Reduced immunogenic gene therapy protocols using circular, extended cruciform containing non-viral vectors

Abstract

Provided herein are non-immunogenic, circular, non-integrating, non-viral DNA vectors, and methods of using such DNA vectors, which are capable of forming one or more specialized secondary structures, for example extended cruciform structures, and express one or more therapeutic genes. These DNA vectors capable of forming one or more specialized secondary structures, for example extended cruciform structures, provide for increased nucleus entry, episomal stability, and long-term transgene expression, and have unique and highly unexpectedly reduced immunogenicity. The one or more specialized secondary structures, for example extended cruciform structures, formed by the circular DNA vectors provided herein are stabilized through the interaction of two specifically oriented repeating sequences, for example AAV-derived inverted terminal repeat (ITR) sequences, separated by a small, non-repeating sequence, for example a non-repeating sequence comprising a small bacterial origin of replication (Ori).

Description

[0001] REDUCED IMMUNOGENIC GENE THERAPY PROTOCOLS USING CIRCULAR, EXTENDED CRUCIFORM CONTAINING NON-VIRAL VECTORS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 63 / 545,377, filed October 24, 2023. The entirety of this application is hereby incorporated by reference herein for all purposes.

[0004] FIELD OF THE DISCLOSURE

[0005] The present disclosure provides compositions and methods of using circular, double stranded DNA non-viral vectors capable of forming specialized secondary structures, for example extended cruciform structures, to provide long-term, in vivo expression of a therapeutic protein in human gene therapy protocols that have significantly reduced immunogenicity.

[0006] INCORPORATION BY REFERENCE

[0007] The contents of the XML file named “24012-003W01_ST26” which was created on October 22, 2024, and is 499 KB in size, are hereby incorporated by reference in their entirety.

[0008] BACKGROUND OF THE DISCLOSURE

[0009] Gene therapy is an innovative approach in medicine aimed at treating inherited and acquired diseases through the delivery of new genetic material into a patient's cells to compensate for or suppress the function of a mutant gene and / or treat a disorder.

[0010] Recent advances have seen a number of gene therapies approved for marketing in the United States. The approved therapies treat a range of genetic disorders, including sickle cell disease, Duchenne muscular dystrophy (DMD), inherited retinal disorder, hemophilia B, cerebral adrenoleukodystrophy (CALD), spinal muscular atrophy (SMA), metachromatic leukodystrophy (MLD), dystrophic epidermolysis bullosa with mutations in the collagen type VII alpha 1 chain (COL7A1) gene, and beta thalassemia. The majority of vectors used in approved gene therapies are viral. For example, delandistrogene moxeparvovec-rokl (Elevidys®) is a one-time in vivo administration of a recombinant adeno-associated viral vector (rAAVrh74) containing an engineered micro-dystrophin transgene to treat Duchenne muscular dystrophy. Additional approved therapies using one-time administrations of recombinant AAV vectors include voretigene neparvovec (Luxtuma®), valoctocogene roxaparvovec (Roctavian®), and etranacogene dezaparvovec-drlb (Hemgenix®), to name a few. Other viral vectors, such as lentiviral vectors (LVV), are also used in approved gene therapies. For example, the sickle cell gene therapy lovotibeglogene autotemcel (Lyfgenia®) uses an LVV to transduce ex vivo CD34+ HSCs to express pA-T87Q-globin.

[0011] The primary reasons for using viral vectors for gene delivery include their natural ability to infect target cells, efficient shuttling of genetic materials into the nucleus of target cells, and, where desirable, insertion into the target cell genome (see, e.g., Finer et al., A brief account of viral vectors and their promise for gene therapy. Gene Ther. 2017;24(l): 1-2). As noted above, a particularly useful viral vector is AAV, which is the most widely used viral vector for in vivo gene therapy applications (Zhao et al., Viral vector-based gene therapies in the clinic, Bioeng Transl Med. 2022 Jan; 7(1): el0258). AAV is a nonpathogenic parvovirus with a 4.7 kb DNA genome enclosed in a nonenveloped icosahedral capsid (Wu et al., Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol Ther. 2006; 14(3):316-327). AAV has 11 natural serotypes and over 100 variants (Wang et al., Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov. 2019;18(5):358-378). Different serotypes have tropism toward different tissues that makes each serotype suitable for gene delivery to specific tissues (Zincarelli et al., Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther. 2008; 16(6): 1073-1080). Major characteristics of AAV vectors include the ability to transduce both dividing and nondividing cells and the ability to produce longterm, stable gene expression, while not integrating into the host genome (Zhao et al., 2022).

[0012] Viral vectors such as AAV, however, have limited use in clinical practice due to the immune response generated to the viral vector, which presents a significant hurdle to the translation of viral vector-based gene therapies. Both innate and adaptive immune responses against viral vector-based gene therapies can occur in human patients, which can limit: (1) repeated use of the same viral vector due to host-generation of neutralizing antibodies, thereby altering biodistribution and thus preventing the successful long-term use of viral vectors, and (2) transduction efficiency due to immune system response to the introduced viral structures and gene silencing (see, e.g., Shirley et al., Immune responses to viral gene therapy vectors. Mol Ther. 2020;28(3): 709-722). Despite AAV’ s low relative immunogenicity, approved gene therapies using AAV vectors are limited to a single administration due to the generation of a systemic immune response to the viral vector (see, e.g., Elevidys® Package Insert, available at https: / / www.fda.gov / vaccines-blood-biologics / tissue-tissue-products / devidys) . Furthermore, patients with pre-existing baseline antibodies to the viral vector or a related clade may not be eligible to receive the treatment (see, e.g., id., “Elevidys® administration is not recommended in patients with elevated anti-AAVrh74 total binding antibody titers (>1:400)). Finally, cases of acute liver failure and serious liver damage have been reported with the use of AAV vectors, and at least one approved AAV gene therapy product — Zolgensma® — carries a Food and Drug Administration (FDA) black box warning related to acute liver failure with fatal outcomes (see Zolgensma® Package Insert, available at https: / / www.ltia gov / vaecines-blood- bAtilQSAti Vzolgep sma) .

[0013] Numerous FDA documents warn of the necessity for monitoring immune responses to human gene therapies (e.g., AAV), particularly innate and adaptive immune responses, as enhanced immunogenicity leads to the loss of treatment effect and toxicity in the subject (see, e.g., Human Gene Therapy for Neurodegenerative Diseases - Guidance for Industry. U.S. Department of Health and Human Services. Food and Drug Administration. (October 2022)). This is especially relevant when considering repeat administrations. This is borne out of the observation of more acute immune responses in humans compared to those observed in preclinical models (Martino, et al., Immune Response Mechanisms against AAV Vectors in Animal Models. Molecular Therapy: Methods & Clinical Development. 17:198-208(2020)). Importantly, a correlation between AAV vector dose and vector immunogenicity has been noted in independent studies (see, e.g., Nathwani et al., Adenovirus-Associated Virus Vector-Mediated Gene Transfer in Hemophilia B. N Engl J Med. 365(25):2357-2365(2011)).

[0014] Several studies have concerningly associated acute toxicity in subjects with immune responses, such as acute inflammatory cytokine responses. For example, marked elevation of inflammatory cytokines were observed in non-human primates (NHPs) administered AAV, which may have elicited or exacerbated liver damage in an NHP subject that suffered acute liver failure and shock (see, e.g., Food and Drug Administration (FDA) Briefing Document: Cellular, Tissue, and Gene Therapies Advisory Committee (CTGTAC) Meeting #70. Toxicity Risks of Adeno- associated Virus (AAV) Vectors for Gene Therapy (GT). September 2-3, 2021). Liver failure and shock has been observed in spinal muscular atrophy (SMA) subjects administered onasemnogene abeparvovec (Zolgensma) (see id.), which carries an FDA black box warning. There is also evidence that T-cell activation to AAV administration coincides with neutralizing antibody responses, with one study demonstrating a correlation between anti-AAV antibodies and circulating AAV2-specific memory CD8+ T-cells secreting TNF-alpha, further emphasizing the need to closely monitor immunogenicity assays in subjects through clinical studies (Kuranda et al., Exposure to wild-type AAV drives distinct capsid immunity profiles in humans. J Clin Invest. 128( 12):5267-5279(2018 Dec 3)).

[0015] In addition to the generation of an immune response to AAV capsid proteins, retained viral sequences within the AAV expression cassette may also induce unwanted immune responses. When used in gene therapy settings, greater than 90% of the AAV genome is replaced with a gene cassette of interest, generally leaving only the inverted terminal repeat (ITR) sequences or derivates thereof. These cis-elements, primarily derived from AAV serotype 2, are required for AAV genome rescue, replication, packaging, and vector persistence. Thus, in a clinical setting, patients receiving gene therapy are exposed not only to the capsid proteins but also to the native or derivatized viral AAV2 ITR sequences. The impact of these sequences in cells has been historically understudied, but it is known that the AAV ITR interacts with a number of host proteins and can stimulate anti-viral and DNA damage response pathways (see, e.g., Earley et al., Adeno-Associated Virus Serotype-Specific Inverted Terminal Repeat Sequence Role in Vector Transgene Expression. Hum Gene Ther. February 2020; 31(3-4): 151-162). A particular innate immune pathway believed to be triggered by AAV ITR sequences within AAV expression cassettes includes Toll-like receptor 9 (TLR9), which is activated by unmethylated cytidine- phosphate-guanosine (CpG) dinucleotides (Faust et al., CpG-depleted adeno-associated virus vectors evade immune detection. J Clin Invest 2013;123:2994-3001).

[0016] Retrovirus vectors, such as lentiviruses, are particularly useful for integrating genetic material into a target cell’s genome, including both dividing and non-dividing cells, enabling longterm gene expression (Zhao et al., 2022). The main disadvantage of vectors such as lentiviruses, however, is their limited genetic cargo capability (Kay et al., Viral vectors for gene therapy: the art of turning infectious agents into vehicles of therapeutics. Nat Med. 2001 ;7(l):33-40). In addition, the integration characteristics of retroviruses such as lentiviruses pose the potential of mutagenesis and the formation of unwanted malignancies. Importantly, both Skysona® and Lyfgenia®, lentiviral vector-based gene therapies, carry FDA-mandated black box warnings regarding the development of hematological malignancies, including life-threatening cases of myelodysplastic syndromes, due to the integration of the lentivirus into proto-oncogenes (see Skysona® Package Insert); see Lyfgenia® Package Insert.

[0017] The inherent problems associated with the use of viral vectors in gene therapies have led researchers to examine alternatives, including non-viral vectors. Because it is far more difficult for non-viral vectors (RNA or DNA) to transfect many specific cell types compared to viral vectors, the DNA or RNA expression cassette is often complexed with delivery vehicles (e.g., cationic lipids, cationic polymers, etc.) or subjected to forced entry (e.g., electroporation, hydrodynamic injection, etc.). Potential advantages of using non-viral vectors for gene therapies include larger cargo packing capacity compared to, for example, AAV and LLV, thus expanding the potential disorders that can be targeted due to the ability to encode for larger genes. Furthermore, non-viral vectors are generally less immunogenic than viral vectors (see Hardee et al., Advances in Non- Viral DNA Vectors for Gene Therapy. Genes 2017, 8(2), 65).

[0018] Non-viral vectors, however, have historically been beset with some notable inherent limitations resulting in limited clinical success to date. Because plasmids are non-replicating episomes, transgene expression is transient and diluted by cell division. Non-viral vectors also tend to achieve lower rates of gene delivery compared to select viral vectors. This lower efficiency, especially with DNA-based vector systems, is largely due to the difficulty of getting the expression cassette into the nucleus of target cells, which is classically considered as one of the main bottlenecks of non-viral plasmid-based expression systems (Puras et al., Protamine / DNA / Niosome Ternary Nonviral Vectors for Gene Delivery to the Retina: The Role of Protamine. Mol. Pharm. 2015, 12, 3658-3671).

[0019] Additionally, the recognition and subsequent silencing of foreign DNA by the host immune system also leads to reduced efficiency (Van Gaal et al., Plasmid Engineering for Controlled and Sustained Gene Expression for Nonviral Gene Therapy. Pharm. Res. 2006, 23, 1053-1074). Bacterial sequences in plasmids, generally necessary for replication of the vector in bacterial fermentation processes, can contribute to gene silencing (see, e.g., Lu et al., The extragenic spacer length between the 5’ and 3’ ends of the transgene expression cassette affects transgene silencing from plasmid-based vectors. Mol. Ther. J. Am. Soc. Gene Ther. 2012, 20, 2111-2119).

[0020] Furthermore, early generation plasmids typically included antibiotic resistance-encoding genes for selection of plasmid-harboring bacteria during production. The use of antibiotics and their resistance genes in the preparation of plasmid vectors, however, is discouraged by regulatory bodies such as the Food and Drug Administration and the European Medicines Agency (EMA) because of the risk of transfer and replication of resistance genes to bacteria in the human microbiome and possibly into the environment. Additionally, residual antibiotics that remain from vector production may trigger an immune reaction in patients.

[0021] Small plasmid cassettes known as mini circle DNA (mcDNA) have recently been developed to mitigate some disadvantages associated with the use of conventional plasmids (Kay et al., A robust system for production of minicircle DNA vectors. Nat. Biotechnol. 2010, 28, 1287-1289). Such mcDNAs contain a minimal expression cassette, where the bacterial backbone DNA has been eliminated, which reduces unwanted immunogenic responses due to bacterial backbone sequences and enhances the transfection efficiency due to the plasmid’s reduced size (Maniar et al., Minicircle DNA Vectors Achieve Sustained Expression Reflected by Active Chromatin and Transcriptional Level. Mol. Ther. 2013, 21, 131-138).

[0022] Additional efforts have been made to further minimize plasmid DNA. For example, Aldevron LLC and Nature Technology Corporation have developed minicircle DNA plasmids known as Nanoplasmids®. These plasmids were ultimately developed after removing all non- essential sequences from the plasmid backbone, including extraneous bacterial DNA flanking the selection marker and replication origin, bacterial sequences resulting in the formation of secondary structures (e.g., Z DNA, cruciforms, palindromes, repeats), cryptic splice sites, sequences resulting in RNA secondary structures, sequences with human genome homology, alternative reading frames, cryptic promoters and chi sites (see Hodgson et al., Recent advances in non-viral vectors for gene therapy & vaccination. Cell Gene Therapy Insights 2017; 3(2), 95-101). In addition, the antibiotic resistance genes in the bacterial backbone were replaced with a small RNA selectable marker known as an RNA-Out, which allows selection with sucrose rather than antibiotics (see id). The plasmids were further optimized to use an R6K-derived bacterial origin of replication, a smaller bacterial origin of replication than those traditional used in plasmids such as the pUC origin of replication (see id.). These modifications result in a plasmid with a bacterial origin or replication and selection backbone of less than 0.5kb (see id.). Such small, circular plasmids have also recently been implemented in the production of AAV viral-vectors and have shown improved production capacities (see, e.g., WO2019 / 183248).

[0023] As noted above, one particular problem in using non-viral DNA vectors in gene therapies has been the inability to achieve long-term persistence of gene expression, such as that attained with AAV viral vectors or integrating lentivirus vectors. Recently, non-viral delivery of linear DNAs having modified geometry such as closed-end linear duplex DNA (CELiD) have shown promise as an alternative to viral vectors due to increased transgene expression and less cytotoxicity. CELiDs consists of double-stranded DNA molecules with covalently closed terminal hairpins (see, e g., Li et al., Production and characterization of novel recombinant adeno-associated virus replicative-form genomes: A eukaryotic source of DNA for gene transfer. PLoS ONE 8, e69879 (2013)). A particular-type of CELiD is generated as an intermediate of AAV replication in eukaryotic cells, and such structures are in effect a double stranded AAV genome containing a DD-ITR (“double-D”) element capped with hairpin-forming palindromic terminal regions (see, e.g., Samulski et al., AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014); see also US2021 / 0269828). However, the question of whether modified-end linear DNAs can also provide a safe means of non-integrating gene transfer remains unanswered, as such linear DNA structures have concerningly shown a tendency to stably transfect high fractions of cells in vivo, sometimes as high as between 10 and 20% of the initially transfected cells (Lim et al., High spontaneous integration rates of end-modified linear DNAs upon mammalian cell transfection. Sci Rep 13, 6835 (2023)).

[0024] Because of the challenges, improvements to DNA-based non-viral vector systems are necessary to meet the requirements for acceptable clinical applications.

[0025] SUMMARY OF THE DISCLOSURE

[0026] The present disclosure provides compositions and methods for the treatment of a genetic disorder in a human patient that minimizes deleterious immune responses to the treatment by using a substantially non-immunogenic, non-integrating circular, non-viral, double stranded DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which provides long-term, in vivo expression of a therapeutic protein. By using a DNA vector capable of forming, for example, one or more extended cruciform structures as described herein to express a therapeutic protein in vivo, significant reductions to patient immune responses, including both innate and adaptive responses, caused by the administration of the DNA vector can be achieved. Also provided herein are DNA vectors capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, encoding a therapeutic protein for the treatment of a genetic disorder, for example human alkaline phosphatase protein for use in the treatment of hypophosphatasia in a human, wherein the treatment does not induce a significant immune response in the human patient.

[0027] The one or more specialized secondary structures, for example extended cruciform structures, in the DNA vectors for use in the immunogenicity reducing methods and compositions provided herein are formed through the interaction of two specifically oriented repeating sequences, for example AAV-derived inverted terminal repeat (ITR) sequences, separated by a small, non-repeating sequence, for example a non-repeating sequence comprising a small bacterial origin of replication (Ori). By specifically orienting these two repeating sequences to flank a nonrepeating sequence of particular size, for example an Ori of between about 225 and 460 base-pairs (bps), the two repeating sequences align, forming one or more specialized secondary structures, for example, extended cruciform structures, containing a Holliday junction and two doublestranded arms of significant length (e.g., 80-110 bps or more), with a loop formed at the end of each extended arm by the non-repeating sequence (see, e.g., FIG. 1A, FIG. IB). Importantly, the loop formed at the end of each extended arm by the non-repeating sequence may also form additional secondary structures such as small hairpins, adding to the stability of the DNA vector. Comparatively, using a single ITR in a circular DNA vector, for example a DD-ITR, or failing to sufficiently spatially orient the repeating sequences using an appropriately sized non-repeating sequence, results in one or more hairpin-like structures or short cruciform structures with shorter aligned arms (e.g., less than 50 bps).

[0028] In certain embodiments, the particular alignment of the inverted terminal repeats and nonrepeating sequence as described herein is capable of forming an extended cruciform (an “extended cruciform-forming DNA vector”). In alternative embodiments, the specialized secondary structures that may be formed include, for example, other non-canonical B-DNA forming secondary structures like hairpins, G-quadruplexes, and i-motifs.

[0029] In certain embodiments, the DNA vector is further modified to further reduce its immunogenicity, for example, through one or more modification selected from modifications to phosphodiester linkages of nucleotides in the nucleotide sequence of the DNA vector, modifications of the 2'-OH of ribose in the nucleotide sequence of the DNA vector, or modifications to bases in the nucleotide sequence of the DNA vector, as described further herein.

[0030] Despite the presence of a structure including, for example, a virally-derived ITR sequence, for example an AAV Serotype 2 (AAV2)-derived ITR, and a bacterial origin of replication, the DNA vectors capable of forming one or more specialized secondary structures, for example an extended cruciform structure, as described herein do not induce a host’s adaptive immune response or inflammatory response. For example, non-viral DNA vectors lacking cruciform structure induce up to 2,000 differentially expressed genes (DEGs) across several immune related gene ontology (GO) classifications within 2 hours and 24 hours following administration in mice compared to baseline levels prior to administration (see, e.g., Example 15, FIG. 20C). GO analysis allows the identification of key biological processes that are altered in response to a given treatment condition as represented by the differentially expressed genes within the pathway. Differentially expressed genes are those that experience either two-fold upregulation or downregulation relative to baseline levels prior to DNA vector administration. In comparison to the non-viral DNA vectors lacking the ability to form, for example, a cruciform structure, administration of a DNA vector capable of forming one or more cruciform structures as described herein induces only about 100 total DEGs in mice (FIG. 20C). The administration of DNA vectors containing no ability to form a cruciform structure induces differential expression of more than 20 genes within key GO immune response groups at 2 hours post administration, including G0:0045087 (“innate immune response” (FIG. 20F)) and GO: 0002376 (“immune system process” (GO: 0002376) (FIG. 20F)), while the administration of a DNA vector capable of forming one or more extended cruciform structures induces less than 5 genes that are differentially expressed in these same groups.

[0031] As demonstrated herein, the DNA vectors with these specialized structures are “immunologically quiet” - that is, the DNA vectors do not trigger a widespread immunogenic response following administration, unlike vectors that do not contain specialized secondary structures or those that contain small hairpin structures with shortened aligned arms (e.g., < 50 bps), for example DD-ITR based DNA vectors. This feature contributes to the unexpected ability to repeatedly re-dose the DNA vector over the course of treatment, allowing for advantageously durable transgene expression in subjects for at least about 280 days (see, e.g., FIG. 22A-22C). Accordingly, the DNA vectors described herein are particularly useful for the treatment of a disorder while minimizing deleterious immune responses to the treatment that have previously been shown to be problematic in gene therapy regimens.

[0032] In one aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering to the patient an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example an extended cruciform structure, and capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector does not substantially induce an immune response in the patient. In some embodiments, the substantial immune response comprises a humoral or cellular immune response. In some embodiments, the substantial immune response comprises upregulation of genes involved in an innate immune response pathway and / or an adaptive immune response pathway, for example increased or decreased expression of immune responsive gene products by about a factor of 2 or greater, that is a log2 fold change of greater than 1 or less than -1, as measured by mRNA transcript levels. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0033] In some embodiments, the ability of a DNA vector capable of forming one or more specialized secondary structures, for example one or more cruciform structures, to minimize deleterious immune responses to the treatment in a human patient is illustrated or assayed by administering the DNA vector to adult BALB / c mice, wherein the DNA vector induces no more than about a factor of 2 or greater change in mean mRNA transcript levels in the mice of one or more mouse genes in an immune-related pathway compared to mock control, wherein the immune- related pathway is selected from an innate immune response pathway or an immune response pathway. In a non-limiting exemplary assessment, the mice can be administered about 15 pg of a DNA vector capable of forming one or more extended cruciform structures and the one or more mRNA transcript levels measured at between about 2 and 24 hours. In a non-limiting exemplary assessment, the mean mRNA transcript levels of the genes is measured by RNA sequencing (RNA- SEQ) of liver samples of the mice. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice are selected from the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, and / or Zbtbl, or a combination thereof. In some embodiments, the one or more genes in the immune response pathway are selected from the mouse ortholog of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, and / or Tnfrsf22, or a combination thereof.

[0034] In an additional aspect, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof, at about 2-hours post-administration, at about 24-hours post administration, or about 2- hours and about 24-hours post-administration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein the DNA vector induces an expression change by about a factor of 2 or greater in mean mRNA transcript levels in the mice in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof, at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration compared to mock control. In a non-limiting exemplary assessment, the mice can be administered about 15 pg of a DNA vector described herein and the one or more mRNA transcript levels measured at between about 2 and 24 hours. In a nonlimiting exemplary assessment, the transcript level of the genes is measured by RNA sequencing (RNA-SEQ) of liver samples from the mice.

[0035] In an additional aspect, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes transcriptional responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structure, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 or greater of mRNA transcript levels in no more than 5 expressed genes in a transcriptional-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, at about 2-hours post-administration, at about 24-hours post administration, or about 2-hours and about 24-hours post-administration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein the DNA vector induces an expression change by about a factor of 2 or greater in mean mRNA transcript levels in the mice in no more than 5 expressed genes in a transcriptional-related gene ontology (GO) group selected from mouse GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), mouse GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), mouse 0006397 (mRNA processing), mouse 0008380 (RNA splicing), mouse 0006357 (regulation of transcription from RNA polymerase II promoter), mouse 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, at about 2-hours postadministration, at about 24-hours post administration, or about 2-hours and about 24-hours postadministration compared to baseline mRNA transcript levels prior to administration. In a nonlimiting exemplary assessment, the mice can be administered about 15 pg of the DNA vector and the one or more mRNA transcript levels measured at between about 2 and 24 hours. In a nonlimiting exemplary assessment, the transcript level of the genes is measured by RNA sequencing (RNA-SEQ) of liver samples from the mice.

