incubated; and the cell mass passes through lag, exponential, deceleration, and stationary phases of growth.Attorney Docket No.000241-001402WO
[0175] In batch culture systems, the conditions (e.g., nutrient concentration, pH, etc.) under which the microorganism is cultivated generally change continuously throughout the period of growth. In certain non-limiting embodiments, to avoid the fluctuating conditions inherent in batch cultures, and to improve the overall productivity of the culture system, the microorganisms that are used for the production of cellulose and / or protein and / or vitamins and / or other nutrients are grown in a continuous culture system called a chemostat. In such systems, the culture may be maintained in a perpetual exponential or arithmetic phase of growth by feeding it with fresh medium at a constant rate [F] while at the same time maintaining the volume [V] of the culture constant. In certain embodiments, a continuous culture system ensures that cells are cultivated under environmental conditions that remain roughly constant. In certain embodiments, the cells are maintained in a perpetual exponential or arithmetic phase through the use of a chemostat system. In certain cases, the culture is maintained in a steady state with a roughly fixed amount of standing biomass maintained in the bioreactor over time. In such a case the dilution rate (D) of the culture equals the growth rate of the microorganism, and is given by: D = F / V. The growth rate of a microorganism in continuous culture may be changed by altering the dilution rate. In certain embodiments, the growth rate of the microorganism is changed by altering the dilution rate. In certain non-limiting embodiments, cells are grown in a chemostat at a dilution rate of any of about or at least about 0.02 h-1, 0.05 h-1, 0.1 h-1, 0.15 h-1, 0.2 h-1, 0.25 h-1, 0.3 h-1, or 0.4 h-1, or over 0.4 h-1. In certain embodiments, the continuous bioreactor is maintained as a turbidostat, where a fixed amount of standing biomass is maintained in the bioreactor over time, and where all surplus biomass that is produced beyond that necessary to maintain the fixed amount of standing biomass within the bioreactor, is harvested continuously from the bioreactor. In certain non-limiting embodiments, the standing biomass is maintained at any of about or at least about 1 g / L, 2 g / L, 5 g / L, 10 g / L, 20 g / L, 50 g / L or 100 g / L, or over 100 g / L.
[0176] In certain embodiments, inoculation of the culture into the bioreactor is performed by methods including but not limited to transfer of culture from an existing culture inhabiting another bioreactor, or incubation from a seed stock raised in an incubator. In certain embodiments, the seed stock of the strain may be transported and stored in forms including but not limited to a powder, liquid, frozen, or freeze-dried form as well as any other suitable form, which may be readily recognized by one skilled in the art. In certain non-limiting embodiments, the reserve bacterial cultures are kept in a metabolically inactive, freeze-dried state until required for restart. In certain embodiments, when establishing a culture in a very large reactor, cultures are grown and established in progressively larger intermediate scale vessels prior to inoculation of the full- scale vessel.
[0177] For certain embodiments, the bioreactors have mechanisms to enable mixing of the nutrient media that include, but are not limited to, one or more of the following: spinning stir bars, blades, impellers, or turbines; spinning, rocking, or turning vessels; gas lifts, sparging; recirculation of broth from the bottom of the container to the top via a recirculation conduit, flowing the broth through a loop and / or static mixers. The culture media may be mixed continuously or intermittently.Attorney Docket No.000241-001402WO
[0178] In certain embodiments the microorganism-containing nutrient medium may be removed from the bioreactor partially or completely, periodically, or continuously, and in certain embodiments is replaced with fresh cell-free medium to maintain the cell culture in an exponential growth phase, and / or in another targeted growth phase (e.g., arithmetic growth), and / or to replenish the depleted nutrients in the growth medium, and / or remove inhibitory waste products.
[0179] The ports that are standard in bioreactors may be utilized to deliver, or withdraw, gases, liquids, solids, and / or slurries, into and / or from the bioreactor vessel enclosing the microbes. Many bioreactors have multiple ports for different purposes (e.g., ports for media addition, gas addition, probes for pH and DO, and sampling), and a given port may be used for various purposes during the course of a fermentation run. As an example, a port might be used to add nutrient media to the bioreactor at one point in time, and at another time might be used for sampling. Preferably, the multiple uses of a sampling port can be performed without introducing contamination or invasive species into the growth environment. A valve or other actuator enabling control of the sample flow or continuous sampling can be provided to a sampling port. For certain embodiments, the bioreactors are equipped with at least one port suitable for culture inoculation that can additionally serve other uses including the addition of media or gas. Bioreactor ports enable control of the gas composition and flow rate into the culture environment. For example, the ports can be used as gas inlets into the bioreactor through which gases are pumped.
[0180] For some embodiments, gases that may be pumped into a bioreactor include, but not are not limited to, one or more of the following: syngas, producer gas, hydrogen gas (H2), CO, CO2, O2, air, air / CO2 mixtures, natural gas, methane, ammonia, nitrogen, noble gases, such as argon, as well as other gases. In some embodiments the CO2pumped into the system may come from sources including, but not limited to: CO2from the gasification of organic matter; CO2from the calcination of limestone, CaCO3, to produce quicklime, CaO; CO2 from methane steam reforming, such as the CO2 byproduct from ammonia, methanol, or hydrogen production; CO2 from combustion, incineration, or flaring; CO2byproduct of anaerobic or aerobic fermentation of sugar; CO2byproduct of a methanotrophic bioprocess; geologically or geothermally produced or emitted CO2; CO2 removed from acid gas or natural gas. In certain non-limiting embodiments, the CO2 has been removed from an industrial flue gas, or intercepted from a geological source that would otherwise naturally emit into the atmosphere. In certain embodiments, the carbon source is CO2and / or bicarbonate and / or carbonate dissolved in sea water or other bodies of surface or underground water. In certain such embodiments the inorganic carbon may be introduced to the bioreactor dissolved in liquid water and / or as a solid. In certain embodiments, the carbon source is CO2captured from the atmosphere. In certain non-limiting embodiments, the CO2has been captured from a closed cabin as part of a closed-loop life support system, using equipment such as but not limited to a CO2 removal assembly (CDRA), which is utilized, for example, on the International Space Station (ISS).Attorney Docket No.000241-001402WO
[0181] In certain embodiments, waste CO2 and / or CO2 from the atmosphere is converted into cellulose. In certain embodiments, the production of cellulose has no net greenhouse gas emissions. In certain embodiments, the production of cellulose has very low water consumption and / or land use and / or a very high areal productivity; kg / m2 / yr.
[0182] In certain non-limiting embodiments, geological features such as, but not limited to, geothermal and / or hydrothermal vents that emit high concentrations of energy sources (e.g., H2, H2S, CO gases) and / or carbon sources (e.g., CO2, HCO3-, CO32-) and / or other dissolved minerals may be utilized as nutrient sources for the microorganisms herein.
