Engineered microorganisms for improved production of metabolites

Abstract

The present invention relates to strain improvement by introducing a chromosomal deletion in a microorganism by applying gene-deletion tools. Particularly, the method relates to a gene deletion introduced in the vicinity of the target metabolic pathway or biosynthetic gene cluster encoding the biosynthesis of a primary or secondary metabolite of interest. More specifically, invention relates to specific introduction of a gene deletion of particular size and position chromosomally located close to a target secondary metabolite biosynthetic gene cluster in a primary or secondary metabolite-producing strain, causing change in gene expression of the biosynthetic gene cluster of interest and consequently increase in titer or yield of the target product, or another physiological property such as growth rate, assimilation of sources of carbon or nitrogen.

Description

[0001] P464661PC00 Engineered microorganisms for improved production of metabolites Technical field of the invention The present invention relates to the field of microbiology, recombinant DNA technology, primary and secondary metabolites, strain improvement and fermentation technology. Specifically the invention relates to microorganisms having a chromosomal deletion of a DNA fragment to increase the titer of a metabolite, to activate biosynthetic pathways or improve physiological properties. Background of the invention Strain improvement is the cornerstone of any commercial fermentation process. Over the last 80 years, since the discovery of antibiotic penicillin, new and more efficient industrial processes involving microorganisms have been launched, yielding purer and less expensive products (Sanchez-Garcia et al., 2016). The long list of products obtained by these methods increases every year, and many industrial areas are involved. Industrial microorganisms thus present driving force behind diverse industries which have provided plethora of products that have deeply changed our lives and life spans. This is particularly the case of industrial bioprocesses for production of primary metabolites such as vitamins, amino acids as well as secondary metabolites such as antibiotics, anticancer, anthelmintics, immunosuppressants, antifungals, herbicides, and many others, which are biosynthesised by diverse microorganisms (Sanchez-Garcia et al., 2016). The properties of cultures isolated from natural habitats most often cannot ensure sufficient quality and quantity of target products neither can ensure overall economics of industrial bioprocesses. Although development of bioprocess technology is today supplemented by more knowledge-based scientific methods such as metabolic engineering, greater improvements in overproduction of diverse primary and secondary metabolites (including antibiotics) of specific microbes have resulted from essentially random empirical approaches of mutagenesis and strain selection. The performance of native isolates must be significantly improved by industrial strain-improvement regimes, which are most often work intensive and time consuming. Therefore, there is critical need to develop more targeted, straightforward and significantly less time-consuming approaches of strain development. During the last decade, large-scale genome reduction approaches have been proposed with the aim to streamline microbial genomes, and to further develop simplified and versatile strains or microbial chassis for producing valuable products (Beites & Mendes, 2015; Choe et al., 2016; Vernyik et al., 2020). Rational behind genome reduction aims to solving host interference problem by reduction of complexity of the engineered chassis genome. Desired benefits of genome reduction could be increase of genome stability, increased growth rate and robustness, simplification of secreted metabolome and consequent reduction in number of secreted metabolites. Large scale genome reduction could also have positive implications in industrial high- titer strain improvement efforts. It is thought that genome reduction could potentially lower metabolic burden of a host strain and increase the titer of the target product, and improve other morphological and physiological properties of the industrial cultures (Beites & Mendes, 2015; Choe et al., 2016). Initial studies on genome reduction were aimed to study minimal set of genes, which are necessary for functionality of a cell (Beites & Mendes, 2015; Choe et al., 2016; Vernyik et al., 2020), that is, a cell from a unit of organism, to an assembly of thousands of genetic parts, which is now possible thanks to the recent advances in synthetic biology (Choe et al., 2016). The smallest microbial genomes can be found in nature, such as Mycoplasma genitalium, a parasitic bacteria with one of the smallest genome (580kb) among known free-living microorganisms (Choe et al., 2016). However, for the purpose of genome reduction studies, and based on advanced synthetic biology tools, it was more practical to carry out top-down approach, by carrying on genome reduction (gene deletion) strategies. A number of strategies were used to reduce the genome of E. coli, deletions in a range from 6,8% to 29,7% were achieved (Choe et al., 2016). As reviewed by Choe at al. (2016), most of the engineered E. coli strains with reduced genome displayed normal growth rate. Some of the engineered strains displayed increased genome stability and were able to reach higher cell density. The exception was E. coli delta 16 strain, with 29,7% of the genome reduction, which displayed impaired growth and abnormal nucleotide formation (Choe et al., 2016). In the first attempt, to streamline B. subtillis genome, 7,7% reduction of the genome was achieved (300 genes were removed), and this reduction did not cause any growth rate defects, and the differentiation process remained unaffected (Westers et al., 2003). In the second attempt (Ara et al., 2007) 25% of the genome was removed, resulting in strains with unstable growth rate phenotype. Finally, large scale deletions size of up to 36% of the genome were achieved (Reuß et al., 2017). In this study (Reuß et al., 2016) authors carried out multi-omics analysis of the engineered strains. They observed significant changes in metabolome, transcriptome and proteome. However, these strains were fully viable and their growth rates in complex medium was comparable to the wild type strains (Reuß et al., 2017), showing high degree of gene dispensability in industrially important B. subtilis. Interesting study was carried out by Shen et al. (2017), where up to 685 kb of the Pseudomonas chlororapsis GP72 genome was removed, which represents 10,3% of the genome. The deletion included 5 secondary metabolite biosynthetic gene clusters (BGCs) and 17 strain-specific regions including 525 non-essential genes. Growth characteristics and production of biologically active metabolites phenazines with antibacterial and antifungal activities showed increased productivity. Growth characteristics and morphogenesis of engineered Pseudomonas chlororapsis GP72 also changed significantly. Streptomyces species belonging to the large group of filamentous bacteria known as actinomycetes present one of the richest source of biologically active secondary metabolites, and the richest source of medically and industrially important drugs. A number of genome reduction efforts were attempted in Streptomyces species, which often contain more than 40 BGCs encoding biosynthesis of secondary metabolites (Beites & Mendes, 2015). It is suggested, that the endogenous BGCs not only consume plenty of energy, reducing power and precursor supply, but also produce lots of non- target products which interfere with isolation and purification of target products (Zhou et al., 2012). Therefore, it was suggested, that to refactor the genomes by large-scale deletion of nonessential elements could potentially improve the performance of Streptomyces hosts for drug discovery efforts, and could potentially have positive effect on the titer or yield of a target product (Bu et al., 2019). Gomez-Escribano & Bibb (2011), reported the sequential deletion of four BGCs in Streptomyces coelicolor. Introduction and heterologous expression of actinorhodin, chloramphenicol and congocidine BGCs in S. coelicolor M145 engineered strain resulted in increased titer when compared to the parent strain. In much more comprehensive effort, Zhou et al. (2012) reported sequential deletion of all 10 PKS and NRPS clusters in S. coelicolor M145 including a 900kb deletion of sub-telomeric region. In total 1,22MG of chromosome was removed (14% of the genome), however, significant increase in antibiotic actinorhodin was not observed. Artificially circularised genome of S. coelicolor M145 was also reported (Zhou et al., 2012) including the deletion of 1,6Mb of genome; 840kb from the left and 761kb from the right arm of linear genome in S. coelicolor. No obvious differences if growth rate or strain morphology was observed. Interestingly, the deletion of the 900kb telomeric region resulted in actinorhodin titer decrease compared to S. coelicolor M145 parent strain, suggesting that some unknown genes from 900kb sub-telomeric region affect the expression of the actinorhodin BGC (Zhou et al., 2012). Komatsu et al. (2010) reported stepwise deletion of 1,4Mb left sub-telomeric region containing avermectin, flipin BGCs in Streptomyces avermitilis, important industrial producer of anthelmintic avermectin. The most redundant strain SUKA17 had deletion spanning about 1,67 Mbps (18,5%) at a sub-telomeric region, at the end of the chromosome, which contained several BGCs, genes encoding biosynthesis of terpene geosmin, neopentalenolacton, and carotenoid biosynthesis including other gene clusters related to secondary metabolism. This strain was able to grow on minimal medium, therefore, the extensive chromosome deletion was neither lethal not influential to primary metabolism (Choe et al., 2016; Komatsu et al., 2010). The heterologous streptomycin, cephamycin C and pladielonide BGCs were expressed successfully in engineered S. avermitilis chassis with increased titers of the first two antibiotics when compared to the native strains. Dong et al. (2021) reported an efficient marker-less system, which is adopted for industrial streptomycetes, and they report deletion of 200kb non-essential region In S. albus, producer of polyeter antibiotic salinomycin. The deletion was not beneficial for production of salinomycin, considering that resulting strains displayed reduced growth rate and reduced titre of antibiotic salinomycin. Titer of the antibiotic was reduced for about 50%. Recently, Bu et al. (2019) attempted rational reconstruction of Streptomyces chattanoogenis L10 strain, which is industrial producer of antibiotic natamycin. They have generated two strains with the reduction of the genome for 1,3 and 0,7 Mb of “non-essential” regions of the chromosome. The strain harbouring 0,7Mb deletion, containing 7 biosynthetic gene clusters including gene cluster encoding natamycin, possessed clearer metabolic profile and morphologically strain displayed more dispersed mycelial growth. Bu et al. (2019) also reported increased transformation efficacy, increased capacity for production of heterologous proteins and secondary metabolites. As reported, the titer of heterologously expressed antibiotic actinorhodin gene cluster resulted in 2-3 fold higher titer of actinorhodin compared to the parent strain. 15 dispensable secondary metabolite BGCs were identified in the genome of the Streptomyces albus J1074 by antiSMASH analysis. By removing the 15 BGCs spanning over 503 kb (Myronovskyi et al., 2018), a cluster-free mutant S. albus Del14 was constructed and the mutant Del14 has successfully served as chassis for heterologous expression of BGCs. Significant yield increase, when carried out heterologous expression of BGCs has not been demonstrated, however, this strain provides a substantially improved compound detection limit, owing to the lack of native secondary metabolites (Myronovskyi et al., 2018). Based on the literature data, it is possible to conclude that genome reduction efforts carried in Streptomyces species generally did not impair physiological or morphological properties of the engineered strain. Most often, engineered strains maintained the same growth rate compared to the parent. However, genome reduction efforts in engineered strains generally did not result in significant titer increase of the target metabolite, which would be of relevance for industrial purposes. There is a need for engineered microorganisms for the manufacture of primary and secondary metabolites in increased yields. Also there is a need for engineered microorganisms having silent or cryptic pathways activated such as to produce significant amounts of products therefrom. Brief description of the figures Figure 1 Schematic presentation of the end of the chromosome containing OTC BGC in S. rimosus ATCC 10970 (RefSeq: GCF_000331185.2; University of Strathclyde, 2021). The scheme is displaying the right end of the chromosome containing OTC BGC (locations: 8689563 – 9351267). (a) distance of deletion from targeted BGC (in this case BGC 9 - OTC BGC), and (b) size of deletion (in this case 145 kb). Figure 2 PCR verification of Δ145kb genotype in S. rimosus transformants after CRISPR-editing procedure. Schematic representation of each targeted region is presented with corresponding primer pair. Primer sequences and expected size of correct PCR amplicon is presented in Table 3 (2168bp). Figure 3 Production of OTC by ATCC Δ145kb compared to the parent strain S. rimosus ATCC 10970. Mean with error bars showing s.d. (n=9, three independent fermentations from three biological replicates). Significance is tested by one-way analysis of variance (ANOVA), ****P < 0.0001. Figure 4. Comparison of OTC titer during the entire production stage (from 20h to 144h of incubation time) between engineered strain ATCC Δ145kb and ATCC 10970. Measurements were performed from two biological replicates. Figure 5. Comparative transcriptome analysis of S. rimosus ATCC 10970 and engineered strain ATCC Δ145kb at the first sampling time point (24h). A Transcriptome heatmap displaying relative expression (log2fold change) of BGCs in ATCC Δ145kb strain compared to control ATCC 10970. B Translational background of the ATCC Δ145kb, changes in relative expression (log2fold change) compared to ATCC 10970 are plotted. C Heatmap displaying expression values of entire BGC22 in ATCC 10970 and ATCC Δ145kb (TPM-transcripts per million). D Heatmap displaying expression values of entire OTC cluster (BGC 9) in ATCC 10970 and ATCC Δ145kb. Figure 6. Volcano Plot depicting transcriptome changes when comparing ATCC Δ145kb to control ATCC 10970. The x-axis represents the log2 fold change in gene expression, the y-axis represents the statistical significance as -log 10 adjusted p-value. Each data point represents an individual gene, and significant differentially expressed genes are highlighted (log2ratio >1, log2ratio <-1, log10 p value > 2). Figure 7. Full-scan LC-MS analysis of S. rimosus ATCC 10970 (A), ATCC 10970 Δ145kb (B) production broths after acetonitrile extraction. Emergence of three new metabolites in the strain ATCC Δ145kb is visible on chromatogram B. RIM – rimocidins, OTC – oxytetracycline ([M+H]+obs - see table 3), 1 - tyrobetaine-2 ([M+H]+= + obs 387,7), 2 - longicatenamycin B ([M+H] obs = 764,9), 3 – longicatenamycin C ([M+H]+obs = 778,9). Figure 8. Chromatograms from full-scan LC-MS analysis OTC production broths of control and engineered S. rimosus strain: ATCC 10970 (A), ATCC Δ145kb (B). Acetonitrile extracts (4:1 vol) were analysed. OTC – oxytetracycline, RIM- rimocidins, tyro-B-2 – tyrobetaine – 2, longi-B - longicatenimycin B, longi-C – longicatenamycin C. Figure 9. Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced desmethyl-tetracycline (dmTC) gene cluster from Kitasatospora aureofaciens (right y axis). OTC titer of parental strain ATCC (left y axis). Bar plots represent independent transformants cultivated in triplicates. Figure 10. Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced desmethyl-chlortetracycline (dmCTC) gene cluster from Kitasatospora aureofaciens (right y axis). OTC titer of parental strain ATCC (left y axis). Bar plots represent independent transformants cultivated in triplicates. Figure 11. Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced chlortetracycline (CTC) gene cluster from Kitasatospora aureofaciens (right y axis). OTC titer of parental strain ATCC (left y axis). Bar plots represent independent transformants cultivated in triplicates. Figure 12. A: Titer of S. rimosus ATCC ΔOTC with introduced desmethyl-tetracycline (dmTC) cluster (1), desmethylchlortetracycline (dmCTC) cluster (3) and chlortetracycline (CTC) cluster (5) versus S. rimosus ATCC ΔOTC Δ145 with introduced dmTC (2), dmCTC (4) and CTC cluster (6). Bar plots represent the mean of 3 independent transformants cultivated in triplicates. Legend: 1: ATCC ΔOTC + dmTC, 2: ATCC ΔOTC Δ145 + dmTC, 3: ATCC ΔOTC + dmCTC, 4: ATCC ΔOTC Δ145 + dmCTC, 5: ATCC ΔOTC + CTC, 6: ATCC ΔOTC Δ145 + CTC. B: Titer of OTC in S. rimosus ATCC and S. rimosus ATCC Δ145 strain. Bar plots represent the mean of 3 independent transformants cultivated in 6 parallel. Summary of the invention The present invention provide methods and engineered microorganisms for increasing the yield / titer of a primary or secondary metabolite. Surprisingly, the inventors found that by carrying out precise deletion of the DNA fragment of relatively large size, in the vicinity of the target biosynthetic pathway results in significant increase in target biosynthetic pathway gene expression, which in turn results in significant increase of the target metabolite. In a first aspect the present invention provides an engineered microorganism for the production of a primary or secondary metabolite of interest (MOI) wherein said microorganism comprises at least one deletion of a DNA fragment in the vicinity of the genes encoding the metabolic pathway for synthesis of said MOI as compared to a reference strain which has no such deletion, and wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI. In a second aspect the present invention provides a method for increasing the yield of a primary or secondary metabolite of interest (MOI) from a reference microorganism comprising DNA encoding the metabolic pathway for the synthesis of said MOI, said method comprising the steps of: a) preparing an engineered microorganism by introducing at least one deletion in the vicinity of the genes encoding said metabolic pathway, wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI, and b) cultivating said engineered microorganism. In a third aspect the present invention provides the use of the engineered microorganism as defined in any one of claims 1-27 for the production of the MOI, said use comprising cultivation of said engineered microorganism in a suitable culture medium and isolation of the MOI synthesized by the engineered microorganism. In one embodiment the microorganism is a Streptomyces sp. The present invention is further described by the following items: 1. An engineered microorganism for the production of a primary or secondary metabolite of interest (MOI) wherein said microorganism comprises at least one deletion of a DNA fragment in the vicinity of the genes encoding the metabolic pathway for synthesis of said MOI as compared to a reference strain which has no such deletion, and wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI. 2. An engineered microorganism for the production of a primary or secondary metabolite of interest (MOI) wherein said microorganism comprises the genes encoding the metabolic pathway for synthesis of said MOI having at least one deletion of a DNA fragment in the vicinity of the genes encoding the metabolic pathway for the synthesis of said MOI as compared to a wild type microorganism encoding the same metabolic pathway, and wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI. 3. The engineered microorganism according to item 1 or 2, wherein said deletion does not inactivate the expression of any genes part of the core genome. 4. The engineered microorganism according to any one of the preceding items, wherein the metabolic pathway for the synthesis of said MOI is an operon. 5. The engineered microorganism according to any one of the preceding items, wherein the metabolic pathway for the synthesis of said MOI is a biosynthesis gene cluster that comprises at least one gene encoding at least one enzyme necessary for the synthesis of said MOI. 6. The engineered microorganism according to any one of the preceding items, wherein said at least one deletion is a deletion of a single DNA fragment. 7. The engineered microorganism according to any one of the preceding items, wherein said microorganism has a linear chromosome. 8. The engineered microorganism according to item 7, wherein said deletion of a DNA fragment is towards the upstream end of the chromosome. 9. The engineered microorganism according to item 7 or 8, wherein said deletion of a DNA fragment comprises the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2). 10. The engineered microorganism according to item 7 or 8, wherein said deletion of a DNA fragment is the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2). 11. The engineered microorganism according to any one of items 1-6, wherein said microorganism has a circular chromosome. 12. The engineered microorganism according to item 11, wherein said deleted DNA fragment was placed towards the core region containing the origin of replication. 13. The engineered microorganism according to any one of the preceding items, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 500 Kbp away from the metabolic pathway for synthesis of said MOI. 14. The engineered microorganism according to any one of the preceding items, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 50 Kbp away from the metabolic pathway for synthesis of said MOI. 15. The engineered microorganism according to any one of the preceding items, wherein said deletion encompasses a maximum deletion size of 500 Kbp, a maximum deletion size of 250 Kbp or a maximum deletion size of 150 Kbp. 16. The engineered microorganism according to any one of the preceding items, wherein said deletion is at least 5 Kbp in size. 17. The engineered microorganism according to any one of the preceding items, wherein said deletion comprise from 5 Kbp to 500 Kbp, from 5 Kbp to 250 KBP, from 5 Kbp to 100 Kbp or from 5 Kbp to 70 Kbp. 18. The engineered microorganism according to any one of the preceding items, wherein the MOI is oxytetracycline. 19. The engineered microorganism according to any one of the preceding items, wherein the MOI is longicatenamycin B or longicatenamycin C. 20. The engineered microorganism according to any one of items 1-17, which is selected from the group consisting of secondary metabolites, actinomycin, avermectin, bleomycin, candicidin, cephamycin, cyclosporin, clavulanic acid, daptomycin, daunorubicin, doxorubicin, erythtomycin, tylosin, milbemycin, FK506, FK520, rapamycin, fosfomycin, streptomycin, gentamycin, kanamycin, apramycin, neomycin, tobramycin, cycloserine, chloramphenicol, Mitomycin, natamycin, novobiocin, penicillin, lovastatin, nystatin, amphotericin, phleomycin, polymyxin, bacitracin, pristinamycin, rifamycin, salinomycin, monensin, spinosyn, spiramycin, streptogramins, tetracycline, mycophenolic acid, cephalosporin, epothilone, lincomycin, fidaxomicin, fusaric acid, paromomycin, spectinomycin, mupirocin, lipstatin, vancomycin, primary metabolites, thiamine, riboflavin, folic acid, pantothenic acid, biotin, vitamin b12, beta-carotene (pro-vitamin A), ergosterol, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). 21. The engineered microorganism according to any one of the preceding items, wherein the metabolic pathway for synthesis of said MOI is a naturally occurring pathway. 22. The engineered microorganism according to any one of the preceding items, wherein the MOI is naturally being produced by the microorganism. 23. The engineered microorganism according to any one of items 1-21, wherein the metabolic pathway for synthesis of said MOI is not naturally occurring in said mircroorganism. 24. The engineered microorganism according to any one of the preceding items, wherein the microorganism is an eukaryote. 25. The engineered microorganism according to any one of items 1-23, wherein the microorganism is a prokaryote. 26. The engineered microorganism according to any one of the preceding items, wherein the microorganism is selected from the group consisting of an actinobacteria such as Streptomyces, Corynebacterium sp., Propionibacterium sp., Saccharopolyspora sp., Amycolatopsis sp., myxobacteria, cyanobacteria, Bacillus sp., Saccharomyces sp., Pseudomonas sp and Escherichia coli. 27. The engineered microorganism according to any one of the preceding items, wherein the microorganism is selected from the group consisting of Streptomyces rimosus, Streptomyces hygroscopicus, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Streptomyces rapamycinicus, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Streptomyces albus, Micromonospora sp., Micromonospora griseorubida, Amycolatopsis mediterranei, Actinoplanes sp., Streptomyces lasaliensis, Actinosynnema pretiosum, Streptomyces bikiniensis, Streptomyces graminofaciens, Streptomyces sp., Streptomyces virginiae , Sorangium cellulosum, Micromonospora megalomicea, Streptomyces halstedii, Streptomyces spiroverticillatus, Streptomyces aureofaciens, Streptomyces hygroscopicus, Streptomyces geldanamycininus, Streptomyces sahachiroi, Xanthomonas albilineans, Amycolatopsis balhimycina, Streptomyces verticillus, Acinetobacter baumannii, Bacillus amyloliquefaciens, Bacillus licheniformis, Streptomyces lohii, Streptomyces nanchangensis, Streptomyces caelestis, Streptomyces violaceusniger, Streptomyces noursei, Streptomyces sp. HK803, Streptomyces piomogenus, Streptomyces venezuelae, Streptomyces natalensis, Streptomyces platensis, Pseudomonas fluorescens, Streptomyces sp. SN-593, Amycolatopsis mediterranei, Streptomyces achromogenes, Streptomyces albus, Streptomyces spiroverticillatus, Streptomyces griseus, Streptomyces ambofaciens, Saccharopolyspora spinosa, Streptomyces flaveolus, Nocardiopsis sp. FU40, Streptomyces violaceoruber,, Streptomyces bottropensis , Streptomyces sp. CS40, Streptomyces lavendulae, Streptomyces triostinicus, Bacillus amyloliquefaciens , Actinomadura kijaniata, Streptomyces rochei, Bacillus amyloliquefaciens, Pseudomonas fluorescens, Micromonospora griseorubida, Streptomyces cyaneogriseus , Streptomyces antibioticus, Streptomyces platensis, Stigmatella aurantiaca, Streptomyces lasaliensis, Streptomyces fungicidicus, Streptomyces pristinaespiralis, Streptomyces lividans, Streptomyces coelicolor, Streptomyces roseosporus, Streptomyces actuosus, Streptomyces mycarofaciens, Streptomyces longisporoflavus, Streptomyces parvulus, Streptomyces antibioticus, Streptomyces incarnates, Streptomyces cinnamonensis, Streptomyces parvulus, Micromonospora megalomicea, Streptomyces diastatochromogenes, Streptomyces nodosus, Streptomyces varsoviensis, Streptomyces setae. 28. The engineered microorganism according to any one of the preceding items, wherein the microorganism is Streptomyces sp. 29. The engineered microorganism according to any one of the preceding items, wherein the microorganism is Streptomyces rimosus. 30. The engineered microorganism according to any one of the preceding items, wherein the microorganism is Streptomyces rimosus ATCC 10970. 31. A method for increasing the yield of a primary or secondary metabolite of interest (MOI) from a reference microorganism comprising DNA encoding the metabolic pathway for the synthesis of said MOI, said method comprising the steps of: a) preparing an engineered microorganism by introducing at least one deletion in the vicinity of the genes encoding said metabolic pathway, wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI, and b) cultivating said engineered microorganism. 32. The method according to item 31, wherein said deletion does not inactivate the expression of any genes part of the core genome. 33. The method according to item 31 or 32, wherein the metabolic pathway for the synthesis of said MOI is an operon. 34. The method according to any one of items 31-33, wherein the metabolic pathway for the synthesis of said MOI is a biosynthesis gene cluster that comprises at least one gene encoding at least one enzyme necessary for the synthesis of said MOI. 35. The method according to any one of items 31-34, wherein said at least one deletion is a deletion of a single DNA fragment. 36. The method according to any one of items 31-35, wherein said microorganism has a linear chromosome. 37. The method according to item 36, wherein said deletion of a DNA fragment is towards the upstream end of the chromosome. 38. The method according to item 36 or 37, wherein said deletion of a DNA fragment comprises the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2). 39. The method according to item 36 or 37, wherein said deletion of a DNA fragment is the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2). 40. The method according to any one of items 31-35, wherein said microorganism has a circular chromosome. 41. The method according to item 40, wherein said deleted DNA fragment was placed towards the core region containing the origin of replication. 42. The method according to any one of items 31-41, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 500 Kbp away from the metabolic pathway for synthesis of said MOI. 43. The method according to any one of items 31-42, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 50 Kbp away from the metabolic pathway for synthesis of said MOI. 44. The method according to any one of items 31-43, wherein said deletion encompasses a maximum deletion size of 500 Kbp, a maximum deletion size of 250 Kbp or a maximum deletion size of 150 Kbp. 45. The method according to any one of items 31-44, wherein said deletion is at least 5 Kbp in size. 46. The method according to any one of items 31-45, wherein said deletion comprise from 5 Kbp to 500 Kbp, from 5 Kbp to 250 KBP, from 5 Kbp to 100 Kbp or from 5 Kbp to 70 Kbp. 47. The method according to any one of items 31-46, wherein the MOI is oxytetracycline. 48. The method according to any one of items 31-47, wherein the MOI is longicatenamycin B or longicatenamycin C. 49. The method according to any one of items 31-46, wherein the MOI is selected from the group consisting of secondary metabolites, actinomycin, avermectin, bleomycin, candicidin, cephamycin, cyclosporin, clavulanic acid, daptomycin, daunorubicin, doxorubicin, erythtomycin, tylosin, milbemycin, FK506, FK520, rapamycin, fosfomycin, streptomycin, gentamycin, kanamycin, apramycin, neomycin, tobramycin, cycloserine, chloramphenicol, Mitomycin, natamycin, novobiocin, penicillin, lovastatin, nystatin, amphotericin, phleomycin, polymyxin, bacitracin, pristinamycin, rifamycin, salinomycin, monensin, spinosyn, spiramycin, streptogramins, tetracycline, mycophenolic acid, cephalosporin, epothilone, lincomycin, fidaxomicin, fusaric acid, paromomycin, spectinomycin, mupirocin, lipstatin, vancomycin, primary metabolites, thiamine, riboflavin, folic acid, pantothenic acid, biotin, vitamin b12, beta-carotene (pro-vitamin A), ergosterol, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). 50. The method according to any one of items 31-49, wherein the metabolic pathway for synthesis of said MOI is a naturally occurring pathway. 51. The method according to any one of items 31-50, wherein the MOI is naturally being produced by the microorganism. 52. The method according to any one of items 31-51, wherein the metabolic pathway for synthesis of said MOI is not naturally occurring in said microorganism. 53. The method according to any one of items 31-52, wherein the microorganism is an eukaryote, including fungi, wherein the microorganism is selected, but not limited to the group consisting of yeast and filamentous fungi such as Saccharomyces sp, Pichia sp., Komagataella sp., Kluyveromyces sp, Yarrowia sp, Aspergillus sp., Penicillium sp., Monascus sp. and Trichoderma sp. 54. The method according to any one of items 31-52, wherein the microorganism is a prokaryote. 