[0036] In some embodiments, the human patient is administered a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, as described herein as a pharmaceutical composition comprising the DNA vector and a delivery vehicle. In some embodiments, the delivery vehicle is a lipid nanoparticle (LNP). In some embodiments, the delivery vehicle is a polymer nanoparticle. In some embodiments, the delivery vehicle is a proteo-lipid nanoparticle. In some embodiments, the delivery vehicle is a microbubble. In some embodiments, the DNA vector is formulated with one or more lipid nanoparticles (LNP). In some embodiments, the DNA vector is formulated with one or more polymer nanoparticles. In some embodiments, the DNA vector is formulated with one or more proteo-lipid nanoparticles. In some embodiments, the DNA vector is formulated with one or more microbubbles.

[0037] In some embodiments, the DNA vector is administered as a pharmaceutical composition comprising one or additives as described herein which improves the therapeutic activity of the DNA vector, for example through increasing the stability of the DNA vector or further assisting in reducing the DNA vector’s immunogenicity. In certain embodiments, the additive is an acid. Acidic pH has been shown to stabilize certain motifs in nucleic acid secondary structure. In certain embodiments, the acid additive is selected from acetic, citric, formic, or phosphoric acids, or an ammonium or alkylammonium salt. In certain embodiments, the pH of the pharmaceutical composition comprising the DNA vector is less than about pH 8, 7.8, 7.6, 7.4, 7.2, 7.0, 6.8, 6.6,

[0038] 6.4, 6.2, or 6.0 or less. In certain embodiments, the pH of the pharmaceutical composition comprising the DNA vector is from about pH 5.0, 5.2, 5.4, 5.6, 5.8, or 6.0 to about pH 8, 7.8, 7.6,

[0039] 7.4, 7.2, 7.0, 6.8, 6.6, 6.4, or 6.2. In certain embodiments, the additive is a metal salt wherein the metal is selected from aluminum, cobalt, copper, iron, silver, and nickel. In certain embodiments, the additive is a polyether, for example polyethylene glycol (PEG). In certain embodiments, the additive is dextrane. In certain embodiments, the additive is a polyamine, for example putrescine, spermidine, or spermine.

[0040] In certain embodiments, the DNA vector is administered as a pharmaceutical composition formulated with a natural or synthetic membrane or an implanted vehicle which improves the therapeutic activity of the DNA vector by more efficient delivery. In certain embodiments, the DNA vector is formulated in an implanted delivery vehicle. In some embodiments, the implanted delivery vehicle comprises a polymeric hydrogel. In some embodiments, the implanted delivery vehicle comprises a porous or permeable membrane.

[0041] Also provided herein are DNA vectors that utilize novel arrangements of repeating sequences and their applicable complementary sequence capable of forming specialized secondary structures, for example extended cruciform structures, comprising:

[0042] (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and

[0043] (ii) a second portion capable of forming at least one or more specialized secondary structures, for example one or more extended cruciform structure, wherein the second portion has the Formula X-Y-X', where X and X' each comprise an inverted repeat sequences, and where Y comprises a nonrepeating sequence of at least 25 base-pairs, but less than about 460 bps; wherein the X inverted repeat sequence is operatively arranged as A1-A2-AX; wherein the X’ inverted repeat sequence is operatively arranged as AX’-A2’-A1’; wherein Al’ is the reverse complement of Al; wherein A2’ is the reverse complement of A2; wherein AX’ is the reverse complement of AX, and wherein AX and AX’ represents the addition of at least one or more further complementary repeat sequences to be added to the X and X’ inverted repeat sequences; wherein Al is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto; wherein A2 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto; and wherein AX is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto. In some embodiments, Y is a non-repeating nucleic acid sequence comprising an Ori selected from the sequences of SEQ ID NOs: 163-167, or a sequence at least about 95% identical thereto.

[0044] The DNA vectors provided herein comprising one or more specialized secondary structures, for example one or more extended cruciform structures, are capable of expressing one or more therapeutic proteins suitable for treating a disorder, for example a genetic disorder, when administered to a human. In some embodiments, the DNA vector is capable of expressing the therapeutic protein tissue-nonspecific alkaline phosphatase (TNALP) encoded by the ALPL gene to treat hypophosphatasia or calcium pyrophosphate deposition (CPPD). In some embodiments, the DNA vector is capable of expressing the therapeutic protein proprotein convertase subtilisin / kexin type 9 encoded by the PCSK9 gene to treat autosomal dominant familial hypercholesterolemia. In some embodiments, the DNA vector is capable of expressing the therapeutic protein proprotein convertase subtilisin / kexin type 7 encoded by the PCSK7 gene for treating atherogenic dyslipidemia. In some embodiments, the DNA vector is capable of expressing the therapeutic protein alpha-1 antitrypsin encoded by the SerpinAl gene to treat alpha-1- antitrypsin (A1AT) deficiency. In some embodiments, the DNA vector is capable of expressing the therapeutic protein ATP Binding Cassette Subfamily B Member 4 encoded by the ABCB4 gene for the treatment of progressive familial intrahepatic cholestasis type 3, gallbladder disease 1 (syn. low phospholipid associated cholelithiasis syndrome), high y-glutamyl transferase intrahepatic cholestasis of pregnancy, chronic cholangiopathy, or adult biliary fibrosis / cirrhosis. In some embodiments, the DNA vector is capable of expressing the therapeutic protein ATPase Copper Transporting Beta protein encoded by the ATP7B gene to treat Wilson’s disease. In some embodiments, the DNA vector is capable of expressing the therapeutic protein bile salt export pump (BSEP) protein encoded by the ABCB11 gene to treat progressive familial intrahepatic cholestasis type 2 (PFIC2). In some embodiments, the DNA vector is capable of expressing an anti-CD19 / anti-CD3 therapeutic protein for treating an autoimmune disorder or a hematological malignancy selected from the group consisting of lymphoma, leukemia and myeloma. In some embodiments, the DNA vector is capable of expressing the therapeutic protein B-domain deleted FVIII to treat hemophilia. In some embodiments, the DNA vector is capable of expressing the therapeutic protein l-acylglycerol-3-phosphate O-acyltransferase encoded by the PNPLA3 gene and / or transmembrane 6 superfamily member 2 protein encoded by TM6SF2 and / or fibroblast growth factor 21 encoded by FGF21 to treat Metabolic dysfunction-associated steatohepatitis (MASH). In some embodiments, the DNA vector is capable of expressing the therapeutic protein fibroblast growth factor 21 encoded by FGF21 to treat Metabolic dysfunction-associated steatohepatitis (MASH), obesity, arteriosclerosis, and capable of tissue remodeling. In some embodiments, the DNA vector is capable of expressing the therapeutic protein laminin subunit alpha-2 encoded by the LAMA-2 gene to treat laminin Alpha-2-Congenital Muscular Dystrophy (LAMA2-CMD). In some embodiments, the DNA vector is capable of expressing the therapeutic protein laminin- 111 encoded by the alpha- 1, beta-1, and gamma- 1 subunits to treat laminin Alpha- 2-Congenital Muscular Dystrophy (LAMA2-CMD) or Duchenne Muscular Dystrophy (DMD). In some embodiments, the DNA vector is capable of expressing a single therapeutic protein laminin subunit of alpha- 1, alpha-2, beta-1 ,or gamma- 1, or a combination of the alpha, beta, and gamma subunits, encoded by the LAMA-1, LAMA-2, LAMB-1, andLAMC-1 genes, respectively, to treat laminin alpha-2 congenital muscular dystrophy or Duchenne Muscular Dystrophy (DMD). In some embodiments, the DNA vector is capable of expressing an anti-FGF23 antibody or a fragment thereof, wherein the antibody or fragment thereof competes for the binding of FGF23R / Klotho complex, to treat x-linked hypophosphatemia (XLH). In some embodiments, the DNA vector is capable of expressing a therapeutic protein fragment of FGF23 capable of blocking FGF23 dependent signaling or an antibody or antibody fragment capable of binding and blocking FGF23 dependent signaling. In some embodiments, the DNA vector is capable of expressing the therapeutic protein Collagen IVa345 encoded by COL4A3, COL4A4, and COL4A5 genes to treat Alport syndrome.

[0045] BRIEF DESCRIPTION OF THE FIGURES

[0046] For a general understanding of the features of the disclosure, reference is made to the drawings. In the drawings, like reference numerals have been used throughout to identify identical elements. FIGS. 1-19 are repeated from WO 2024-020320, fded by Applicant, as supportive background information for the current disclosure.

[0047] FIG. 1A illustrates a circular, non-integrating, non-viral DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, comprising (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, where each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and (ii) a second portion capable of forming a specialized secondary structures, for example one or more extended cruciform structures, wherein the second portion comprises at least about two inverted repeat sequences, wherein the at least about two inverted repeat sequences are separated by a non-repeating nucleotide sequence comprising, for example a bacterial replication of origin of between about 225 and about 460 base-pairs. The first portion includes a nucleic acid encoding a transgene, for example the human tissue non-specific alkaline phosphatase (TNALP), the nucleic acid under control of a promoter, including any of those described herein.

[0048] FIGS. IB and 1C illustrate the DNA vector of FIG. 1A and illustrate an example of an extended cruciform structure as described herein. The DNA sequence elements that lead to the formation of an extended cruciform DNA structure may contain additional secondary structure that stabilizes the formation of a larger cruciform structure (see, e.g., FIG. ID). As depicted in FIG. IB, the cruciform structure is formed between specific repeat elements, however, due to the nature of these repeats, a cruciform may be formed between other repeat elements, or between the inverted repeat sequences and the remainder of the non-viral DNA vector. In some embodiments, the inverted repeat elements may also be discontinuous, with regions of non-base paired or singlestranded DNA. One such region containing non-base paired or single-stranded DNA is in the region comprising the non-repeating nucleotide sequence, for example a bacterial Ori sequence, having at least about between about 25 and about 460 base-pairs, which is internal to the cruciform structure (see FIG. 1A). Given the components of the non-viral DNA vectors of the present disclosure, it is believed that at least about two inverted repeat sequences, each separated by a nonrepeating nucleotide sequence having at least about between about 25 and 460 base-pairs, facilitates the formation of a specialized secondary structure such as an extended cruciform structure having two long arms capped by a loop region of single-stranded DNA.

[0049] FIG. ID illustrates the non-viral DNA vector of FIG. 1A, and illustrates an example of a formed extended cruciform structure, and further depicts secondary structure of the incorporated portion of the non-repeating nucleotide sequence having between about 25 and 460 base-pairs, which may be a portion of a bacterial origin of replication.

[0050] FIG. IE depicts the predicted secondary structure of a bacterial origin of replication between two inverted terminal repeats. This extended cruciform structure contains numerous regions of single-stranded and non-repeat forming DNA in the region of the bacterial origin of replication.

[0051] FIG. 2A, 2B, 2C, 2D depict the predicted DNA secondary structure of internal repeat sequences of circular, non-viral DNA vectors according to the present disclosure.

[0052] FIG. 2E depict the predicted DNA secondary structure and calculated Gibbs free energy, normalized calculated Gibbs free energy per bp, melting temperature (Tm) of zero-CpG internal repeat sequences of circular, non-viral DNA vectors according to the present disclosure (SEQ ID NO: 243 (M013 - a DNA vector comprising a single ITR with a double-DD element (i.e., DD- ITR) + R6Ky Ori sequence of 607 bps), SEQ ID NO: 242 (MO 12 - a DNA vector capable of forming one or more extended cruciform structures of ITR- R6Ky Ori-ITR sequence of 709 bps), and SEQ ID NO: 262 (a DNA vector capable of forming one or more extended cruciform structures of ITR-R6Ky Ori-ITR (652 bps) containing a minimized non-repeating sequence). The 607 bp comprises a DD-ITR (SEQ ID NO: 169) and an R6Ky Ori sequence comprising, for example, SEQ ID NO: 166. The extended cruciform structure of ITR-R6Ky Ori-ITR sequence of 709 bps is SEQ ID NO: 168. The extended cruciform structure with an ITR-R6Ky Ori-ITR of 652 bps which contains a minimized non-repeating sequence is SEQ ID NO: 176.

[0053] FIG. 3 provides three representative transmission electron microscope photos of circular, non-viral DNA vectors of the present disclosure which include at least about two inverted repeat sequences separated by at least about a portion of a bacterial origin of replication capable of forming one or more extended cruciform structures (M012 - SEQ ID NO: 242).

[0054] FIG. 4 illustrates resolution of circular, non-viral vector DNA reporter constructs containing either non-extended cruciform structures (P004 - SEQ ID NO: 259 (BC deleted single ITR) or double-D ITR structure (P006 - SEQ ID NO: 246) delivered by polyethylenimine (PEI) and SM-102-based lipid nanoparticle (LNP) in 293 cells. The data suggests resolution of reporter constructs delivered with LNP and PEI started from day 6. The data further suggests that different inverted repeat sequences will have different resolution efficiencies.

[0055] FIG. 5 illustrates simultaneous green fluorescent protein (GFP) and red fluorescent protein (RFP) expression at day 3, and largely RFP expression at day 8, in non-dividing induced pluripotent stem cell (iPSC)-derived human hepatocytes transfected with a circular, non-viral DNA vector including an RFP / GFP reporter (SEQ ID NO: 246 (double-D ITR)).

[0056] FIG. 6 compares the gene expression and durability of firefly luciferase from two different constructs, namely from a circular, non-viral DNA vector containing a single DD-ITR (SEQ ID NO: 244) and from a plasmid without structure (SEQ ID NO: 245) in post-mitotic human iPSC- derived hepatocytes. The data reveals that transgene expression from the circular, non-viral DNA vector with a single DD-ITR (SEQ ID NO: 244) is higher and more stable than the plasmid construct (SEQ ID NO: 245).

[0057] FIG. 7 compares the secretive ALP activity of human tissue non-specific alkaline phosphatase (TNALP) in post-mitotic iPSC-derived hepatocytes from three different constructs, namely from an extended cruciform DNA vector (MO 12 - SEQ ID NO: 242), a DNA vector comprising a single DD-ITR (MO I 3 - SEQ ID NO: 243), and from a regular plasmid vector without structure (P020 - SEQ ID NO: 247), respectively. The data suggest significantly enhanced transgene (TNALP) expression from vectors comprised of an extended cruciform DNA.

[0058] FIG. 8A illustrates that a circular, non-viral DNA vector encoding a luciferase reporter (MO 14 - SEQ ID NO: 244 - DNA vector comprising a single DD-ITR) showed persistent bioluminescent signal from mouse liver tissue harvested from week 1 to weeks 4 and 5 after dosing through hydrodynamic tail vein injection compared with the fast decay of control luciferase plasmid without structure (P021 - SEQ ID NO: 245).

[0059] FIG. 8B shows that DNA copy number results matched gene expression of two DNA vectors. The DNA copy number of the circular, non-viral DNA vector (M014 - SEQ ID NO: 244 - DNA vector comprising a single DD-ITR) was maintained for one month in mouse liver tissue while the copy number of a control luciferase plasmid without structure (P021 - SEQ ID NO: 245) in mouse liver cells dropped significantly from week 1 to week 5.

[0060] FIG. 9 shows data from a single time point comparing two different studies. The first study used a circular, non-viral DNA vector including a nucleic acid encoding TNALP (MO 13 - SEQ ID NO: 243 - DNA vector comprising a single DD-ITR); while the second study utilized mobilized human hematopoietic stem cells transduced with a lentiviral vector expressing TNALP without structure (SEQ ID NO: 248). Similar plasma ALP activities were mediated in mice in the two different studies.

[0061] FIG. 10 illustrates the canonical mechanism of Holliday junction resolution (A) Antiparallel stacked-X Holliday junction with twofold symmetry. (B) Canonical Holliday junction resolvases are dimeric enzymes that induce structural changes to the junction on binding, causing the junction to unfold. Resolution occurs by the introduction of two coordinated and symmetrically related nicks in strands of like polarity at, or very near, the branchpoint. (C) Symmetrical resolution gives a pair of nicked DNA duplexes, each of which can be directly repaired by nick ligation, or homologous sequences can serve as templates for non-homologous end-joining (NHEJ) or homology-directed repair (HDR). Asterisks signify a given strand of DNA.

[0062] FIG. 11 illustrates the mechanism of resolution of the presently disclosed circular, non- viral DNA vector containing at least about one extended cruciform structure (Holliday junction) (Form A). Once introduced into a eukaryotic cell, Holliday junction resolvases introduce two coordinated and symmetrically related nicks in strands of like polarity at, or very near, the branchpoint. Symmetrical resolution gives a nicked circular or linear DNA duplex, which can be directly repaired by nick ligation (yielding Form B), or homologous sequences can serve as templates for NHEJ or HDR (yielding Form C). It is further anticipated that this process could be repeated yielding higher molecular weight linear or circular forms.

[0063] FIGS. 12A,12B, and 12C illustrate the persistence of circular, non-viral DNA vectors capable of forming one or more specialized secondary structures, for example extended cruciform structures, of ITR-R6Ky Ori-ITR (709 bps) and also encoding a murine secreted embryonic alkaline phosphatase (SEAP) reporter (M027 - SEQ ID NO: 267; M032 - SEQ ID NO: 268) in a rodent model through hydrodynamic tail vein injection at 15 pg DNA per mouse per dose. High plasma SEAP activity in mouse plasma was maintained from day 1 to day 198 after double dosing through hydrodynamic tail vein injection (15 pg of DNA per mouse per dose). Further, DNA vector copy number per diploid cell analysis showed that the two constructs according to the present disclosure (M027 - SEQ ID NO: 267; M032 - SEQ ID NO: 268) were maintained for 183 days in mouse liver (FIG. 12C).

[0064] FIGS. 13A and 13B illustrate a comparison of two constructs according to the present disclosure, where the two constructs are capable of forming two different cruciform structures, namely MO 12 (SEQ ID NO: 242 - DNA vector capable of forming one or more extended cruciform structures of ITR-R6Ky Ori-ITR (709 bps)) and M056 (SEQ ID NO: 263 - DNA vector capable of forming one or more extended cruciform structures of ITR- R6Ky Ori-ITR (652 bps) with a minimized non-repeating sequence) in iPSC-derived hepatocytes at day 3.

[0065] FIG. 13A shows that the cells transfected with the construct M056 (SEQ ID NO: 263) capable of forming one or more extended cruciform structures of an ITR-R6I<y Ori-ITR (652 bps) with a minimized non-repeating sequence had much higher ALP activity level in medium than those transfected with MO 12 (SEQ ID NO: 242), capable of forming one or more extended cruciform of an ITR- R6Ky Ori-ITR (709 bps) with both FuGENE and SMI 02-based lipid nanoparticle formulations.

[0066] FIG. 13B shows that the cells transfected with the construct M056 (SEQ ID NO: 263) capable of forming one or more extended cruciform structures of an ITR-R6K7 Ori-ITR (652 bps) with a minimized non-repeating sequence and MO 12 (SEQ ID NO: 242), capable of forming one or more extended cruciform structures of an ITR- R6Ky Ori-ITR (709 bps) do not significant impact the viability of transfected cells.

[0067] FIGS. 14 A, 14B and 14C illustrate the enhanced nuclear entry of constructs according to the present disclosure having structure (M012 - SEQ ID NO: 242 capable of forming one or more extended cruciform structures; MOB - SEQ ID NO: 243 having a single DD-ITR) as compared with DNA without a cruciform structure (M022 - SEQ ID NO: 249) in post-mitotic non-dividing iPSC-derived hepatocytes after transfection. FIG. 14A shows a representative image in which DAPI staining (blue) represents the nucleus, green foci without green circle represents the constructs of the present disclosure in cytoplasm, green foci marked with green circle represents constructs of the present disclosure in the nucleus. The fluorescence-labeled circular, non-viral DNA vector including a nucleic acid encoding TNALP and also capable of forming one or more extended cruciform structures (MO 12 - SEQ ID NO: 242) showed highest number of foci per nucleus at day 3 and 6 as compared with (i) a circular, non-viral DNA vector including single inverted repeats without intervening heterologous sequences (a DD-ITR construct) (MO 13 - SEQ ID NO: 243), and (ii) a control and without cruciform structure at all (M022 - SEQ ID NO: 249) (FIG. 14B). There is a correlation between the number of foci per nucleus and measured ALP activity in the cell culture medium (FIG. 14C).

[0068] FIGS. 15A and 15B illustrate that a firefly luciferase DNA construct (M014 - SEQ ID NO: 244) with a short cruciform structure (DD-ITR) led to a higher luciferase activity than control DNA without cruciform structure (P021 - SEQ ID NO: 245) across species both in human and cynomolgus monkey hepatocytes. Both constructs were transfected to hepatocytes with SMI 02- based lipid nanoparticle formulation.

[0069] FIG. 16 illustrates that a firefly luciferase DNA construct (MO 14 - SEQ ID NO: 244) with a short cruciform structure (DD-ITR) also led to a higher luciferase activity in mouse than control DNA without a cruciform structure (P021 - SEQ ID NO: 245). The DNA vectors were dosed to mice through hydrodynamic tail vein injection (15 pg per mouse) and mouse liver tissues were harvested at day 7 and 14 before luciferase activity assay was carried out.

[0070] FIG. 17 illustrates the great durability of a DNA vector capable of forming one or more extended cruciform structures (M026 - SEQ ID NO: 253 (ITR- R6Ky Ori-ITR (709 bps) with zero CpG content in transgene coding)) as compared with mRNA (SEQ ID NO: 196). A DNA vector capable of forming one or more extended cruciform structures according to the present disclosure (M026 - SEQ ID NO: 253) and chemically modified mRNA encoding cynomolgus monkey soluble TNALP transgene (SEQ ID NO: 196) were transfected via SM102-based lipid nanoparticle formulation to primary human hepatocytes. ALP activity from constructs according to the present disclosure in culture medium increased from day 1 to 3, then was maintained from day 3 to day 6. At the same time, ALP activity of mRNA-transfected cells decreased from day 1 to 5 and diminished at day 6.

[0071] FIG. 18 illustrates that co-localization of PARP1 (purple color) and a DNA vector capable of forming one or more extended cruciform structures (green color) (MO 12 - SEQ ID NO: 242 (ITR-R6Ky Ori-ITR (709 bps)) in the cytoplasm of 293 cells 24 hours post-transfection. PARP1 is a well-known first responder that detects DNA damage and then facilitates genomic DNA repair pathway. The colocalization data suggests that PARP1 might be one of the factors involved in the innate immune evasion, resolution, nuclear entry, recombination, and nuclear retention of DNA vectors capable of forming one or more extended cruciform structures according to the present disclosure.

[0072] FIGS. 19A, 19B and 19C illustrate immunomodulatory effects of circular, non-viral DNA vectors capable of forming one or more extended cruciform structures. FIG. 19B shows that a human TNALP DNA construct capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bps (M012 - SEQ ID NO: 242) led to a much higher ALP activity, more durable transgene expression, and no immune response (as shown by the ability to re-dose) in mice as compared with a non-viral human TNALP DNA vector with short cruciform structure formed by a single inverted repeat without intervening heterologous sequences (DD-ITR construct) (M013 - SEQ ID NO: 243) (FIG. 19A). FIG. 19C illustrates that a cynomolgus monkey TNALP DNA vector (M026 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene further increased potency, durability of the transgene expression while maintaining the ability to re-dose as compared with the similar construct without gene cassette optimization. Non- viral DNA constructs were administered repeatedly at 3-week intervals through hydrodynamic tail vein injection (15 pg per mouse) and plasma samples were collected weekly for assessment of ALP activity.

[0073] FIG. 20A illustrates that a construct according to the present disclosure with cynomolgus monkey TNALP (M026 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene also led to a 4-folder higher plasma ALP activity in a mouse 24 hours post tail-vein-based hydrodynamic injection than control DNA carrying cynomolgus monkey TNALP without a cruciform structure (SEQ ID NO: 264).

[0074] FIG. 20B illustrates that a construct according to the present disclosure with cynomolgus monkey TNALP (M026 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene also led to a much higher mRNA transcript level of transgene cynomolgus monkey TNALP in mouse liver lysate 2 hours and 24 hours post tail -vein-based hydrodynamic injection than control DNA carrying cynomolgus monkey TNALP without a cruciform structure (SEQ ID NO: 264) in RNAseq-based transcriptomic analysis.

[0075] FIG. 20C shows RNA-Seq results with a volcano plot. The circular, non-viral DNA vector according to the present disclosure carrying cynomolgus monkey TNALP (M026 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene had minimal impact on transcriptomic profile of mouse liver while the circular, non-viral DNA vector carrying cynomolgus monkey TNALP without cruciform structure (SEQ ID NO: 264) causes profound disturbance in transcription level. This data suggests that the one or more extended cruciform structures incorporated in the circular, non-viral DNA vector according to the present disclosure carrying cynomolgus monkey TNALP (M026 - SEQ ID NO: 253) might have immunoregulatory function.