[0183] In certain embodiments, carbon dioxide, bicarbonate, and / or carbonate, is either dissolved into solution and fed to the culture broth and / or dissolved directly into the culture broth. In certain embodiments, one or more gases in addition to carbon dioxide, or in place of carbon dioxide as an alternative carbon source, are either dissolved into solution and fed to the culture broth and / or dissolved directly into the culture broth, including but not limited to gaseous electron donors and / or carbon sources (e.g., hydrogen and / or CO and / or methane gas). In certain embodiments, input gases may include other electron donors and / or electron acceptors and / or carbon sources and / or mineral nutrients such as, but not limited to, other gas constituents and impurities of syngas (e.g., hydrocarbons); ammonia; hydrogen sulfide; and / or other sour gases; and / or O2; and / or mineral containing particulates and ash.
[0184] In certain embodiments, one or more gases are dissolved into the culture broth, including but not limited to gaseous electron donors such as, but not limited to, one or more of the following: hydrogen, carbon monoxide, methane, hydrogen sulfide or other sour gases; gaseous carbon sources such as, but not limited to one or more of the following: CO2, CO, CH4; and electron acceptors such as, but not limited to, oxygen, either within air (e.g., 20.9% oxygen) or as pure O2or as an O2-enriched gas. In some embodiments, the dissolution of these and other gases into solution is achieved using a system of compressors, flowmeters, and flow valves known to one skilled in the art of fermentation engineering, that feed into one of more of the following widely used systems for dispersing gas into solution: sparging equipment; diffusers including but not limited to dome, tubular, disc, or doughnut geometries; coarse or fine bubble aerators; venturi equipment. In certain embodiments, surface aeration and / or gas mass transfer may also be performed using paddle aerators and the like. In certain embodiments, gas dissolution is enhanced by mechanical mixing with an impeller or turbine, as well as hydraulic shear devices to reduce bubble size. Following passage through the reactor system holding microorganisms which uptake the gases, in certain embodiments the residual gases may either be recirculated back to the bioreactor, or burned for process heat, or flared, or injected underground, or released into the atmosphere. In certain embodiments herein utilizing H2 as electron donor, H2may be fed to the culture vessel either by bubbling it through the culture medium, or by diffusing it through a hydrogen permeable-water impermeable membrane known in the art that interfaces with the liquid culture medium.
[0185] In certain embodiments, the microorganisms grow and multiply on H2 and CO2 and other dissolved nutrients under microaerobic conditions. In certain embodiments, a C1 chemical suchAttorney Docket No.000241-001402WO as but not limited to CO2, carbon monoxide, methane, methanol, formate, or formic acid, and / or mixtures containing C1 chemicals including but not limited to various syngas compositions generated from various gasified, pyrolyzed, or steam-reformed fixed carbon feedstocks, are biochemically converted into longer chain organic chemicals (i.e., C2 or longer and, in some embodiments, C5 or longer carbon chain molecules) under one or more of the following conditions: aerobic, microaerobic, anoxic, anaerobic, and / or facultative conditions.
[0186] A controlled amount of oxygen can also be maintained in the culture broth of some embodiments, and in certain embodiments, oxygen will be actively dissolved into solution fed to the culture broth and / or directly dissolved into the culture broth. In certain aerobic or microaerobic embodiments that require the pumping of air or oxygen into the culture broth in order to maintain targeted DO levels, oxygen bubbles may be injected into the broth at an optimal diameter for mixing and oxygen transfer. In some embodiments, conditions suitable for growth of an oxyhydrogen microorganism are deployed, such as use of H2 and O2 gas substrates (electron donors and acceptors), and optionally a C1 gaseous carbon source, such as CO2and / or CO.
[0187] In some embodiments, the microorganisms convert a fuel gas, including but not limited to syngas, producer gas, CO, CO2, H2, natural gas, methane, and mixtures thereof. In some embodiments, the heat content of the fuel gas is at least 100 BTU per standard cubic foot (scf). In some embodiments, a bioreactor that is used to contain and grow the microorganisms is equipped with fine-bubble diffusers and / or high-shear impellers for gas delivery.
[0188] Introducing and / or raising the gas flow rate into a bioreactor can enhance mixing of the culture and produce turbulence if the gas inlet is positioned beneath the surface of the liquid media such that gas bubbles or sparges up through the media. In certain embodiments, mixing is enhanced through turbulence provided by gas bubbles and / or sparging and / or gas plugging up through the liquid media. In some embodiments, a bioreactor comprises gas outlet ports for gas escape and pressure release. In some embodiments, gas inlets and outlets are preferably equipped with check valves to prevent gas backflow.
[0189] In certain embodiments where chemosynthetic reactions occur within the bioreactor, one or more types of electron donor and one or more types of electron acceptor are pumped or otherwise added as either a bolus addition, or periodically, or continuously to the nutrient medium containing chemoautotrophic organisms in the reaction vessel. The chemosynthetic reaction, driven by the transfer of electrons from electron donor to electron acceptor in cellular respiration, fixes inorganic carbon dioxide and / or other dissolved carbonates and / or other carbon oxides into organic compounds and biomass.
[0190] In certain embodiments a nutrient media for culture growth and production is used, comprising an aqueous solution containing suitable minerals, salts, vitamins, cofactors, buffers, and other components needed for microbial growth, known to those skilled in the art [Bailey and Ollis, Biochemical Engineering Fundamentals, 2nded; pp 383-384 and 620-622; McGraw-Hill: New York (1986)].Attorney Docket No.000241-001402WO
[0191] In certain embodiments, the chemicals used for maintenance and growth of microbial cultures as known in the art are included in the nutrient media. In certain embodiments, these chemicals may include but are not limited to one or more of the following: nitrogen sources such as ammonia, ammonium (e.g., ammonium chloride (NH4Cl), ammonium sulfate ((NH4)2SO4)), nitrate (e.g., potassium nitrate (KNO3)), urea or an organic nitrogen source; phosphate (e.g., disodium phosphate (Na2HPO4), potassium phosphate (KH2PO4), phosphoric acid (H3PO4), potassium dithiophosphate (K3PS2O2), potassium orthophosphate (K3PO4), dipotassium phosphate (K2HPO4)); sulfate; yeast extract; chelated iron; potassium (e.g., potassium phosphate (KH2PO4) , potassium nitrate (KNO3), potassium iodide (KI), potassium bromide (KBr)); and other inorganic salts, minerals, and trace nutrients (e.g., sodium chloride (NaCl), magnesium sulfate (MgSO47H2O) or magnesium chloride (MgCl2), calcium chloride (CaCl2) or calcium carbonate (CaCO3), manganese sulfate (MnSO47H2O) or manganese chloride (MnCl2), ferric chloride (FeCl3), ferrous sulfate (FeSO47H2O) or ferrous chloride (FeCl.sub.24H.sub.2O), sodium bicarbonate (NaHCO3) or sodium carbonate (Na2CO3), zinc sulfate (ZnSO4) or zinc chloride (ZnCl2), ammonium molybdate (NH4MoO4) or sodium molybdate (Na2MoO42H2O), cuprous sulfate (CuSO4) or copper chloride (CuCl22H2O), cobalt chloride (CoCl26H2O), aluminum chloride (AlCl3.6H2O), lithium chloride (LiCl), boric acid (H3BO3), nickel chloride NiCl26H2O), tin chloride (SnCl2H2O), barium chloride (BaCl22H2O), copper selenate (CuSeO45H2O) or sodium selenite (Na2SeO3), sodium metavanadate (NaVO3), chromium salts). In certain embodiments, the mineral salts medium (MSM) formulated by Schlegel et al may be used [“Thermophilic bacteria”, Jakob Kristjansson, Chapter 5, Section III, CRC Press, (1992)].