55. The method according to any one of items 31-54, wherein the microorganism is selected from the group consisting of an actinobacteria such as Streptomyces, Corynebacterium sp., Propionibacterium sp., Saccharopolyspora sp., Amycolatopsis sp., myxobacteria, cyanobacteria, Bacillus sp., Saccharomyces sp., Pseudomonas sp and Escherichia coli. 56. The method according to any one of items 31-55, wherein the microorganism is selected from the group consisting of Streptomyces rimosus, Streptomyces hygroscopicus, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Streptomyces rapamycinicus, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Streptomyces albus, Micromonospora sp., Micromonospora griseorubida, Amycolatopsis mediterranei, Actinoplanes sp., Streptomyces lasaliensis, Actinosynnema pretiosum, Streptomyces bikiniensis, Streptomyces graminofaciens, Streptomyces sp., Streptomyces virginiae , Sorangium cellulosum, Micromonospora megalomicea, Streptomyces halstedii, Streptomyces spiroverticillatus, Streptomyces aureofaciens, Streptomyces hygroscopicus, Streptomyces geldanamycininus, Streptomyces sahachiroi, Xanthomonas albilineans, Amycolatopsis balhimycina, Streptomyces verticillus, Acinetobacter baumannii, Bacillus amyloliquefaciens, Bacillus licheniformis, Streptomyces lohii, Streptomyces nanchangensis, Streptomyces caelestis, Streptomyces violaceusniger, Streptomyces noursei, Streptomyces sp. HK803, Streptomyces piomogenus, Streptomyces venezuelae, Streptomyces natalensis, Streptomyces platensis, Pseudomonas fluorescens, Streptomyces sp. SN-593, Amycolatopsis mediterranei, Streptomyces achromogenes, Streptomyces albus, Streptomyces spiroverticillatus, Streptomyces griseus, Streptomyces ambofaciens, Saccharopolyspora spinosa, Streptomyces flaveolus, Nocardiopsis sp. FU40, Streptomyces violaceoruber,, Streptomyces bottropensis , Streptomyces sp. CS40, Streptomyces lavendulae, Streptomyces triostinicus, Bacillus amyloliquefaciens , Actinomadura kijaniata, Streptomyces rochei, Bacillus amyloliquefaciens, Pseudomonas fluorescens, Micromonospora griseorubida, Streptomyces cyaneogriseus , Streptomyces antibioticus, Streptomyces platensis, Stigmatella aurantiaca, Streptomyces lasaliensis, Streptomyces fungicidicus, Streptomyces pristinaespiralis, Streptomyces lividans, Streptomyces coelicolor, Streptomyces roseosporus, Streptomyces actuosus, Streptomyces mycarofaciens, Streptomyces longisporoflavus, Streptomyces parvulus, Streptomyces antibioticus, Streptomyces incarnates, Streptomyces cinnamonensis, Streptomyces parvulus, Micromonospora megalomicea, Streptomyces diastatochromogenes, Streptomyces nodosus, Streptomyces varsoviensis, Streptomyces setae. 57. The method according to any one of items 31-56, wherein the microorganism is Streptomyces sp. 58. The method according to any one of items 31-57, wherein the microorganism is Streptomyces rimosus. 59. The method according to any one of items 31-58, wherein the microorganism is Streptomyces rimosus ATCC 10970. 60. Use of the engineered microorganism as defined in any one of items 1-30 for the production of the MOI, said use comprising cultivation of said engineered microorganism in a suitable culture medium and isolation of the MOI synthesized by the engineered microorganism. 61. Use of the engineered microorganism as defined in any one of items 1-30 for activating one or more cryptic gene cluster(s). 62. Use of the engineered microorganism as defined in any one of items 1-30 for expressing biosynthetic gene cluster not native to the engineered host and producing the MOI. Detailed description of the Invention The present disclosure provides a new genome reduction technology carried out through targeted deletion of a selected sequence located in the vicinity of a metabolic pathway involved in the biosynthesis of a target product. In a first aspect the present invention provides an engineered microorganism for the production of a primary or secondary metabolite of interest (MOI) wherein said microorganism comprises at least one deletion of a DNA fragment in the vicinity of the genes encoding the metabolic pathway for synthesis of said MOI as compared to a reference strain which has no such deletion, and wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI. It is to be understood that the reference strain having no such deletion typically is a microorganism wherein the part of the chromosome spanning over the DNA encoding the metabolic pathway for synthesis of the MOI will have the DNA fragment which has been deleted in the engineered microorganism. The person skilled in the art can establish this by mapping this area of the chromosome using standard DNA technology. In a second aspect the present invention provides a method for increasing the yield of a primary or secondary metabolite of interest (MOI) from a reference microorganism comprising DNA encoding the metabolic pathway for the synthesis of said MOI, said method comprising the steps of: a) preparing an engineered microorganism by introducing at least one deletion in the vicinity of the genes encoding said metabolic pathway, wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI, and b) cultivating said engineered microorganism. In the scope of this invention, and to develop new genome reduction strategy for target product titer improvement, Streptomyces rimosus ATCC 10970 native strain, progenitor of the important industrial producer of broad spectrum antibiotic oxytetracycline (OTC) was used as a model system. This invention generally relates on genetic and cell engineering approach with defined focus in improvement of the titer / yield of the target products being primary metabolite or secondary metabolite of interest. Surprisingly, the inventors found that by carrying precise deletion of the DNA fragment of relatively large size, in the vicinity of the target biosynthetic pathway results in significant increase in target biosynthetic pathway gene expression, which in turn results in significant increase of the target metabolite. Surprisingly, and based on the model system, which we have applied in the scope of this invention, in addition to oxytetracycline hyper-producing phenotype, we also identified novel compounds at relatively high concentrations, which we could not previously detected when parent host strain was cultivated at the identical conditions. Therefore, the methodological approaches developed in the scope of present invention also provides opportunity for activating so-called cryptic / silent pathways (operons a BGCs), whose products cannot be detected, or they are detected in trace amounts. The whole genome transcriptome studies clearly displayed selected BGCs, encoding unknown metabolites, which were very significantly overexpressed in the strain containing the deletion in the vicinity of the target gene cluster (in this case oxytetracycline BGC). Surprisingly, as presented in examples (Example 10) previously “silent”, but now strongly overexpressed BGCs were not necessary located in the close vicinity of the region with introduced deletion (close to the target BGC, in this case oxytetracycline BGC). Therefore, this approach can be used for activation of silent BGCs, as demonstrated on the model system Streptomyces rimosus in the scope of this invention. The present disclosure describes a set of steps, which can enable significant single-step increase in titer of target metabolite in the following steps: a) Identification of the metabolic pathway, encoding biosynthesis of target metabolite, whose genes encode biosynthetic enzymes which are most often located in a single operon or several operons, part of the biosynthetic pathway (or biosynthetic gene cluster, BGC). Not necessarily, but most often, the identification of the target operon or BGC carried out by sequencing of the entire genome of the microorganism producing target product. b) Alternatively, part of the present invention also includes introduction and expression of a target operon or BGC in a heterologous host, which has the operon or BGC encoding target product integrated in the chromosome of a heterologous host (chassis). After integration of the heterologous BGC, according to this disclosure, the procedure for targeted deletion of the DNA fragment follows the same route as disclosed in the procedure in the native strain. c) In the following step, different methodological approaches can be applied to carry out deletion of the DNA fragment located in the vicinity of the target operon or BGC. In the scope of this invention, as exemplified later, we have applied CRISPR-Cas9 (Pšeničnik et al., 2022). It is clear to the person skilled in the art that other type of CRSIPR systems exist, that can be applied to achieve the same engineering step. Alternatively, it is known to the person skilled in the art that other methodological approaches for the deletion of a targeted DNA exist, such as classical homologous recombination directed two-step gene replacement method or by applying specific recombinase (e.g. Cre-LoxP or Flp) mediated recombination systems (Sauer, 1987; Schlake & Bode, 1994), but not limited to these two. For this purpose, suitable plasmid constructs are constructed and transformed into the host cell containing operon or BGC of interest. d) In the central aspect of the present invention we here disclose the technology, how to select location of the DNA deletion on the chromosome (close to the target biosynthetic pathway) and how to define the size of the deletion introduced in the host cell as described below: According to the present invention, the deletion of the target DNA fragment should be located close to the one side of the target operon or metabolic pathway. Preferably, the deleted DNA fragment should according to the present invention be located on the one side of the target operon or biosynthetic pathway which is: - more preferentially, but not necessarily, the deleted DNA fragment is oriented towards the nearest end of the chromosome (when the host cell contains linear chromosome or linear plasmid, such as Streptomyces species). - alternatively, the deleted DNA fragment is oriented towards core region containing origin of replication - more preferentially, but not necessarily, the deleted DNA fragment is located further away from the origin of replication in the host cells containing circular chromosomes - alternatively, the deleted DNA fragment is oriented towards core region containing origin of replication - The operon or metabolic pathway of interest is preferably located outside of the »core-region« of the chromosome. The deletion introduced in the chromosome of the host cell should be located minimum of 1 Kbp and maximum of 500 Kbp away from the target biosynthetic pathway. The deletion introduced in the vicinity of the target biosynthetic pathway in the host cell should encompass maximum deletion size of 500Kbp, more preferably 250Kbp, more preferably 150kb and should not be smaller than 5kb in size. The independent clones selected after the gene deletion procedure are then tested for productivity of the target product (titer) and their correct genotype confirmed PCR and / or whole genome sequencing. Alternatively, whole transcriptome sequencing can be carried out to evaluate the effect of the deletion on the expression of the target genes (operon or BGC). In another aspect of the present invention, the morphological and physiological properties such as growth rate and robustness, rate of assimilation of source on carbon and nitrogen, oxygen consumption, and other physiological properties can be evaluated, and the best clones selected for further testing and further evaluations, according to standard procedures in bioprocess development known to the persons skilled in the art. Hence, in one embodiment said deletion does not inactivate the expression of any genes part of the core genome. In another embodiment the metabolic pathway for the synthesis of said MOI is an operon. In another embodiment the metabolic pathway for the synthesis of said MOI is a biosynthesis gene cluster that comprises at least one gene encoding at least one enzyme necessary for the synthesis of said MOI. In another embodiment said at least one deletion is a deletion of a single DNA fragment. In another embodiment said microorganism has a linear chromosome. In another embodiment said deletion of a DNA fragment is towards the upstream end of the chromosome. In another embodiment said deletion of a DNA fragment comprises the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2). In yet another embodiment 10 said deletion of a DNA fragment is the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2). In another embodiment said microorganism has a circular chromosome. In another embodiment said deleted DNA fragment was placed towards the core region containing the origin of replication. In another embodiment said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 500 Kbp away from the metabolic pathway for synthesis of said MOI. In another embodiment said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 50 Kbp away from the metabolic pathway for synthesis of said MOI. In another embodiment said deletion encompasses a maximum deletion size of 500 Kbp, a maximum deletion size of 250 Kbp or a maximum deletion size of 150 Kbp. In another embodiment said deletion is at least 5 Kbp in size. In another embodiment said deletion comprise from 5 Kbp to 500 Kbp, from 5 Kbp to 250 KBP, from 5 Kbp to 100 Kbp or from 5 Kbp to 70 Kbp. In another embodiment the MOI is oxytetracycline. In another embodiment the MOI is longicatenamycin B or longicatenamycin C. In another embodiment the MOI is selected from the group consisting of secondary metabolites, actinomycin, avermectin, bleomycin, candicidin, cephamycin, cyclosporin, clavulanic acid, daptomycin, daunorubicin, doxorubicin, erythtomycin, tylosin, milbemycin, FK506, FK520, rapamycin, fosfomycin, streptomycin, gentamycin, kanamycin, apramycin, neomycin, tobramycin, cycloserine, chloramphenicol, Mitomycin, natamycin, novobiocin, penicillin, lovastatin, nystatin, amphotericin, phleomycin, polymyxin, bacitracin, pristinamycin, rifamycin, salinomycin, monensin, spinosyn, spiramycin, streptogramins, tetracycline, mycophenolic acid, cephalosporin, epothilone, lincomycin, fidaxomicin, fusaric acid, paromomycin, spectinomycin, mupirocin, lipstatin, vancomycin, primary metabolites, thiamine, riboflavin, folic acid, pantothenic acid, biotin, vitamin b12, beta-carotene (pro-vitamin A), ergosterol, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). In another embodiment the metabolic pathway for synthesis of said MOI is a naturally occurring pathway. In another embodiment the MOI is naturally being produced by the microorganism. In another embodiment the metabolic pathway for synthesis of said MOI is not naturally occurring in said mircroorganism. In another embodiment the microorganism is an eukaryote. In another embodiment the microorganism is selected from the group consisting of fungi, wherein the microorganism is selected, but not limited to the group consisting of yeast and filamentous fungi such as Saccharomyces sp, Pichia sp., Komagataella sp., Kluyveromyces sp, Yarrowia sp, Aspergillus sp., Penicillium sp., Monascus sp. and Trichoderma sp. In another embodiment the microorganism is a prokaryote. In another embodiment the microorganism is selected from the group consisting of an actinobacteria such as Streptomyces, Corynebacterium sp., Propionibacterium sp., Saccharopolyspora sp., Amycolatopsis sp., myxobacteria, cyanobacteria, Bacillus sp., Saccharomyces sp., Pseudomonas sp and Escherichia coli. In another embodiment the microorganism is selected from the group consisting of Streptomyces rimosus, Streptomyces hygroscopicus, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Streptomyces rapamycinicus, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Streptomyces albus, Micromonospora sp., Micromonospora