[0076] FIGS. 20D, 20E, 20F and 20G illustrate that GO enrichment analysis determined that the circular, non-viral DNA vector according to the present disclosure carrying cynomolgus monkey TNALP (M026 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene had substantially less differentially expressed genes in RNA processing gene ontology groups compared with the circular, non-viral DNA vector carrying cynomolgus monkey TNALP without cruciform structure (SEQ ID NO: 264) at 2 hours and 24 hours post-injection. The data were sorted by the count of differentially expressed genes in each group, respectively.

[0077] FIGS. 20H, 201, 20J and 20K illustrate that transcriptome analysis further revealed that the circular, non-viral DNA vector according to the present disclosure carrying cynomolgus monkey TNALP (M026 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene has much less transcript changes in individual gene transcripts of negative regulation of transcription, DNA- templated pathway, innate immune response pathway, immune response and chemocytokines compared with the circular, non-viral DNA vector carrying cynomolgus monkey TNALP without cruciform structure (SEQ ID NO: 264) at 2 hours post-injection.

[0078] FIG. 21 illustrates compares the gene expression and durability of firefly luciferase from two different constructs, namely from (i) a circular, non-viral DNA vector capable of forming one or more extended cruciform structures of the present disclosure (M029 - SEQ ID NO: 265; triangles), and (ii) a circular DNA vector comprising two TTR sequences flanking a non-repeating sequence comprising an R6Ky Ori and an RNA-Out bacterial selection marker (M034 - SEQ ID NO: 266; diamonds in post-mitotic human iPSC-derived hepatocytes as described in Example 16. The data reveal that firefly luciferase transgene expression from the circular, non-viral DNA vector of the present disclosure (M029 - SEQ ID NO: 265) capable of forming one or more extended cruciform structures is much higher and more prolonged than the circular DNA vector comprising two ITR sequences flanking a non-repeating sequence comprising an R6Ky Ori and an RNA-Out bacterial selection marker structure (M034 - SEQ ID NO: 266).

[0079] FIG. 22A illustrates the persistence of the circular, non-viral DNA vector of the present disclosure encoding a cynomolgus monkey TNALP (M 26 - SEQ ID NO: 253) capable of forming one or more extended cruciform structures formed from an ITR-R6Ky Ori-ITR of 709 bp with zero CpG content in the transgene in a rodent model through hydrodynamic tail vein injection at 15 pg DNA per mouse per dose as described in Example 17. High plasma ALP activity in mouse plasma was maintained from day 1 to day 183 after double dosing through hydrodynamic tail vein injection (15 pg of DNA per mouse per dose).

[0080] FIG. 22B illustrates the persistence of the circular, non-viral DNA vector of the present disclosure encoding a murine secreted embryonic alkaline phosphatase (SEAP) reporter (M027 - SEQ ID NO: 267) in a rodent model through hydrodynamic tail vein injection at 15 pg DNA per mouse per dose as described in Example 17. High plasma SEAP activity in mouse plasma was maintained from day 1 to day 280 after double dosing through hydrodynamic tail vein injection (15 pg of DNA per mouse per dose).

[0081] FIG. 22C illustrates the persistence of the circular, non-viral DNA vector of the present disclosure encoding a murine secreted embryonic alkaline phosphatase (SEAP) reporter (M032 - SEQ ID NO: 268) in a rodent model through hydrodynamic tail vein injection at 15 pg DNA per mouse per dose as described in Example 17. High plasma SEAP activity in mouse plasma was maintained from day 1 to day 280 after double dosing through hydrodynamic tail vein injection (15 pg of DNA per mouse per dose).

[0082] FIG. 22D illustrates that the DNA vector copy number per diploid cell of three constructs according to the present disclosure (M026 - SEQ ID NO: 253; M027 - SEQ ID NO: 267; M032 - SEQ ID NO: 268) were maintained for 183 days in mouse liver as described in Example 17. Hepatocyte copy number (DNA vector copy number per diploid cell) is represented on the y-axis for the three vectors (M026 - SEQ ID NO: 253; M027 - SEQ ID NO: 267; M032 - SEQ ID NO: 268) represented on the x-axis. Data are visualized as mean plus standard deviation (SD) with replicates illustrated as individual points.

[0083] FIG. 23A illustrates the formation of a non-viral DNA vector comprising (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and (ii) a second portion capable of forming at least one specialized secondary structure, for example an extended cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, wherein the two inverted repeat sequences are separated by a non-repeating nucleotide sequence. Here, the first inverted repeat sequence is operatively arranged as A1-A2-A3-A4-AX-AX-AX. The second inverted repeat sequence is operatively arranged as AX’-AX’-AX’-A4’-A3’-A2’-Ar. The Al’ is the reverse complement of Al, the A2’ is the reverse complement of A2, the A3’ is the reverse complement of A3, the A4’ is the reverse complement of A4, and the AX’ is the reverse complement of AX. In some embodiments, at least one or more pairs of complementary repeat sequences may be added to each of the two inverted repeats.

[0084] FIG. 23B illustrates the formation of a non-viral DNA vector comprising (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and (ii) a second portion capable of forming at least one specialized secondary structure, for example an extended cruciform structure, wherein the second portion comprises a first fragment of a palindromic sequence and a second fragment of a palindromic sequence, wherein the first fragment and second fragment are complementary, and wherein the first fragment of the palindromic sequence and the second fragment of the palindromic sequence are separated by a non-repeating nucleotide sequence.

[0085] DETAILED DESCRIPTION

[0086] The present disclosure provides compositions and methods for the treatment of a disorder, for example a genetic disorder, in a human patient that minimizes deleterious immune responses to the treatment by using a substantially non-immunogenic, non-integrating circular, non-viral, double stranded DNA vector capable of forming one or more specialized secondary structures such as an extended cruciform structure which is capable of long-term, in vivo expression of a therapeutic protein. By using a DNA vector capable of forming one or more specialized secondary structures as described herein to express a therapeutic protein in vivo, significant reductions to patient immune responses, including both innate and adaptive responses, caused by the administration of the DNA vector can be achieved. These improved compositions and methods enhance the duration of transgene expression and re-dosability of the vector, leading to improved therapy in a subject.

[0087] As described herein, these DNA vectors capable of forming, for example, one or more extended cruciform structures are “immunologically quiet” and do not trigger a widespread immunogenic response following administration, unlike vectors that do not contain cruciform structure or contain small hairpin structures with shortened aligned arms (e.g., < 50 bps), for example DD-ITR based DNA vectors.

[0088] The present disclosure also provides isolated, circular, non-integrating, non-viral DNA vectors having new inverted repeats with alternatively arranged repeats, wherein one or more new repeat sequences are operatively arranged to form a first inverted repeat and a second inverted repeat, and wherein the inverted repeats are separated by a non-repeating sequence of appropriate length (e.g., an Ori or other non-repeating sequence described herein). The new combinations of repeat sequences allow for the formation of new cruciform structures via the specific alignment of the repeat sequences and the formation of extended, double-stranded arms (e g., > 80 bps).

[0089] Definitions

[0090] References in the specification to “one embodiment,” “an embodiment,” “an illustrative embodiment,” etc., indicate that the embodiment described may include a particular feature, structure, or characteristic, but every embodiment may or may not necessarily include that particular feature, structure, or characteristic. Moreover, such phrases are not necessarily referring to the same embodiment. Further, when a particular feature, structure, or characteristic is described in connection with an embodiment, it is submitted that it is within the knowledge of one skilled in the art to affect such feature, structure, or characteristic in connection with other embodiments whether or not explicitly described.

[0091] As used herein, the singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. The term “includes” is defined inclusively, such that “includes A or B” means including A, B, or A and B.

[0092] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, e.g., the inclusion of at least about one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (e.g., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0093] As used herein, the terms “comprising,” “including,” “having,” and the like are used interchangeably and have the same meaning. Similarly, “comprises,” “includes,” “has,” and the like are used interchangeably and have the same meaning. Specifically, each of the terms is defined consistent with the common United States patent law definition of “comprising” and is therefore interpreted to be an open term meaning “at least about the following,” and is also interpreted not to exclude additional features, limitations, aspects, etc. Thus, for example, “a vector having components a, b, and c” means that the vector includes at least about components a, b, and c. Similarly, the phrase: “a method involving steps a, b, and c” means that the method includes at least about steps a, b, and c. Moreover, while the steps and processes may be outlined herein in a particular order, the skilled artisan will recognize that the ordering steps and processes may vary.

[0094] As used herein in the specification and in the claims, the phrase “at least about one,” in reference to a list of one or more elements, should be understood to mean at least about one element selected from any one or more of the elements in the list of elements, but not necessarily including at least about one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least about one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least about one of A and B” (or, equivalently, “at least about one of A or B,” or, equivalently “at least about one of A and / or B”) can refer, in one embodiment, to at least about one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least about one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least about one, optionally including more than one, A, and at least about one, optionally including more than one, B (and optionally including other elements); etc.

[0095] As used herein, the term “about” refers to a measurable value such as an amount of the length of a nucleotide sequence, a polynucleotide or polypeptide sequence, dose, time, temperature, plasma level, transcript level, and the like, is meant to encompass + / - 5% of the specified amount.

[0096] The term “extended cruciform” refers to one or more structures contained within or between DNA vectors formed through the interaction of two specifically oriented repeating sequences, for example AAV-derived inverted terminal repeat (ITR) sequences, separated by a small, non-repeating sequence of between about 3 to about 460 base pairs (bps), for example between about 25 and 460 bps, for example a non-repeating sequence comprising a small bacterial origin of replication (Ori), wherein the two repeating sequences align, forming one or more extended cruciform structures containing a Holliday junction and two double-stranded arms of significant length (e.g., 80-110 bps or more), with a loop formed at the end of each extended arm by the non-repeating sequence.

[0097] As used herein, the term “Fc” refers to a human IgG Fc domain. Subtypes of IgG such as IgGl, IgG2, IgG3, and IgG4 are all being contemplated for usage as Fc domains.

[0098] As used herein, the terms “hypophosphatasia” and “HPP” refer to a rare, heritable skeletal disorder caused by, e.g., one or more loss-of-function mutations in the ALPL (alkaline phosphatase, liver / bone / kidney) gene, which encodes tissue-nonspecific alkaline phosphatase (TNALP). HPP can be further characterized as, e g., infantile HPP or perinatal HPP (e.g., benign perinatal HPP or lethal perinatal HPP). For instance, “infantile HPP” describes a patient having HPP that is about three years of age or younger, whereas “perinatal HPP” describes a patient having HPP immediately before or after birth (e.g., one to four weeks after birth). The age of onset of HPP, such as when the subject exhibits symptoms of HPP, can also be categorized as, e.g., perinatal-onset HPP and infantile-onset HPP. Patients with HPP can exhibit symptoms of HPP including, but not limited to, skeletal deformity, hypotonia, mobility impairments, gait disturbance, bone deformity, joint pain, bone pain, bone fracture, muscle weakness, muscle pain, rickets (e.g., defects in growth plate cartilage), premature loss of deciduous teeth, incomplete bone mineralization, elevated blood and / or urine levels of phosphoethanolamine (PEA), PPi, pyridoxal 5 '-phosphate (PLP), hypomineralization, rachitic ribs, hypercal ciuria, short stature, HPP-related seizure, inadequate weight gain, craniosynostosis, and / or calcium pyrophosphate dihydrate crystal deposition (CPPD) in joints leading to, e.g., chondrocalcinosis and premature death. Symptoms of HPP can also include tracheobronchomalacia (TBM) and symptoms of TBM, such as cardiorespiratory arrest, tracheostomy, cardiac arrest, respiratory distress, sputum retention, wheezing, coughing, anoxic spells, cyanosis, bradycardia, tachyarrhythmia, spontaneous hyperextension of the neck, prolonged expiratory breathing phase, failure to thrive, sternal retractions, substemal retractions, intercostal retractions, intermittent or continuous dyspnea, and recurrent bronchitis or pneumonia.

[0099] As provided herein, the terms “identity”, “identical”, “homology”, “homologous”, and the like are used interchangeably to indicate similarity between two sequences. In some embodiments, a transgene sequence for insertion or incorporation into a circular, non-integrating, non-viral DNA vector having an extended cruciform structure of the present disclosure may a have a nucleic acid sequence, or encode an amino acid sequence, with at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99.0% sequence homology or identity to a nucleic acid or amino acid sequence set forth herein. Percent sequence homology or identity is calculated by determining the number of matched positions in aligned sequences, dividing the number of matched positions by the length of an aligned sequence, and multiplying by 100. A matched position refers to a position in which identical amino acids or nucleic acids occur at the same position in aligned sequences.

[0100] The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence homology or identification number (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, etc.) can be determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand- alone version of BLASTZ can be obtained online at fr.com / blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; - o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.

[0101] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, etc.), followed by multiplying the resulting value by 100. For example, the 5' Inverted Repeat Sequence derived from AAV2 sequence of SEQ ID NO: 1 has 106 matches when aligned with the 5' Inverted Repeat Sequence derived from AAV1 sequence set forth in SEQ ID NO: 3, and is 81.5 percent identical to the sequence set forth in SEQ ID NO: 3 (i.e., 106 130 x 100 = 81.53%). It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 81.51, 81.52, 81.53, and 81.54 are rounded down to 81.5, while 81.55, 81.56, 81.57, 81.58, and 81.59 is rounded up to 81.6. It also is noted that the length value will always be an integer.

[0102] The term “log2 fold change” as used herein represents the upregulation, or alternatively, the downregulation of a gene in a treatment condition compared to a control condition, as measured by ratios of mRNA transcript levels as determined by RNA-SEQ. This value is typically reported in logarithmic scale (base 2). Herein, “fold change” is synonymous with the expression ratio of the treatment to control condition and is represented as the log2(ratio) (see, e.g., FIG. 20H-20K). This is described in Quakenbush, J. Microarray data normalization and transformation. Nat Genet Suppl. 32:496-501(2002), incorporated herein by reference. A positive log2 fold change value indicates an increase of expression, while a negative log2 fold change indicates a decrease in expression. Take, for example, wherein a two-fold increase in expression of a certain gene in treatment over control condition (ratio = 2 to 1, or 2 / 1, or 2) is observed, the log base 2 of the ratio 2 (i.e., Iog2(2)) equals 1. See the following series of logarithmic relationships: log2(l) = 0, log2(2) = 1, log2(l / 2) = -1, log2(4) = 2, log2(l / 4) = -2, etc. Although ratios are an intuitive measure of gene expression changes, ratios treat up- and down-regulated genes differently. For example, genes that are up regulated by a factor of 2 have an expression ratio of 2, whereas those that are down regulated by the same factor have an expression ratio of -0.5 (50% decrease). In order to more intuitively compare expression ratio changes, gene expression ratios are log2 -transformed to produce a continuous spectrum of down- and up-regulated genes. As can be seen, the logarithms of expression ratios are treated symmetrically, so that a gene that is upregulated by a factor of 2 (i.e., 2x) compared to control (i.e., doubled) has a log2(ratio) of 1, whereas a gene that is 0.5x compared to control (i.e., halved, or a 50% decrease) has a log2(ratio) of -1. In comparison, a gene with no expression change (i.e., lx) has a log2(ratio) equal to 0.

[0103] The gene expression change descriptive term “by a factor of about 2” as used herein when referring to increased gene expression refers to a changed or experimental value that is 2-times the value of the control or baseline value (i.e., changed / experimental = 30; control / baseline = 15). When describing a decrease of expression of a gene by a “factor of greater than about 2” herein, the control or baseline value is 2-times the value of the changed or experimental value (i.e., changed / experimental = 7.5; control / baseline = 15).

[0104] Therefore, log2(ratio)>l represents an increase in gene expression by greater than a factor of 2, while 0<log2(ratio)<l represents an increase in gene expression less than a factor of 2. For example, a gene that is upregulated by a factor of 4 compared to control (i.e., quadrupled) has a log2(ratio) of 2. As another example, administration of a non-viral DNA vector having extended cruciform structure that mediates an increase in expression of immune response gene X by a factor of 1.25 compared to control (i.e., a 25% increase in gene expression) has a log2 fold change equaling 0.322. In comparison, administration of a non-viral DNA vector without cruciform structure mediating an increase by a factor of 4 (i.e., quadrupled) in expression of the same immune response gene X compared to control (i.e., a 400% increase in gene expression) has a log2 fold change equaling 2 (see, e.g., FIG. 201).

[0105] Similarly, a Iog2(ratio)<-1 represents a gene that is down regulated by more than a factor of 2 (i.e., >50% decrease), while a -l>log2(ratio)<0 represents a gene that is down regulated by less than a factor of 2 (i.e., <50% decrease). For example, a gene that is down regulated by a factor of 4 (i.e., quarter-fold change, a 75% decrease) compared to control (i.e., quartered) has a log2(ratio) of -2. As another example, administration of a non-viral DNA vector without cruciform structure which mediates a decrease in expression of innate immune response gene Y by a factor of 5 compared to control (i.e. an 80% decrease) has a log2 fold change equaling -2.32 (see, e.g., FIG. 201). In comparison, wherein administration of a non-viral DNA vector having extended cruciform structure mediates a decrease in expression of the same innate immune response gene Y by a factor of 1.33 compared to control (i.e., 25% decrease), the log2 fold change equals -0.42.

[0106] As used herein, the terms “operably linked” or “operably associated” refer to a functional relationship between two nucleic acids, wherein the expression, activity, localization, etc., of one of the sequences is controlled by, directed by, regulated by, modulated by, etc., the other nucleic acid. The two nucleic acids are said to be operably linked or operably associated or in operable association. “Operably linked” or “operably associated” can also refers to a relationship between two polypeptides wherein the expression of one of the polypeptides is controlled by, directed by, regulated by, modulated by, etc., the other polypeptide. For example, transcription of a nucleic acid is directed by an operably linked promoter; post-transcriptional processing of a nucleic acid is directed by an operably linked processing sequence; translation of a nucleic acid is directed by an operably linked translational regulatory sequence such as a translation initiation sequence; transport, stability, or localization of a nucleic acid or polypeptide is directed by an operably linked transport or localization sequence such as a secretion signal sequence; and post-translational processing of a polypeptide is directed by an operably linked processing sequence. Typically, a first nucleic acid sequence that is operably linked to a second nucleic acid sequence, or a first polypeptide that is operatively linked to a second polypeptide, is covalently linked, either directly or indirectly, to such a sequence, although any effective three-dimensional association is acceptable. One of ordinary skill in the art will appreciate that multiple nucleic acids, or multiple polypeptides, may be operably linked or associated with one another.

[0107] As used herein, the term “Poll” refers to Escherichia coli DNA Polymerase I. As used herein, the term “PolIII” refers to Escherichia coli DNA Polymerase III.

[0108] As used herein, the term “Poll-dependent origin of replication” refers to a replication origin that requires Pol I, for example the pMBl, ColEl or pBR322 or derivatives thereof such as the high copy pUC origin. For these origin of replications the RNAII primer forms an RNA:DNA R-loop that is cleaved by RNasell to create a primer for DNA pol I-directed DNA synthesis. DNA synthesis then converts to DNA pol III. Numerous additional Poll-dependent replication origins are known in the art, many of which are summarized in del Solar et al. Microbiol Mol Biol Rev. 62:434-464(1998) which is incorporated herein by reference.

[0109] As used herein, the term “PolIII-dependent origin of replication” refers to a replication origin that does not require Poll, for example the rep protein-dependent R6K gamma replication origin. Numerous additional PolIII dependent replication origins are known in the art, many of which are summarized in Solar et al. Microbiol Mol Biol Rev. 62:434-464(1998) which is incorporated herein by reference.

[0110] As used herein, the term “promoter,” as used herein, refers to a DNA sequence that determines the site of transcription initiation for an RNA polymerase. Promoter sequences comprise motifs which are recognized and bound by polypeptides, i.e., transcription factors. The said transcription factors shall upon binding recruit RNA polymerases II, preferably, RNA polymerase I, II or III, more preferably, RNA polymerase II or III, and most preferably, RNA polymerase II. Thereby will be initiated the expression of a nucleic acid operatively linked to the transcription control sequence. It is to be understood that dependent on the type of nucleic acid to be expressed, expression as meant herein may comprise transcription of DNA sequences into RNA polynucleotides (as suitable for, e.g., anti-sense approaches, RNAi approaches or ribozyme approaches) or may comprise transcription of DNA sequences into RNA polynucleotides followed by translation of the said RNA polynucleotides into polypeptides (as suitable for, e.g., gene expression and recombinant polypeptide production approaches). In order to govern expression of a nucleic acid sequence, the transcription control sequence may be located immediately adjacent to the nucleic acid to be expressed, i.e., physically linked to the said nucleic acid at its 5' end. Alternatively, it may be located in physical proximity. In the latter case, however, the sequence must be located so as to allow functional interaction with the nucleic acid to be expressed.

[0111] As used herein, the term “R6K replication origin” or “R6K origin of replication” or “R6K Ori” refers to a sequence which is specifically recognized by the R6K Rep protein to initiate DNA replication. The term “R6K origin of replication” includes but is not limited to R6Ky replication origin sequences disclosed herein as SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, and SEQ ID NO: 167, and variants thereof. The R6K origin of replication includes CpG free versions (e.g., SEQ ID NO: 164) as described in Droeourt et al., United States Patent No. 7244609, incorporated herein by reference.

[0112] As used herein, the terms “regulatory sequence” or “regulatory element” refer to a nucleic acid sequence that regulates one or more steps in the expression (particularly transcription, but in some cases other events such as splicing or other processing) of nucleic acid sequence(s) with which it is operatively linked. The term includes promoters, enhancers, and other transcriptional control elements that direct or enhance transcription of an operatively linked nucleic acid. Regulatory sequences may direct constitutive expression (e.g., expression in most or all cell types under typical physiological conditions in culture or in an organism), cell type specific, lineage specific, or tissue specific expression, and / or regulatable (inducible or repressible) expression. For example, expression may be induced or repressed by the presence or addition of an inducing agent such as a hormone or other small molecule, by an increase in temperature, etc. Non-limiting examples of cell type, lineage, or tissue specific promoters appropriate for use in mammalian cells include lymphoid-specific promoters (see, for example, Calame et al., Adv. Immunol. 43:235, 1988) such as promoters of T cell receptors (see, e.g., Winoto et al., EMBO J. 8:729, 1989) and immunoglobulins (see, for example, Baneiji et al., Cell 33:729, 1983; Queen et al., Cell 33:741, 1983), and neuron-specific promoters (e.g., the neurofilament promoter; Byrne et al., Proc. Natl. Acad. Sci. USA 86:5473, 1989). Developmentally regulated promoters include hox promoters (see, e.g., Kessel et al., Science 249:374, 1990) and the a-fetoprotein promoter (Campes et al., Genes Dev. 3:537, 1989). Some regulatory elements may inhibit or decrease expression of an operatively linked nucleic acid. Such regulatory elements may be referred to as “negative regulatory elements.” A regulatory element whose activity can be induced or repressed by exposure to an inducing or repressing agent and / or by altering environmental conditions is referred to herein as a “regulatable” element.

[0113] As used herein, the term “RNA selectable marker” refers to a non -translated RNA that is expressed within a plasmid or vector that regulates a chromosomally-expressed target gene in a host cell to allow for selection of the plasmid or vector from the host cell. In some embodiments, the non-translated RNA comprises a tRNA. In some embodiments, the non-translated RNA comprises an antisense repressor RNA. In some embodiments, the non-translated RNA comprises an engineered repressor RNA or a synthetic small RNA. In some embodiments, the RNA selectable marker is RNA-OUT. In some embodiments, the RNA selectable marker is RNA-IN.

[0114] As used herein, the term “signal peptide” refers to a short peptide (about 5 to about 30 amino acids long) at the N-terminus of a polypeptide that directs a polypeptide towards the secretory pathway (e.g., the extracellular space). In some embodiments, the signal peptide is typically cleaved during secretion of the polypeptide. In some embodiments, the signal sequence may direct the polypeptide to an intracellular compartment or organelle. In some embodiments, a signal sequence may be identified by homology, or biological activity, to a peptide with the known function of targeting a polypeptide to a particular region of the cell.

[0115] As used herein, the term “subject,” “host,” and “patient” typically refers to a human. When understood in context, it may alternatively refer to a mammalian subject such as a laboratory animal (e.g., primate, rat, rodent), livestock (e.g., cow, sheep, goat, and pig), or household pets (e g., dog or cat).

[0116] As used herein, the terms “variants” or “variant” refer to a nucleic acid or polypeptide differing from a reference nucleic acid or polypeptide but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the reference nucleic acid or polypeptide.