[0192] Microorganisms described herein can be cultured in some embodiments in media of any type (rich or minimal), including fermentation medium, and any composition. As would be understood by one of ordinary skill in the art, routine optimization would allow for use of a variety of types of media. The selected medium can be supplemented with various additional components. Some non-limiting examples of supplemental components include glucose, fructose, sucrose, starches, polysaccharides, protein hydrolysates, antibiotics, IPTG for gene induction, and ATCC Trace Mineral Supplement. Similarly, other aspects of the medium and growth conditions of the microorganisms described herein may be optimized through routine experimentation. For example, pH and temperature are non-limiting examples of factors which can be optimized. In some embodiments, factors such as choice of media, media supplements, and temperature can influence production levels of a desired molecule. In some embodiments, the concentration and amount of a supplemental component may be optimized. In some embodiments, how often the media is supplemented with one or more supplemental components, and the amount of time that the media is cultured before harvesting the desired molecule is optimized.
[0193] In certain embodiments, the concentrations of nutrient chemicals (e.g., electron donors, electron acceptors, carbon sources, and / or various mineral nutrients), are maintained within the bioreactor close to or at their respective optimal levels for optimal carbon uptake and / or fixationAttorney Docket No.000241-001402WO and / or conversion and / or production of biomass and / or organic compounds, and in particular cellulose, which varies depending upon the microorganism utilized but may be routinely determined and / or optimized by one of ordinary skill in the art of culturing microorganisms.
[0194] In certain embodiments, one or more of the following parameters are monitored and / or controlled in the bioreactor: waste product levels; pH; temperature; salinity; dissolved oxygen; dissolved carbon dioxide gas; liquid flow rates; agitation rate; gas pressure. In certain embodiments, the operating parameters affecting chemoautotrophic growth, and / or other types of growth (e.g., heterotrophic growth) are monitored with sensors (e.g., dissolved oxygen probe or oxidation-reduction probe to gauge electron donor / acceptor concentrations), and / or are controlled either manually or automatically based upon feedback from sensors through the use of equipment including but not limited to actuating valves, pumps, and agitators. In certain embodiments, the temperature of the incoming broth as well as of incoming gases is regulated by systems such as, but not limited to, coolers, heaters, and / or heat exchangers.
[0195] In certain embodiments, the microbial culture and bioreaction is maintained using continuous influx and removal of nutrient medium and / or biomass, in steady state where the cell population and environmental parameters (e.g., cell density, pH, DO, chemical concentrations) are targeted at a constant level over time. In certain embodiments, the constant level is an optimal level for feedstock conversion and / or production of targeted organic compounds. In certain embodiments the targeted organic compounds comprise cellulose. In certain embodiments the targeted organic compounds comprise feedstock for the microbial production of cellulose. In certain embodiments, cell densities can be monitored by direct sampling, by a correlation of optical density to cell density, and / or with a particle size analyzer. In certain embodiments, the hydraulic and biomass retention times can be decoupled so as to allow independent control of both the broth chemistry and the cell density. In certain embodiments, dilution rates can be kept high enough so that the hydraulic retention time is relatively low compared to the biomass retention time, resulting in a highly replenished broth for cell growth and / or feedstock conversion and / or production of organic compounds. In certain embodiments, dilution rates are set at an optimal technoeconomic trade-off between culture broth and nutrient replenishment and / or waste product removal, and increased process costs from pumping, increased inputs, and / or costs of dewatering the harvested culture broth and / or other demands that rise with dilution rates.
[0196] In certain embodiments, the pH of the microbial culture is controlled. In certain embodiments, pH is controlled within an optimal range for microbial maintenance and / or growth and / or conversion of feedstock and / or production of organic compounds and / or survival. To address a decrease in pH, in certain embodiments a neutralization step can be performed directly in the bioreactor environment or prior to recycling the media back into the culture vessel through a recirculation loop. Neutralization of acid in the broth of certain embodiments can be accomplished by the addition of bases, including but not limited to one or more of the following: limestone, lime, sodium hydroxide, ammonia, ammonium hydroxide, caustic potash, magnesium oxide, iron oxide, alkaline ash.Attorney Docket No.000241-001402WO
[0197] In certain embodiments, an aqueous suspension of chemoautotrophic microorganisms converts one or more electron donors and CO2into protoplasm. In certain embodiments the said protoplasm comprises proteins, peptides, and / or amino acids. In certain embodiments, an aqueous suspension of hydrogen-oxidizing microorganisms can be used to convert hydrogen and carbon dioxide into microbial protoplasm. In certain embodiments, an aqueous suspension of carbon monoxide-oxidizing microorganisms can be used to convert carbon monoxide and hydrogen and / or water into protoplasm. In certain embodiments, an aqueous suspension of methane-oxidizing microorganisms can be used to convert methane into protoplasm. In certain embodiments, the microorganism in suspension is a bacterium or an archaeon. In certain non- limiting embodiments, an aqueous suspension or biofilm of H2-oxidizing chemoautotrophic microorganisms converts H2and CO2, along with some other dissolved mineral nutrients, into biochemicals and protoplasm. In certain embodiments the said biochemicals and / or protoplasm comprises cellulose. In certain embodiments, the other dissolved mineral nutrients include, but are not limited to, a nitrogen source, a phosphorous source, and a potassium source. In certain embodiments, the protoplasm produced is of food value to humans and / or other animals and / or other heterotrophs. In certain embodiments, certain biochemicals may be extracted from the protoplasm and / or extracellular broth, which have value in a variety of organic chemistry or materials applications. In certain such embodiments, the biochemicals comprise cellulose. In certain embodiments, the intracellular energy to drive this production of protoplasm is derived from the oxidation of an electron donor by an electron acceptor. In certain non-limiting embodiments, the electron donor includes, but is not limited to, one or more of the following: H2; CO; CH4. In certain non-limiting embodiments, the electron acceptor includes but is not limited to O2and / or CO2. In certain non-limiting embodiments, the product of the energy generating reaction, or respiration, includes but is not limited to water. In certain embodiments, the intracellular energy derived from respiration used to drive this synthesis of biochemicals and protoplasm from CO2is stored and carried in biochemical molecules including, but not limited to, ATP. For the knallgas microbes used in certain embodiments herein, the electron acceptor is O2and the product of respiration is water.