griseorubida, Amycolatopsis mediterranei, Actinoplanes sp., Streptomyces lasaliensis, Actinosynnema pretiosum, Streptomyces bikiniensis, Streptomyces graminofaciens, Streptomyces sp., Streptomyces virginiae , Sorangium cellulosum, Micromonospora megalomicea, Streptomyces halstedii, Streptomyces spiroverticillatus, Streptomyces aureofaciens, Streptomyces hygroscopicus, Streptomyces geldanamycininus, Streptomyces sahachiroi, Xanthomonas albilineans, Amycolatopsis balhimycina, Streptomyces verticillus, Acinetobacter baumannii, Bacillus amyloliquefaciens, Bacillus licheniformis, Streptomyces lohii, Streptomyces nanchangensis, Streptomyces caelestis, Streptomyces violaceusniger, Streptomyces noursei, Streptomyces sp. HK803, Streptomyces piomogenus, Streptomyces venezuelae, Streptomyces natalensis, Streptomyces platensis, Pseudomonas fluorescens, Streptomyces sp. SN-593, Amycolatopsis mediterranei, Streptomyces achromogenes, Streptomyces albus, Streptomyces spiroverticillatus, Streptomyces griseus, Streptomyces ambofaciens, Saccharopolyspora spinosa, Streptomyces flaveolus, Nocardiopsis sp. FU40, Streptomyces violaceoruber,, Streptomyces bottropensis , Streptomyces sp. CS40, Streptomyces lavendulae, Streptomyces triostinicus, Bacillus amyloliquefaciens , Actinomadura kijaniata, Streptomyces rochei, Bacillus amyloliquefaciens, Pseudomonas fluorescens, Micromonospora griseorubida, Streptomyces cyaneogriseus , Streptomyces antibioticus, Streptomyces platensis, Stigmatella aurantiaca, Streptomyces lasaliensis, Streptomyces fungicidicus, Streptomyces pristinaespiralis, Streptomyces lividans, Streptomyces coelicolor, Streptomyces roseosporus, Streptomyces actuosus, Streptomyces mycarofaciens, Streptomyces longisporoflavus, Streptomyces parvulus, Streptomyces antibioticus, Streptomyces incarnates, Streptomyces cinnamonensis, Streptomyces parvulus, Micromonospora megalomicea, Streptomyces diastatochromogenes, Streptomyces nodosus, Streptomyces varsoviensis, Streptomyces setae. In another embodiment the microorganism is Streptomyces sp. In another embodiment the microorganism is Streptomyces rimosus. In yet another embodiment the microorganism is Streptomyces rimosus ATCC 10970. In another aspect the present invention provides the use of the engineered microorganism as defined above for the production of the MOI, said use comprising cultivation of said engineered microorganism in a suitable culture medium and isolation of the MOI synthesized by the engineered microorganism. In another aspect the present invention provides the use of the engineered microorganism as defined above for activating one or more cryptic gene cluster(s). In another aspect the present invention provides the use of the engineered microorganism as defined above for expressing biosynthetic gene cluster not native to the engineered host and producing the MOI. EXAMPLES Strains and growth conditions Plasmids were propagated in Escherichia coli DH10β, cultured in 2TY medium with apramycin (100 μg / ml) at 28°C. E. coli ET12567 / pUB307 was used for conjugation and grown in 2TY at 28 °C with apramycin (100 μg / ml) and kanamycin (50 μg / ml). All the Streptomyces rimosus strains were cultivated on soy-mannitol (MS) agar plates for sporulation and in tryptone soy broth medium (TSB) for genomic DNA isolation and plasmid removal (subcultivations). Throughout all experiments, S. rimosus standard growth conditions (SGC) were set at 28°C and 220 rpm, in a rotary shaker. Thiostrepton (30ug / ml) was used for selection of S. rimosus exconjugants. OTC fermentations were conducted in 50mL falcon tubes with working volume of 5mL, shaken at SGC. Seed cultures were prepared by inoculating with an agar plug from a freshly grown culture into 5mL of GOTC-V medium (Pikl et al., 2021) and incubated for 30h at SGC. Then, the seed cultures were inoculated into GOTC- P production medium (Pikl et al., 2021) at 10% v / v and incubated for 5 days in SGC and 60% humidity. When larger volumes of the cultures were needed for transcriptome analysis and preliminary tests, the production phase was moved to 250mL Erlenmeyer flasks, that were filled with 40mL of GOTC-P medium and inoculated with 4mL of vegetative stage culture prepared in 50mL falcon tubes. Example 1 - Construction of pRep_P1_cas9_Δ145kb plasmid The primers, spacer sequences and constructed plasmids from this study are listed in Tables 1-4. The primers used for plasmid construction contained 20-36 bp of appropriate overlapping regions to enable different homology-based cloning methods. All spacer sequences were selected with help of the gRNA activity scoring algorithm (Doench et al., 2014) in Geneious R11.1.5 software (https: / / www.geneious.com). All homology regions were amplified from genomic DNA isolated from S. rimosus ATCC 10970. The Large del_DOWN homology used for 145kb deletion was amplified by a set of primers: DOWN_Fw and DOWN_Rw. Δ145kb_UP homology was amplified with primer pair: Δ145kb_UP_Fw / Δ145kb_UP_Rw. gRNA part was PCR amplified from synthesized fragments (ATG Biosynthetics GmbH; Germany). Δ145kb_gRNA was composed of two consecutive gRNA cassettes. The single gRNA cassette consisted of synthetic P21 promoter (Myronovskyi & Luzhetskyy, 2016) followed by 20bp spacer sequence and native S. pyogenes trans-activating CRISPR RNA and t0 terminator (Mrak et al., 2018). For the pRep_P1_cas9_Δ145kb assembly, the pRep_P1_cas9_tsr plasmid was first linearized with and SpeI enzyme. The Δ145kb_gRNA, Δ145kb_UP fragments were fused with overlap extension PCR (OE-PCR). The OE PCR reaction consisted of equimolar amounts of each part, initially run for 10 cycles without primers. After the first step, the external primers (gRNA_FW and Δ145kb_UP_Rw) were added to the reaction and run for another 30 cycles. The Δ145kb OE-PCR fragment was then joined to the Large del_DOWN PCR fragment and SpeI-linearized pREP_P1_cas9_tsr in a homology-based SLiCE reaction (Zhang et al., 2012) to obtain the final plasmid construct pRep_P1_cas9_Δ145kb. Example 2 - Construction of engineered strain pRep_P1_cas9_Δ145kb plasmid was first introduced to E.coli strain Et-pUB307 (Flett et al., 1997), that mediated the transfer of the plasmid to S. rimosus ATCC 19070 and ATCC 10970 ΔOTC. According to the conjugation procedure, E. coli ET-pUB307 carrying pREP-CRISPR plasmids and S. rimosus spores were mixed and plated on MS agar plates (40mL), supplemented with 30mM MgCl2 and 30mM CaCl2. After 4-6h the plates were overlayed with 1.5ml aqueous solution of nalidixic acid and thiostrepton, both to final concentration of 30mg / L. After 6 days, exconjugants were transferred to MS+tio+nal medium. Viable exconjugants were then inoculated into 5mL TSB medium and subjected to two rounds of subcultivation (24h at 28 °C and 220 rpm). Subcultivation aimed at removal of the replicative pREP-CRISPR-plasmid from the mutants to avoid the occurrence of non-specific mutations, caused by prolonged presence of active Cas9-gRNA complex. 100ul of 10-6dilution of subcultivated cultures was spread on MS agar plates with (MS+thio) and without the selection marker. Colonies from MS plates where substantial loss of plasmid was observed were further patched onto new replica agar plates. Plasmid loss was evident from inability of the colonies to grow in presence of thiostrepton. Example 3 – Confirmation of deletion. Confirmation of the correct deletion events by PCR and DNA sequencing To verify the correct deletion, 10 plasmid-cleared independent exconjugants were analysed for each deletion size. For gDNA extraction an agar plug of sporulating colonies from MS medium was inoculated into 5 mL TSB and harvested during mid-exponential-growth phase (after 24 h). gDNA was isolated from potential mutants using a peqGOLD bacterial DNA isolation kit (VWR, USA). The presence of the expected deletion was confirmed on isolated gDNA samples by PCR using RepliQ HIFI Though mix (Quantabio, USA). In the case of the 145kb deletion, primer pair Δ145kb_UP_Fw and Δ145kb_DOWN_Rw was used to identify mutants with required deletion size. The primer sequences used for confirmation and expected amplicons sizes are represented in Table 3. PCR amplicons of the expected size were excised from agarose gels, isolated using E.Z.N.A. Gel Extraction Kit (Omega Bio-Tek, USA) and analysed by Sanger sequencing at Macrogen, Inc. (Daejeon, Republic of Korea). WGS of ATCC Δ145kb strain Whole genome sequencing (WGS) was undertaken with Illumina technology. gDNA was isolated from the two S. rimosus ATCC 10970 Δ145kb (a / b) mutants for which the 145kb deletion had been confirmed by PCR and two ATCC 10970 colonies (gDNA isolation described above). Library preparation and DNA sequencing was performed by Macrogen, Inc. (Daejeon, Republic of Korea). The short-read genome-sequencing library was prepared with TruSeq DNA PCR Free kit (Illumina, Inc., San Diego, CA, USA), sequencing was performed on a Novaseq Illumina platform (Illumina, Inc., San Diego, CA, USA). The short sequence reads obtained from Illumina sequencing were initially subjected to quality control and adapter sequence trimming using BBDuk trimmer (version 38.84) (https: / / jgi.doe.gov / data-and-tools / bbtools / ). The trimmed reads were aligned to the ATCC 10970 reference genome (RefSeq:GCF_000331185.2) (accessible at https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 1265868 / . The alignment was performed using the Geneious mapper tool, employing a Medium-Low Sensitivity setting and iterating the process five times to ensure optimal alignment. All these operations were executed within Geneious Prime 20221.1 (https: / / www.geneious.com). Isolation of total mRNA Total RNA was isolated from culture broths at 24h and 50h of OTC fermentation procedure (see Methods section - Strains and growth conditions). Total RNA was isolated with RNeasy Mini Kit (Qiagen) from 0.8 ml of the fixed culture. Before isolation, the cell pellet was washed in fixative and then treated with lysozyme (40 mg / mL, Sigma) and proteinase K (20 mg / mL; Macherey-Nagel) for 10 minutes, followed by homogenization with FastPrep using Lysing Matrix B beads (MP Biomedicals) and RLT Buffer (750 μl, Qiagen). The homogenate was centrifuged, and the supernatant was used for subsequent RNA isolation using the RNeasy Mini Kit (Qiagen) with the following modifications to the manufacturer’s protocol: samples were washed twice and three times with RW1 and RPE buffer, respectively. RNA was eluted after 5 min incubation with pre- warmed (65 °C) RNAse-free water. Samples were further purified with DNase I and the Zymo RNA Clean & Concentrator-5 kit (Zymo Research), with DNase treatment in solution and washing repeated three times. The efficiency of DNase digestion was tested using RT- controls. Quantity and quality of RNA were tested using Nanodrop, gel electrophoresis and Bioanalyzer (Agilent). Formatting and analysis of RNA-seq data Total RNA was isolated and sent to Novogene (China) for Sample QC & Library preparation with 250-300 bp insert strand-specific library with rRNA removal & sequencing with 2 Gb (6.6M reads) raw data output. After QC checking for GC complience RNA-seq library was prepared according to the classic workflow for library construction (Novogene QC Analysis Report). Sequencing was performed on an Illumina NovaSeq (Illumina, USA) in paired-end mode with read length of 150bp (PE150). Base read quality of obtained sequences was of very high quality, with the lowest Q20 and Q30 sample scores of 97.93% and 94.61%, respectively. Raw paired-end reads obtained from Novogene (China) were trimmed using BBDuk trimmer (version 38.84) to remove adapters and bases not reaching phred score Q15. Trimmed sequences were then simultaneously aligned to reference S. rimosus ATCC 10970 chromosome (RefSeq:GCF_000331185.2) (accessible at https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 1265868 / using Bowtie2. Expression levels of reference CDS aligned sequences were then determined using embedded Genious Prime quantification tool, where ambiguously mapped reads were counted as partial matches. Differential expression analysis between replicate data of control (ATCC 10970) and mutant strains was performed using DEseq2 (Love et al., 2014), which also produced volcano plots (Figure 6) that were visualised with Genious Prime 20221.1 (https: / / www.geneious.com). Example 4 - HPLC analysis of OTC production After fermentation of S. rimosus strains in GOTC-P medium (Methods – strains and growth conditions) titres of OTC in fermentation broths were analysed using HPLC, as described by Pikl et al., 2021. Briefly, 1mL of fermentation broth was acidified to pH 1.5-2.0 with 37 % HCl and centrifuged at 13000rpm for 10 min. The supernatants were filtered with 0,45 µm syringe filters and subjected to HPLC analysis (UltiMate 3000 HPLC system) using a C-18 column (150 × 4.6 mm; 5 μm; 40 °C; Macherey-Nagel), with UV absorption detection at 270 nm, and a flow rate of 1 mL / min. The elution solvent A (80%H2O,20%MeOH, 0,1% formic acid) and solvent B (100%MeOH) were used in 20 min gradient elution as follows: The 0→8 min, 10 % B; 8→12 min, 10 %→90 % B; 12→15 min, 90 % B; 15→15.01 min, 90 %→10 % B; 15.01→20 min, 10 % B. The OTC ^tres were calculated as the mean titres from at least three parallel samples of each mutant and the parental strains. Example 5 – MS analysis of the engineered strain Full-scan MS analysis of the engineered strain Samples were prepared with 5 times dilution of water, stirred well and centrifuged. Acetonitrile extracts were prepared by adding 4 vol. of ACN to culture broths. Supernatants (5 μL) were injected onto a Merck Porospher STAR RP-18 endcapped column (100 x 2.1 mm, 2 µm), with a flow rate of 0.4 mL min-1 at 60 °C column temperature. A gradient method was performed using mobile phase A: acetonitrile / water / formic acid, 10:990:1 (v / v / v), and mobile phase B: acetonitrile / water / formic acid, 800:200:1 (v / v / v). Starting with 100% mobile phase A (0% mobile phase B), mobile phase B was first brought to 7.6 % at 1.2 min, and then to 80 % at 9.0 min, before returning back to 0% for re-equilibration of the column for 2 min. MS detection was performed with an LCQ iontrap mass spectrometer (ThermoFisher, USA) equipped with a HESI source. Positive ionization (source voltage 5 kV, heater OFF, capillary temperature 275 °C, sheath gas 10 AU, auxiliary gas 5 AU, sweep gas 0 AU) and full-scan monitoring with m / z range 150-1000 allowed detection of the compounds, primarily as proton (M+H)+ adducts. UV diode array multi-wavelength detection was performed in parallel. Raw data were visualised using QualBrouser, a part of Xcalibur package (ThermoFischer, USA) and MZmine 3.0 (Schmid et al., 2023). HR-MS analysis of the engineered strain LC-MS analysis was performed on an UltiMate 3000 UHPLC system (Thermo Scientific, U.S.A.) coupled with a triple quadrupole / linear ion trap mass spectrometer (4000 QTRAP LC-MS / MS System; Applied Biosystems / MDS Sciex, Ontario, Canada). Methanol (Chromasolv LC-MS grade, Fluka, Switzerland) and water purified on a Milli-Q system from Millipore (Bedford, MA, USA) were used for the preparation of mobile phases, formic acid from Fluka was used as modifier. An analytical HPLC column Kinetex XB-C18100A (2.1 × 100 mm, 2.6 µm particle size, Phenomenex) was used with the flow rate of 0.5 mL min-1(the details on method gradient and Ms experiments are given in supplementary information). A mobile phase consisted of acetonitrile and water, both modified with 0.1% formic acid was used throughout the work. Injection volume and column temperature were 10 µL and 30 °C, respectively. HRMS measurements were performed with a hybrid quadrupole orthogonal acceleration time-of-flight mass spectrometer (QTOF Premier, Waters, Milford, MA, U.S.A.). Statistical analysis Statistical analysis of OTC production as quantified by HPLC was performed using GraphPad Prism v9. Pairwise comparisons were made using Šídák's ANOVA test (n=9). Multiple comparisons were performed with Brown-Forsythe and Welch ANOVA with Dunnett's T3 Test assuming unequal variances (n=9). Corresponding p values are reported in Figure legends.