[0117] Reduced Immunogenicity of DNA Vectors Capable of Forming One or More Specialized Secondary Structures such as Extended Cruciform Structures

[0118] The DNA vectors capable of forming one or more specialized secondary structures such as extended cruciform structures provided herein have shown to have significantly reduced immunogenicity when administered to a host. While not wanting to be limited to one theory, it is proposed that the one or more extended cruciform structures mimic endogenous secondary DNA structures (e.g., cruciform and Holliday junctions), which can bind to nuclear import proteins to facilitate the transcription of a transgene while not provoking a toxic inflammatory response.

[0119] In some embodiments, the DNA vectors capable of forming one or more specialized secondary structure, for example at least one extended cruciform structure, are substantially non- immunogenic, for example, have a reduced likelihood of triggering an immune response as compared with other non-viral DNA vectors, or viral vectors, such as lentiviral vectors, adenoviral vectors, and adeno-associated virus (AAV) vectors. Accordingly, the extended cruciform-forming DNA vectors are capable of being repeatedly dosed.

[0120] In one aspect, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes deleterious immune responses to the treatment in the patient, comprising administering to the patient an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector does not substantially induce an immune response in the patient. In some embodiments, the immune response comprises a humoral or cellular immune response. In some embodiments, the substantial immune response comprises upregulation of genes involved in an innate immune response pathway and / or an adaptive immune response pathway, wherein the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved as measured by mRNA transcript levels. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0121] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response, wherein the genes are Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, and Zbtbl.

[0122] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from at least 16 of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from at least 12 of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0123] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from at least 8 of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0124] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from at least 5 of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0125] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Ankhdl. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Atg9a. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Cls2. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of C3. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Card9. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Cd84. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Cfh. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Fes. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Fga. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Jchain. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Klrkl. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Map3k5. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Maspl . In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Naip5. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Nlrc5. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Oas2. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Sla2. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Slamfl . In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Trdc. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Triml 1. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Txk. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Zbtb 1.

[0126] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0127] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response, wherein the genes are Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0128] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response selected from at least 6 of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0129] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response selected from at least 4 of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0130] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Enpp3. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Iglvl. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of 116. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Map3kl4. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Oas2. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Pf4. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Ppbp. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Tnfrsfl lb. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of Tnfrsf22.

[0131] In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human patient is illustrated by administering the DNA vector to adult BALB / c mice, wherein the DNA vector induces a change in expression of no more than a factor of 2 in mean mRNA transcript levels in the mice of one or more mouse genes in an immune- related pathway compared to mock control, wherein the immune-related pathway is selected from an innate immune response pathway or an immune response pathway. In a non-limiting exemplary assessment, the mice can be administered about 15 pg of the DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, and the one or more mRNA transcript levels measured at between about 2 and 24 hours. In a nonlimiting exemplary assessment, the mean mRNA transcript level of the genes is measured by RNA sequencing (RNA-SEQ) of liver samples of the mice. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice are selected from the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, and / or Zbtbl, or a combination thereof.

[0132] In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice are the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, and Zbtbl.

[0133] In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is selected from at least 16 of the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0134] In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is selected from at least 12 of the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is selected from at least 8 of the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0135] In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is selected from at least 5 of the mouse ortholog of Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof.

[0136] In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Ankhdl. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Atg9a. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Cls2. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of C3. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Card9. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Cd84. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Cfh. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Fes. In some embodiments the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Fga. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Jchain. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Klrkl. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Map3k5. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Maspl. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Naip5. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Nlrc5. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Oas2. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Sla2. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Slamfl . In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Trdc. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Triml 1. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Txk. In some embodiments, the one or more genes analyzed in the innate immune response pathway in the mice is the mouse ortholog of Zbtbl.

[0137] In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is selected from the mouse ortholog of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0138] In some embodiments, the one or more genes analyzed in the immune response pathway in the mice are the mouse ortholog of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0139] In some embodiments, the one or more genes analyzed in the immune response pathway in the mice are selected from at least 6 of the mouse ortholog of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0140] In some embodiments, the one or more genes analyzed in the immune response pathway in the mice are selected from at least 4 of the mouse ortholog of Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof.

[0141] In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Enpp3. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Iglvl . In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of 116. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Map3kl4. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Oas2. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Pf4. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Ppbp. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Tnfrsfl lb. In some embodiments, the one or more genes analyzed in the immune response pathway in the mice is the mouse ortholog of Tnfrsf22.

[0142] Biologically related groups of genes, referred to as “gene ontology (GO) groups” herein, are categorized according to shared biological functions and processes. GO terms were originally classified by the GO Consortium, which was established in 1998 as a collaboration between model organism databases to develop shared vocabularies to annotate molecular characteristics across organisms (Ashburner, M. et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000 May;25(l):25-29)).

[0143] In some embodiments, provided herein is a method for the treatment of a disorder in a human patient, for example, a genetic disorder, that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the genetic disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group G0:0045087 (innate immune response) at about 2- hours post-administration, at about 24-hours post administration, or about 2-hours and about 24- hours post-administration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in mouse G0:0045087 (innate immune response) at about 2-hours post-administration, at about 24-hours post administration, or about 2- hours and about 24-hours post-administration compared to compared to mock control.

[0144] In some embodiments, provided herein is a method for the treatment of a disorder, for example a genetic disorder, in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in an immune- related gene ontology (GO) group G0:0002376 (immune system process) at about 2-hours postadministration, at about 24-hours post administration, or about 2-hours and about 24-hours postadministration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in mouse G0:0002376 (immune system process) at about 2-hours post-administration, at about 24-hours post administration, or about 2- hours and about 24-hours post-administration compared to compared to mock control.

[0145] In some embodiments, provided herein is a method for the treatment of a disorder in a human patient, such as a genetic disorder, that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group G0:0006955 (immune response) at about 2-hours post-administration, at about 24-hours post administration, or about 2-hours and about 24-hours post-administration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in mouse GO: 0006955 (immune response) at about 2-hours postadministration, at about 24-hours post administration, or about 2-hours and about 24-hours postadministration compared to compared to mock control.

[0146] In some embodiments, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in an immune- related gene ontology (GO) group G0:0006955 (immune response) at about 2-hours postadministration, at about 24-hours post administration, or about 2-hours and about 24-hours postadministration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in mouse G0:0006955 (immune response) at about 2-hours post-administration, at about 24-hours post administration, or about 2- hours and about 24-hours post-administration compared to compared to mock control.

[0147] In some embodiments, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in each of gene ontology (GO) group G0:0045087 (innate immune response), G0:0002376 (immune system process), and G0:0006955 (immune response), at about 2-hours post-administration, at about 24- hours post administration, or about 2-hours and about 24-hours post-administration compared to baseline mRNA transcript levels prior to administration. In some embodiments, the ability of the DNA vector to minimize deleterious immune responses to the treatment in a human is illustrated by administering the DNA vector to adult BALB / c mice, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in mouse gene ontology (GO) group G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), and mouse G0:0006955 (immune response), at about 2-hours post-administration, at about 24-hours post administration, or about 2- hours and about 24-hours post-administration compared to compared to mock control. Improved Transcriptional Regulation Profiles of DNA Vectors Capable of Forming One or More Specialized Structures

[0148] In some embodiments, the DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures are substantially have a reduced likelihood of triggering a transcriptional response as compared with other non-viral DNA vectors, or viral vectors, such as lentiviral vectors, adenoviral vectors, and adeno-associated virus (AAV) vectors. Accordingly, the DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, are capable of being repeatedly dosed.

[0149] In one aspect, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes deleterious transcriptional responses to the treatment in the patient, comprising administering to the patient an effective amount of a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures which is capable of expressing at least one therapeutic protein for treating the disorder, wherein administration of the DNA vector does not substantially induce a transcriptional response in the patient. In some embodiments, the substantial transcriptional response comprises differential expression of genes involved in a transcriptional pathway, for example a negative regulation of transcription, DNA-templated pathway, wherein the substantial immune response comprises an expression change by about a factor of 2 or greater of genes as measured by mRNA transcript levels. In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an innate immune response selected from Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0150] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an transcriptional response selected from Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0151] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response selected from at least 6 of Arid4a, Bclafl , Cid, Cirl, Cux2, Dachl , Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0152] In some embodiments, the substantial immune response comprises an expression change by about a factor of 2 or greater of genes involved in an immune response selected from at least 4 of Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0153] In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Arid4a. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Bclafl . In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Cid. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Cirl. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Cux2. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Dachl . In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Deafl . In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Foxgl . In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Hinfp. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Id2. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Ing4. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of KlflO. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Mlxipl. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Mphosph8. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Nkap. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Nrgl. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Pura. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Rest. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Smydl. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Tbx2. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Tmprss6. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Trim 11. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Trim 6. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Wnt4. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Zbtb20. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Zfhx3. In some embodiments, the substantial transcriptional response comprises an expression change by about a factor of 2 or greater of Zfp263.

[0154] In some embodiments, the ability of the DNA vector to minimize deleterious transcriptional responses to the treatment in a human patient is illustrated by administering the DNA vector to adult BALB / c mice, wherein the DNA vector induces a change in expression of no more than a factor of 2 in mean mRNA transcript levels in the mice of one or more mouse genes in an transcriptional-related pathway compared to mock control, wherein the transcriptional- related pathway is negative regulation of transcription, DNA-templated pathway. In a non-limiting exemplary assessment, the mice can be administered about 15 pg of the extended cruciform- forming DNA vector and the one or more mRNA transcript levels measured at between about 2 and 24 hours. In a non-limiting exemplary assessment, the mean mRNA transcript level of the genes is measured by RNA sequencing (RNA-SEQ) of liver samples of the mice. In some embodiments, the one or more genes analyzed in the negative regulation of transcription, DNA- templated pathway in the mice are selected from the mouse ortholog of Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11 , Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0155] In some embodiments, the one or more genes analyzed in the negative regulation of transcription, DNA-templated pathway in the mice is selected from at least 16 of the mouse ortholog of Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0156] In some embodiments, the one or more genes analyzed in the negative regulation of transcription, DNA-templated pathway in the mice is selected from at least 12 of the mouse ortholog of Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0157] In some embodiments, the one or more genes analyzed in the negative regulation of transcription, DNA-templated pathway in the mice is selected from at least 8 of the mouse ortholog of Arid4a, Bclafl, Cid, Cirl, Cux2, Dachl, Deafl, Foxgl, Hinfp, Id2, Ing4, KlflO, Mlxipl, Mphosph8, Nkap, Nrgl, Pura, Rest, Smydl, Tbx2, Tmprss6, Trim 11, Trim 6, Wnt4, Zbtb20, Zfhx3, and / or Zfp263, or a combination thereof.

[0158] In an additional aspect, provided herein is a method for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes transcriptional responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, nonintegrating, non-viral DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, as described herein and a nucleic acid encoding at least one therapeutic protein for treating the genetic disorder operatively linked to a promoter, wherein administration of the DNA vector induces an expression change by about a factor of 2 in mRNA transcript levels in no more than 5 expressed genes in a transcriptional-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, at 2-hours post-administration, at 24-hours post administration, or 2-hours and 24-hours post-administration compared to baseline. In some embodiments, the ability of the DNA vector to minimize deleterious transcriptional responses to the treatment in human is established by administering 15 ug of the DNA vector to adult BALB / c mice, wherein the DNA vector induces an expression change by about a factor of 2 in mean mRNA transcript levels in the mice in no more than 5 expressed genes in an transcriptional-related gene ontology (GO) group selected from mouse GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), mouse GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), mouse GO: 0006397 (mRNA processing), mouse GO: 0008380 (RNA splicing), mouse G0:0006357 (regulation of transcription from RNA polymerase II promoter), mouse G0:0006355 (regulation of transcription, DNA-templated), mouse G0:0006351 (transcription, DNA- templated), or a combination thereof, at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration compared to mock control. In some embodiments, differentially expressed genes are measured based on the transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

[0159] In some embodiments, the deleterious immune response is measured in a sample of a subject using an RNA sequencing (RNA-SEQ) assay.

[0160] DNA Vectors Capable of Forming One or More Specialized Secondary Structures

[0161] The present disclosure includes compositions and methods for the treatment of a disorder in a human patient, for example a genetic disorder, that minimizes deleterious immune responses to the treatment whereby a DNA vector capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, is administered to the patient, and wherein the patient does not develop a significant or substantial reactive immune response to the treatment. These DNA vectors described herein provide for increased nucleus entry, episomal stability, and long-term transgene expression, and have unique and highly unexpectedly reduced immunogenicity. In an illustrative embodiment, the extended cruciform structures in the DNA vector are stabilized through the interaction of two specifically oriented repeating sequences separated by a small, non-repeating sequence, for example a non-repeating sequence comprising a small bacterial origin of replication (Ori). Importantly, when the non-repeating sequence comprises a small bacterial Ori, the non-repeating sequence does not include a bacterial selection marker. By specifically orienting these two repeating sequences to flank a non-repeating sequence of particular size, for example less than about 460 base-pairs (bps), the two repeating sequences align, forming one or more extended cruciform structures containing a Holliday junction and two double-stranded arms of significant length (e.g., 80-110 bps or more), with a loop formed at the end of each extended arm by the non-repeating sequence (see, e.g., FIG. 1A, FIG. IB, FIG. 1C, and FIG. 3). Importantly, the loop formed at the end of each extended arm by the non-repeating sequence may also form additional structures, adding to the stability of the DNA vector (see, e.g., FIG. ID, FIG. IE, FIG. 2A, FIG. 2B, FIG. 2C, FIG. 2D, and FIG. 2E).

[0162] Comparatively, using a single ITR in a circular DNA vector, or failing to sufficiently spatially orient the repeating sequences using an appropriately sized non-repeating sequence, results in one or more hairpin-like structures or short cruciform structures with shorter aligned arms (e.g., less than 50 bps). Surprisingly, the inclusion of a bacterial selection marker within the non-repeating sequence, for example an RNA-Out selection marker, reduces the efficacy and persistence of transgene expression (see, e.g., Example 16, FIG. 21, comparing the extended- cruciform-forming DNA vector having the sequence of SEQ ID NO: 265 comprising two ITR sequences flanking a non-repeating sequence comprising an R6Ky Ori and no bacterial selection marker with, in contrast, the DNA vector having the sequence of SEQ ID NO: 266 and containing two ITR sequences flanking a non-repeating sequence comprising an R6Ky Ori and an RNA-Out bacterial selection marker). Accordingly, significant advantages in nucleus entry, transgene expression and persistence, and reduced immunogenicity are achieved with the circular DNA vectors of the present invention capable of forming one or more extended cruciform structures, making these DNA vectors particularly useful in human gene therapy applications.

[0163] Importantly, the DNA vectors capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, provided herein do not comprise or form an AAV ITR-DD element, that is an ITR having both a D element and D’ element in the inverted terminal repeat (a “double-D ITR”), as commonly observed with recombinant AAV vectors in vivo (see, e.g., Schnepp et al., Recombinant Adeno- Associated Virus Vector Genomes Take the Form of Long-Lived, Transcriptionally Competent Episomes in Human Muscle. Hum Gene Ther. 2016 Jan 1; 27(1): 32-42). As shown herein, such vectors having a double-D ITR have decreased transgene expression and persistence compared to the DNA vectors capable of forming one or more extended cruciform structures (see, e.g., FIGS. 19A, 19B and 19C). The DNA vectors for use in the present invention comprise a nucleic acid sequence which forms at least about one specialized secondary structure, for example an extended cruciform structure. These extended cruciform structures, for example, are highly stable and durable with advantageous free energies and melting temperatures based on in silica modeling (see, e.g., FIG. 2E). As depicted in FIG. IB, a cruciform structure is formed between specific repeat elements. Due to the nature of these repeats, however, a cruciform may be formed between other repeat elements, or between the inverted repeat sequences and the remainder of the non-viral DNA vector. In some embodiments, the inverted repeat elements may also be discontinuous, with regions of non-base paired or single-stranded DNA. One such region containing non-base paired or singlestranded DNA is in the region comprising the non-repeating nucleotide sequence, for example an Ori sequence, having at least about between about 25 and about 460 base-pairs, which is internal to the one or more cruciform structures (see FIG. 1A). Given the components of the non-viral DNA vectors of the present disclosure, it is believed that at least about two inverted repeat sequences, each separated by a non-repeating nucleotide sequence having at least about 3 base pairs and facilitates the formation of a single extended cruciform structure having two long arms capped by a loop region of single-stranded DNA. In some embodiments, the non-repeating nucleotide sequence comprises between about 3 and 460 base-pairs, for example between about 25 and 460 base-pairs. In some embodiments, the nucleic acid sequence which forms a cruciform has a predicted Gibbs free energy (KJ / mol) of between about 300 and about 600, between about 350 and about 550, or between about 400 and about 500. In some embodiments, the nucleic acid sequence which forms a cruciform has a normalized predicted Gibbs free energy (KJ / mol / bp) of between about -0.5 and about -0.75, between about -0.525 and about -0.725, between about -.055 and about -0.7, or between about -0.575 and about -0.675. In some embodiments, the nucleic acid sequence which forms a cruciform has a predicted melting temperature (Tm) in a composition of between about 92°C and about 96°C, between about 92.5°C and about 95.5°C, between about 93°C and about 95°C, or between about 93.5°C and about 94.5°C, wherein the nucleic acid sequence is at a concentration of about 400 nM, and wherein the composition further comprises 50 mM salt and 2.5 mM magnesium (Mg).

[0164] In some embodiments, the specialized secondary structure formed is another non-canonical B-DNA forming secondary structures like hairpin, G-quadruplexes, and i-motifs. In some embodiments, the circular, non-viral DNA vectors are substantially double stranded. In other embodiments, the circular, non-viral DNA vectors are substantially supercoiled. In other embodiments, the substantially supercoiled non-viral DNA vectors comprise one or more regions of negative supercoiling.

[0165] In some embodiments, the DNA vectors provided herein facilitate persistent in vivo expression of one or more genes encoding one or more therapeutic proteins. Without wishing to be bound by any particular theory, it is believed that the DNA vectors provided herein act like an endogenous gene in the nucleus for enhanced persistence of gene expression. In some embodiments, the DNA vectors provided herein persist for a period of at least about 4 weeks after in vivo administration. In other embodiments, the DNA provided herein persist for a period of at least about 6 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 8 weeks after in vivo administration. In other embodiments, the DNA vectors as provided herein persist for a period of at least about 10 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 12 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 14 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 16 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 20 weeks after in vivo administration. In other embodiments, DNA vectors provided herein persist for a period of at least about 24 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 36 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 48 weeks after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 1 year after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 2 years after in vivo administration. In other embodiments, the DNA vectors provided herein persist for a period of at least about 4 years after in vivo administration.

[0166] It is believed that the transgenes carried by the DNA vectors provided herein are taken up by cells and expressed at levels similar to transgene expression from viral vectors; and persist for periods similar to those of non-integrating viral vectors. Without wishing to be bound by any particular theory, it is believed that DNA vectors provided herein act similar to some non- integrating viral vectors by assuming molecular forms that allow for persistent gene expression. Such similarities may be related to chromatin factors that both DNA vectors provided herein and viral vectors interact with or related to chromatin structures assumed by both viral vectors and the DNA vectors of the present disclosure. Chromatin is a term that describes structures that organize DNA within the nucleus of eukaryotic cells. In its simplest conception, chromatin is composed of histone proteins that form nucleosomes on DNA. However, the spacing and modifications of these histones is complex and non-random and provide structural and signaling capacity to the protein scaffold surrounding genes or structural elements. The role of chromatin in virus biology depends largely on the type of virus, but for all viruses that transverse the nucleus, interactions with chromatin is unavoidable. The importance of chromatin dynamics in the regulation of essential viral-vector processes, including entry, gene expression, and persistence is beginning to be understood. The DNA vectors containing an extended cruciform as provided herein are thought to utilize a variety of aspects of chromatin dynamics in a manner akin to viral vectors. Such attributes could include chromatin structures that promote interaction with the nuclear matrix, structures that regulate epigenetic factors influencing gene expression, structures that mediate nuclear organization, or structures that promote active transcriptionally active chromatin status among others.

[0167] The DNA vectors capable of forming one or more specialized secondary structures, for example extended cruciform structures, for use in the present invention comprise: a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and a second portion capable of forming at least one specialized secondary structure, for example an extended cruciform structure, wherein the second portion includes two non-repeating sequences, for example but not limited to two inverted terminal repeat (ITR) sequences, and a non-repeating sequence contained between the two repeating sequences, wherein the ITRs are capable of aligning to form two doublestranded arms of significant length (e.g., at least about 80 bps - about 110 bps or longer), with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the nonrepeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication or fragment thereof, and wherein the second portion lacks a bacterial selection marker. In some embodiments, the DNA vector comprises the following elements operatively linked in a 5' to a 3' direction: (i) a first repeating sequence; (ii) a non-repeating nucleotide sequence of between about 225 bps and about 460 bps, wherein the non-repeating sequence comprises an Ori and lacks a bacterial selection marker; (iii) a second repeating sequence; and (iv) an expression cassette. In some embodiments, the non-repeating sequence is between about 225 bps and about 450 bps. In some embodiments, the non-repeating sequence is between about 390 bps and about 450 bps. In some embodiments, the repeating sequences are inverted terminal repeat sequences derived from an AAV serotype.

[0168] In an alternative, the DNA vector comprises: a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, where each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and a second portion capable of forming at least about one extended cruciform structure, wherein the second portion has the Formula X-Y-X1, where X and X' are each inverted repeat sequences, and where Y is not repeated and comprises a nucleotide sequence having at least about 3 base-pairs, for example at least about 25 base-pairs, but less than about 460 bps. In some embodiments, Y is not repeated and comprises a nucleotide sequence having at least about 25 bps, but less than about 450 bps. In some embodiments, Y is not repeated and comprises a nucleotide sequence having at least about 25 bps, but less than about 350 bps. In some embodiments, Y is not repeated and comprises a nucleotide sequence having at least about 25 bps, but less than about 300 bps. In some embodiments, Y is not repeated and comprises a nucleotide sequence having at least about 25 bps, but less than about 250 bps. The inverted repeating sequences are separated by Y, a non-repeating sequence of appropriate length, allowing the alignment of the inverted repeating sequences and the formation of double-stranded arms of sufficient length, for example at least about 80 bps, at least about 90 bps, at least about 100 bps, or at least about 110 bps in the extended cruciform structure. In some embodiments, the repeating sequences are inverted terminal repeat sequences derived from an AAV serotype.

[0169] In some embodiments, the X and X’ inverted repeats are capable of forming an extended cruciform structure containing two double-stranded arms of between about 80 bps to about 150 bps. In some embodiments, the two double-stranded arms are between about 85 bps to about 140 bps, between about 90 bps to about 130 bps, or between about 100 bps to about 120 bps. In some embodiments, the X inverted repeat sequence is between about 80 bps and about 250 bps. In some embodiments, the X’ inverted repeat sequence is between about 80 bps and about 250 bps. In an alternative, the DNA vector comprises: a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, where each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and a second portion, wherein the second portion comprises a means for forming at least about one extended cruciform comprising a Holliday junction and two DNA double-stranded arms of significant length of at least about 80 bps, and a loop at the end of each extended arm.

[0170] In some embodiments, the expression cassette includes one or more nucleic acid sequences encoding one or more therapeutic proteins, where each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter. In some embodiments, the expression cassette includes one or more of an enhancer and / or promoter, a 3' untranslated region (with or without introns), a translation initiation region, a transgene (protein coding regions, which could themselves be broken down into several components), a 5' untranslated region, and a polyadenylation addition region.

[0171] In some embodiments, the DNA vector provided herein lacks a drug resistance gene. In some embodiments, the DNA vector lacks a selection marker. In some embodiments, the DNA vector includes two inverted repeat sequences separated by the non-repeated nucleotide sequence; where the vector further includes at least about a portion of a bacterial origin of replication, and wherein the at least about the portion of the bacterial origin of replication is not included within either of the two inverted repeat sequences or in the non-repeated nucleotide sequence. In some embodiments, the bacterial origin of replication is located adjacent to the nucleic acid encoding the therapeutic protein. In some embodiments, the DNA vector includes one or more recombination sites, e.g., LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, e.g., Lox7, Lox511 or Lox66 sites.

[0172] In some embodiments, the DNA vector is substantially devoid of CpG sequences. The DNA vectors described herein having one or more sequences substantially devoid of CpG sequences not only exhibit increased transgene expression (e.g., FIG. 19B-19C), but also exhibit profoundly reduced immunogenicity (see e.g., FIG. 20C).