[0198] In some embodiments the cellulose production is optimized through one or more of the following: control of bioreactor conditions, control of nutrient levels, and / or genetic modifications of the cells. In certain embodiments, pathways to amino acids, or proteins, or sugar, or polysaccharides, or other nutrients, or whole cell products, are controlled and optimized for the production of chemical products, such as but not limited to cellulose by maintaining specific growth conditions (e.g., levels of electron donors, nitrogen, oxygen, phosphorous, sulfur, trace micronutrients such as inorganic ions, and if present any regulatory molecules that might not generally be considered a nutrient or energy source). In certain embodiments, dissolved oxygen (DO) may be optimized by maintaining the broth in aerobic, microaerobic, anoxic, anaerobic, or facultative conditions, depending upon the requirements of the microorganisms. A facultative environment is considered to be one having aerobic upper layers and anaerobic lower layers caused by stratification of the water column. The biosynthesis of cellulose, aminoAttorney Docket No.000241-001402WO acids, or proteins, or other nutrients, or whole cell products by the microbes disclosed herein can happen during the logarithmic phase, the arithmetic phase, or afterwards during the stationary phase when cell doubling has stopped, provided there is sufficient supply of carbon and energy and other nutrient sources.
[0199] In some embodiments, the growth medium for a microorganism described herein includes a protein and / or nutrient source from another microorganism (e.g., cell lysate, protein hydrolysate, peptides, oligopeptides, and / or amino acids, and / or vitamins, and / or organic molecules and / or other nutrients from a different microorganism). In some embodiments, the microorganism in the growth medium is a cellulose producing microorganism. In one embodiment, the growth medium for a cellulose producing bacterium, such as, but not limited to, Komagataeibacter (formerly Gluconacetobacter) xylinus, Komagataeibacter hansenii, Komagataeibacter rhaeticus, Komagataeibacter europaeus, and / or Komagataeibacter medellinensis, includes cell lysate, protein hydrolysate, peptides, oligopeptides, and / or amino acids, and / or sugars, and / or short chain fatty acids, and / or vitamins, and / or organic molecules and / or other nutrients from a different microorganism, such as, but not limited to, a Cupriavidus microorganism, such as, but not limited to Cupriavidus necator, for example, Cupriavidus necator DSM 531 or DSM 541 or DSM 428. In some embodiments the said cellulose producing microorganism is Komagataeibacter xylinus DSM 2325 and / or Gluconacetobacter xylinus (Brown) ATCC 23767.
[0200] In some embodiments, a fungal microorganism that is capable of lysing bacterial cells and / or hydrolyzing bacterial protein is cultured in the presence of chemoautotrophic bacterial cells or nutrients derived from such bacterial cells. For example, chemoautotrophic bacterial biomass may be isolated and optionally dewatered or optionally deactivated, and then fungal microorganisms inoculated onto the bacterial biomass, or fungal microorganisms may be cultured in a growth medium as described herein, in the presence of bacterial biomass and / or bacterially derived nutrients. In certain nonlimiting embodiments, the fungal microorganisms include Fusarium or Rhizopus, and / or Aspergillus microorganisms, such as but not limited to, Fusarium venenatum, Rhizopus oligosporus, Rhizopus oryzae, Aspergillus oryzae, and / or Aspergillus sojae. In certain non-limiting embodiments, the edible fungal species Agaricus bisporus is cultivated on media comprising protein-rich cells and / or nutrients produced according to the present invention. In certain embodiments, Agaricus bisporus lyses cells produced according to the present invention. In certain embodiments one or more of the aforementioned fungal organisms, through lysis and / or hydrolysis of the chemoautotrophic microorganism biomass, releases proteins, amino acids, and / or sugars and / or other nutrients released by the lysis of cells for the nutrition, growth, and production of a cellulose producing microorganism.
[0201] The specific examples of bioreactors, culture conditions, heterotrophic and chemotrophic growth, maintenance, and amino acids, and / or proteins, and / or sugars and / or other nutrients, or whole cell product production methods described herein can be combined in any suitable manner to improve efficiencies of microbial growth and cellulose, or amino acid, or protein, or other nutrient, or whole cell production.Attorney Docket No.000241-001402WO Electron donors and acceptors
[0202] In certain non-limiting embodiments, microorganisms described herein are grown chemoautotrophically. For example, the microorganism growth may utilize biosynthetic reduction of CO2, utilizing O2 electron acceptor and / or H2 electron donor. In certain embodiments, O2and H2are generated by the electrolysis of water. In certain non-limiting embodiments, part of the O2generated by electrolysis of water, and all of the H2, is fed to an aqueous suspension of microorganisms as described herein. In certain non-limiting embodiments, the molar ratio of H2 fed to an aqueous suspension of microorganisms to the moles of O2is greater than 2:1. In certain non-limiting embodiments where O2electron acceptor and H2electron donor are generated by the electrolysis of water, there is a surplus of O2remaining after all of the metabolic requirements for H2 and O2 of the microorganisms described herein have been met. In certain such embodiments the surplus O2 may be supplied to humans and / or other aerobic lifeforms and / or to hydroponic systems for root aeration and / or is used in a gasification or partial oxidation or combustion process and / or is stored and sold as a chemical co-product. In certain embodiments, the surplus O2 is used to cultivate an aerobic or microaerobic cellulose producing culture.
[0203] In certain embodiments that utilize molecular hydrogen as an electron donor, there can be a chemical co-product formed in the generation of molecular hydrogen using a renewable and / or CO2emission-free energy input. In certain embodiments, the oxyhydrogen reaction used in respiration is enzymatically linked to oxidative phosphorylation. In certain embodiments, the ATP and / or other intracellular energy carriers thus formed are utilized in the anabolic synthesis of amino acids and / or proteins and / or cellulose. In certain embodiments, the oxygen produced by water-splitting in excess of what is required for respiration in order to maintain optimal conditions for carbon fixation and organic compound production by the knallgas microorganisms, may be processed into a form suitable for sale through process steps known in the art and science of commercial oxygen gas production.