[0002] Table 1. Strains used in this study Name Description Reference E. coli DH10B Escherichia coli for cloning (Grant et al., 1990) procedures E. coli ET12567 / pUB307 Escherichia coli for conjugal (Flett et al., 1997) transfer Streptomyces rimosus ATTC ATCC strain NCBI: txid1265868 10970 Streptomyces rimosus ATTC ATCC strain with Δ145kb deletion This study 10970 Δ145kb Streptomyces rimosus ATTC Deletion of otc gene cluster - otc (Pikl et al., 2021) 10970 Δotc mutant Streptomyces rimosus ATTC otc mutant, deletion of 145kb This study 10970 Δotc Δ145kb

[0003] Table 2. Plasmids used in this study Name Description Reference pREP_P1_cas9 Base plasmid with JTU412-derived (Mrak et al., 2018) unstable replicon, P1 promoter, codon optimized cas9 and sgRNA scaffold pREP_P1_cas9 tsr +tsr resistance (Pšeničnik et al., 2022) pYAC-ΦC31-Ts-OTC Integrative plasmid with entire (Pikl et al., 2021) OTC cluster and ΦC31 integrase pRep_P1_cas9_Δ145kb cas9 carrying plasmid for 145kb This study deletion

[0004] Table 3. Primers used in this study PCR primer name Nucleotide sequence 5'→3' PCR product Size (bp) gRNA_Fw gacccgcatcgacctgtcgcag Δ145kb_gRNA 460 gRNA_Rw ctcgagtcaaagcttgcgcgcggatc Large del_DOWN_Fw tttaaaccttcctgctgtgggtgctc Large del_DOWN 1967 Large gtcggcgggacgctgatcgtgcggttcgaaactagtctggca del_DOWN_Rw tcgctgtcggaagtggcg Δ145kb_UP_Fw aatattcttaaggatccgcgcgcaagctttgactcgagcgaa Δ145kb_UP 2020 gacctgtcccgcgtatc Δ145kb_UP_Rw gctccgggcggaagagcacccacagcaggaaggtttaaaac ttcgaggccatcgtcacc Stich_delete_SpeI cacttccgacagcgatgccagactattcgaaccgcacgatca / / gcgtcccg cPCR_Δ145kb_Fw gacgacgcctcccgtccgcag Δ145kb genotype 2168 cPCR_Δ145kb_Rw gcgggttctgagccggcctg Table 4. Homology regions, used in creation of 145kb deletion and nearby targeting gRNA sequences Homology region Size (bp) Location in ATCC 109970 gRNA sequence (5-3) Δ145kb_UP 1942 8915913 - 8949972 CGTGTACACCAAGTTCGGCG Large del_DOWN 1925 8804637 - 8802713 GCCCCCGTCGAGATCCCCGT Example 6 - Design of the deletion experiment We had observed that relocation of the OTC BGC to a different chromosomal location can have a positive effect on OTC production (Pikl et al., 2021). This finding together with recent studies regarding conformational structure of Streptomyces genomes (Deng et al., 2023; Szafran et al., 2021) lead us to test whether changing the location of the OTC BGC relative to the end of the chromosome had a positive effect on OTC production. This was done by introducing a large (145kb) deletion in ATCC 10970. The 145kb deletion removed two BGCs (6 and 7) from the ATCC 10970 genome (Figure 1). BGC 6 encodes biosynthesis of rimocidin, a polyene macrolide metabolite with antifungal activity (DAVISSON et al., 1951), which is alongside the OTC BGC (Petković et al., 2006) a major metabolite in S. rimosus. BGC 6 contains 14 modules, making it one of the larges BGCs present in the genome of S. rimosus. Based on AntiSMASH analysis (Blin et al., 2021) BGC 7 encodes a NRPS gene cluster for a yet unknown secondary metabolite. Plasmid pRep_P1_cas9_Δ145kb was used to introduce deletions into the ATCC 10970 chromosome. The overall procedure for creating the deletions in S. rimosus using CRISPR-Cas9 had been optimized previously using the Cas9-SD-GusA tool (Pšeničnik et al., 2022). Example 7 - Deletion of 145kb region in S. rimosus ATCC 10970 (A) and S. rimosus ATCC 10970 ∆OTC strain (B) A) Deletion of 145kb region in S. rimosus ATCC 10970 strain Both CRISPR constructs carried 2 consecutive gRNA cassettes, targeting both the 5ʹ and 3ʹ ends of deleted regions, and near-by homology regions with size of approximately 2000bp. Exact coordinates of homology regions and used gRNA sequences are presented in Table 4. By conjugation (see Example 2 - Construction of engineered strain) we introduced pRep_P1_cas9_Δ145kb to S. rimosus ATCC 10970. No additional induction of theophylline inducible P1 promoter was necessary to achieve sufficient Cas9 expression in our system. Therefore, viable exconjugants could be characterised as mutants carrying 145kb deletion immediately after conjugation. Exconjugants were first cleared of pREP-CRISPR plasmid by sub-cultivation and only then assayed for the presence of correct deletion (see Example 3 - Confirmation of the correct deletion events by PCR and DNA sequencing and WGS of ATCC Δ145kb strain). This way we limited the exposure time of the S. rimosus genome to the active Cas9-gRNA complex, hence reducing the occurrence of non-specific mutations and strain adaptation. After introduction of the pRep_P1_cas9_Δ145kb plasmid and after subcultivation procedure was completed independent clones of ATCC 10970 ∆145kb were verified with PCR (Figure 2) and WGS (see Methods section - WGS of ATCC Δ145kb strain. B) Deletion of 145kb region in S. rimosus ATCC 10970 ∆OTC strain We introduced identical 145kb deletion in the genome of S. rimosus ATCC 10970 ∆OTC strain (Pikl et al., 2021). This is ATCC 19070 parent strain, which has almost entire otc BGC deleted and therefore does not produce oxytetracycline. After introduction of the pRep_P1_cas9_Δ145kb plasmid and after subcultivation procedure was completed independent clones of ATCC 10970 ∆OTC ∆145kb were verified with PCR (Figure 2). Example 8 - Comparative analysis of OTC production ATCC 10970 and ATCC Δ145kb The fermentations were conducted as described in the Methods section - Strains and growth conditions. OTC analysis was performed as described in the Example 4 - HPLC analysis of OTC production. The strain with 145kb deletion, designated ATCC Δ145kb, had a significant increase in OTC production of 2.9 g / L - a remarkable 7-fold increase compared to 0.452 g / L produced by its parent strain – ATCC 10970 (Figure 3). This is comparable with the titers of the industrial production strains derived by intensive strain selection. ATCC Δ145kb not only produced significantly larger amounts of OTC, but also initiated the biosynthesis of OTC much earlier than ATCC 10970 (Figure 4). Example 9 - Comparative bioinformatic analysis of BGC expression in ATCC 10970 and engineered strain ATCC Δ145kb The procedure of OTC fermentation and RNA isolation and formating is described in Method sections - Strains and growth conditions and Example 3 - Isolation of total mRNA; Formatting and analysis of RNA-seq data. Obtained RNA-seq data demonstrated clearly indicated that increases in OTC biosynthesis of the engineered strains is correlated with a significant increase in expression of otc biosynthetic genes (Figure 5). Even more, genes encoding OTC biosynthesis were the most overexpressed group of in the Δ145kb strain (Figs. 5 and 6), with average log2fold ratios of 4.7 (Table 5). Alongside BGC 9 (OTC BGC), a cryptic cluster annotated as BGC 22 way highly over-expressed (>32- fold change, Table 5, Figs.5 and 6) in the Δ145kb strain. Upon more detailed analysis, we propose that BGC 22 (Slemc et al., 2022) region consist of two separate BGCs each with its own NRPS and accessory genes. The first part (BGC 22_1) encodes a cyclic hexapeptide longicatenamycin B, recently discovered in S. rimosus by Li et al. (2022). And the second part (BGC 22_2) encodes a yet unknown NRPS metabolite. Importantly, BGC 22_1 encoding longicatenamycin congeners has been considered cryptic in S. rimosus, and until now its activation could only be detected when using high-throughput elicitor screening (HiTES)(Li et al., 2022). Similarly, Longicatenamides A-D could be detected in Streptomyces cultures only when using a co-cultivation approach (Jiang et al., 2021). Our results therefore indicate that 145kb deletion and other large deletions can be used to induce expression of cryptic clusters. Also, it is important to emphasize that the expression of other BGCs, of which many are un-characterised, was also significantly affected in ATCC Δ145kb strain (see Table 5).