[0173] In some embodiments, the DNA vector comprises less than about 750 CpG per vector. In some embodiments, the DNA vector comprises less than about 700 CpG per vector. In some embodiments, the DNA vector comprises less than about 600 CpG per vector. Tn some embodiments, the DNA vector comprises less than about 500 CpG per vector. In some embodiments, the DNA vector comprises less than about 400 CpG per vector. In some embodiments, the DNA vector comprises less than about 300 CpG per vector. In some embodiments, the DNA vector comprises less than about 200 CpG per vector. In some embodiments, the DNA vector comprises less than about 150 CpG per vector. In some embodiments, the DNA vector comprises less than about 50 CpG per vector.

[0174] Repeating Sequence

[0175] The specialized secondary structures, for example extended cruciform structures, of the DNA vectors provided herein are formed through the interaction of two specifically oriented repeating sequences, for example AAV-derived or other inverted terminal repeat (ITR) sequences, separated by a small, non-repeating sequence, for example a non-repeating sequence comprising a small bacterial origin of replication (Ori) or other non-repeating sequence described herein. By specifically orienting these two repeating sequences to flank a non-repeating sequence of particular size, for example less than about 460 base-pairs (bps), the two repeating sequences align, forming one or more specialized secondary structures, for example extended cruciform structures containing a Holliday junction and two double-stranded arms of significant length — for example at least about 80 bps, at least about 90 bps, at least about 100 bps, or at least about 110 bps — with a loop formed at the end of each extended arm by the non-repeating sequence.

[0176] For example, the repeating sequences can be derived from any known repeating sequence capable of forming a Holliday junction and two double-stranded arms of significant length — for example at least about 80 bps, at least about 90 bps, at least about 100 bps, or at least about 110 bps — when separated by a non-repeating sequence of sufficient length. In particular embodiments, the repeating sequences are inverted terminal repeat (ITR) sequences derived from an AAV serotype, for example, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AVV6, AVV7, AAV8, or AAV9.

[0177] In some embodiments, each of inverted repeat sequences are nucleic acid sequences which include between about 20 to about 500 bp, from between about 20 bp and about 450 bp, from between about 20 bp to about 400 bp, from between about 20 bp to about 300 bp, from between about 20 bp to about 250 bp, from between about 20 bp to about 200 bp, from between about 20 bp to about 160 bp, from between about 60 bp to about 160 bp, from about 70 bp to about 150 bp, from about 80 bp to about 140 bp, or from about 90 bp to about 130 bp. In some embodiments, each of the inverted repeat sequences have about 115 bp, 116 bp, 117 bp, 118 bp, 119 bp, 120 bp, 121 bp, 122 bp, 123 bp, 124 bp, 125 bp, 126 bp, 127 bp, 128 bp, 129 bp, 130 bp, 131 bp, 132 bp, 133 bp, 134 bp, 135 bp, 136 bp, 137 bp, 138 bp, 139 bp, 140 bp, 141 bp, 142 bp, 143 bp, 144 bp,

[0178] 145 bp, 146 bp 147 bp, 148 bp, 149 bp, or about 150 bp.

[0179] In some embodiments, the ITR sequences are derived from one or more AAV serotypes, for example, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AVV6, AVV7, AAV8, or AAV9. Suitable AAV ITR sequences for use in the present invention include any of SEQ ID NOs: 1-18 as provided for in Table 1, or a sequence at least about 90%, at least about 95%, at least about

[0180] 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.

[0181] Table 1. AAV ITR Sequences

[0182] In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to any one of SEQ ID NOs: 1 - 19. In some embodiments, each of the inverted repeat sequences have a nucleic acid sequence having a nucleic acid sequence of any one of SEQ ID NOs: 1 - 19.

[0183] In some embodiments, each of the inverted repeat sequences comprise or are derived from AAV inverted terminal repeat elements (e.g., derived from elements of an AAV serotype, such as any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, and / or AAV7). For instance, each of the inverted repeat groups may include one or more of the A, A', B, B1, C, C, D, and / or D' elements of inverted terminal repeat elements from one or more AAV serotypes. Particularly suitable AAV ITR elements are provided in Table 2. Table 2. ITR Element Sequences

[0184] In some embodiments, the ITR comprises a 5' A element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 20). In some embodiments, the ITR comprises a 5' A element comprising TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 20). In some embodiments, the ITR comprises a 3' A element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99%identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 21). In some embodiments, the ITR comprises a 3' A element comprising GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 21). In some embodiments, the ITR comprising a 5' B element comprises at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to CGGGCGACC (SEQ ID NO: 22). In some embodiments, the ITR comprises a 5' B element comprising CGGGCGACC (SEQ ID NO: 22). In some embodiments, the ITR comprises a 3' B element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to GGTCGCCCG (SEQ ID NO: 23). In some embodiments, the ITR comprises a 3' B element comprising GGTCGCCCG (SEQ ID NO: 23). In some embodiments, the ITR comprises a 5' C element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to CGCCCGGGC (SEQ ID NO: 24). In some embodiments, the ITR comprises a 5' C element comprising CGCCCGGGC (SEQ ID NO: 24). In some embodiments, the ITR comprises a 3' C element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to GCCCGGGCG (SEQ ID NO: 25). In some embodiments, the ITR comprises a 3' C element comprising GCCCGGGCG (SEQ ID NO: 25). In some embodiments, the comprises a 5' D element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 26). In some embodiments, the ITR comprises a 5' D element comprising AGGAACCCCTAGTGATGGAG (SEQ ID NO: 26). In some embodiments, the ITR comprises a 3' D element comprising at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 27). In some embodiments, the comprises a 3' D element comprising CTCCATCACTAGGGGTTCCT (SEQ ID NO: 27).

[0185] In some embodiments, a first inverted repeat sequence may have the Formula D — A-C- C'-B-B'-A1, whereas a second inverted repeat sequence may have the Formula -A-B-B'-C-C- A'-D'. In some embodiments, a first inverted repeat sequence may have the Formula D — A-C- C'-B-B'-A', whereas a second inverted repeat sequence may have the Formula -A-B-B'-C-C- A'-D', but do not include a DD element as described herein. In some embodiments, a first inverted repeat sequence may have the Formula D — A-B-B'-C-C'-A', whereas a second inverted repeat sequence may have the Formula -A-C-C'-B-B'-A'-D'. In some embodiments, a first inverted repeat sequence may have the Formula D — A-B-B'-C-C'-A', whereas a second inverted repeat sequence may have the Formula -A-C-C'-B-B'-A'-D', but do not include a DD element as described herein.

[0186] As provided herein, the DNA vectors provided herein do not include or form a DD-ITR, "double D" ITR, or "DD element.” Surprisingly, Applicant has discovered that the presently disclosed non-viral DNA vectors capable of forming one or more specialized secondary structures, for example one or more extended cruciform structures, which are devoid of a "DD element” direct higher amounts of linked heterologous gene expression and may persist in vivo as long, or longer, as those vectors which do include a "DD element." Furthermore, the structure of the repeat elements within the non-viral DNA vector of the present disclosure are not formed through the process of circularization of a viral genome (e.g., an AAV genome, or AAV vector genome) or linear DNA fragment via the inverted terminal repeat sequences.

[0187] In an alternative embodiment, the one or more repeat sequences are derived from SEQ ID NOs: 20-162 (see Table 3), or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.

[0188] Table 3: Repeat Sequences

[0189]

[0190]

[0191] In some embodiments, the second portion of the DNA vector comprises a first inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 20-162, or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto; a non-repeating nucleic acid sequence; and a second inverted repeat sequence comprising one or more repeat sequences selected from SEQ ID NOs: 20-162, or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at about least 98%, or at least about 99% identical thereto.

[0192] In an aspect of the present disclosure, provided herein is an isolated, circular, extended cruciform structure-containing, non-integrating, non-viral DNA vector comprising: a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, where each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and a second portion capable of forming at least one extended cruciform structure, wherein the second portion has the Formula X- Y-X', where X and X' are each inverted repeat sequences each comprising one or more repeat sequences selected from SEQ ID NOs: 20-162, or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto, and where Y is not repeated and comprises a nucleotide sequence having at least 25 base- pairs, but less than about 460 bps. In some embodiments, the X and X’ inverted repeats form an extended cruciform structure containing two double-stranded arms of between about 80 bps to about 150 bps. In some embodiments, the two double-stranded arms are between about 85 bps to about 140 bps, between about 90 bps to about 130 bps, or between about 100 bps to about 120 bps. In some embodiments, the X inverted repeat sequence is between about 80 bps and about 250 bps. In some embodiments, the X’ inverted repeat sequence is between about 80 bps and about 250 bps.

[0193] In some embodiments, the X inverted repeat sequence is operatively arranged as A1-A2, wherein the X’ inverted repeat sequence is operatively arranged as A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2.

[0194] In some embodiments, the X inverted repeat sequence is operatively arranged as A1-A2- A3, wherein the X’ inverted repeat sequence is operatively arranged as A3’-A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2, wherein A3’ is the reverse complement of A3.

[0195] In some embodiments, the X inverted repeat sequence is operatively arranged as A1-A2- A3-A4, wherein the X’ inverted repeat sequence is operatively arranged as A4’-A3’-A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2, wherein A3’ is the reverse complement of A3, wherein A4’ is the reverse complement of A4.

[0196] In some embodiments, the X inverted repeat sequence is operatively arranged as A1-A2- A3-A4-AX, wherein the X’ inverted repeat sequence is operatively arranged as AX’-A4’-A3’- A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2, wherein A3’ is the reverse complement of A3, wherein A4’ is the reverse complement of A4, wherein AX’ is the reverse complement of AX, and wherein AX and AX’ represents the addition of at least one or more further complementary repeat sequences to be added to the X and X’ inverted repeat sequences, respectively.

[0197] In some embodiments, the AX repeats comprise identical repeat sequences. In some embodiments, the AX repeats comprise different repeat sequences. In some embodiments, the X inverted repeat sequence is operatively arranged as A1-A2-A3-A4-AX-AX, wherein the X’ inverted repeat sequence is operatively arranged as AX’-AX’-A4’-A3’-A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2, wherein A3’ is the reverse complement of A3, wherein A4’ is the reverse complement of A4, wherein AX’ is the reverse complement of AX. In some embodiments, the X inverted repeat sequence is operatively arranged as A1 -A2- A3-A4-AX-AX-AX, wherein the X’ inverted repeat sequence is operatively arranged as AX’- AX’-AX’-A4’-A3’-A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2, wherein A3’ is the reverse complement of A3, wherein A4’ is the reverse complement of A4, wherein AX’ is the reverse complement of AX.

[0198] In some embodiments, the X inverted repeat sequence is operatively arranged as A1-A2- A3-A4-AX-AX-AX-AX, wherein the X’ inverted repeat sequence is operatively arranged as AX’- AX’-AX’-AX’-A4’-A3’-A2’-A1’, wherein Al’ is the reverse complement of Al, wherein A2’ is the reverse complement of A2, wherein A3’ is the reverse complement of A3, wherein A4’ is the reverse complement of A4, wherein AX’ is the reverse complement of AX.

[0199] In some embodiments, Al is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0200] In some embodiments, A2 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0201] In some embodiments, A3 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0202] In some embodiments, A4 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0203] In some embodiments, AX is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0204] In some embodiments, Al’ is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0205] In some embodiments, A2’ is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0206] In some embodiments, A3’ is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0207] In some embodiments, A4’ is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

[0208] In some embodiments, AX’ is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto. The inverted repeat sequences are separated by Y, a non-repeating sequence of appropriate length, allowing the alignment of the inverted repeating sequences and the formation of doublestranded arms of sufficient length, for example at least about 80 bps, at least about 90 bps, at least about 100 bps, or at least about 110 bps in the extended cruciform structure. In some embodiments, Y forms loops at the ends of the double-stranded arms in the extended cruciform structure.

[0209] In some embodiments, the inverted repeats are substantially devoid of CpG sequences. In some embodiments, the inverted repeats comprise less than about 100 CpG, less than about 75 CpG, less than about 50 CpG, less than about 25 CpG, less than about 20 CpG, less than about 15 CpG, less than about 10 CpG, etc.

[0210] Non-repeating Nucleic Acid Sequence

[0211] The repeat sequences used to form the extended arms of the specialized secondary structures, for example an extended cruciform structure, are contiguous with and flank the nonrepeated nucleic acid sequence. In general, the non-repeating sequence can be any suitable sequence that allows for the formation of, for example, one or more extended cruciform structures, for example a non-repeating sequence of at least about 3 bps. In some embodiments, the nonrepeating sequence is between about 25 bps and 460 bps.

[0212] The non-repeating sequence provides appropriate spacing for the ITR sequences, allowing the ITR sequences to appropriately align to form the double-stranded extended arms of, for example, a cruciform, with the non-repeating sequence forming a loop between the aligned repeating sequences at the top of each extended arm. The DNA sequence elements that lead to the formation of one or more specialized secondary structures, for example one or more extended cruciform structures, may contain additional secondary structure that stabilizes the formation of a larger cruciform structure (see, e.g., FIG. ID). Thus, in some embodiments, the non-repeating sequence may contribute additional structure to the DNA vector, thus further enhancing the stability of the DNA vector. In some embodiments, the non-repeating sequence comprises a bacterial origin of replication (Ori) having a sequence of between about 225 bps and about 400 bps. In some embodiments, the non-repeating sequence comprises an Ori having a sequence of less than about 400 bps. In some embodiments, the non-repeating sequence comprises an Ori having a sequence of less than about 350 bps. In some embodiments, the non-repeating sequence comprises an Ori having a sequence of less than about 300 bps. In some embodiments, the non- repeating sequence comprises an Ori of between about 375 bps and about 400 bps. In some embodiments, the non-repeating sequence comprises an Ori of between about 290 bps and about 310 bps. In some embodiments, the non-repeating sequence comprises an Ori of between about 235 bps and about 260 bps.

[0213] In some embodiments, the Ori is derived from pR6K (see, e.g., Rakowski et al., Plasmid R6K Replication Control. Plasmid. 2013 May; 69(3): 231-242, incorporated herein by reference). In some embodiments, the Ori is derived from R6Ky. In some embodiments, the R6K-derived Ori has been modified to reduce CpG content, e.g., to reduce CpG content by at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 25%, at least about 20%, at least about 10%, at least about 5%, etc. In some embodiments, the Ori includes one or more internal direct repeat sequences.

[0214] In some embodiments, the Ori is capable of forming one or more regions of internal secondary structure which are believed to assist in helping to maintain the cruciform structure.

[0215] In some alternative embodiments, the Ori is derived from an origin or replication from pMBl, pBR322, ColEl, pl 5 A, pSClOl, or Fl plasmids.

[0216] In some embodiments, the bacterial origin of replication is selected from any of one of SEQ ID NOS: 163-167 as provided in Table 4, or a nucleic sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.

[0217] In some embodiments, Y is a non-repeating nucleic acid sequence comprising an Ori selected from the sequences of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto.

[0218] Table 4. Bacterial Origin of Replication

[0219] In some embodiments, in addition to an Ori sequence, the non-repeating sequence may contain additional DNA sequences, for example, small runs of extraneous and or spacer nucleotide sequences (e g., from about 1 bp to about 20 bps), cloning or recombination sites, and / or other sites such as LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, e.g., Lox511 or Lox66 sites, provided that such additional DNA sequences do not unduly interfere with the formation or function of the extended cruciform. As provided herein, the DNA vectors capable of forming one or more extended cruciforms, wherein the non-repeating sequence comprises an Ori, does not include a bacterial selection marker, for example, a drug resistance gene or an RNA-based selectable marker such as an RNA-IN or RNA-Out selectable marker, within the non-repeating sequence forming an extended cruciform structure.

[0220] In alternative embodiments, the non-repeating sequence comprises a heterologous gene or a portion of a heterologous gene. In alternative embodiments, the non-repeating sequence comprises a bacterial suppressor tRNA. In alternative embodiments, the non-repeating sequence comprises a bacterial RNAi repressor. In alternative embodiments, the non-repeating sequence comprises a nucleic acid sequence encoding antisense RNA. In alternative embodiments, the nonrepeating sequence comprises a bacterial operator sequence. In some embodiments, the bacterial operator sequence comprises a lac operator. In some embodiments, the bacterial operator sequence comprises a tet operator.

[0221] In some embodiments, the non-repeating sequence lacks a drug resistance gene. In some embodiments, the non-repeating sequence lacks a selection marker. In some embodiments, the non-repeating sequence does not include a bacterial selection marker, for example, a drug resistance gene or an RNA-based selectable marker such as an RNA-IN or RNA-Out selectable marker.

[0222] In some embodiments, the non-repeating sequence comprises AGTACAAATTG (SEQ ID NO: 240) or ACCTTAGAGGCTA (SEQ ID NO: 241).

[0223] Nucleic Acid Sequences Capable of Forming One or More Specialized Secondary Structures

[0224] The secondary specialized structures of the DNA vectors provided herein are formed through the interaction of two specifically oriented repeating sequences, for example AAV-derived inverted terminal repeat (ITR) sequences or other inverted repeat sequences, separated by a small, non-repeating sequence, for example a non-repeating sequence comprising a small bacterial origin of replication (Ori) or other non-repeating sequence described herein.

[0225] In some embodiments, the nucleic acid capable of forming one or more specialized structures, for example an extended cruciform structure, comprises a first nucleic acid sequence comprising a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a nucleic acid sequence at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identical thereto; a second nucleic acid comprising a sequence selected from SEQ ID NOs: 163-167, or a nucleic acid at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identical thereto; and a third nucleic acid sequence comprising a sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 19, or a nucleic acid at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identical thereto.

[0226] In some embodiments, the second portion of the DNA vector comprises a first inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 20-162, or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto; a non-repeating nucleic acid sequence comprising an Ori having any one of SEQ ID NOs: 163-167, or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto; and a second inverted repeat sequence comprising one or more repeat sequences selected from SEQ ID NOs: 20-162, or a sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at about least 98%, or at least about 99% identical thereto. In some embodiments, the second portion of the DNA vector comprises a nucleic acid sequence selected from a sequence of SEQ ID NOs: 168, 173, 175, or 176 (provided in Table 5), or a nucleic acid at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% identical thereto.

[0227] Table 5. Second Portion Sequences

[0228] Nucleic Acid Sequence Encoding A Therapeutic Protein

[0229] The DNA vectors for use in the methods provided herein include an expression cassette (or “first portion”) including one or more nucleic acid sequences encoding one or more therapeutic proteins. In some embodiments, the DNA vectors provided herein include one or more nucleic acid sequences encoding one or more reporter genes. In yet other embodiments, the DNA vectors provided herein include one or more heterologous genes encoding one or more therapeutic proteins. Particularly suitable therapeutic proteins and their encoding sequences are provided for in Table 6.

[0230] In some embodiments, the one or more nucleic acid sequences encoding the one or more therapeutic proteins ranges in size from between about 1 Kb to about 150 Kb, e.g., from between about 1 Kb to about 120 Kb, from between about 1 Kb to about 100 Kb, from between about 1 Kb to about 80 Kb, from between about 1 Kb to about 60 Kb, from between about 1 Kb to about 40 Kb, from between about 1 Kb to about 30 Kb, from between about 1 Kb to about 25 Kb, from between about 1 Kb to about 20 Kb, from between about 1 Kb to about 15 Kb, from between about 1 Kb to about 12 Kb, from between about 1 Kb to about 11 Kb, from between about 1 Kb to about 10 Kb, from between about 1 Kb to about 9 Kb, from between about 1 Kb to about 8 Kb, from between about 1 Kb to about 7 Kb, from between about 1 Kb to about 6 Kb, etc. In some embodiments, the one or more nucleic acid sequences encoding the one or more therapeutic proteins has a size of about 5 Kb, about 6 Kb, about 7 Kb, about 7.5 Kb, about 8 Kb, about 8.5 Kb, about 9 Kb, about 9.5 Kb, about 10 Kb, about 10.5 Kb, about 11 Kb, about 12 Kb, about 13 Kb, about 14 Kb, about 15 Kb, about 16 Kb, about 17 Kb, about 18 Kb, about 19 Kb, about 20 Kb, about 21 Kb, etc.

[0231] In some embodiments, the therapeutic protein is tissue-nonspecific alkaline phosphatase (TNALP) encoded by the ALPL gene. In some embodiments, the encoded protein is selected from SEQ ID NO: 177-182, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NO: 183, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NO: 197, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0232] In some embodiments, the therapeutic protein is proprotein convertase subtilisin / kexin type 9 encoded by the PCSK9 gene. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 184, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0233] In some embodiments, the therapeutic protein is proprotein convertase subtilisin / kexin type 7 encoded by the PCSK7 gene. In some embodiments, the encoded protein is SEQ ID NO: 214, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 215, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0234] In some embodiments, the therapeutic protein is alpha- 1 antitrypsin encoded by the SerpinAl gene. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 194, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0235] In some embodiments, the therapeutic protein is ATP Binding Cassette Subfamily B Member 4 encoded by the ABCB4 gene. In some embodiments, the encoded protein is SEQ ID NO: 187, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NO: 188 orl 89, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0236] In some embodiments, the therapeutic protein is ATPase Copper Transporting Beta protein encoded by the ATP7B gene. In some embodiments, the encoded protein is SEQ ID NO: 195, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NO: 192 or 193, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0237] In some embodiments, the therapeutic protein is the bile salt export pump (BSEP / ABCBB) protein encoded by the ABCB11 gene. In some embodiments, the encoded protein is SEQ ID NO: 216, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 217, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0238] In some embodiments, the therapeutic protein is an antiCD 19-antiCD3 protein. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 190, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0239] In some embodiments, the therapeutic protein is B-domain deleted FVIII. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 191, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0240] In some embodiments, the therapeutic protein is 1 -acylglycerol -3 -phosphate O- acyltransferase (PLPL3) encoded by the PNPLA3 gene. In some embodiments, the encoded protein is SEQ ID NO: 198, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 199, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0241] In some embodiments, the therapeutic protein is transmembrane 6 superfamily member 2 (TM6SF2) encoded by the TM6SF2 gene. In some embodiments, the encoded protein is SEQ ID NO: 200, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 201, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0242] In some embodiments, the therapeutic protein is fibroblast growth factor 21 encoded by the FGF21 gene. In some embodiments, the encoded protein is SEQ ID NO: 202, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 203, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0243] In some embodiments, the therapeutic protein is laminin subunit alpha-2 (LAMA2) encoded by the LAMA2 gene. In some embodiments, the encoded protein is SEQ ID NO: 204, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 205, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0244] In some embodiments, the therapeutic protein is laminin- 111, comprising a laminin subunit alpha 1 (LAMA1) encoded by the LAMA1 gene, a laminin subunit alpha 2 (LAMA2) encoded by the LAMA2 gene, a laminin subunit beta 1 (LAMB1) encoded by the LAMB 1 gene, a laminin subunit gamma 1 (LAMC1) encoded by the LAMC1 gene, or a combination thereof. In some embodiments, the encoded protein comprises SEQ ID NO: 206, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 208, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 210, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 212, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 207, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 209, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 211, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 213, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0245] In some embodiments, the therapeutic protein is an anti-FGF23 antibody or a fragment thereof. In some embodiments, the encoded protein comprises SEQ ID NO: 218, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 220, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 219, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 221, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0246] In some embodiments, the therapeutic protein is a truncated FGF23 polypeptide. In some embodiments, the encoded protein comprises SEQ ID NO: 222, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 223, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0247] In some embodiments, the therapeutic protein is Collagen IVa345 encoded by COL4A3, COL4A4, and COL4A5 genes. In some embodiments, the encoded protein comprises SEQ ID NO: 224, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 226, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 228, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 225, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 227, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 229, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0248] In some embodiments, the one or more therapeutic proteins are alkaline phosphatase or a variant thereof.

[0249] Table 6. Therapeutic Protein Sequences and Encoding Sequences Thereof

[0250] Ill

[0251] In some embodiments, the non-viral DNA vectors of the present disclosure include one or more nucleic acid sequences encoding an alkaline phosphatase or a variant thereof. In other embodiments, the non-viral DNA vectors of the present disclosure include a nucleic acid sequence encoding a polypeptide including amino acid sequence encoding an alkaline phosphatase. For example, in some embodiments the polypeptide including an amino acid sequence encoding an alkaline phosphatase has any one of the Formulas (IA) to (IE):

[0252] [A]v-[B]-[C]w-[R]q-([D]x-[E]y)z (IA),

[0253] [A]-[B]-[C]-[R]q-([D]x-[E]y) (IB),

[0254] ([A]-[B])-([D]HE]y)z (IC),

[0255] ([A]-[B])-([E]y) (ID), and

[0256] [A]-[B] -[R]q-([E]y) (IE) wherein

[0257] A comprises an amino acid sequence encoding a secretion signal peptide;

[0258] B comprises an amino acid encoding an alkaline phosphatase;

[0259] C comprises an amino acid sequence encoding a GPI anchor;

[0260] R is -(Mo(Fc)Np)-, where M and N each independently include between 1 and 6 amino acids, where Fc is a Fc domain, and o and p are each independently 0, 1, or 2;

[0261] D comprises an amino acid sequence having between 4 and 6 amino acids, or is F(G)tF, where each F is the same amino acid, G is an amino acid sequence having 3, 4, or 5 amino acids, and t is an integer ranging from 2 - 5;

[0262] E comprises an amino acid sequence having between 1 and 8 amino acids; q is 0 or 1; v is 0 or 1; w is 0 or 1; x is 0 or an integer ranging from 1 to 6; y is 0 or an integer ranging from 1 to 16; and z is 0 or an integer ranging from 1 to 6.