[0204] Certain embodiments apply hydrogen-oxidizing and / or CO-oxidizing and / or CH4oxidizing microorganisms that use more electronegative electron acceptors than CO2in energy conserving reactions for ATP production (e.g., respiration), such as but not limited to O2. For example, hydrogenotrophic oxyhydrogen or knallgas microbes that couple the oxyhydrogen reaction, 2 H2+ O2-> 2 H2O, to ATP production, can produce more ATP per H2and / or other electron donor consumed for respiration, than acetogens or methanogens that use CO2as an electron acceptor in respiration. For example, knallgas microorganisms can produce at least two ATP per H2 consumed in respiration [L. Bongers (1970) “Energy generation and utilization in hydrogen bacteria” Journal of bacteriology 104(1):145-151 (http: / / jb.asm.org / content / 104 / 1 / 145.abstract), which is incorporated herein by reference in its entirety], which is eight times more ATP produced per H2 consumed in respiration than what can be produced in microorganisms undergoing methanogenesis or acetogenesis, using H2 as electron donor and CO2as electron acceptor in respiration. For this reason, usingAttorney Docket No.000241-001402WO microorganisms that can utilize more electronegative electron acceptors in respiration and in the production of ATP, such as but not limited to knallgas microbes, for anabolic biosynthesis such as but not limited to amino acid or protein or fatty acid biosynthesis or sugar synthesis or polysaccharide synthesis, including cellulose synthesis from syngas or H2, can be more efficient than using acetogens or methanogens, such as those which are currently used in biological gas- to-chemical (GTC) technologies for the production of short chain acids or alcohols (e.g., acetic acid or ethanol). In certain embodiments, the oxyhydrogen reaction used in respiration is enzymatically linked to oxidative phosphorylation. In certain embodiments, aerobic respiration is utilized by the microorganism cells described herein for the production of ATP. In certain embodiments, the ATP and / or other intracellular energy carriers thus formed are utilized in the anabolic biosynthesis of amino acids and / or proteins and / or lipids, and / or sugars and / or polysaccharides including cellulose. In some embodiments, a knallgas and / or carboxydotrophic and / or methanotrophic and / or heterotrophic microorganism or a composition or consortium comprising these microorganisms is utilized, wherein the microorganism expresses one or more enzymes that enables biosynthesis of useful carbon-based products of interest including but not limited to chemicals, monomers, polymers, proteins, polysaccharides, cellulose, vitamins, nutraceuticals, antibiotics, or pharmaceutical products or intermediates thereof from a carbon- containing gas feedstock, including but not limited to syngas or producer gas or natural gas or biogas or CO2combined with renewable H2or CO or methane containing gases. In some embodiments, these said carbon-based products of interest can be biosynthesized heterotrophically from an organic multi-carbon feedstock, such as, but not limited to glucose, fructose, sucrose, and other sugars. In some non-limiting embodiments, a microorganism, or a composition comprising a microorganism is utilized, wherein the microorganism requires less than 4H2 or NADH to produce one ATP through respiration. In other non-limiting embodiments, a microorganism is utilized that produces more than one ATP per H2 or NADH consumed through respiration. In other non-limiting embodiments, a microorganism is utilized that produces at least two ATP per H2or NADH consumed through respiration, or at least 2.5 ATP per H2 or NADH consumed through respiration.
[0205] An additional feature of certain non-limiting embodiments regards the source, production, or recycling of the electron donors used by chemoautotrophic microorganisms to fix carbon dioxide and / or other C1 feedstocks into organic compounds. The electron donors used for carbon dioxide capture and carbon fixation can be produced or recycled in certain embodiments electrochemically or thermochemically using power from a number of different renewable and / or low carbon emission energy technologies including but not limited to: photovoltaics, solar thermal, wind power, hydroelectric, nuclear, geothermal, enhanced geothermal, ocean thermal, ocean wave power, tidal power. Many of the reduced inorganic chemicals upon which chemoautotrophs can grow (e.g. H2, CO, H2S, ferrous iron, ammonium, Mn2+) can be readily produced using electrochemical and / or thermochemical processes well known in the art and science of chemical engineering that can be powered by a variety carbon dioxide emission-free or low-carbon emission and / or renewable sources of power including but not limited toAttorney Docket No.000241-001402WO photovoltaics, solar thermal, wind power, hydroelectric, nuclear, geothermal, enhanced geothermal, ocean thermal, ocean wave power, or tidal power.
[0206] The production of hydrogen from renewable energy sources is gradually replacing the generation from fossil feedstock systems, and the technical advances in the energy sector are expected to lower the prices of green hydrogen production in the near future. For instance, electrical energy efficiencies up to 73% are already achieved by commercial and industrial grade electrolyzers, and research on new materials and electrolyzer configurations have shown possible efficiencies as high as 96%. Certain embodiments utilize a commercially available electrolysis technology with electrical energy efficiency of over 70% for the generation of H2 electron donor and / or O2electron acceptor. Certain embodiments use electrolysis technologies with 73% or higher energy efficiency, and / or up to 96% energy efficiency, or higher.
[0207] In certain embodiments that use molecular hydrogen as electron donor, the H2is generated by methods well known to art and science of chemical and process engineering, including but not limited to one or more of the following: through electrolysis of water including but not limited to approaches using Proton Exchange Membranes (PEM), liquid electrolytes such as KOH, alkaline electrolysis, Solid Polymer Electrolyte electrolysis, high-pressure electrolysis, high temperature electrolysis of steam (HTES), two-step electrochemical–chemical cycles such as those utilizing nickel oxide and nickel hydroxide electrodes, and / or through the thermochemical splitting of water through methods including but not limited to the iron oxide cycle, cerium(IV) oxide-cerium(III) oxide cycle, zinc zinc-oxide cycle, sulfur-iodine cycle, copper-chlorine cycle, calcium-bromine-iron cycle, hybrid sulfur cycle; and / or electrolysis of hydrogen sulfide; and / or thermochemical splitting of hydrogen sulfide; and / or other electrochemical or thermochemical processes known to produce hydrogen with low- or no- carbon dioxide emissions including but not limited to: carbon capture and sequestration (CCS) enabled methane reforming or biomass gasification, the Kværner-process and other processes generating a carbon-black product; carbon capture and pyrolysis of biomass. In certain embodiments, the approach to generating H2includes but is not limited to electrolysis powered by renewable electrical energy and / or electricity from a low-GHG source. In certain embodiments, electrolysis is powered by one or more of the following: solar, including but not limited to, photovoltaics and / or solar thermal; wind power; hydroelectric; nuclear; geothermal; enhanced geothermal; ocean thermal; ocean wave power; tidal power.
[0208] Worldwide there are enormous wind energy resources, of which only a tiny percentage is utilized. The low current utilization is mainly attributed to the intermittent nature of wind resources, resulting in varying electricity generation over time, and underutilization of capacity to meet energy demand at most hours. The common mismatch between wind power supply and grid demand is manifested in examples from around the world, such as in Scotland where wind farms have been paid to shut down turbines due to oversupply [http: / / www.mnn.com / earth- matters / energy / blogs / blown-away-wind-turbines-generate-enough-energy-to-power-every- home-in], and in parts of Texas where electricity has been provided for free at night when wind power is high and grid demand is low [http: / / www.nytimes.com / 2015 / 11 / 09 / business / energy-Attorney Docket No.000241-001402WO environment / a-texas-utility-offers-a-nighttime-special-free-electricity.html?_r=2]. This challenge may be resolvable by utilizing wind power produced during off-peak demand hours to produce H2feedstock for the process in certain embodiments herein.