[0005] Table 5. Significantly affected* BGCs after genome reductions in S. rimosus ATCC Δ145kb. Average log2ratio - fold change of expression at 24h time point. * BGCs with an average gene log2 fold change of >1 or <-1 in was considered significantly affected. Significantly affected Metabolite Fold change-log2ratio (ATCC BGC Δ145kb vs ATCC 19070) BGC 22_1 longicatenamycin B 5,36 BGC 22_2 unknown 5,15 BGC 9 - OTC oxytetracycline 4,7 BGC 45 momomycin 1,73 BGC 23 tyrobetaine-2 1,74 BGC 46 unknown -1,97 BGC 5 unknown -2,33 BGC 41 unknown -4,09 Example 10 - Comparative analysis of metabolite profiles of S. rimosus ATCC 10970 and ATCC Δ145kb by applying MS analysis Full-scan MS analysis of the S. rimosus ATCC strains was done to assess the impact of genetic modification on production profile. Evident are peaks on Figure 7 peaks belonging to oxytetracycline (OTC; 461,7 [M+H]+obs / 460,4340 [M]) (OTC on Figure 7) and rimocidins in S. rimosus ATCC 19070 (RIM on Figure 7). On full-scan LC-MS chromatograms (Figure 8) we could distinguish between production of 5 rimocidin congeners in the ATCC 10970 strain background. Additionally, in the next step, using high-resolution mass spectrometry (HR-MS) we confirmed production of rimocidin, CE-108, rimocidin (27-etyl), CE-108B and rimocidin B in the ATCC 10970 background (HR-MS data - Table 7). As expected, no rimocidin congeners could be detected in ATCC Δ145kb (Figs. 7 and 8). Comparable to the HPLC results (Figure 3), differences in titre of OTC between ATCC 10970 and engineered strains Δ145kb and Δ240kb can clearly be observed also on full-scan-LC-MS spectrum (Figs.7 and 8). The absence of the OTC BGC accompanied with deletion of 145kb region in ATCC 10970 ΔOTC Δ145kb strain resulted in a clean background; the metabolic profile contained virtually no major metabolites. In addition to OTC and rimocidin congeners, we also identified metabolites related to cryptic BGCs which were noticed through transcriptomics analysis (Table 5). Accordingly, full-scan LC-MS analysis of ATCC Δ145kb sample revealed three newly emerged peaks when metabolites were extracted using 4 volumes of acetonitrile (ACN) ([M+H]+obs 387,7; 764,9 and 778,9 (peaks 1, 2 and 3 on Figure 7; see also Table 6). An observed peak No.1 was predicted to be tyrobetaine-2, a member of the tyrobetaines, a class of nonribosomal peptides with an unusual trimethylammonium tyrosine residue (Parkinson et al., 2018). Interestingly, the tyrobetaine BGC (BGC 23) was significantly overexpressed in Δ145kb strain (Figure 5; Table 5), which is consistent with LC-MS results (Figure 9 B). Peak No.2 was identified as a product of BGC 22_1, longycatenamycin B (Li et al., 2022) (HR-MS - [M+H]+obs 763.3546, [M+H]+cal 763.3546). Also, the HR-MS results (Table 7) indicated that peak No.3 is in fact another member of the longicatenamycin (S-520 antibiotic) family, synthesized by the same NRPS as longicatenamycin B (BGC No.22_1), with an additional methyl group (D-Val - >Ile) ([M + H]+obs777.3699, [M + H]+ cal777.3702). This longycatenamycin congener was detected before by von Nussbaum et al. (2008) (von Nussbaum et al., 2008) and possibly by Shoji & Sakazaki (1970), but only as a component of a complex mixture of congeners and without a specific name. We therefore designated this congener as longicatenamycin C (Table 7). Table 6. Compounds identified by HR-MS analysis Compound [M + H]+Experimental Calculated Difference [ppm] [Da] [Da] rimocidins rimocidin C39H62NO14 768.4170 768.4170 0 rimocidin B C39H62N2O13 767.4331 767.4330 0.1 CE-108 C37H58NO14 740.3844 740.3857 -1.8 CE-108 B C37H59N2O13 739.4037 739.4017 2.0 rimocidin (27-etil) C38H60NO14 754.4014 754.4014 0 longicatenamycins longicatenamycin B C35H52ClN8O9 763.3546 763.3546 0 longicatenamycin C C36H54ClN8O9777.3699 777.3702 -0.4 (D-Val ->Ile) Example 11. Materials and Methods Table 7. Strains used in this example. Name Description Reference E. coli DH10B Escherichia coli for cloning procedures Grant et al., 1990 E. coli ET12567 / pUB307 Escherichia coli for conjugal transfer Flett et al., 1997 Streptomyces rimosus ATTC 10970 ATCC strain NCBI: txid1265868 Streptomyces rimosus ATTC 10970 Deletion of otc gene cluster - otc Pikl et al., 2021 Δotc mutant Streptomyces rimosus ATTC otc mutant, deletion of 145kb Pšeničnik et al. 10970 Δotc Δ145kb Table 8. Plasmids used in this example. Name Description Reference pYAC-ΦC31-Ts-OTC Integrative plasmid with entire OTC Pikl et al., 2021 gene cluster and ΦC31 integrase pYAC-ΦC31-Ts-DMTC Integrative plasmid with entire DMTC This work gene cluster and ΦC31 integrase pYAC-ΦC31-Ts-DMCTC Integrative plasmid with entire This work DMCTC gene cluster and ΦC31 integrase pYAC-ΦC31-Ts-CTC Integrative plasmid with entire CTC This work gene cluster and ΦC31 integrase Strains and plasmids Escherichia coli DH10β was used for standard cloning procedures. E. coli ET12567 / pUB307 was used for conjugative transfer of plasmids between the E. coli and S. rimosus strains. Strains and plasmids used in this example are listed in Tables 7 and 8. Construction of engineered strains Entire OTC, DMTC, DMCTC and CTC cluster was cloned on shuttle vector pYAC-ΦC31-Ts. The plasmid constructs were initially introduced into the E. coli strain ET-pUB307, which facilitated the transfer of the pYAC plasmid constructs to S. rimosus ATTC 10970 Δotc and S. rimosus ATTC 10970 Δotc Δ145kb. Following the conjugation procedure E. coli ET-pUB307 carrying the plasmids pYAC- ΦC31-Ts was mixed with S. rimosus spores and plated on MS agar plates supplemented with 30 mM MgCl₂ and 30 mM CaCl₂. After 5 hours the plates were overlayed with sterile water supplemented with nalidixic acid and thiostrepton. After 7 days exconjugates were transferred to MS plates supplemented with nalidixic acid and thiostrepton. Media and culture conditions E. coli DH10β was cultured in 2TY medium with ampicillin (100 μg / ml) at 28°C. E. coli ET12567 / pUB307 was used for conjugation and cultured in 2TY medium with ampicillin (100 μg / ml) and kanamycin (50 μg / ml) at 28°C. For sporulation of S. rimosus strains soy-mannitol (MS) agar was used. For selection of exconjugants MS agar was supplemented with thiostrepton (30ug / ml). For OTC, DMTC, DMCTC and CTC production an agar plug of confluent grown culture was inoculated into GOTC-V seed medium (Pikl et al., 2021) and incubated at 28°C for 28 hours at 220 rpm, in a rotary shaker. Then, 10 % (v / v) of seed cultures were used to inoculate GOTC production medium. Strains were incubated in production media for 5 days at 28°C, 220 rpm and 60% humidity. HPLC analysis of OTC, dmTC, dmCTC and CTC production To quantify the titers of OTC, dmTC, dmCTC and CTC from the S. rimosus engineered strains, 1 mL of fermentation broth was adjusted to a pH of 1.5 using 37% HCl, followed by centrifugation at 13,000 rpm for 10 minutes. The resulting supernatants were then analyzed using HPLC (UltiMate 3000 HPLC system) equipped with a C-18 column (150 × 4.6 mm; 5 μm; maintained at 40 °C; Macherey-Nagel), utilizing UV absorption detection at 270 nm and a flow rate of 0.3 mL / min. The elution solvents consisted of water with 0.1% formic acid (solvent A) and acetonitrile (solvent B). The 30-minute gradient elution was programmed as follows: from 0 to 20 minutes, 5% to 25% B; from 20 to 21 minutes, 25% to 90% B; from 21 to 25 minutes, 90% B; from 25 to 26 minutes, 90% to 5% B; and from 26 to 30 minutes, 5% B. The titers were calculated as the average titers from three parallel samples of each transformant and the parental strain. LC-MS / MS analysis of dmTC, dmCTC and CTC production DmTC, dmCTC and CTC metabolites were further analysed using LC-MS / MS. Tetracyclines were separated on an UltiMate 3000 UHPLC system (Thermo Scientific, USA) with a Kinetex reverse- phase column (XB-C18100 A, 100 × 2.1 mm, particle size: 2.6 µm, Phenomenex, USA). A gradient method with mobile phase A (milli-Q water with added 0.1% formic acid) and B (acetonitrile with added 0.1% formic acid) at 30 °C and a flow rate of 0.3 mL / minute was employed. The gradient conditions were: 0 min – 5% B, 0-15 min – 5-45% B, 15.5 min – 45-90% B, 18 min – 90% B, 18.1 min – 90-5% B, 23 min - 5% B. The UPLC system is coupled with the MS apparatus 4000 QTRAP LC- MS / MS System (Applied Biosystems / MDS Sciex, Canada). Results In the following tables the results from the experiments are given for : - The titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced dmTC cluster (Table 9). - Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced dmCTC cluster (Table 10). - Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced CTC cluster (Table 11). Table 9. Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced dmTC cluster. Strain dmTC mg / L Average St dev ATCC ΔOTC + dmTC 29,8 ATCC ΔOTC + dmTC 10,3 17,17 10,95 ATCC ΔOTC + dmTC 11,4 ATCC ΔOTC + dmTC 24,2 ATCC ΔOTC + dmTC 36 25,40 10,05 ATCC ΔOTC + dmTC 16 ATCC ΔOTC + dmTC 31,7 ATCC ΔOTC + dmTC 26,8 31,97 5,31 ATCC ΔOTC + dmTC 37,4 ATCC ΔOTC Δ145 + dmTC 42,5 ATCC ΔOTC Δ145 + dmTC 50,2 46,20 3,86 ATCC ΔOTC Δ145 + dmTC 45,9 ATCC ΔOTC Δ145 + dmTC 30,7 ATCC ΔOTC Δ145 + dmTC 41,7 40,10 8,71 ATCC ΔOTC Δ145 + dmTC 47,9 ATCC ΔOTC Δ145 + dmTC 40,2 ATCC ΔOTC Δ145 + dmTC 46,8 40,07 6,80 ATCC ΔOTC Δ145 + dmTC 33,2 OTC mg / L Average St dev ATCC 1 158,51 ATCC 2 310,97 ATCC 3 198,66 224,4758,75ATCC 4 277,09 ATCC 5 179,93 ATCC 6 221,67 Table 10. Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced dmCTC cluster. Strain dmCTC mg / L Average St dev ATCC ΔOTC + dmCTC 76,6 ATCC ΔOTC + dmCTC 74,2 81,87 11,26 ATCC ΔOTC + dmCTC 94,8 ATCC ΔOTC + dmCTC 84,4 ATCC ΔOTC + dmCTC 99,2 90,60 7,69 ATCC ΔOTC + dmCTC 88,2 ATCC ΔOTC + dmCTC 81,4 ATCC ΔOTC + dmCTC 56,4 76,27 17,86 ATCC ΔOTC + dmCTC 91 ATCC ΔOTC Δ145 + dmCTC 169,4 ATCC ΔOTC Δ145 + dmCTC 139,2 159,93 17,98 ATCC ΔOTC Δ145 + dmCTC 171,2 ATCC ΔOTC Δ145 + dmCTC 153,4 ATCC ΔOTC Δ145 + dmCTC 172,2 159,87 10,69 ATCC ΔOTC Δ145 + dmCTC 154 ATCC ΔOTC Δ145 + dmCTC 168,4 ATCC ΔOTC Δ145 + dmCTC 78,4 137,93 51,56 ATCC ΔOTC Δ145 + dmCTC 167 OTC mg / L Average St devATCC 1385,53ATCC 2 377,94ATCC 3275,09 352,62 55,79ATCC 4373,07ATCC 5291,17ATCC 6412,90

[0006] Table 11. Titer of S. rimosus ATCC ΔOTC and S. rimosus ATCC ΔOTC Δ145 strains with introduced CTC cluster. Strain CTC mg / L Average St dev ATCC ΔOTC + CTC 94,4 ATCC ΔOTC + CTC 92 98,60 9,43 ATCC ΔOTC + CTC 109,4 ATCC ΔOTC + CTC 91,6 ATCC ΔOTC + CTC 69,6 86,47 14,98 ATCC ΔOTC + CTC 98,2 ATCC ΔOTC + CTC 100,8 ATCC ΔOTC + CTC 114,6 100,27 14,61 ATCC ΔOTC + CTC 85,4 ATCC ΔOTC Δ145 + CTC 162,2 ATCC ΔOTC Δ145 + CTC 132,2 148,40 15,14 ATCC ΔOTC Δ145 + CTC 150,8 ATCC ΔOTC Δ145 + CTC 204 ATCC ΔOTC Δ145 + CTC 156,2 172,87 26,98 ATCC ΔOTC Δ145 + CTC 158,4 ATCC ΔOTC Δ145 + CTC 126,2 ATCC ΔOTC Δ145 + CTC 125,2 140,20 25,12 ATCC ΔOTC Δ145 + CTC 169,2 OTC mg / L Average St dev ATCC 1260,19ATCC 2262,00ATCC 3342,92 275,22 33,54 ATCC 4 254,58 ATCC 5261,56ATCC 6270,08The Figures 9-12 depicts the results obtained from the experiments. Conclusion : To summarize the experiments in short points: 1. Native OTC cluster is located around 600kb away from one end of the chromosome, and we have deleted 145kb fragment from OTC cluster towards the end of the chromosome. That makes huge increase in transcription of native OTC cluster and very high titer increase. 2. If now adding an additional copy of OTC cluster, the way that this additional copy of OTC cluster is integrated more in the middle of the chromosome by applying plasmid containing phiC integrase, a further increase the titer of OTC is obtained. 3. Importantly, the vector carrying OTC cluster has phage integrase, which precisely integrate vector in the same specific location on the chromosome, the so-called attachment site. This att site is located more in the middle of chromosome. Anything that is cloned in this vector gets integrated in that site in a reproducible manner. 4. A S. rimosus strain which has only OTC gene cluster deleted (and does not comprise the 145kb deletion) does not produce OTC. Introducing OTC cluster in other position of the chromosome, then OTC production capability is naturally returned. In this case, OTC cluster is “re- located” to a new position in the middle of chromosome. Such translocated strains produce 3-4 times more, around 1 g / L. 5. Now, introducing the deletion of 145kb to the strain, which already comprises OTC deletion (being a delta OTC - delta 145), then this further enhances the titer of OTC. So, a) native strain makes 2-300 mg / L, b) translocated strain (with one OTC copy in the internal part of the chromosome) can reach around 1 g / L, and c) strain containing only 145kb deletion (still maintains native OTC cluster, which is located around 600kb from the end of chromosome), and now an additional copy of OTC cluster is integrated in the middle of chromosome, then titer reaches up to 2 g / L, i.e.100% more. So here, we have a “dual effect”, translocation + 145kb deletion. So, it is synergistic. 6. Performing exactly the same experiment as described under the point 5 : Having a S. rimosus strain which has OTC deleted and 145kb deletion, i.e. S. rimosus delta OTC - delta 145 which does not make any OTC. Also, using S. rimosus strain which contains only OTC deletion (but not 145kb deletion), i.e. strain S. rimosus delta OTC, which also does not do not produce OTC. Performing the 145kb deletion to positively affect the production of a heterologous gene cluster (like the one in above Examples for production of desmethy-tetracycline (dmTC), desmethyl- chlortetracycline (dmCTC) and chlortetracycline (CTC)), actually works. Clear increase in titer of all the compounds with strains containing 145kb deletion, which have heterologous gene cluster integrated into att site towards the middle of chromosome. So, the same situation such as in case of OTC. Only titers are lower, which is as expected because of working with heterologous clusters, which come from very distant actinomycete Kitasatospora aureofaciens, which do not belong to Streptomyces species.