[0263] In some embodiments, when v is 1, w is 0, q is 1, o is 1, p is 1, N is the diamino acid -D- I-, M is the diamino acid -L-K-, [B] comprises SEQ ID NO: 182, Fc comprises SEQ ID NO: 231, and x is 0, then [E]y does not comprise ten to sixteen contiguous aspartic acid residues.

[0264] In some embodiments, the polypeptide of any one of the Formulas (IA) to (IE) is not conjugated to a dextran. In other embodiments, the polypeptide of any one of the Formulas (IA) to (IE) is catalytically competent to allow formation of hydroxyapatite crystals in bone.

[0265] In some embodiments, [A] comprises the amino acid sequence of SEQ ID NO: 232, or an amino acid sequence at least about 95% identical thereto. In some embodiments, [A] comprises the amino acid sequence of SEQ ID NO: 234, or an amino acid sequence at least about 95% identical thereto. In some embodiments, the nucleic acid sequence encoding [A] comprises the nucleic acid sequence of SEQ ID NO: 233, or a nucleic acid sequence at least about 95% identical thereto.

[0266] In some embodiments, [A]V-[B] comprises the amino acid sequence of SEQ ID NO: 177, or an amino acid sequence at least about 95% identical thereto, and wherein v=l.

[0267] In some embodiments, [A]V-[B] comprises the amino acid sequence of SEQ ID NO: 180, or an amino acid sequence at least about 95% identical thereto, and wherein v=l.

[0268] In some embodiments, [A]v[B] is encoded by the nucleic acid sequence of SEQ ID NO: 197, or a nucleic acid sequence at least about 95% identical thereto. In some embodiments, [B] comprises the amino acid sequence of SEQ ID NO: 181, or an amino acid sequence at least about 95% identical thereto. In some embodiments, [B] comprises the amino acid sequence of SEQ ID NO: 182, or an amino acid sequence at least about 95% identical thereto.

[0269] In some embodiments, [C] comprises the amino acid sequence of SEQ ID NO: 235, or an amino acid sequence at least about 95% identical thereto. In some embodiments, [C] comprises the amino acid sequence of SEQ ID NO: 236, or an amino acid sequence at least about 95% identical thereto.

[0270] In some embodiments, the polypeptide has the Formula (ID) and comprises the amino acid sequence of SEQ ID NO: 178, or an amino acid sequence at least about 95% identical thereto, wherein v=l, wherein E is the amino acid aspartic acid, and wherein y=10.

[0271] In some embodiments, the polypeptide has the Formula (ID) and comprises the amino acid sequence of SEQ ID NO: 179, or an amino acid sequence at least about 95% identical thereto, wherein v=l, wherein E comprises the amino acid sequence -D-S-S-, and wherein y=6.

[0272] In some embodiments, the polypeptide is encoded by the nucleic acid of SEQ ID NO: 183, or a nucleic acid sequence at least about 95% identical thereto.

[0273] In some embodiments, the polypeptide is encoded by the nucleic acid of SEQ ID NO: 197, or a nucleic acid sequence at least about 95% identical thereto.

[0274] In some embodiments, [R] comprises the amino acid sequence of SEQ ID NO: 230, or an amino acid sequence at least 95% identical thereto.

[0275] In some embodiments, (Fc) comprises the amino acid sequence of SEQ ID NO: 231, or an amino acid sequence at least about 95% identical thereto. In some embodiments, N comprises the dipeptide -D-I- and p is 1 . In some embodiments, N is encoded by the nucleic acid sequence of gatatt.

[0276] In some embodiments, E comprises 3 amino acids. In some embodiments, the 3 amino acids are selected from aspartic acid, serine, lysine, threonine, tyrosine, alanine, methionine, valine, tryptophan, proline, arginine, glutamine. In other embodiments, the 3 amino acid is selected from aspartic acid and serine. In some embodiments, E is -D-S-S-. In other embodiments, E is - D-D-S-. In other embodiments, E is -D-D-D. In other embodiments, E is -D-S-S-.

[0277] In some embodiments, E comprises 3 amino acids, and y ranges from 1 to 16. In some embodiments, E comprises 3 amino acids, and y ranges from 1 to 12. In some embodiments, E comprises 3 amino acids, and y ranges from 2 to 12. In some embodiments, E comprises 3 amino acids, and y ranges from 1 to 10. In some embodiments, E comprises 3 amino acids, and y ranges from 2 to 10. In some embodiments, E comprises 3 amino acids, and y ranges from 1 to 8. In some embodiments, E comprises 3 amino acids, and y ranges from 2 to 8. In some embodiments, E comprises 3 amino acids, and y ranges from 1 to 6. In some embodiments, E comprises 3 amino acids, and y ranges from 3 to 6. In some embodiments, E comprises 3 amino acids, and y ranges from 3 to 6 and q is 0.

[0278] In some embodiments, E is -D-S-S-, and y ranges from 1 to 16. In some embodiments, E is -D-S-S-, and y ranges from 1 to 12. In some embodiments, E is -D-S-S-, and y ranges from 1 to 10. In some embodiments, E is aspartic acid, and y ranges from 1 to 8. In some embodiments, E is -D-S-S-, and y is 6, i.e. [E]yis [-DSS-]6. In some embodiments, [E]ycomprises SEQ ID NO: 239. In some embodiments, the nucleic acid sequence encoding [E]ycomprises SEQ ID NO: 238. In other embodiments, E is -D-S-S-, y is 6 and z is 1. In some embodiments, E is -D-S-S- , y is 6 and q is 0. In other embodiments, E is -D-S-S-, y is 6, z is 1, and q is 0. In other embodiments, E is -D-S-S-, y is 6, z is 1, q is 0, and x is 0. In other embodiments, E is -D-S-S- , y is 6, z is 1, q is 0, and x is 2.

[0279] In some embodiments, E is -D-S-S-, y is 6 and q is 1. In other embodiments, E is -D-S- S- , y is 6, z is 1, and q is 1. In other embodiments, E is -D-S-S-, y is 6, z is 1, x is 0, and q is 1. In other embodiments, E is -D-S-S-, y is 6, z is 1, x is 2, and q is 1.

[0280] Table 7. Sequence Elements

[0281] I Identifier | Sequence I Other examples of polypeptides encoding a soluble alkaline phosphatase are described in US Publication No. 20240150737, the disclosure of which is hereby incorporated by reference in its entirety.

[0282] In some embodiments, the nucleic acid sequence encoding the polypeptide is operably linked to a promoter. In some embodiments, the promoter is selected from the group consisting of EF1A, MND, CDlb, CD68LPP, EFlal, EFS, and UbC. In some embodiments, the promoter is a long elongation factor 1 -alpha promoter (EF1L).

[0283] In some embodiments, the one or more heterologous genes are reporter genes. As used herein, a "reporter gene" is any gene whose expression can be measured. In some embodiments, a reporter gene can have a previously determined reference range of detectable expression. In some embodiments, a reporter gene can express a selectable or screenable marker. In some embodiments, selectable markers may also be used to select for organisms or cells that contain exogenous genetic material.

[0284] Reporter genes can encode enzymes such as beta-lactamase, beta-galactosidase, murine secreted embryonic alkaline phosphatase (MUSEAP), and luciferase (for beta-lactamase, see WO 96 / 30540 to Tsien, published Oct. 3, 1996). Reporter genes can also encode fluorescent proteins, such as green fluorescent protein (GFP) or mutants thereof as they are known in the art or are later developed (see, U.S. Pat. No. 5,625,048. to Tsien, issued Apr. 29, 1997; WO 96 / 23810 to Tsien, published Aug. 8, 1996; WO 97 / 28261 to Tsien, published Aug. 7, 1997: and PCT / tJS97 / 12410 to Tsien, filed Jul. 16, 1996). The products of reporter genes can be detected using methods known in the art, such as the use of chromogenic or fluorogenic substrates for enzymes. Chromogenic or fluorogenic readouts can be detected using, for example, optical methods such as absorbance or fluorescence.

[0285] Examples of selectable markers include, but are not limited to, a neo gene, which codes for kanamycin resistance and can be selected for using kanamycin, GUS, green fluorescent protein (GFP), neomycin phosphotransferase II (nptll), luciferase (LUX), or an antibiotic resistance coding sequence. In some embodiments, screenable markers can be used to monitor expression. In some embodiments, exemplary screenable markers include, by way of example, a P-glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known; a P-lactamase gene, a gene which encodes an enzyme for which various chromogenic substrates are known (e.g., PAD AC, a chromogenic cephalosporin); a luciferase gene; a tyrosinase gene, which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to melanin; and a-galactosidase, which can turn a chromogenic a-galactose substrate.

[0286] In some embodiments, the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding the one or more therapeutic proteins.

[0287] Promoters

[0288] Any promoter utilized in the art may be utilized to drive expression of one or nucleic acid sequences within the expression vectors described herein, e.g., to drive expression of the nucleic acid sequence encoding the polypeptide. In some embodiments, the promoter is one which is functional in mammalian cells. High-level constitutive promoters are preferred for use in the vectors according to the present disclosure. Examples of such promoters include, without limitation, the retroviral Rous sarcoma virus (RSN) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al, Cell, 41 :521-530 (1985)), the SN40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the beta-active promoter linked to the enhancer derived from the cytomegalovirus (CMN) immediate early (IE) promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter (Invitrogen). Inducible promoters are regulated by exogenously supplied compounds, including, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al, Science, 268: 1766-1769 (1995); see also Harvey et al, Curr. Opin. Chem. Biol, 2:512-518 (1998)), the RU486-inducible system (Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997) and the rapamycin-inducible system (Magari et al, J Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters which may be useful in the present disclosure are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only. Illustrative ubiquitous expression control sequences suitable for use in particular embodiments include, but are not limited to, a cytomegalovirus (CMV) immediate early promoter, a viral simian virus 40 (SV40) (e.g., early or late), a Moloney murine leukemia virus (MoMLV) LTR promoter, a Rous sarcoma virus (RSV) LTR, a herpes simplex virus (HSV) (thymidine kinase) promoter, H5, P7.5, and Pl l promoters from vaccinia virus, a short elongation factor 1- alpha (EF la-short) promoter, a long elongation factor 1 -alpha (EF la-long) promoter, early growth response 1 (EGR1), ferritin H (FerH), ferritin L (FerL), Glyceraldehyde 3 -phosphate dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1 (EIF4A1), heat shock 70 kDa protein 5 (HSPA5), heat shock protein 90 kDa beta, member 1 (HSP90B1), heat shock protein 70 kDa (HSP70), P-kinesin ((3-KIN), the human ROSA 26 locus Orions et al., Nature Biotechnology 25, 1477-1482 (2007)), a Ubiquitin C promoter (UBC), a phosphoglycerate kinase- 1 (PGK) promoter, a cytomegalovirus enhancer / chicken P-actin (CAG) promoter, a P-actin promoter and a myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND) promoter (Challita et al., J Virol. 69(2):748-55 (1995)).

[0289] In some embodiments, the promoter may be selected from a Cytomegalovirus (CMV) minimal promoter and, more preferably, from human CMV (hCMV) such as the hCMV immediate early promoter derived minimal promoter as described in, e.g., Gossen and Bujard (Proc. Natl. Acad. Sci. USA, 1992, 89: 5547-5551). Modified promoters also may be utilized, including insertion and deletion mutation of native promoters and combinations or permutations thereof. One example of a modified promoter is the "minimal CMV promoter" as described by Gossen and Bujard (Proc. Natl. Acad. Sci. USA, 1992, 89: 5547-5551). In any case, any promoter can be tested readily for its effectiveness in the tetracycline-responsive expression system described herein by substitution for the minimal CMV promoter described herein.

[0290] In some embodiments, the promoter is an MND promoter. In some embodiments, the promoter is an EF 1 a promoter. In some embodiments, the promoter is a CD1 lb promoter. In some embodiments, the promoter is a EFS promoter. In some embodiments, the promoter is a Ubc promoter. In some embodiments, the promoter is a CD68LPp promoter. In some embodiments, the promoter is a long elongation factor 1 -alpha promoter (EF1L).

[0291] In some embodiments, the promoter is a tissue-specific promoter, where the tissue-specific promoter is used to achieve cell type specific, lineage specific, or tissue-specific expression of a desired polynucleotide sequence (e.g., to express a particular nucleic acid encoding a polypeptide in only a subset of cell types or tissues or during specific stages of development). Illustrative examples of tissue specific promoters include, but are not limited to: an B29 promoter (B cell expression), a runt transcription factor (CBFa2) promoter (stem cell specific expression), an CD14 promoter (monocytic cell expression), an CD43 promoter (leukocyte and platelet expression), an CD45 promoter (hematopoietic cell expression), an CD68 promoter (macrophage expression), a CYP450 3A4 promoter (hepatocyte expression), an desmin promoter (muscle expression), an elastase 1 promoter (pancreatic acinar cell expression, an endoglin promoter (endothelial cell expression), a fibroblast specific protein 1 promoter (FSP1) promoter (fibroblast cell expression), a fibronectin promoter (fibroblast cell expression), a fms-related tyrosine kinase 1 (FLT1) promoter (endothelial cell expression), a glial fibrillary acidic protein (GFAP) promoter (astrocyte expression), an insulin promoter (pancreatic beta cell expression), an integrin, alpha 2b (ITGA2B) promoter (megakaryocytes), an intracellular adhesion molecule 2 (IC AM-2) promoter (endothelial cells), an interferon beta (FFN-0) promoter (hematopoietic cells), a keratin 5 promoter (keratinocyte expression), a myoglobin (MB) promoter (muscle expression), a myogenic differentiation 1 (MYODI) promoter (muscle expression), a nephrin promoter (podocyte expression), a bone gamma-carboxyglutamate protein 2 (OG-2) promoter (osteoblast expression), an 3-oxoacid CoA transferase 2B (Oxct2B) promoter, (haploid-spermatid expression), a surfactant protein B (SP-B) promoter (lung expression), a synapsin promoter (neuron expression), a Wiskott- Aldrich syndrome protein (WASP) promoter (hematopoietic cell expression).

[0292] In some embodiments, the native promoter for the transgene is utilized. In some embodiments, the native promoter may be preferred when it is desired that expression of the gene should mimic the native expression. In some embodiments, the native promoter may be used when expression of the gene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In some embodiments, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression. In some embodiments, the transgene product or other desirable product to be expressed is operably linked to a tissue-specific promoter. For instance, if expression in skeletal muscle is desired, a promoter active in muscle should be used. These include the promoters from genes encoding skeletal a-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters with activities higher than naturally occurring promoters (see Li et al., Nat. Biotech, 17:241-245 (1999)). Examples of promoters that are tissue-specific are known for liver [albumin, Miyatake et al. J Virol, 71:5124- 32 (1997); Human thyroxine binding globulin (TBG) promoter (see Yan et al, Gene. 2012 15;506(2):289-94 (2012), the disclosure of which is hereby incorporated by reference herein in its entirety; hepatitis B virus core promoter, Sandig et al, Gene Ther., 3: 1002-9 (1996); and alphafetoprotein (AFP), Arbuthnot et al, Hum. Gene Ther, 7: 1503-14 (1996)], bone [osteocalcin, Stein et al, Mol. Biol. Rep., 24: 185-96 (1997); and bone sialoprotein, Chen et al, J Bone Miner. Res., 11:654-64 (1996)], lymphocytes (CD2, Hansal et al., J Immunol, 161: 1063-8 (1998); immunoglobulin heavy chain; T cell receptor a chain), neuronal [neuron-specific enolase (NSE) promoter, Andersen et al. Cell. Mol. Neurobiol, 13:503-15 (1993); neurofilament light-chain gene, Piccioli et al., 1991, Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991); and the neuron-specific vgf gene, Piccioli et al, Neuron 15:373-84 (1995)); among others.

[0293] Transcription may be increased by inserting an enhancer sequence into the non-viral DNA vectors of the present disclosure. Enhancers are typically cis-acting elements of DNA, usually about 10 to 300 bp in length, that act on a promoter to increase its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha-fetoprotein, and insulin) and from eukaryotic cell viruses. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the antigen-specific polynucleotide sequence but is preferably located at a site 5' from the promoter.

[0294] In some embodiments, the vectors of the present disclosure include an insulator element, e.g., a cHS insulator.

[0295] Inhibitory Sequences of Toll-Like Receptor 9 (TLR9)

[0296] It has been well demonstrated a central role for Toll-like receptor 9 (TLR9), an immune sensor of DNA, in detecting non-viral DNA vectors and activating innate immune and CD8+ T cell responses. TLRs are a family of innate immune sensors preserved across mammalian species that are found on endosomal or plasma membranes of immune or other cells. TLR9 normally senses DNA from invasion of pathogenic DNA viruses and bacteria containing unmethylated cytosine-phosphate-guanine (CpG) motifs. After binding to TLR9, CpG-rich motifs of DNA lead to its dimerization and activates TLR9 signaling through MyD88, promoting induction of type I interferons and pro-inflammatory cytokines. Innate immune responses, such as interferon induction, trigger an antiviral state among cells, while inflammation recruits other immune cells to the site of infection and primes adaptive immune responses. One solution blocking TLR9 activation is to include specific short DNA oligonucleotides that antagonize TLR9 activation into the DNA vectors having an extended cruciform structure. In some embodiments, the vectors of the present disclosure comprise one copy of such sequence. In some embodiments, the vectors of the present disclosure comprise two or more copies of such sequence. In some embodiments, the TLR9 antagonist is the nucleic acid of SEQ ID NO: 237.

[0297] DNA Vectors Capable of Forming One or More Specialized Secondary Structures

[0298] In some embodiments, the DNA vectors capable of forming one or more specialized secondary structures, for example extended cruciform structures, for use in the methods described herein comprise a nucleic acid sequence having the sequence of any SEQ ID NOs: 242, 249, 250- 253, 255, and 262 - 263 (see Table 8), or a nucleic acid at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical thereto.

[0299] Table 8. Vector Sequences

[0300] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a proprotein convertase subtilisin / kexin type 7 (PCSK7) therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded PCSK7 therapeutic protein is SEQ ID NO: 214, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid sequence encoding the PCSK7 therapeutic protein is SEQ ID NO: 215, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the PCSK7 therapeutic protein is used for the treatment of atherogenic dyslipidemia.

[0301] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a bile salt export pump BSEP therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded BSEP therapeutic protein is SEQ ID NO: 216, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid sequence encoding the BSEP therapeutic protein is SEQ ID NO: 217, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the BSEP therapeutic protein is used for the treatment of progressive familial intrahepatic cholestasis type 2 (PFIC2).

[0302] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a l-acylglycerol-3 -phosphate O-acyltransf erase (PLPL3) therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded PLPL3 therapeutic protein is SEQ ID NO: 198, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid sequence encoding the PLPL3 therapeutic protein is SEQ ID NO: 199, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the PLPL3 therapeutic protein is used for the treatment of Metabolic dysfunction- associated steatohepatitis (MASH).

[0303] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a transmembrane 6 superfamily member 2 (TM6SF2) therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173,

[0304] 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded TM6SF2 therapeutic protein is SEQ ID NO: 200, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid sequence encoding the TM6SF2 therapeutic protein is SEQ ID NO: 201, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the TM6SF2 therapeutic protein is used for the treatment of MASH.

[0305] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a fibroblast growth factor 21 (FGF21) therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or

[0306] 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded FGF21 therapeutic protein is SEQ ID NO: 202, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid encoding the FGF21 therapeutic protein is SEQ ID NO: 203, or a nucleic acid having at least at least about 95% identity thereto. In some embodiments, the DNA vector encoding the FGF21 therapeutic protein is used for the treatment of MASH, obesity, arteriosclerosis, and tissue remodeling.

[0307] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a laminin subunit alpha-2 (LAMA2) therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded LAMA2 therapeutic protein is SEQ ID NO: 204, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid encoding the LAMA2 therapeutic protein is SEQ ID NO: 205, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the LAMA2 therapeutic protein is used for the treatment of laminin Alpha-2-Congenital Muscular Dystrophy (LAMA2-CMD).

[0308] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding a laminin- 111 therapeutic protein, wherein the one or more nucleic acid sequences are operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded laminin-111 protein comprises SEQ ID NO: 206, or a sequence having at least about 95% identity thereto. In some embodiments, the encoded laminin-111 protein comprises SEQ ID NO: 208, or a sequence having at least about 95% identity thereto. In some embodiments, the encoded laminin-111 protein comprises SEQ ID NO: 210, or a sequence having at least about 95% identity thereto. In some embodiments, the encoded laminin- 111 protein comprises SEQ ID NO: 212, or a sequence having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding laminin-111 comprise SEQ ID NO: 207, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding laminin-111 comprise SEQ ID NO: 209, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding laminin-111 comprise SEQ ID NO: 211, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding laminin-111 comprise SEQ ID NO: 213, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the laminin-111 therapeutic protein is used for the treatment of laminin alpha-2 congenital muscular dystrophy or Duchenne Muscular Dystrophy (DMD).

[0309] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding an anti-FGF23 antibody or a fragment thereof therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded anti-FGF23 antibody or fragment thereof protein comprises SEQ ID NO: 218, or a sequence having at least about 95% identity thereto. In some embodiments, the encoded anti-FGF23 antibody or fragment thereof protein comprises SEQ ID NO: 220, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid encoding the anti-FGF23 antibody or fragment thereof is SEQ ID NO: 219, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the nucleic acid encoding the anti-FGF23 antibody or fragment thereof is SEQ ID NO: 221, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the anti-FGF23 antibody or fragment thereof therapeutic protein is used for the treatment of x-linked hypophosphatemia (XLH).

[0310] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a truncated FGF23 therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded truncated FGF23 therapeutic protein comprises SEQ ID NO: 222, or a sequence having at least about 95% identity thereto. In some embodiments, the nucleic acid encoding the truncated FGF23 therapeutic protein is SEQ ID NO: 223, or a nucleic acid having at least about 95% identity thereto.

[0311] In one aspect, provided herein is an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette including a nucleic acid sequence encoding a Collagen IVa345 therapeutic protein, wherein the nucleic acid sequence is operatively linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto, wherein the second portion lacks a bacterial selection marker. In some embodiments, the encoded Collagen IVa345 therapeutic protein comprises SEQ ID NO: 224, or a sequence having at least about 95% identity thereto. In some embodiments, the encoded Collagen IVo.345 therapeutic protein comprises SEQ ID NO: 226, or a sequence having at least about 95% identity thereto. In some embodiments, the encoded Collagen IVa345 therapeutic protein comprises SEQ ID NO: 228, or a sequence having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding Collagen IVa345 therapeutic protein comprise SEQ ID NO: 225, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding Collagen IVa345 therapeutic protein comprise SEQ ID NO: 227, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the one or more of the nucleic acid sequences encoding Collagen IVa345 therapeutic protein comprise SEQ ID NO: 229, or a nucleic acid having at least about 95% identity thereto. In some embodiments, the DNA vector encoding the Collagen IVa345 therapeutic protein is used for the treatment of Alport syndrome.

[0312] In Vivo Resolution

[0313] The circular, non-integrating, non-viral DNA vectors containing an extended cruciform structure are resolved in vivo. In some embodiments, the DNA vectors enter the cell through an endosomal mechanism (receptor-mediated endocytosis, pinocytosis, phagocytosis, etc.) or a non- endosomal mechanism (electroporation, ultrasonication-induced microbubble, membrane fusion through fusogenic complex etc.). Once inside an endosome, the non-viral DNA vector "escapes" the endosome and enters into the cytosol before the endosome fuses with a lysosome and the DNA is degraded. It is believed that the formulation of the non-viral DNA vector determines how the DNA escapes the endosome.