[0209] Currently, hydrogen is increasingly regarded as a possible energy storage system in the so- called “power-to-gas” approach. The inherent instability of renewable energy production (particularly solar and wind energy), and excess grid electricity (off-peak energy) may be mitigated by the production of hydrogen through water electrolysis. According to most current schemes, the produced hydrogen gas may then be converted back to electricity, by fuel cells and / or gas turbines, during periods of peak demand. Or alternatively the H2 may be fed into the gas grid, or converted to methane via methanation. Furthermore, the hydrogen may be used as a raw material in the chemical, petrochemical, metallurgy and food industries. Certain embodiments provide new options within the power-to-gas framework, by enabling the H2 to be used in a wider range of products, including biochemicals and in particular proteins, amino acids, fertilizers, biostimulants, polysaccharides, cellulose, polymers, and materials. In certain embodiments, hydrogen produced using excess grid electricity and / or off-peak energy is used as an electron donor for one or more metabolic pathways occurring in hydrogen-utilizing microorganisms. In certain embodiments, the hydrogen and / or the oxygen needed for the microbial biosynthesis by hydrogen-oxidizing bacteria and / or aerobic bacteria is generated by water electrolysis using renewable energy, and in particular off-peak electricity, i.e., electrical power available when the energy supply exceeds demand, and which, in the current situation, is often wasted or mitigated through shutting down renewable power generation.
[0210] In certain embodiments, onsite storage of H2 and CO2 gases enables diversion of power from the grid only during periods when renewable generation exceeds electrical demand. In certain embodiments, power is allowed to flow as usual into the grid during periods of higher demand. In certain embodiments, the process does not disrupt renewable power supply, but rather facilitates more complete utilization of renewable generation capacity such as, but not limited to, wind and solar. Certain embodiments allow continued renewable operation and generation even during periods when electrical generation exceeds grid demand (e.g., off-peak wind or solar generation).
[0211] In certain embodiments, hydrogen electron donors are not necessarily generated with low- or no- carbon dioxide emissions. However, in certain such embodiments the hydrogen is generated from sustainable or low value sources of energy and / or carbon using methods known in the art of chemical and process engineering. Such methods include but are not limited to gasification, pyrolysis, steam-reforming, or autothermal reforming of feedstock such as but not limited to one or more of the following: agricultural materials, wood, methane hydrates, straw, seaweed and kelp, and low value, highly lignocellulosic biomass in general. In certain embodiments, a synthesis gas or producer gas containing H2and / or CO and / or CO2is utilized as an electron donor and / or as a carbon source. In certain embodiments, the H2 and / or CO and / or CO2 contained in a syngas or producer gas is supplemented by H2 generated using aAttorney Docket No.000241-001402WO renewable and / or low-GHG energy source and conversion process such as one or more of those described herein.
[0212] In certain non-limiting embodiments, reduction of CO2occurs. In certain embodiments, the ratio of hydrogen to carbon monoxide in syngas or producer gas may be adjusted through the water gas shift reaction and / or carbon capture, prior to the gas being delivered to the microbial culture. In certain embodiments, C1 compounds are generated through methane steam reforming of methane or natural gas, and particularly stranded natural gas, or natural gas that would be otherwise flared or released to the atmosphere, or biogas, or landfill gas, and provided as a syngas and / or producer gas or liquid stream of C1 compounds to the culture of microorganisms, where in certain embodiments the ratio of hydrogen to carbon monoxide in the syngas or producer gas may be adjusted through the water gas shift reaction and / or carbon capture, prior to the gas being delivered to the microbial culture.
[0213] The following examples are intended to illustrate, but not limit, the invention. EXAMPLES Example 1. Bacterial Cellulose Production
[0214] Komagataeibacter xylinus, DSM 2315, was obtained from DSMZ, and was rehydrated in Gluconobacter oxydans medium (glucose: 100 g; yeast extract: 10 g; CaCO3 : 20 g; distilled H2O to 1 L (for solid agar to 15 g / L) pH=6.5). (Fig.1) Four vials were preserved, 1 ml each, with 7% DMSO at -80oC.
[0215] Liquid medium was inoculated, shaking at 200 rpm, 30oC, and streaked onto solid media. Results were obtained after 3-4 days.
[0216] Liquid culture media was used to inoculate 100 ml and 400 ml of liquid medium (0.1 and 0.4 ml). Shaking was at 100 rpm 30oC for ~ 1 week (Fig.2).
[0217] The media was decanted without disturbing the mat of cellulose.100 ml 3% NaOH was added, the flask was stirred at 50 rpm for 90 minutes at RT, The liquid was decanted without disturbing the mat of cellulose.
[0218] 100 ml of 0.3% acetic acid (pH 3) was added, and the flask was stirred at for 30 min. Then the liquid was decanted without disturbing the mat of cellulose.
[0219] 100 ml H2O was added and the pellet rinsed. The water was decanted without disturbing the mat of cellulose (Fig.3).
[0220] The cellulose was lyophilized to dryness. The product had a white chunky cellulose-like appearance (Fig.4).1.6 g lyophilized material was recovered from 100 ml culture after 1 week fermentation. Example 2. Nutrient Substitution
[0221] Growth of Komagataeibacter xylinus and harvest of bacterial cellulose in Hestrin-Schramm (HS) medium is performed. Then, a media comparison and substitution of C. necator derivedAttorney Docket No.000241-001402WO acid protein hydrolysate for yeast extract or peptone or both is performed in a matrix experiment.
[0222] Bacterial cellulose production test with Komagateibacter xylinus - use of substituted vs complete HS medium (HS), and effect of C. necator Acid Hydrolysate (AH) is determined.
[0223] Composition of HS: 2% (w / v) glucose, 0.5% (w / v) peptone, 0.5% (w / v) yeast extract, 0.27% (w / v) Na2HPO4 and 1.15 g / L citric acid, as shown. Table 1 For 100 ml each medium HS P / YE dropout P dropout YE dropout Glucose 0.2 g 0.2 g 0.2 g 0.2 g Peptone 0.5 g —-- —-- 0.5 g Yeast extract 0.5 g —-- 0.5 g —-- C. necator AH —-- 1.0 0.5 g 0.5 g Na2HPO40.27 g 0.27 g 0.27 g 0.27 g Citric acid 0.115 0.115 0.116 0.116
[0224] Make up 100 ml each medium as shown in Table 1. Set up 4 x 25 ml each medium in 125 ml flasks. Incubate 2 of each, shaking 25 rpm, 30oC. Incubate 2 of each static, 30oC. Examine bacterial growth and cellulose production after 1 week. Example 3. Characterizing Cellulose
[0225] One or more of the following characterization methods is used: - X-ray diffraction (XRD) for crystallinity degree and crystal size - Geometrical characterization of the material fibers by Scanning Electron Microscopy (SEM). - Thermal analysis (TG / DTA / DSC analysis). - Fourier-transform infrared spectrophotometry (FTIR) for chemical structure characterization. - Dynamomechanical analysis (DMA) for mechanical properties determination. - Determination of the absorbent capacity. It may be carried out through the “tea bag method” and the swelling resistance of the adsorbent under load. Example 4. Extracting and Characterizing Polysaccharides
[0226] Polysaccharides are extracted using different methods, Ethanol, hot water, acid, alkali, etc. are often used as solvents. Crude extraction may be assisted by homogenization, ultrasound, or microwave. In certain embodiments, supercritical fluid extraction technology may be utilized. In other embodiments, enzyme-assisted extraction technologies may be utilized, for example,Attorney Docket No.000241-001402WO enzymes may specifically degrade the cell wall and / or membrane enabling the release of intracellular macromolecules including polysaccharides.