[0007] List of references: Ara, K., Ozaki, K., Nakamura, K., Yamane, K., Sekiguchi, J., & Ogasawara, N. (2007). Bacillus minimum genome factory: effective utilization of microbial genome information. Biotechnology and Applied Biochemistry, 46(Pt 3), 169–178. https: / / doi.org / 10.1042 / BA20060111 Beites, T., & Mendes, M. V. (2015). Chassis optimization as a cornerstone for the application of synthetic biology based strategies in microbial secondary metabolism. Frontiers in Microbiology, 6, 906. https: / / doi.org / 10.3389 / fmicb.2015.00906 Blin, K., Shaw, S., Kloosterman, A. M., Charlop-Powers, Z., van Wezel, G. P., Medema, M. H., & Weber, T. (2021). antiSMASH 6.0: improving cluster detection and comparison capabilities. Nucleic Acids Research, 49(W1), W29–W35. https: / / doi.org / 10.1093 / nar / gkab335 Bu, Q. T., Yu, P., Wang, J., Li, Z. Y., Chen, X. A., Mao, X. M., & Li, Y. Q. (2019). Rational construction of genome-reduced and high-efficient industrial Streptomyces chassis based on multiple comparative genomic approaches. Microbial Cell Factories, 18(1), 1–17. https: / / doi.org / 10.1186 / s12934-019-1055-7 Chen, Y., Smanski, M. J., & Shen, B. (2010). Improvement of secondary metabolite production in Streptomyces by manipulating pathway regulation. Applied Microbiology and Biotechnology, 86(1), 19–25. https: / / doi.org / 10.1007 / s00253-009-2428-3 Choe, D., Cho, S., Kim, S. C., & Cho, B.-K. (2016). Minimal genome: Worthwhile or worthless efforts toward being smaller? Biotechnology Journal, 11(2), 199–211. https: / / doi.org / 10.1002 / biot.201400838 DAVISSON, J. W., TANNER, F. W. J., FINLAY, A. C., & SOLOMONS, I. A. (1951). Rimocidin, a new antibiotic. Antibiotics & Chemotherapy (Northfield, Ill.), 1(5), 289–290. Deng, L., Zhao, Z., Liu, L., Zhong, Z., Xie, W., Zhou, F., Xu, W., Zhang, Y., Deng, Z., & Sun, Y. (2023). Dissection of 3D chromosome organization in Streptomyces coelicolor A3(2) leads to biosynthetic gene cluster overexpression. Proceedings of the National Academy of Sciences of the United States of America, 120(11), e2222045120. https: / / doi.org / 10.1073 / pnas.2222045120 Doench, J. G., Hartenian, E., Graham, D. B., Tothova, Z., Hegde, M., Smith, I., Sullender, M., Ebert, B. L., Xavier, R. J., & Root, D. E. (2014). Rational design of highly active sgRNAs for CRISPR- Cas9-mediated gene inactivation. Nature Biotechnology, 32(12), 1262–1267. https: / / doi.org / 10.1038 / nbt.3026 Flett, F., Mersinias, V., & Smith, C. P. (1997). High efficiency intergeneric conjugal transfer of plasmid DNA from. FEMS Microbiology Letters, 155, 223–229. Gomez-Escribano, J. P., & Bibb, M. J. (2011). Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. Microbial Biotechnology, 4(2), 207–215. https: / / doi.org / 10.1111 / j.1751-7915.2010.00219.x Grant, S. G., Jessee, J., Bloom, F. R., & Hanahan, D. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proceedings of the National Academy of Sciences of the United States of America, 87(12), 4645–4649. https: / / doi.org / 10.1073 / pnas.87.12.4645 Jiang, Y., Matsumoto, T., Kuranaga, T., Lu, S., Wang, W., Onaka, H., & Kakeya, H. (2021). Longicatenamides A-D, Two Diastereomeric Pairs of Cyclic Hexapeptides Produced by Combined-culture of Streptomyces sp. KUSC_F05 and Tsukamurella pulmonis TP-B0596. The Journal of Antibiotics, 74(5), 307–316. https: / / doi.org / 10.1038 / s41429-020-00400-3 Komatsu, M., Uchiyama, T., Omura, S., Cane, D. E., & Ikeda, H. (2010). Genome-minimized Streptomyces host for the heterologous expression of secondary metabolism. Proceedings of the National Academy of Sciences of the United States of America, 107(6), 2646–2651. https: / / doi.org / 10.1073 / pnas.0914833107 Li, Y., Lee, S. R., Han, E. J., & Seyedsayamdost, M. R. (2022). Momomycin, an Antiproliferative Cryptic Metabolite from the Oxytetracycline Producer Streptomyces rimosus. Angewandte Chemie International Edition, 61(39), e202208573. https: / / doi.org / https: / / doi.org / 10.1002 / anie.202208573 Liao, Z., Zhang, J., Shi, Y., Zhang, Y., Ma, Z., Bechthold, A., & Yu, X. (2022). Improvement of Rimocidin Biosynthesis by Increasing Supply of Precursor Malonyl-CoA via Over-expression of Acetyl-CoA Carboxylase in Streptomyces rimosus M527. Current Microbiology, 79(6), 174. https: / / doi.org / 10.1007 / s00284-022-02867-9 Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550. https: / / doi.org / 10.1186 / s13059-014-0550-8 Mrak, P., Krastel, P., Pivk Lukančič, P., Tao, J., Pistorius, D., & Moore, C. M. (2018). Discovery of the actinoplanic acid pathway in Streptomyces rapamycinicus reveals a genetically conserved synergism with rapamycin. The Journal of Biological Chemistry, 293(52), 19982– 19995. https: / / doi.org / 10.1074 / jbc.RA118.005314 Myronovskyi, M., & Luzhetskyy, A. (2016). Native and engineered promoters in natural product discovery. Natural Product Reports, 33(8), 1006–1019. https: / / doi.org / 10.1039 / C6NP00002A Myronovskyi, M., Rosenkränzer, B., Nadmid, S., Pujic, P., Normand, P., & Luzhetskyy, A. (2018). Generation of a cluster-free Streptomyces albus chassis strains for improved heterologous expression of secondary metabolite clusters. Metabolic Engineering, 49, 316–324. https: / / doi.org / 10.1016 / j.ymben.2018.09.004 Parkinson, E. I., Tryon, J. H., Goering, A. W., Ju, K.-S., McClure, R. A., Kemball, J. D., Zhukovsky, S., Labeda, D. P., Thomson, R. J., Kelleher, N. L., & Metcalf, W. W. (2018). Discovery of the Tyrobetaine Natural Products and Their Biosynthetic Gene Cluster via Metabologenomics. ACS Chemical Biology, 13(4), 1029–1037. https: / / doi.org / 10.1021 / acschembio.7b01089 Petković, H., Cullum, J., Hranueli, D., Hunter, I. S., Perić-Concha, N., Pigac, J., Thamchaipenet, A., Vujaklija, D., & Long, P. F. (2006). Genetics of Streptomyces rimosus, the oxytetracycline producer. Microbiology and Molecular Biology Reviews^: MMBR, 70(3), 704–728. https: / / doi.org / 10.1128 / MMBR.00004-06 Pikl, Š., Carrillo Rincón, A. F., Slemc, L., Goranovič, D., Avbelj, M., Gjuračić, K., Sucipto, H., Stare, K., Baebler, Š., Šala, M., Guo, M., Luzhetskyy, A., Petković, H., & Magdevska, V. (2021). Multiple copies of the oxytetracycline gene cluster in selected Streptomyces rimosus strains can provide significantly increased titers. Microbial Cell Factories, 20(1), 47. https: / / doi.org / 10.1186 / s12934-021-01522-5 Pšeničnik, A., Reberšek, R., Slemc, L., Godec, T., Kranjc, L., & Petković, H. (2022). Simple and reliable in situ CRISPR-Cas9 nuclease visualization tool is ensuring efficient editing in Streptomyces species. Journal of Microbiological Methods, 200, 106545. https: / / doi.org / 10.1016 / j.mimet.2022.106545 Pšeničnik, A. et al. Oxytetracycline hyper-production through targeted genome reduction of Streptomyces rimosus. mSystems, 16;9 (5):e0025024. Reuß, D. R., Altenbuchner, J., Mäder, U., Rath, H., Ischebeck, T., Sappa, P. K., Thürmer, A., Guérin, C., Nicolas, P., Steil, L., Zhu, B., Feussner, I., Klumpp, S., Daniel, R., Commichau, F. M., Völker, U., & Stülke, J. (2017). Large-scale reduction of the Bacillus subtilis genome: consequences for the transcriptional network, resource allocation, and metabolism. Genome Research, 27(2), 289–299. https: / / doi.org / 10.1101 / gr.215293.116 Reuß, D. R., Commichau, F. M., Gundlach, J., Zhu, B., & Stülke, J. (2016). The Blueprint of a Minimal Cell: MiniBacillus. Microbiology and Molecular Biology Reviews^: MMBR, 80(4), 955– 987. https: / / doi.org / 10.1128 / MMBR.00029-16 Sanchez-Garcia, L., Martín, L., Mangues, R., Ferrer-Miralles, N., Vázquez, E., & Villaverde, A. (2016). Recombinant pharmaceuticals from microbial cells: a 2015 update. Microbial Cell Factories, 15(1), 33. https: / / doi.org / 10.1186 / s12934-016-0437-3 Sauer, B. (1987). Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae. Molecular and Cellular Biology, 7(6), 2087–2096. https: / / doi.org / 10.1128 / mcb.7.6.2087-2096.1987 Schlake, T., & Bode, J. (1994). Use of Mutated FLP Recognition Target (FRT) Sites for the Exchange of Expression Cassettes at Defined Chromosomal Loci. Biochemistry, 33(43), 12746–12751. https: / / doi.org / 10.1021 / bi00209a003 Schmid, R., Heuckeroth, S., Korf, A., Smirnov, A., Myers, O., Dyrlund, T. S., Bushuiev, R., Murray, K. J., Hoffmann, N., Lu, M., Sarvepalli, A., Zhang, Z., Fleischauer, M., Dührkop, K., Wesner, M., Hoogstra, S. J., Rudt, E., Mokshyna, O., Brungs, C., … Pluskal, T. (2023). Integrative analysis of multimodal mass spectrometry data in MZmine 3. Nature Biotechnology, 41(4), 447–449. https: / / doi.org / 10.1038 / s41587-023-01690-2 Shen, X., Wang, Z., Huang, X., Hu, H., Wang, W., & Zhang, X. (2017). Developing genome-reduced Pseudomonas chlororaphis strains for the production of secondary metabolites. BMC Genomics, 18(1), 715. https: / / doi.org / 10.1186 / s12864-017-4127-2 Shoji, J., & Sakazaki, R. (1970). A new peptide antibiotic complex S-520. II. Further characterization and degradative studies. The Journal of Antibiotics, 23(9), 432–436. https: / / doi.org / 10.7164 / antibiotics.23.432 Slemc, L., Jakše, J., Filisetti, A., Baranasic, D., Rodríguez-García, A., Del Carratore, F., Marino, S. M., Zucko, J., Starcevic, A., Šala, M., Pérez-Bonilla, M., Sánchez-Hidalgo, M., González, I., Reyes, F., Genilloud, O., Springthorpe, V., Goranovič, D., Kosec, G., Thomas, G. H., … Tome, M. (2022). Reference-Grade Genome and Large Linear Plasmid of Streptomyces rimosus: Pushing the Limits of Nanopore Sequencing. Microbiology Spectrum, 10(2), e0243421. https: / / doi.org / 10.1128 / spectrum.02434-21 Szafran, M. J., Małecki, T., Strzałka, A., Pawlikiewicz, K., Duława, J., Zarek, A., Kois-Ostrowska, A., Findlay, K. C., Le, T. B. K., & Jakimowicz, D. (2021). Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic development. Nature Communications, 12(1), 5222. https: / / doi.org / 10.1038 / s41467-021-25461-2 Vernyik, V., Karcagi, I., Tímár, E., Nagy, I., Györkei, Á., Papp, B., Györfy, Z., & Pósfai, G. (2020). Exploring the fitness benefits of genome reduction in Escherichia coli by a selection-driven approach. Scientific Reports, 10(1), 7345. https: / / doi.org / 10.1038 / s41598-020-64074-5 von Nussbaum, F., Anlauf, S., Freiberg, C., Benet-Buchholz, J., Schamberger, J., Henkel, T., Schiffer, G., & Häbich, D. (2008). Total synthesis and initial structure-activity relationships of longicatenamycin A. ChemMedChem, 3(4), 619–626. https: / / doi.org / 10.1002 / cmdc.200700297 Westers, H., Dorenbos, R., van Dijl, J. M., Kabel, J., Flanagan, T., Devine, K. M., Jude, F., Seror, S. J., Beekman, A. C., Darmon, E., Eschevins, C., de Jong, A., Bron, S., Kuipers, O. P., Albertini, A. M., Antelmann, H., Hecker, M., Zamboni, N., Sauer, U., … Quax, W. J. (2003). Genome engineering reveals large dispensable regions in Bacillus subtilis. Molecular Biology and Evolution, 20(12), 2076–2090. https: / / doi.org / 10.1093 / molbev / msg219 Xia, H., Li, X., Li, Z., Zhan, X., Mao, X., & Li, Y. (2020). The Application of Regulatory Cascades in Streptomyces: Yield Enhancement and Metabolite Mining. Frontiers in Microbiology, 11, 406. https: / / doi.org / 10.3389 / fmicb.2020.00406 Zhang, Y., Werling, U., & Edelmann, W. (2012). SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Research, 40(8), e55. https: / / doi.org / 10.1093 / nar / gkr1288 Zhou, M., Jing, X., Xie, P., Chen, W., Wang, T., Xia, H., & Qin, Z. (2012). Sequential deletion of all the polyketide synthase and nonribosomal peptide synthetase biosynthetic gene clusters and a 900-kb subtelomeric sequence of the linear chromosome of Streptomyces coelicolor. In FEMS microbiology letters (Vol.333, Issue 2, pp.169–179). https: / / doi.org / 10.1111 / j.1574-6968.2012.02609.x

Claims

Claims 1. An engineered microorganism for the production of a primary or secondary metabolite of interest (MOI) wherein said microorganism comprises at least one deletion of a DNA fragment in the vicinity of the genes encoding the metabolic pathway for synthesis of said MOI as compared to a reference strain which has no such deletion, and wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI.

2. An engineered microorganism for the production of a primary or secondary metabolite of interest (MOI) wherein said microorganism comprises the genes encoding the metabolic pathway for synthesis of said MOI having at least one deletion of a DNA fragment in the vicinity of the genes encoding the metabolic pathway for the synthesis of said MOI as compared to a wild type microorganism encoding the same metabolic pathway, and wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI.

3. The engineered microorganism according to claim 1 or 2, wherein said deletion does not inactivate the expression of any genes part of the core genome.

4. The engineered microorganism according to any one of the preceding claims, wherein the metabolic pathway for the synthesis of said MOI is an operon.

5. The engineered microorganism according to any one of the preceding claims, wherein the metabolic pathway for the synthesis of said MOI is a biosynthesis gene cluster that comprises at least one gene encoding at least one enzyme necessary for the synthesis of said MOI.

6. The engineered microorganism according to any one of the preceding claims, wherein said at least one deletion is a deletion of a single DNA fragment.

7. The engineered microorganism according to any one of the preceding claims, wherein said microorganism has a linear chromosome.

8. The engineered microorganism according to claim 7, wherein said deletion of a DNA fragment is towards the upstream end of the chromosome.

9. The engineered microorganism according to claim 7 or 8, wherein said deletion of a DNA fragment comprises the deletion of the Δ-145kbp DNA fragment located betweenbases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2).

10. The engineered microorganism according to claim 7 or 8, wherein said deletion of a DNA fragment is the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2).

11. The engineered microorganism according to any one of claims 1-6, wherein said microorganism has a circular chromosome.

12. The engineered microorganism according to claim 11, wherein said deleted DNA fragment was placed towards the core region containing the origin of replication.

13. The engineered microorganism according to any one of the preceding claims, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 500 Kbp away from the metabolic pathway for synthesis of said MOI.