[0314] Once in the cytosol, the DNA needs to make its way into the nucleus in order to be expressed. It is believed that this process is assisted by the one or more specialized secondary structures, for example extended cruciform structures. For example, it is believed that cellular proteins, or protein complexes, known to bind a cruciform structure or known to be involved in Holliday junction resolution, have nuclear localization motifs. In other words, it is believed that the one or more extended cruciform structures formed by the DNA vectors described herein are bound by proteins that direct transport thereof into the nucleus. As the proteins that help mediate nuclear translocation are the same (or a subset of) that mediate resolution, it is unclear if resolution occurs in the cytoplasm or in the nucleus, although the expectation is that this process occurs in the nucleus. For example, PARP1 was identified to co-localized with constructs according to the present disclosure in the cytoplasm of 293 cells post-transfection (see, e.g., FIG. 18). Generally speaking, PARP1 is a nuclear protein and might shuttle out to the cytoplasm to help DNA traffic into the nucleus.

[0315] Although the process of "resolution" is largely unknown, we can speak to the events that it would seem need to occur. Note that the process of normal endogenous Holliday junction resolution is also largely unknown and may occur through multiple pathways involving multiple different proteins / enzymes either in different cell types, or at different stages of the cell cycle. For instance, the first step is the recognition of the cruciform structure by proteins or protein complexes. This binding may be involved in nuclear localization as described above but is believed to be necessary to unwind the DNA slightly to permit the next enzymatic steps. In some embodiments, the first enzymatic activity would cut the structure (see, e.g., FIGS. 10 - 11). After cutting, it is believed that a linear molecule is formed through a ligation process. It is believed that there are several DNA topoisomerases and / or DNA ligases that could been implicated in this process. It is also believed that there also several potential process / pathways via which this could occur. It is believed that DNA protein kinase (DNA-PK) is implicated in these pathways to convert the circular, non-viral vectors of the present disclosure into a linear form. In particular, DNA-PK is thought to be involved in the non-homologous end-joining (NHEJ) reaction and is believed to be part of a large multiprotein complex.

[0316] In some embodiments, other homology-mediated pathways may be involved in the formation of concatemers (see, e.g., FIG. 11).

[0317] Pharmaceutical Compositions

[0318] Another aspect of the present disclosure is directed to compositions comprising one or more circular, non-viral DNA vectors described herein. In some embodiments, the pharmaceutical composition comprises a DNA vector having a nucleic acid sequence of any one of SEQ ID NOs: 242, 249, 250-253, 255, and 262-263, or a sequence at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0319] In some embodiments, the present disclosure provides a composition comprising one or more of the DNA vectors described herein and a carrier therefore (e.g., a pharmaceutically acceptable carrier). The composition desirably is a physiologically acceptable (e.g., pharmaceutically acceptable) composition, which comprises a carrier, e.g., a physiologically (e.g., pharmaceutically) acceptable carrier, and the DNA vector. Any suitable carrier can be used within the context of the present disclosure, and such carriers are well known in the art, including any of those described above. In some embodiments, the pharmaceutically acceptable carrier is a delivery vehicle, for example a lipid nanoparticle or the like.

[0320] In some embodiments, the non-viral DNA vectors may be formulated with a delivery vehicle. In some embodiments, the delivery vehicle is a lipid-based delivery vehicle. In some embodiments, the delivery vehicle is a lipid nanoparticle. As used herein, the term "lipid nanoparticle" or "LNP" refers to any lipid composition that can be used to deliver a therapeutic product, including, but not limited to, liposomes or vesicles, wherein an aqueous volume is encapsulated by amphipathic lipid bilayers, or wherein the lipids coat an interior that comprises a therapeutic product, or lipid aggregates or micelles, wherein the lipid-encapsulated therapeutic product is contained within a relatively disordered lipid mixture.

[0321] In some embodiments, lipid nanoparticles include lipid-based compositions with a solid lipid core stabilized by a surfactant. In some embodiments, the core lipids can be fatty acids, acyiglycerols, waxes, and mixtures of these surfactants. In some embodiments, biological membrane lipids such as phospholipids, sphingomyelins, bile salts (sodium taurocholate), and sterols (cholesterol) can be utilized as stabilizers.

[0322] In some embodiments, lipid nanoparticles can be formed using defined ratios of different lipid molecules, including, but not limited to, defined ratios of one or more cationic, anionic, or neutral lipids. In some embodiments, lipid nanoparticles can encapsulate molecules, such as the disclosed non-viral DNA vectors, within an outer-membrane shell and subsequently can be contacted with target cells to deliver the encapsulated molecules (e.g., the disclosed non-viral DNA vectors) to the host cell cytosol. In some embodiments, lipid nanoparticles can be modified or functionalized with non-lipid molecules, including on their surface (e.g., CD3, CD4, CD8, CD19, CD20, CD22, CD38, CD47, CD117, transferrin, ApoE, folate, etc.). In some embodiments, lipid nanoparticles can be modified to specifically bind to one or more receptors on the surface of the target cell (e.g., 1 or more receptors, 2 or more receptors, 3 or more receptors, 4 or more receptors, etc.). By "specifically bind" is meant that the lipid nanoparticle binds to the receptors on surface of the target cell with at least about 2-fold greater affinity relative to the receptors on the surface of a non-target cell, e.g., at least about 3-fold, 4-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20- fold, 25-fold, 50-fold, or 100-fold higher. Cell surface receptors to which the modified lipid nanoparticles can bind include, but are not limited, to an integrin, transferrin receptor type 1 and 2, EGF receptor, a VEGF receptor, an NGF receptor, CD3, CD4, CD7, CD8, CD 19, CD20, CD22, CD33, CD43, CD38, CD56, CD69, the asialoglycoprotein receptor (ASGPR), N-acetyl-D- galactose (GalNAc) receptor, a folate receptor, and a sigma receptor. In some embodiments, the first and / or the second targeting ligand bind to the asialoglycoprotein receptor (ASGPR) or GalNAc receptor. Accordingly, in some embodiments, the modified lipid nanoparticles specifically bind to ASGPR or GalNAc receptor on surface of hepatocytes. In some embodiments, the targeting ligand used to modify the lipid nanoparticles is a carbohydrate or a carbohydrate conjugate. Carbohydrate based targeting ligands include, but are not limited to, glucose, multivalent glucose, fucose, D-mannose, multivalent mannose, lactose, multivalent lactose, D- galactose, multivalent galactose, GalNAc, multivalent GalNAc (e.g., GalNAc2 and GalNAc3), acetyl-galactosamine, N-acetyl-gulucosamine, glycosylated polyaminoacids and lectins. The term multivalent indicates that one, two, three or four monosaccharide units is present. Such monosaccharide subunits may be linked to each other through glycosidic linkages or linked to a scaffold molecule. In some embodiments, lipid nanoparticles can be single layered (unilamellar) or multi-layered (multilamellar). In some embodiments, lipid nanoparticles can be complexed with nucleic acid. Unilamellar lipid nanoparticles can be complexed with nucleic acid, wherein the nucleic acid is in the aqueous interior. In some embodiments, multilamellar lipid nanoparticles can be complexed with nucleic acid, wherein the nucleic acid is in the aqueous interior, or to form or sandwiched between.

[0323] In some embodiments, liposomal particles can, for example, be formed of a mixture of zwitterionic, cationic and anionic lipids which can be saturated or unsaturated, for example 1,2- distearoyl-sn-glycero-3 -phosphocholine (DSPC) (zwitterionic, saturated), 1,2-dilinoley oxy-3 - dimethylaminopropane (DlinDMA) (cationic, unsaturated), and / or 1,2-dimyristoyl-rac-glycerol (DMG) (anionic, saturated). In some embodiments, the liposomes will typically comprise helper lipids. Useful helper lipids include zwitterionic lipids, such as DPPC, DOPC, DSPC, dodecylphosphocholine, l,2-dioleoyl-sn-glycero-3 -phosphatidylethanolamine (DOPE), and 1,2- diphytanoyl-sn-glycero-3-phosphoethanolamine (DPyPE); sterols, such as cholesterol; and PEGylated lipids, such as PEG-DMPE (PEG-conjugated 1, 2-dimyristoyl-Sn-glycero-3- phosphoethanolamine-N-[methoxy (polyethylene glycol)]) or PEG-DMG (PEG-conjugated 1,2- Dimyristoyl-sn-glycerol, methoxypolyethylene Glycol). In some embodiments, suitable PEGylated lipids include PEG2K-DMPE (PEG-conjugated 1, 2-di myristoyl -Sn-glycero-3- phosphoethanolamine-N-[methoxy (polyethylene glycol)-2000]) or PEG2K-DMG (PEG- conjugated 1,2-Dimyristoyl-sn-glycerol, methoxypolyethylene Glycol-2000). In some embodiments, LNPs for use with the non-viral DNA vectors of the present disclosure include a zwitterionic lipid which can form liposomes, optionally in combination with at least about one cationic lipid (such as N-[l-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (DOTAPBis(2-methacryloyl)oxyethyl disulfide (DSDMA), 2,3-Dioleyloxy-l- (dimethylamino)propane (DODMA), 1,2-dilinoley oxy-3 -dimethylaminopropane (DLinDMA), N,N-dimethyl-3 -aminopropane (DLenDMA), etc.).

[0324] In some embodiments, the lipid nanoparticles have a mean diameter ranging from between about 20 nm to about 300 nm, e.g., from between about 20 nm to about 250 nm from between about 30 nm to about 200 nm, from between about 40 nm to about 180 nm, from between about 50 nm to about 150 nm, from between about 60 nm to about 140 nm, etc. Lipid nanoparticle particle size can be determined by quasi-elastic light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, UK) system or electron microscope using, for example, FEI Quanta 200 Scanning Electron Microscope or FEI Tecnai Twin 120kV Transmission Electron Microscope.

[0325] Examples of LNPs are described by Schoeenmaker et. al., " mRNA-lipid nanoparticle COVID-19 vaccines: Structure and stability," Int J Pharm. 2021 May 15; 601 : 120586, the disclosure of which is hereby incorporated by reference herein in its entirety. Other exemplary LNPs are described by Eygeris et. al., " Chemistry of Lipid Nanoparticles for RNA Delivery," Acc Chem Res. 2022 Jan 4;55(1):2-12. doi: 10.1021 / acs. accounts. lc00544. Epub 2021 Dec 1. PMID: 34850635, the disclosure of which is hereby incorporated by reference herein in its entirety. Yet other suitable LNPs for use with the non-viral DNA vectors of the present disclosure are described in United States Patent Publication Nos. 2021 / 0371877, 2022 / 0175968, 2022 / 0042035, and 2022 / 0062409, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0326] The non-viral DNA vectors of the present disclosure may also be formulated with one or more polymers. Various polymers or copolymers may be adapted as a vehicle for the non-viral DNA vectors of the present disclosure. Exemplary polymeric materials include poly(D,L-lactic acid-co-glycolic acid) (PLGA), poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), PLGA-b- poly(ethylene glycol)-PLGA (PLGA-bPEG-PLGA), PLLA-bPEG-PLLA, PLGA-PEG-maleimide (PLGA-PEG-mal), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co- glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacralate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethyleneglycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as polyethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohols (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, hydroxypropyl cellulose, carboxymethylcellulose, polymers of acrylic acids, such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) (polyacrylic acids), and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate), polyoxymethylene, poloxamers, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, polyvinylpyrrolidone, polyorthoesters, polyphosphazenes, Poly([beta]-amino esters (PBAE), and polyphosphoesters, and blends and / or block copolymers of two or more such polymers. Polymer-based systems may also include Cyclodextrin polymer (CDP)-based nanoparticles such as, for example, CDP-admantane (AD)-PEG conjugates and CDP-AD-PEG-transferrin conjugates.

[0327] In certain embodiments, the DNA vector is administered as a pharmaceutical composition formulated with a polymer selected from diethylaminoethyl-dextran (DEAE-D), 1,5-Dimethyl- 1,5-diazaundecamethylene polymethobromide (Polybrene), poly-DL-lactide-poly(ethylene glycol) (PELA), polyethylene glycol)-b-poly(L-histidine-co-L-phenylalanine) (PEGZ>PHF), hyaluronic acid cross-linked with PEG (HA-PEG), P-Cyclodextrin-PEI-MMP-cleavable-PEG (MMP-cleavable = GPLGIAGQC) (CDPCP), PEGylated and tax ol -conjugated polymeric arginine grafted poly(disulfide amine) (APP), poly(ethylene glycol) diacrylate blended with PLL, 25 kDa poly(ethylene imine) (PEI), 2 kDa PEI cross-linked with diethylene glycol (PEI-DEG-bis-NPC), 600 Da PEI cross-linked with cyclodextrin and folic acid (PEI-CyD-FA), PEI conjugated with deoxycholic acid (PEI-DA), 1.8 kDa PEI cross-linked with cystamine (rPEI), PEI cross-linked with cystamine derivative (PCDP), PEI- / >-poly(glycidyl methacrylate) (PEI-pGMA), PEI functionalized with 3-(3,4-dihydroxy-phenyl) propionic acid (catechol groups) (PEI-DPA), 1.8 kDa PEI-dibenzocyclooctyl (PEI-DBCO), PEI / hyaluronic acid, PEI / chondroitin sulfate, 2 kDa PEG grafted on 25 kDa PEI (PEG-g-PEI), PEO101-PPO56-PEO101 (Poloxamer 407), Poloxamer 407 / polycarbophil, Poloxamer PF68 and T908, Poloxamer 338 (PEO141 PPO44 PEO141) (LentiBOOST), a PAMAM-, EGFR-targeting peptide, PEG, PEGylated polyamidoamine G4, 63 kDa (PAMAM, antibody, PEG), polyphenylene 3 (PPD3), one quarter of amphiphilic polyphenylene 3 (PPD3-dendron), poly(s-caprolactone) (PCL), PCL blended with elastin like pentapeptide (VPGVGjns (PCL / ELP), 80 kDa PCL, Poly(lactide-co-glycolic acid) (PLGA), Poly (lactic-co-glycolic) acid and poly-L-lysine (PLL / PLGA), 75 / 25 DL-PLGA 9.4 kDa / PLL 56 kDa (PLGA / PLL), 50 / 50 (PLGA / PEG), Linear copolymer of [D-mannuronate ( 1— >4) L-guluronate (al ^4)]n (alginate), Alginate / pol oxamer 407, Poly 0-(l — >4)-linked D-glucosamine (chitosan), Chitosan / 0-glycerol phosphate, Poly (l ^6)-linked a-D-mannose (polymannose), Cellulose- grafted poly(N,N-dimethylaminoethyl methacrylate) (Cellulose-g-P(QDMAEMA)), Poly hydroxyethyl disulfide diglycidyl ether and tobramycin (Polyaminogly coside), 0-Cyclodextrin, a- Cyclodextrin with pluronic PF68 and chondroitin sulfate or hyaluric acid (a-Cyclodextrin), Ethylene glycol diglycidyl ether (EGDE) and 3,3 '-diamino-N-m ethyl dipropylamine (3,3') (EDGE, 3,3’), polydopamine, catecholamines (Polynorepinephrine or polydopamine), Poly(N-(2- hydroxypropyl)methacrylamide) (pHPMA), PEG cross-linked with 1,6-hexam ethylene diisocyanate and epsilon caprolactone sulfamethazine (PUSMA), Poly-arginine-g-polydisulfide amine, Copolymer of polycaprolactone diol, butyl diisocyanate, and putrescine blended PEG (Polyester urethane urea), Polystyrene coated with methyl methacrylate and divinylbenzene (polystyrene), Poly(e-caprolactone) grafted poly(sodium styrene sulfonate) (pNaSS), Hydroxyethyl methacrylate (HEMA) with aminopropyl methacrylamide (APMA) (HEMA / APMA), Vinyl ether acrylate-functionalized poly(vinyl alcohol) (PVA-VEA), Poly(2- ethyl-2-oxazoline), Cross-linked amino ketal methacrylamide and ketal bis methacrylamide mixed with siRNA, or a DNA aptamer.

[0328] In certain embodiments, the DNA vector is administered as a pharmaceutical composition formulated with a natural or synthetic membrane or an implanted vehicle which improve the therapeutic activity of the DNA vector by more efficient delivery. In certain embodiments, the DNA vector is formulated in an implanted delivery vehicle. Implanted delivery vehicles facilitate local administration and the enhancing of a spatiotemporal release. Methods of making and formulating implanted delivery vehicles are known to those skilled in the art (Shin, S. & Shea, L.D. Lentivirus Immobilization to Nanoparticles for Enhanced and Localized Delivery From Hydrogels. Mol Ther. 18:700-706(2010); McMahon, S.S. et al. Thermosensitive hydrogel for prolonged delivery of lentiviral vector expressing neurotrophin-3 in vitro. J Gene Med. 13(11 ): 591 -601 (2011 Sep 26); Kangasniemi, L. et al. Extended release of adenovirus from silica implants in vitro and in vivo. Gene Ther. 16: 103-110(2009)). In some embodiments, the implanted delivery vehicle comprises a polymeric hydrogel. In some embodiments, the polymeric hydrogel is composed of hydrophilic polymers, wherein the hydrophilic polymers are selected from natural or synthetic sources. A hydrogel is an exemplary carrier for gene therapies due to their high water content and physicochemical properties that mimic the extracellular matrix (ECM) of tissues. In some embodiments, the implanted delivery vehicle is biodegradable. In some embodiments, the polymeric hydrogel comprises collagen. In some embodiments, the polymeric hydrogel comprises hyaluronic acid. In some embodiments, the polymeric hydrogel comprises gelatin. In some embodiments, the polymeric hydrogel comprises alginate hydrogels. In some embodiments, the polymeric hydrogel comprises polyethylene glycol (PEG). In some embodiments, the polymeric hydrogel comprises fibronectin. In some embodiments, the polymeric hydrogel comprises agarose. In some embodiments, the polymeric hydrogel comprises fibrin. In some embodiments, the polymeric hydrogel comprises a silica gel. In some embodiments, the implanted delivery vehicle comprises a porous or permeable membrane.

[0329] Non-limiting examples of polymeric particle systems for delivery of the disclosed non- viral DNA vectors include the systems described in U.S. Pat. No. 5,543,158, U.S. Pat. No. 6,007,845, U.S. Pat. No. 6,254,890, U.S. Pat. No. 6,998,115, U.S. Pat. No. 7,727,969, U.S. Pat. No. 7,427,394, U.S. Pat. No. 8,323,698, U.S. Pat. No. 8,071,082, U.S. Pat. No. 8,105,652, US 2008 / 0268063, US 2009 / 0298710, US 2010 / 0303723, US 2011 / 0027172, US 2011 / 0065807, US 2012 / 0156135, US 2014 / 0093575, WO 2013 / 090861, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0330] In some embodiments, the non-viral DNA vectors may be formulated as pharmaceutically acceptable nanocapsule formulations. Nanocapsules can generally entrap compounds in a stable and reproducible way (Henry -Michell and et al., 1987; Quintanar-Guerrero et al., 1998; Douglas et al., 1987). To avoid side effects due to intracellular polymeric overloading, such ultrafme particles (sized around 0.1 gm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use in the present invention. Such particles may be easily made, as described (Couvreur et al., 1980; Couvreur, 1988; zur Muhlen et al., 1998; Zambaux et al. 1998; Pinto- Alphandry et al., 1995 and U.S. Pat. No. 5,145,684, specifically incorporated herein by reference in its entirety).

[0331] In some embodiments, the pharmaceutical compositions including the non-viral DNA vectors of the present disclosure, and which are suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (see U.S. Pat. No. 5,466,468, the disclosure of which is hereby incorporated by reference herein in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils.

[0332] In some embodiments, the non-viral DNA vectors may be given to the patients with physical methods, such as electroporation, sonoporation with microbubbles, sonoporation without microbubbles, magnetofection, hy droporation, photoporation, mechanical massage, jet injection, biolistics (gene gun), hydrodynamic injection, needle injection or microinjections.

[0333] Further Stabilization of DNA Vectors Capable of Forming Specialized Secondary Structures

[0334] Also provided herein are DNA vectors capable of forming specialized secondary structures as described herein which have been further modified to further stabilize the secondary structure, thus preserving or further enhancing its non-immunogenic nature. In certain embodiments, the DNA vector comprises one or more modifications as described herein which further stabilizes the secondary structure and enhances the substantially non-immunogenic nature of the DNA vectors provided herein. In certain embodiments, the pharmaceutical composition comprising the DNA vector further comprises one or more additives that can render the DNA vector substantially non- immunogenic.

[0335] Methods of Treatment

[0336] The present disclosure is also directed to administering therapeutically effective amounts of a circular, non-integrating, non-viral DNA vector capable of forming one or more specialized secondary structures, for example extended cruciform structures, capable of expressing one or more transgenes or a pharmaceutical composition comprising such a DNA vector to a patient in need of treatment thereof.

[0337] In some embodiments, the present disclosure is directed to treating a condition or disease related to a bone defect characterized by a lack of or an insufficient amount of functional alkaline phosphatase. Another aspect of the present disclosure is directed to a method of treating hypophosphatasia in a mammal, e.g., a human, in need thereof. Another aspect of the present disclosure is directed to a method of treating, mitigating, or preventing a symptom of hypophosphatasia in a mammal, e.g., a human.

[0338] Hypophosphatasia (HPP) is a rare, heritable skeletal disease with an incidence of 1 per 100,000 births for the most severe forms of the disease. The disorder results from loss-of-function mutations in the gene encoding tissue-nonspecific alkaline phosphatase (TNALP). HPP patients present a remarkable range of symptoms, from teeth loss or osteomalacia (rickets) to almost complete absence of bone mineralization in utero. Many patients with HPP present the characteristics of skeletal deformities, short stature, muscle and bone pain, impaired mobility, and premature loss of teeth. Perinatal-onset or infantile-onset HPP can also be characterized by the presence of rachitic chest deformity, vitamin B6-dependent seizures, and failure to thrive. In particular, HPP presenting at less than six months of age is often lethal due to respiratory insufficiency, with a low survival rate at one year of age.

[0339] In some embodiments, the methods of the present disclosure provide for the treatment of hypophosphatasia in the mammal. In some embodiments, hypophosphatasia may be treated by administering a therapeutically effective amount of a pharmaceutical composition including a DNA vector described herein capable of expressing one or more nucleic acid sequences encoding TNALP or a polypeptide having an amino acid sequence encoding TNALP (see, e.g., SEQ ID NOs: 242, 249, 250-253, 255, and 262-263). In other embodiments, treating, mitigating, or preventing a symptom of hypophosphatasia or calcium pyrophosphate deposition (CPPD) in a mammal comprises administering a therapeutically effective amount of a pharmaceutical composition including a DNA capable of expressing one or more nucleic acid sequences encoding TNALP or a polypeptide having an amino acid sequence encoding TNALP (see, e.g., SEQ ID NOs: 242, 249, 250-253, 255, and 262-263).