[0227] Low molecular weight impurities may be removed by dialysis. Protein impurity may be removed by a protease method, Sevag method, Trichloroacetic acid (TCA) method, or trifluorotrichloroethane method. Fat impurities may be removed with organic solvents such as ethanol, ether, and / or petroleum ether. Adsorption and oxidation may be used to remove pigment impurities.
[0228] After separation and removal of impurities, a mixed polysaccharide solution is obtained, and the process to separate the mixed polysaccharide solution into various single polysaccharides undertaken. Methods to isolate a single type of polysaccharide may include sedimentation, chromatography, zone electrophoresis, ultracentrifugation and other biochemical analysis methods. In certain embodiments, the polysaccharides purification will utilize a combination of two or more methods.
[0229] Polysaccharides have a wide variety of components, complex structures and large molecular weights and may be analyzed on the following criteria:
[0230] Sugar content determination - In order to determine the sugar content in the sample, a developer-sulfuric acid method may be used. Monosaccharides, polysaccharides, and their derivatives are hydrolyzed to monosaccharides under the action of sulfuric acid and quickly dehydrated to form aldehyde derivatives, which are condensed with phenols and / or aromatic amines into colored compounds. The content of polysaccharides may be indirectly determined by colorimetric quantification.
[0231] Molecular weight determination - Osmotic pressure method, end group method, viscosity method, and light scattering method may be used. Gel filtration and high-performance liquid chromatography methods may be used with standard polysaccharides of known molecular weight used as a reference. For polysaccharides with a molecular weight of less than 50,000, mass spectrometry may be used.
[0232] Component determination - Polysaccharide composition analysis methods include: traditional chemical analysis, physical analysis (instrument analysis), and biological analysis. Chemical analysis includes partial or complete acid hydrolysis, neutralization and filtration. At the end, paper chromatography (PC), thin layer chromatography (TLC), gas chromatography (GC), liquid chromatography (HPLC) or ion chromatographic may be implemented for analysis. Instrumental analysis methods include spectrophotometry, infrared spectroscopy, nuclear magnetic resonance, GC, and mass spectrometry (MS).
[0233] Structure determination - Structural analysis methods may include periodate oxidation, Smith degradation, or methylation reaction. Ultraviolet light may be used for structure determination. Example 5Attorney Docket No.000241-001402WO
[0234] Recombinant nanocellulose is produced by a chemolithoautotrophic microorganism, e.g., Cupriavidus, to produce nanocellulose from a heterologous gene sequence that expresses cellulose synthase, such as from a Komagetaeibacter species.
[0235] Two genes are used to reconstitute bacterial cellulose biosynthesis, BcsA and BcsB. These two genes lie immediately adjacent to each other in the genome of the cellulose producing strain Komagataeibacter xylinus DSM 2325 (2832687-2837361 genomic interval). Both genes are obtained by PCR synthesis from template DNA of this species using a single set of primers to produce a single fragment containing both genes. The following primers are designed to amplify the BcsA-BcsB fragment to enable its cloning in the arabinose inducible pBAD vector: forward primer-GGTCTAGAAGGAGTACACATGTCAGAGGTTCAGTCGCC (No: 2); reverse primer- GGCCTAGGTCACGTTCCCTGCCTTTCTTCCTG (SEQ ID No: 3). A two gene fragment is amplified using these primers and then the DNA is digested with the enzymes XbaI and AvrII. Purified pBAD vector DNA is digested with the same enzymes and the vector piece recovered after gel electrophoresis. The BcsA-BcsB fragment is ligated to the pBAD vector fragment and the mixture is then transformed into E. coli. Colonies are screened for DNA containing the BcsA-BcsB insert in the correct orientation for expression from the arabinose inducible promoter of this construct.
[0236] Although the foregoing invention has been described in some detail by way of illustration and examples for purposes of clarity of understanding, it will be apparent to those skilled in the art that certain changes and modifications may be practiced without departing from the spirit and scope of the invention. Therefore, the description should not be construed as limiting the scope of the invention.
[0237] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entireties for all purposes and to the same extent as if each individual publication, patent, or patent application were specifically and individually indicated to be so incorporated by reference. References:
[0238] Liu, M., Liu, L., Jia, S. et al. (2018). Complete genome analysis of Gluconacetobacter xylinus CGMCC 2955 for elucidating bacterial cellulose biosynthesis and metabolic regulation. Sci Rep 8, 6266 https: / / doi.org / 10.1038 / s41598-018-24559-w
[0239] Florea, M., Hagemann, H., Santosa, G..., Ellis, T. (2016) Engineering bacterial cellulose with genetic tools. Proceedings of the National Academy of Sciences 113 E3431-E3440; DOI: 10.1073 / pnas.1522985113
[0240] Imai T, Sun SJ, Horikawa Y, Wada M, Sugiyama J. Functional reconstitution of cellulose synthase in Escherichia coli. Biomacromolecules (2014) 15:4206-13. doi: 10.1021 / bm501217g.Attorney Docket No.000241-001402WO
[0241] Buldum G, Bismarck A, Mantalaris A. (2018) Recombinant biosynthesis of bacterial cellulose in genetically modified Escherichia coli. Bioprocess Biosyst Eng.2018 Feb;41(2):265- 279. doi: 10.1007 / s00449-017-1864-1
[0242] Nobles, DR and Brown, RM (2008) Transgenic expression of Gluconacetobacter xylinus strain ATCC 53582 cellulose synthase genes in the cyanobacterium Synechococcus leopoliensis strain UTCC 100. Cellulose 15:691-701 DOI:10.1007 / s10570-008-9217-5
[0243] Zhao C, Li Z, Li T, Zhang Y, Bryant DA, Zhao J. (2015) High-yield production of extracellular type-I cellulose by the cyanobacterium Synechococcus sp. PCC 7002. (2015) Cell Discov. 28;1:15004. doi: 10.1038 / celldisc.2015.4.
[0244] Singh, Amritpal, Kenneth T. Walker, Rodrigo Ledesma-Amaro, and Tom Ellis.2020. "Engineering Bacterial Cellulose by Synthetic Biology" International Journal of Molecular Sciences 21, no.23: 9185.