14. The engineered microorganism according to any one of the preceding claims, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 50 Kbp away from the metabolic pathway for synthesis of said MOI.

15. The engineered microorganism according to any one of the preceding claims, wherein said deletion encompasses a maximum deletion size of 500 Kbp, a maximum deletion size of 250 Kbp or a maximum deletion size of 150 Kbp.

16. The engineered microorganism according to any one of the preceding claims, wherein said deletion is at least 5 Kbp in size.

17. The engineered microorganism according to any one of the preceding claims, wherein said deletion comprise from 5 Kbp to 500 Kbp, from 5 Kbp to 250 KBP, from 5 Kbp to 100 Kbp or from 5 Kbp to 70 Kbp.

18. The engineered microorganism according to any one of the preceding claims, wherein the MOI is oxytetracycline.

19. The engineered microorganism according to any one of the preceding claims, wherein the MOI is longicatenamycin B or longicatenamycin C.

20. The engineered microorganism according to any one of claims 1-17, which is selected from the group consisting of secondary metabolites, actinomycin, avermectin, bleomycin, candicidin, cephamycin, cyclosporin, clavulanic acid, daptomycin, daunorubicin, doxorubicin, erythtomycin, tylosin, milbemycin, FK506, FK520, rapamycin, fosfomycin, streptomycin, gentamycin, kanamycin, apramycin, neomycin, tobramycin, cycloserine, chloramphenicol, Mitomycin, natamycin, novobiocin, penicillin, lovastatin, nystatin, amphotericin, phleomycin, polymyxin, bacitracin, pristinamycin, rifamycin, salinomycin, monensin, spinosyn, spiramycin, streptogramins, tetracycline, mycophenolic acid, cephalosporin, epothilone, lincomycin, fidaxomicin, fusaric acid, paromomycin, spectinomycin, mupirocin, lipstatin, vancomycin, primary metabolites, thiamine, riboflavin, folic acid, pantothenic acid, biotin, vitamin b12, beta-carotene (pro-vitamin A), ergosterol, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA).

21. The engineered microorganism according to any one of the preceding claims, wherein the metabolic pathway for synthesis of said MOI is a naturally occurring pathway.

22. The engineered microorganism according to any one of the preceding claims, wherein the MOI is naturally being produced by the microorganism.

23. The engineered microorganism according to any one of claims 1-21, wherein the metabolic pathway for synthesis of said MOI is not naturally occurring in said mircroorganism.

24. The engineered microorganism according to any one of the preceding claims, wherein the microorganism is an eukaryote such as fungi, wherein the microorganism is selected, but not limited to the group consisting of yeast and filamentous fungi such as Saccharomyces sp, Pichia sp., Komagataella sp., Kluyveromyces sp, Yarrowia sp, Aspergillus sp., Penicillium sp., Monascus sp. and Trichoderma 25. The engineered microorganism according to any one of claims 1-23, wherein the microorganism is a prokaryote.

26. The engineered microorganism according to any one of the preceding claims, wherein the microorganism is selected from the group consisting of an actinobacteria such as Streptomyces, Corynebacterium sp., Propionibacterium sp., Saccharopolyspora sp., Amycolatopsis sp., myxobacteria, cyanobacteria, Bacillus sp., Saccharomyces sp., Pseudomonas sp and Escherichia coli.

27. The engineered microorganism according to any one of the preceding claims, wherein the microorganism is selected from the group consisting of Streptomyces rimosus, Streptomyces hygroscopicus, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Streptomyces rapamycinicus, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Streptomyces albus, Micromonospora sp., Micromonospora griseorubida, Amycolatopsis mediterranei, Actinoplanes sp., Streptomyces lasaliensis, Actinosynnema pretiosum, Streptomyces bikiniensis, Streptomyces graminofaciens, Streptomyces sp., Streptomyces virginiae , Sorangium cellulosum, Micromonospora megalomicea, Streptomyces halstedii, Streptomyces spiroverticillatus, Streptomyces aureofaciens, Streptomyces hygroscopicus, Streptomyces geldanamycininus, Streptomyces sahachiroi, Xanthomonas albilineans, Amycolatopsis balhimycina, Streptomyces verticillus, Acinetobacter baumannii, Bacillus amyloliquefaciens, Bacillus licheniformis, Streptomyces lohii, Streptomyces nanchangensis, Streptomyces caelestis, Streptomyces violaceusniger, Streptomyces noursei, Streptomyces sp. HK803, Streptomyces piomogenus, Streptomyces venezuelae, Streptomyces natalensis, Streptomyces platensis, Pseudomonas fluorescens, Streptomyces sp. SN-593, Amycolatopsis mediterranei, Streptomyces achromogenes, Streptomyces albus, Streptomyces spiroverticillatus, Streptomyces griseus, Streptomyces ambofaciens, Saccharopolyspora spinosa, Streptomyces flaveolus, Nocardiopsis sp. FU40, Streptomyces violaceoruber,, Streptomyces bottropensis , Streptomyces sp. CS40, Streptomyces lavendulae, Streptomyces triostinicus, Bacillus amyloliquefaciens , Actinomadura kijaniata, Streptomyces rochei, Bacillus amyloliquefaciens, Pseudomonas fluorescens, Micromonospora griseorubida, Streptomyces cyaneogriseus , Streptomyces antibioticus, Streptomyces platensis, Stigmatella aurantiaca, Streptomyces lasaliensis, Streptomyces fungicidicus, Streptomyces pristinaespiralis, Streptomyces lividans, Streptomyces coelicolor, Streptomyces roseosporus, Streptomyces actuosus, Streptomyces mycarofaciens, Streptomyces longisporoflavus, Streptomyces parvulus, Streptomyces antibioticus, Streptomyces incarnates, Streptomyces cinnamonensis, Streptomyces parvulus, Micromonospora megalomicea, Streptomyces diastatochromogenes, Streptomyces nodosus, Streptomyces varsoviensis, Streptomyces setae.

28. The engineered microorganism according to any one of the preceding claims, wherein the microorganism is Streptomyces sp.

29. The engineered microorganism according to any one of the preceding claims, wherein the microorganism is Streptomyces rimosus.

30. The engineered microorganism according to any one of the preceding claims, wherein the microorganism is Streptomyces rimosus ATCC 10970.

31. A method for increasing the yield of a primary or secondary metabolite of interest (MOI) from a reference microorganism comprising DNA encoding the metabolic pathway for the synthesis of said MOI, said method comprising the steps of: a) preparing an engineered microorganism by introducing at least one deletion in the vicinity of the genes encoding said metabolic pathway, wherein said deletion does not prevent the expression of a functional metabolic pathway for synthesis of the MOI, and b) cultivating said engineered microorganism.

32. The method according to claim 31, wherein said deletion does not inactivate the expression of any genes part of the core genome.

33. The method according to claim 31 or 32, wherein the metabolic pathway for the synthesis of said MOI is an operon.

34. The method according to any one of claims 31-33, wherein the metabolic pathway for the synthesis of said MOI is a biosynthesis gene cluster that comprises at least one gene encoding at least one enzyme necessary for the synthesis of said MOI.

35. The method according to any one of claims 31-34, wherein said at least one deletion is a deletion of a single DNA fragment.

36. The method according to any one of claims 31-35, wherein said microorganism has a linear chromosome.

37. The method according to claim 36, wherein said deletion of a DNA fragment is towards the upstream end of the chromosome.

38. The method according to claim 36 or 37, wherein said deletion of a DNA fragment comprises the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2).

39. The method according to claim 36 or 37, wherein said deletion of a DNA fragment is the deletion of the Δ-145kbp DNA fragment located between bases 8,804,637 to 8,949,972 on the chromosome of Streptomyces rimosus ATCC 10970 reference genome (RefSeq:GCF_000331185.2).

40. The method according to any one of claims 31-35, wherein said microorganism has a circular chromosome.

41. The method according to claim 40, wherein said deleted DNA fragment was placed towards the core region containing the origin of replication.

42. The method according to any one of claims 31-41, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 500 Kbp away from the metabolic pathway for synthesis of said MOI.

43. The method according to any one of claims 31-42, wherein said deletion is located on the chromosome of the microorganism at a location minimum 1 Kbp and maximum of 50 Kbp away from the metabolic pathway for synthesis of said MOI.

44. The method according to any one of claims 31-43, wherein said deletion encompasses a maximum deletion size of 500 Kbp, a maximum deletion size of 250 Kbp or a maximum deletion size of 150 Kbp.

45. The method according to any one of claims 31-44, wherein said deletion is at least 5 Kbp in size.

46. The method according to any one of claims 31-45, wherein said deletion comprise from 5 Kbp to 500 Kbp, from 5 Kbp to 250 KBP, from 5 Kbp to 100 Kbp or from 5 Kbp to 70 Kbp.

47. The method according to any one of claims 31-46, wherein the MOI is oxytetracycline.

48. The method according to any one of claims 31-47, wherein the MOI is longicatenamycin B or longicatenamycin C.

49. The method according to any one of claims 31-46, wherein the MOI is selected from the group consisting of secondary metabolites, actinomycin, avermectin, bleomycin, candicidin, cephamycin, cyclosporin, clavulanic acid, daptomycin, daunorubicin, doxorubicin, erythtomycin, tylosin, milbemycin, FK506, FK520, rapamycin, fosfomycin, streptomycin, gentamycin, kanamycin,apramycin, neomycin, tobramycin, cycloserine, chloramphenicol, Mitomycin, natamycin, novobiocin, penicillin, lovastatin, nystatin, amphotericin, phleomycin, polymyxin, bacitracin, pristinamycin, rifamycin, salinomycin, monensin, spinosyn, spiramycin, streptogramins, tetracycline, mycophenolic acid, cephalosporin, epothilone, lincomycin, fidaxomicin, fusaric acid, paromomycin, spectinomycin, mupirocin, lipstatin, vancomycin, primary metabolites, thiamine, riboflavin, folic acid, pantothenic acid, biotin, vitamin b12, beta-carotene (pro-vitamin A), ergosterol, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA).

50. The method according to any one of claims 31-49, wherein the metabolic pathway for synthesis of said MOI is a naturally occurring pathway.

51. The method according to any one of claims 31-50, wherein the MOI is naturally being produced by the microorganism.

52. The method according to any one of claims 31-51, wherein the metabolic pathway for synthesis of said MOI is not naturally occurring in said mircroorganism.

53. The method according to any one of claims 31-52, wherein the microorganism is an eukaryote.

54. The method according to any one of claims 31-52, wherein the microorganism is a prokaryote.

55. The method according to any one of claims 31-54, wherein the microorganism is selected from the group consisting of an of an actinobacteria such as Streptomyces, Corynebacterium sp., Propionibacterium sp., Saccharopolyspora sp., Amycolatopsis sp., myxobacteria, cyanobacteria, Bacillus sp., Saccharomyces sp., Pseudomonas sp and Escherichia coli.

56. The method according to any one of claims 31-55, wherein the microorganism is selected from the group consisting of Streptomyces rimosus, Streptomyces hygroscopicus, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Streptomyces rapamycinicus, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Streptomyces albus, Micromonospora sp., Micromonospora griseorubida, Amycolatopsis mediterranei, Actinoplanes sp., Streptomyces lasaliensis, Actinosynnema pretiosum, Streptomyces bikiniensis, Streptomyces graminofaciens, Streptomyces sp., Streptomyces virginiae , Sorangium cellulosum, Micromonospora megalomicea, Streptomyceshalstedii, Streptomyces spiroverticillatus, Streptomyces aureofaciens, Streptomyces hygroscopicus, Streptomyces geldanamycininus, Streptomyces sahachiroi, Xanthomonas albilineans, Amycolatopsis balhimycina, Streptomyces verticillus, Acinetobacter baumannii, Bacillus amyloliquefaciens, Bacillus licheniformis, Streptomyces lohii, Streptomyces nanchangensis, Streptomyces caelestis, Streptomyces violaceusniger, Streptomyces noursei, Streptomyces sp. HK803, Streptomyces piomogenus, Streptomyces venezuelae, Streptomyces natalensis, Streptomyces platensis, Pseudomonas fluorescens, Streptomyces sp. SN-593, Amycolatopsis mediterranei, Streptomyces achromogenes, Streptomyces albus, Streptomyces spiroverticillatus, Streptomyces griseus, Streptomyces ambofaciens, Saccharopolyspora spinosa, Streptomyces flaveolus, Nocardiopsis sp. FU40, Streptomyces violaceoruber,, Streptomyces bottropensis , Streptomyces sp. CS40, Streptomyces lavendulae, Streptomyces triostinicus, Bacillus amyloliquefaciens , Actinomadura kijaniata, Streptomyces rochei, Bacillus amyloliquefaciens, Pseudomonas fluorescens, Micromonospora griseorubida, Streptomyces cyaneogriseus , Streptomyces antibioticus, Streptomyces platensis, Stigmatella aurantiaca, Streptomyces lasaliensis, Streptomyces fungicidicus, Streptomyces pristinaespiralis, Streptomyces lividans, Streptomyces coelicolor, Streptomyces roseosporus, Streptomyces actuosus, Streptomyces mycarofaciens, Streptomyces longisporoflavus, Streptomyces parvulus, Streptomyces antibioticus, Streptomyces incarnates, Streptomyces cinnamonensis, Streptomyces parvulus, Micromonospora megalomicea, Streptomyces diastatochromogenes, Streptomyces nodosus, Streptomyces varsoviensis, Streptomyces setae.

57. The method according to any one of claims 31-56, wherein the microorganism is Streptomyces sp.

58. The method according to any one of claims 31-57, wherein the microorganism is Streptomyces rimosus.

59. The method according to any one of claims 31-58, wherein the microorganism is Streptomyces rimosus ATCC 10970.

60. Use of the engineered microorganism as defined in any one of claims 1-30 for the production of the MOI, said use comprising cultivation of said engineered microorganism in a suitable culture medium and isolation of the MOI synthesized by the engineered microorganism.

61. Use of the engineered microorganism as defined in any one of claims 1-30 for activating one or more cryptic gene cluster(s).

62. Use of the engineered microorganism as defined in any one of claims 1-30 for expressing biosynthetic gene cluster not native to the engineered host and producing the MOI.

Images