[0245] Charreau, H., Cavallo, . nanocellulose: analysis of their evolution since 2010. Carbohydrate Polymers doi:10.1016 / j.carbpol.2020.116039
Claims
Attorney Docket No.000241-001402WO CLAIMS We claim:
1. A method for producing nanocellulose, said method comprising: introducing an inorganic carbon compound and / or an organic compound containing only carbon atom into an environment that comprises chemoautotrophic microorganism cells in a culture medium that is suitable for maintaining the microorganism cells, wherein the inorganic carbon compound and / or organic molecules containing only one carbon atom are used as a carbon source by the chemoautotrophic microorganism cells for growth and / or biosynthesis; converting the inorganic carbon compound and / or organic compound containing only one carbon atom into a nanocellulose product within the chemoautotrophic microorganism cells via at least one chemosynthetic carbon-fixing reaction and an anabolic biosynthesis pathway that produces the nanocellulose, wherein the chemosynthetic carbon-fixing reaction is at least partially driven by a chemical and / or electrochemical energy source provided by electron donors and / or electron acceptors that have been generated chemically and / or electrochemically and / or thermochemically and / or are introduced into the environment from at least one source external to the environment, and wherein the nanocellulose is secreted from the chemoautotrophic microorganism cells into the culture medium; and separating the nanocellulose from the culture medium.
2. The method of claim 1, wherein the chemoautotrophic microorganism cells comprise Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas, Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter cells.
3. The method of claim 1, wherein the carbon source comprises one or more of CO2, CO, and CH4.
4. The method of claim 1, wherein the energy source comprises H2and / or O2.
5. The method of claim 1, wherein the electron donors comprise one or more of H2, CO, and CH4.
6. The method of claim 1, wherein the chemoautotrophic microorganism cells are oxyhydrogen microorganism cells.
7. The method of claim 6, wherein the electron donors comprise H2and the electron acceptors comprise O2.
8. The method of claim 1, wherein the oxyhydrogen microorganism comprises a CupriavidusAttorney Docket No.000241-001402WO necator or Cupriavidus metallidurans microorganism.
9. The method of claim 8, wherein the oxyhydrogen microorganism comprises Cupriavidus necator DSM 531 or DSM 541 or DSM 428.
10. The method of claim 1, wherein the secreted nanocellulose is greater than about 75% crystalline.
11. The method of claim 1, wherein the secreted nanocellulose comprises one or more property selected from: tensile stiffness of about 100 GPa to about 160 GPa; tensile strength of at least about 1 GPa; and water holding capacity greater than about 80%.
12. The method of claim 1, wherein the chemosynthetic microorganism cells are recombinant cells and at least a portion of the anabolic biosynthesis pathway that produces the nanocellulose is provided by expression of one or more heterologous gene sequence(s).
13. The method of claim 12, wherein the one or more heterologous gene sequence(s) comprises a cellulose synthase gene sequence.
14. The method of claim 12, wherein the one or more heterologous gene sequence(s) is derived from a Komagataeibacter species.
15. The method of claim 14, wherein the Komagateibacter species is selected from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, and K. medellinensis.
16. A method for producing nanocellulose, said method comprising: introducing an inorganic carbon compound and / or an organic compound containing only carbon atom into an environment that comprises chemoautotrophic microorganism cells in a culture medium that is suitable for maintaining the microorganism cells, wherein said chemoautotrophic microorganism cells are recombinant cells that express one or more heterologous gene sequence(s) in an anabolic biosynthesis pathway that produces nanocellulose, wherein the inorganic and / or organic molecules containing only one carbon atom are used as a carbon source by the chemoautotrophic microorganism cells for growth and / or biosynthesis; converting the inorganic carbon compound and / or organic compound containing only one carbon atom into a nanocellulose product within the chemoautotrophic microorganism cells via at least one chemosynthetic carbon-fixing reaction and the anabolic biosynthesis pathway that produces the nanocellulose,Attorney Docket No.000241-001402WO wherein the chemosynthetic carbon-fixing reaction is at least partially driven by a chemical and / or electrochemical energy source provided by electron donors and / or electron acceptors that have been generated chemically and / or electrochemically and / or thermochemically and / or are introduced into the environment from at least one source external to the environment, and wherein the nanocellulose is secreted from the chemoautotrophic microorganism cells into the culture medium; and separating the nanocellulose from the culture medium.
17. The method of claim 16, wherein the one or more heterologous gene sequence(s) comprises a cellulose synthase gene sequence.
18. The method of claim 16, wherein the one or more heterologous gene sequence(s) is derived from a Komagataeibacter species.
19. The method of claim 18, wherein the Komagateibacter species is selected from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, and K. medellinensis.
20. The method of claim 17, wherein the one or more heterologous gene sequence(s) are inserted into the chemoautotrophic microorganism cell chromosome using phage insertion.
21. The method of any of claims 1 to 20, further comprising processing the nanocellulose into a product, wherein the product is selected from: a food or beverage product or an ingredient thereof; a personal care product; a cleaning product; a biomedical product; a textile product; a composite material; an antimicrobial product; an anti-inflammatory product; a packaging material; a container; and a substrate for incorporation or immobilization of an enzyme or other biomolecule.
22. Nanocellulose produced by the method of any of claims 1 to 20.
23. A nanocellulose containing product, comprising nanocellulose according to claim 22.
24. A recombinant chemoautotrophic microorganism cell that produces nanocellulose, wherein the microorganism cell expresses one or more heterologous gene sequence(s) in an anabolic biosynthesis pathway that produces nanocellulose.
25. The recombinant chemoautotrophic microorganism cell of claim 24, wherein the microorganism cell secretes nanocellulose.
26. The recombinant chemoautotrophic microorganism cell of claim 24, wherein the microorganism is selected from Cupriavidus, Rhodococcus, Hydrogenovibrio, Rhodopseudomonas,Attorney Docket No.000241-001402WO Hydrogenobacter, Gordonia, Arthrobacter, Streptomycetes, Rhodobacter, and / or Xanthobacter cells.
27. The recombinant chemoautotrophic microorganism cell of claim 24, wherein the one or more heterologous gene sequence(s) comprises a cellulose synthase gene sequence.
28. The recombinant chemoautotrophic microorganism cell of claim 22, wherein the one or more heterologous gene sequence(s) is derived from a Komagataeibacter species.
29. The recombinant chemoautotrophic microorganism cell of claim 28, wherein the Komagateibacter species is selected from K. xylinus, K. hansenii, K. rhaeticus, K. europaeus, and K. medellinensis.
30. The recombinant chemoautotrophic microorganism cell of claim 24, wherein the one or more heterologous gene sequence(s) are inserted into the microorganism cell chromosome by phage insertion.
31. Nanocellulose produced by a recombinant chemoautotrophic microorganism cell according to any of 24 to 30.
32. A nanocellulose containing product, comprising nanocellulose according to claim 31.
Citation Information
Cited By
Rhodococcus pyridinivorans and application thereof in degradation of nitrocellulose
CN116814455A
Rhodococcus pyrphila and its application in degrading nitrated cellulose
CN116814455B