[0340] In some embodiments, the DNA vector is capable of expressing the therapeutic protein proprotein convertase subtilisin / kexin type 9 encoded by the PCSK9 gene to treat autosomal dominant familial hypercholesterolemia. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 184, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0341] In some embodiments, the DNA vector is capable of expressing the therapeutic protein proprotein convertase subtilisin / kexin type 7 encoded by the PCSK7 gene for treating atherogenic dyslipidemia. In some embodiments, the encoded protein is SEQ ID NO: 214, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 215, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0342] In some embodiments, the DNA vector is capable of expressing the therapeutic protein alpha-1 antitrypsin encoded by the SerpinAl gene to treat alpha- 1 -antitrypsin (A1AT) deficiency. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 194, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0343] In some embodiments, the DNA vector is capable of expressing the therapeutic protein ATP Binding Cassette Subfamily B Member 4 encoded by the ABCB4 gene for the treatment of progressive familial intrahepatic cholestasis type 3, gallbladder disease 1 (syn. low phospholipid associated cholelithiasis syndrome), high y-glutamyl transferase intrahepatic cholestasis of pregnancy, chronic chol angiopathy, or adult biliary fibrosis / cirrhosis. In some embodiments, the encoded protein is SEQ ID NO: 187, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NO: 188 or 189, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0344] In some embodiments, the DNA vector is capable of expressing the therapeutic protein ATPase Copper Transporting Beta protein encoded by the ATP7B gene to treat Wilson’s disease. In some embodiments, the encoded protein is SEQ ID NO: 195, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NO: 192 or 193, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0345] In some embodiments, the DNA vector is capable of expressing the therapeutic protein bile salt export pump (BSEP) protein encoded by the ABCB11 gene to treat progressive familial intrahepatic cholestasis type 2 (PFIC2). In some embodiments, the encoded protein is SEQ ID NO: 216, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 217, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0346] In some embodiments, the DNA vector is capable of expressing an anti-CD19 / anti-CD3 therapeutic protein for treating an autoimmune disorder or a hematological malignancy selected from the group consisting of lymphoma, leukemia and myeloma. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 190, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0347] In some embodiments, the DNA vector is capable of expressing the therapeutic protein B- domain deleted FVIII to treat hemophilia. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 191, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the DNA vector is capable of expressing the therapeutic protein 1 - acylglycerol-3 -phosphate O-acyltransferase encoded by the PNPLA3 gene and / or transmembrane 6 superfamily member 2 protein encoded by TM6SF2 and / or fibroblast growth factor 21 encoded by FGF21 to treat Metabolic dysfunction-associated steatohepatitis (MASH). In some embodiments, the DNA vector is capable of expressing the therapeutic protein fibroblast growth factor 21 encoded by FGF21 to treat Metabolic dysfunction-associated steatohepatitis (MASH), obesity, arteriosclerosis, and capable of tissue remodeling. In some embodiments, the encoded protein is selected from SEQ ID NOs: 198, 200, or 202, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid selected from SEQ ID NOs: 199, 201, or 203, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0348] In some embodiments, the therapeutic protein is fibroblast growth factor 21 encoded by the FGF21 gene. In some embodiments, the encoded protein is SEQ ID NO: 202, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 203, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0349] In some embodiments, the DNA vector is capable of expressing the therapeutic protein laminin subunit alpha-2 encoded by the LAMA-2 gene to treat laminin Alpha-2-Congenital Muscular Dystrophy (LAMA2-CMD). In some embodiments, the encoded protein is SEQ ID NO: 204, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 205, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0350] In some embodiments, the therapeutic protein is laminin- 111 encoded by laminin subunit alpha 1 (LAMA1), laminin subunit alpha 2 (LAMA2), laminin subunit beta 1 (LAMB1), laminin subunit gamma 1 (LAMC 1), or a combination thereof, to treat laminin alpha-2 congenital muscular dystrophy or Duchenne Muscular Dystrophy (DMD). In some embodiments, the encoded protein is SEQ ID NO: 206, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 208, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 210, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the encoded protein comprises SEQ ID NO: 212, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 207, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 209, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 211, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 213, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0351] In some embodiments, the DNA vector is capable of expressing an anti-FGF23 antibody or a fragment thereof, wherein the antibody or fragment thereof competes for the binding of FGF23R / Klotho complex, to treat x-linked hypophosphatemia (XLH). In some embodiments, the encoded protein comprises SEQ ID NO: 218 or 220, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 219 or 221, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0352] In some embodiments, the DNA vector is capable of expressing a therapeutic protein fragment of FGF23 capable of blocking FGF23 dependent signaling or an antibody or antibody fragment capable of binding and blocking FGF23 dependent signaling. In some embodiments, the encoded protein comprises SEQ ID NO: 222, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto. In some embodiments, the expression cassette comprises a nucleic acid of SEQ ID NO: 223, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto.

[0353] In some embodiments, the DNA vector is capable of expressing the therapeutic protein Collagen IVa345 encoded by COL4A3, COL4A4, and COL4A5 genes to treat Alport syndrome. In some embodiments, the encoded protein comprises a sequence selected from SEQ ID NOs: 224, 226, or 228, or a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto, or a combination of these sequences. In some embodiments, the expression cassette comprises a nucleic acid sequence selected from SEQ ID NOs: 225, 227, or 229, or a nucleic acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 99% identity thereto, or a combination of these sequences.

[0354] In one aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0355] In another aspect, provided herein is a method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

[0356] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0357] In another aspect, provided herein is a method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice

[0358] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an 6K7 bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0359] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

[0360] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious transcription responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6I<y bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in a transcription-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0361] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an 6K7 bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from transcription-related gene ontology (GO) group selected from mouse G0:0045944 (positive regulation of transcription from RNA polymerase II promoter), mouse GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), mouse G0:0006397 (mRNA processing), mouse G0:0008380 (RNA splicing), mouse G0:0006357 (regulation of transcription from RNA polymerase II promoter), mouse G0:0006355 (regulation of transcription, DNA-templated), mouse G0:0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

[0362] In one aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cl s2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0363] In another aspect, provided herein is a method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

[0364] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0365] In another aspect, provided herein is a method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

[0366] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0367] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice. In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious transcription responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in a transcription-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0368] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction: (a) a first AAV inverted repeat sequence; (b) an oriR6Ky sequence; and (c) a second AAV inverted repeat sequence; wherein the change in mean transcript level is determined at 2- hours post-administration, 24-hours post administration, or 2-hours and 24-hours postadministration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice. In some embodiments, the AAV inverted repeat sequences are selected from a sequence of SEQ ID NOs: 1-19, or a sequence at least about 95% identical thereto.

[0369] In some embodiments, the first AAV ITR nucleic acid sequence is any one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a sequence at least about 95% identical thereto; wherein the oriR6Ky has the nucleic acid sequence of any one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and wherein the second AAV ITR nucleic acid repeating sequence is any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 19, or a sequence at least about 95% identical thereto.

[0370] In some embodiments, the second portion of the DNA vector comprises a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto.

[0371] In some embodiments, the second portion of the DNA vector comprises a first AAV inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 160, 161, or a sequence at least 95% identical thereto; wherein the oriR6Ky is one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and a second AAV inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 159, 160, 162, or a sequence at least about 95% identical thereto.

[0372] In one aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence comprising the Formula X-Y-X'; wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0373] In another aspect, provided herein is a method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence comprising the Formula X-Y-X'; wherein X and X1are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

[0374] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence comprising the Formula X-Y-X'; wherein X and X1 are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0375] In another aspect, provided herein is a method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence comprising the Formula X-Y-X'; wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours post-administration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice

[0376] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and (ii) a second portion comprising a nucleic acid sequence comprising the Formula X-Y-X'; wherein X and X1are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune- related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

[0377] In another aspect, provided herein is a method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises: (i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic ...

Claims

CLAIMSWe claim:

1. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

2. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprises two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

3. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequencesare capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

4. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker;wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice5. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in animmune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

6. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencingfrom liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

7. A method for the treatment of a disorder in a human patient that minimizes deleterious transcription responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in a transcription-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof,wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

8. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprising two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from transcription-related gene ontology (GO) group selected from mouse G0:0045944 (positive regulation of transcription from RNA polymerase II promoter), mouse GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), mouse G0:0006397 (mRNA processing), mouse G0:0008380 (RNA splicing), mouse G0:0006357 (regulation of transcription from RNA polymerase II promoter), mouse GO: 0006355 (regulation of transcription, DNA- templated), mouse G0:0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level;wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

9. The method of claims 1-8, wherein the double stranded arms are at least about 90 bps.

10. The method of claims 1-8, wherein the double stranded arms are at least about 100 bps.

11. The method of claims 1-8, wherein the double stranded arms are at least about 110 bps.

12. The method of claims 1-11, wherein the repeating sequences are inverted terminal repeat(ITR) sequences derived from one or more adeno-associated virus (AAV) serotypes.

13. The method of claim 12, wherein the ITR sequences are selected from a sequence of SEQ ID NOs: 1-19, or a sequence at least about 95% identical thereto.

14. The method of claims 1-13, wherein the non-repeating sequence comprises a bacterial Ori derived from R6K.

15. The method of claims 1-13, wherein the non-repeating sequence comprises a sequence selected from any of SEQ ID NOs: 163-167, or a sequence at least about 95% identical thereto.

16. The method of claims 1-15, the second portion of the DNA vector comprises a first ITR nucleic acid sequence having any one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a sequence at least about 95% identical thereto; a non-repeating nucleic acid sequence comprising an Ori having any one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and a second ITR nucleic acid repeating sequence having any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 19, or a sequence at least about 95% identical thereto.

17. The method of claims 1-15, wherein the second portion of the DNA vector comprises a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto.

18. The method of claims 1-15, wherein the second portion of the DNA vector comprises a first inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110,112, 114, 116, 1 18, 120, 122, 124, 126, 128, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 160, 161, or a sequence at least 95% identical thereto; a non-repeating nucleic acid sequence comprising an Ori having any one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and a second inverted repeat sequence comprising one or more repeat sequences selected from SEQ ID NOs: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 159, 160, 162, or a sequence at least about 95% identical thereto.

19. The method of claims 1-18, wherein the therapeutic protein is tissue-nonspecific alkaline phosphatase (TNALP) encoded by the ALPL gene.

20. The method of claim 19, wherein the TNALP protein is selected from SEQ ID NO: 177- 182, or a sequence at least about 95% identical thereto.

21. The method of claims 1-18, wherein the first portion comprises a nucleic acid sequence of SEQ ID NO: 183, 197, or a nucleic acid at least about 80% identical thereto.

22. The method of claims 1-18, wherein the therapeutic protein is proprotein convertase subtilisin / kexin type 9 encoded by the PCSK9 gene.

23. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 184, or a nucleic acid at least about 80% identical thereto.

24. The method of claims 1-18, wherein the therapeutic protein is proprotein convertase subtilisin / kexin type 7 encoded by the PCSK7 gene.

25. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 214, or a nucleic acid at least about 80% identical thereto.

26. The method of claims 1-18, wherein the therapeutic protein is alpha-1 antitrypsin encoded by the SerpinAl gene.

27. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 194, or a nucleic acid at least about 80% identical thereto.

28. The method of claims 1-18, wherein the therapeutic protein is ATP Binding Cassette Subfamily B Member 4 encoded by the ABCB4 gene.

29. The method of claim 28, wherein the protein sequence is SEQ ID NO: 187, or a sequence at least about 95% identical thereto.

30. The method of claims 1 -18, wherein the first portion comprises a nucleic acid selected from SEQ ID NO: 188 or 189, or a nucleic acid at least about 80% identical thereto.

31. The method of claims 1-18, wherein the therapeutic protein is ATPase Copper Transporting Beta protein encoded by the ATP7B gene.

32. The method of claim 31, wherein the protein sequence is SEQ ID NO: 195, or a sequence at least about 95% identical thereto.

33. The method of claims 1-18, wherein the first portion comprises a nucleic acid selected from SEQ ID NO: 192 or 193, or a nucleic acid at least about 80% identical thereto.

34. The method of claims 1-18, wherein the therapeutic protein is the bile salt export pump (BSEP) protein encoded by the ABCB11 gene.

35. The method of claims 1-18, wherein the first portion comprises a nucleic acid selected from SEQ ID NO: 217, or a nucleic acid at least about 80% identical thereto.

36. The method of claims 1-18, wherein the therapeutic protein is an antiCD 19-antiCD3 protein.

37. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 190, or a nucleic acid at least about 80% identical thereto.

38. The method of claims 1-18, wherein the therapeutic protein is B-domain deleted FVIII.

39. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 191, or a nucleic acid at least 80% identical thereto.

40. The method of claims 1-18, wherein the therapeutic protein is phosphate-regulating neutral endopeptidase.

41. The method of claims 1-18, wherein the therapeutic protein is 1 -acyl glycerol-3 -phosphate O-acyltransferase.

42. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 199, or a nucleic acid at least 80% identical thereto.

43. The method of claims 1-18, wherein the therapeutic protein is transmembrane 6 superfamily member 2.

44. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 201, or a nucleic acid at least 80% identical thereto.

45. The method of claims 1-18, wherein the therapeutic protein is laminin subunit alpha-2.

46. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 205, or a nucleic acid at least 80% identical thereto.

47. The method of claims 1-18, wherein the therapeutic protein is fibroblast growth factor 21 encoded by the FGF21 gene.

48. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 203, or a nucleic acid at least about 80% identical thereto.

49. The method of claim 48, wherein the protein sequence is SEQ ID NO: 202, or a sequence at least about 95% identical thereto.

50. The method of claims 1-18, wherein the therapeutic protein is laminin-111, encoded by the subunits laminin alpha- 1 (LAMA-1), laminin alpha-2 (LAMA-2), laminin beta-1 (LAMB- 1), laminin gamma- 1 (LAMC-1), or a combination thereof.

51. The method of claims 1-18, wherein the first portion comprises a nucleic acid selected from SEQ ID NOs: 207, 209, 211, or 213, or a nucleic acid at least about 80% identical thereto, or a combination of these sequences.

52. The method of claim 50, wherein the protein sequence comprises an amino acid sequence selected from SEQ ID NOs: 206, 208, 210, 212, or a sequence at least about 95% identical thereto, or a combination of these sequences.

53. The method of claims 1-18, wherein the therapeutic protein is an anti-FGF23 antibody or a fragment thereof.

54. The method of claims 1-18, wherein the first portion comprises a nucleic acid selected from SEQ ID NOs: 219 or 221, or a nucleic acid at least about 80% identical thereto, or a combination of these sequences.

55. The method of claim 54, wherein the protein sequence comprises SEQ ID NOs: 218 or 220, or a sequence at least about 95% identical thereto, or a combination of these sequences.

56. The method of claims 1-18, wherein the therapeutic protein is a fragment of FGF23.

57. The method of claims 1-18, wherein the first portion comprises a nucleic acid of SEQ ID NO: 223, or a nucleic acid at least about 80% identical thereto.

58. The method of claim 57, wherein the protein sequence is SEQ ID NO: 222, or a sequence at least about 95% identical thereto.

59. The method of claims 1 -18, wherein the therapeutic protein is Collagen IVa345, encoded by COL4A3, COL4A4, or COL4A5, or a combination thereof.

60. The method of claims 1-18, wherein the first portion comprises a nucleic acid selected from SEQ ID NOs: 225, 227, or 229, or a nucleic acid at least about 80% identical thereto, or a combination of these sequences.

61. The method of claim 60, wherein the protein sequence comprises a sequence selected from SEQ ID NOs: 224, 226, or 228, or a sequence at least about 95% identical thereto, or a combination of these sequences.

62. The method of claims 1-18, wherein the therapeutic protein is alkaline phosphatase or a variant thereof.

63. The method of claims 1-18, wherein the expression cassette of the DNA vector comprises a nucleic acid sequence encoding a polypeptide having any one of Formulas (IA) to (IE), where the nucleic acid sequence encoding the polypeptide is operatively linked to a promoter;[A]^[B]-[C]w-[R]q-([D]x-[E]y)z(IA),[A]-[B]-[C]-[R]q-([D [E]y) (IB),([A]-[B])-([D]X-[E]V)Z (IC),([A]-[B])-([E]y) (ID), and[A]— [B] — [R]q— ([E]y) (IE); whereinA comprises an amino acid sequence encoding a secretion signal peptide;B comprises an amino acid encoding an alkaline phosphatase;C comprises an amino acid sequence encoding a GPI anchor;R is -(Mo(Fc)Np)-, where M and N each independently include between 1 and 6 amino acids, where Fc is a Fc domain, and o and p are each independently 0, 1, or 2;D comprises an amino acid sequence having between 4 and 6 amino acids, or is F(G)tF, where each F is the same amino acid, G is an amino acid sequence having 3, 4, or 5 amino acids, and t is an integer ranging from 2 - 5;E comprises an amino acid sequence having between 1 and 8 amino acids; q is 0 or 1; v is 0 or 1;w is 0 or 1 ; x is 0 or an integer ranging from 1 to 6; y is 0 or an integer ranging from 1 to 16; and z is 0 or an integer ranging from 1 to 6.

64. The method of claim 63, wherein when v is 1, w is 0, q is 1, o is 1, p is 1, N is the diamino acid -D-I-, M is the diamino acid -L-K-, [B] comprises an amino acid selected from SEQ ID NOS: 177-182, Fc comprises SEQ ID NO: 230 or 231, and x is 0, then [E]ydoes not comprise ten to sixteen contiguous aspartic acid residues.

65. The method of claims 63-64, wherein E comprises 3 amino acids.

66. The method of claims 63-65, wherein E is -D-S-S-.

67. The method of claims 63-66, wherein E is -D-S-S-, and y ranges from 1 to 16.

68. The method of claims 63-67, wherein E is -D-S-S-, y is 6, z is 1, q is 0, and x is 0.

69. The methods of claims 63-67, wherein E is -D-S-S-, y is 6, z is 1, q is 0, and x is 2.

70. The methods of claims 63-67, wherein E is -D-S-S-, y is 6, z is 1, x is 2, and q is 1.

71. The method of claim 63, wherein when v is 1, w is 0, q is 1, o is 1, p is 1, N is the diamino acid -D-I-, M is the diamino acid -L-K-, [B] comprises SEQ ID NO: 182, Fc comprises SEQ ID NO: 231, and x is 0, then [E]ydoes not comprise ten to sixteen contiguous aspartic acid residues.

72. The method of claims 63-71, wherein [A] comprises the amino acid sequence of SEQ ID NO: 234, or an amino acid sequence at least about 95% identical thereto.

73. The method of claims 63-71, the nucleic acid sequence encoding [A] comprises the nucleic acid sequence of SEQ ID NO: 233, or a nucleic acid sequence at least about 95% identical thereto.

74. The method of claims 63-71, wherein [A]V[B] is encoded by the nucleic acid sequence of SEQ ID NO: 197, or a nucleic acid sequence at least about 95% identical thereto.

75. The method of claims 63, 65-70, or 72-74, wherein M comprises the dipeptide -L-K- and o is 1.

76. The method of claim 75, wherein M is encoded by the nucleic acid sequence of ctgaaa.

77. The method of claims 63, 65-70, or 72-76, wherein (Fc) comprises the amino acid sequence of SEQ ID NO: 231, or an amino acid sequence at least about 95% identical thereto.

78. The method of claims 63, 65-70, or 72-77, wherein N comprises the dipeptide -D-I- and p is 1.

79. The method of claim 78, wherein N is encoded by the nucleic acid sequence of gatatt.

80. The method of claim 63, wherein the polypeptide comprises the Formula (IE).

81. The method of claims 63-80, wherein the promoter is selected from the group consisting of EF1A, MND, CDlb, CD68LPP, EFlal, EFS, and UbC.

82. The method of claims 63-80, wherein the promoter is a long elongation factor 1-alpha promoter (EF1L).

83. The method of claims 63-82, wherein the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding the one or more therapeutic proteins.

84. The method of claim 83, wherein the polyadenylation site is a bGH or bGH2 poly(A) sequence.

85. The method of claims 63-84, wherein the non-viral vector further comprises a WPRE element.

86. The method of claims 1-8, wherein the DNA vector is selected from a sequence of SEQ ID NOs: 242, 262, or a sequence at least about 95% identical thereto.

87. The method of claims 1-86, wherein the second portion of the DNA vector is capable of forming one or more specialized secondary structures.

88. The method of claim 87, wherein the one or more specialized secondary structures is an extended cruciform structure.

89. The method of claims 1-88, wherein the non-repeating sequence comprises one or more additional DNA sequences selected from small runs of extraneous and or spacer nucleotide sequences of from about 1 bp to about 20 bps, cloning or recombination sites, or a LoxP site, FRT site, attB and attP site, attL or attR sire, or alternative recombination target sites derived from Lox511 or Lox66 sites.

90. A circular, non-viral, double-stranded DNA vector comprising:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion having the Formula X-Y-X', where X and X1are each inverted repeat sequences, and where Y is not repeated and comprises a nucleotide sequence having at least 25 base-pairs, but less than about 460 bps; wherein the X inverted repeat sequence is operatively arranged as A1-A2-A3-A4- AX; wherein the X’ inverted repeat sequence is operatively arranged as AX’-A4’-A3’- A2’-A1’; wherein Al’ is the reverse complement of Al; wherein A2’ is the reverse complement of A2; wherein A3’ is the reverse complement of A3; wherein A4’ is the reverse complement of A4; wherein AX’ is the reverse complement of AX, and wherein AX and AX’ represents the addition of at least one or more further complementary repeat sequences to be added to the X and X’ inverted repeat sequences; wherein Al is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto; wherein A2 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto; wherein A3 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto; wherein A4 is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto; and wherein AX is selected from SEQ ID NOs: 20-162, or a sequence at least about 90% identical thereto.

91. The DNA vector of claim 90, wherein Y is a non-repeating nucleic acid sequence comprising an Ori selected from the sequences of SEQ ID NOs: 163-167, or a sequence at least about 95% identical thereto.

92. The DNA vector of claims 90-91, wherein the therapeutic protein is tissue-nonspecific alkaline phosphatase (TNALP) encoded by the ALPL gene.

93. The DNA vector of claim 92, wherein the TNALP protein is selected from SEQ ID NO: 177-182, or a sequence at least about 95% identical thereto.

94. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid sequence of SEQ ID NO: 183, or 197, or a nucleic acid at least about 80% identical thereto.

95. The DNA vector of claims 90-91, wherein the therapeutic protein is proprotein convertase subtilisin / kexin type 9 encoded by the PCSK9 gene.

96. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 184, or a nucleic acid at least about 80% identical thereto.

97. The DNA vector of claims 90-91, wherein the therapeutic protein is proprotein convertase subtilisin / kexin type 7 encoded by the PCSK7 gene.

98. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 214, or a nucleic acid at least about 80% identical thereto.

99. The DNA vector of claims 90-91, wherein the therapeutic protein is alpha-1 antitrypsin encoded by the SerpinAl gene.

100. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 194, or a nucleic acid at least about 80% identical thereto.

101. The DNA vector of claims 90-91, wherein the therapeutic protein is ATP Binding Cassette Subfamily B Member 4 encoded by the ABCB4 gene.

102. The DNA vector of claim 101, wherein the protein sequence is SEQ ID NO: 187, or a sequence at least about 95% identical thereto.

103. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid selected from SEQ ID NO: 188 or 189, or a nucleic acid at least about 80% identical thereto.

104. The DNA vector of claims 90-91, wherein the therapeutic protein is ATPase Copper Transporting Beta protein encoded by the ATP7B gene.

105. The DNA vector of claim 104, wherein the protein sequence is SEQ ID NO: 195, or a sequence at least about 95% identical thereto.

106. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid selected from SEQ ID NO: 192 or 193, or a nucleic acid at least about 80% identical thereto.

107. The DNA vector of claims 90-91, wherein the therapeutic protein is the bile salt export pump (BSEP) protein encoded by the ABCB11 gene.

108. The DNA vector of claims 90-91 , wherein the first portion comprises a nucleic acid selected from SEQ ID NO: 217, or a nucleic acid at least about 80% identical thereto.

109. The DNA vector of claims 90-91, wherein the therapeutic protein is an antiCD19- antiCD3 protein.

110. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 190, or a nucleic acid at least about 80% identical thereto.

111. The DNA vector of claims 90-91, wherein the therapeutic protein is B-domain deleted FVIII.

112. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 191, or a nucleic acid at least 80% identical thereto.

113. The DNA vector of claims 90-91, wherein the therapeutic protein is phosphate- regulating neutral endopeptidase.

114. The DNA vector of claims 90-91, wherein the therapeutic protein is 1-acylglycerol- 3 -phosphate O-acyltransf erase.

115. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 199, or a nucleic acid at least 80% identical thereto.

116. The DNA vector of claims 90-91 , wherein the therapeutic protein is transmembrane 6 superfamily member 2.

117. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 201, or a nucleic acid at least 80% identical thereto.

118. The DNA vector of claims 90-91, wherein the therapeutic protein is laminin subunit alpha-2.

119. The DNA vector of claims 90-91, wherein the first portion comprises a nucleic acid of SEQ ID NO: 205, or a nucleic acid at least 80% identical thereto.

120. The DNA vector of claims 90-91, wherein the therapeutic protein is alkaline phosphatase or a variant thereof.

121. The DNA vector of claims 90-91, wherein the expression cassette of the DNA vector comprises a nucleic acid sequence encoding a polypeptide having any one of Formulas (IA) to (IE), where the nucleic acid sequence encoding the polypeptide is operatively linked to a promoter;[A]v-[B]-[C]w-[R]q-([D]x-[E]y)z(IA),[A]-[B]-[C]-[R]q-([D]-[E]y) (IB),([A]-[B])-([D]^[E]y)z(IC),([A]-[B])-([E]y) (ID), and[A]-[B] -[R]q-([E]y) (IE); whereinA comprises an amino acid sequence encoding a secretion signal peptide;B comprises an amino acid encoding an alkaline phosphatase;C comprises an amino acid sequence encoding a GPI anchor;R is -(M0(Fc)Np)-, where M and N each independently include between 1 and 6 amino acids, where Fc is a Fc domain, and o and p are each independently 0, 1, or 2;D comprises an amino acid sequence having between 4 and 6 amino acids, or is F(G)tF, where each F is the same amino acid, G is an amino acid sequence having 3, 4, or 5 amino acids, and t is an integer ranging from 2 - 5;E comprises an amino acid sequence having between 1 and 8 amino acids; q is 0 or 1; v is 0 or 1; w is 0 or 1; x is 0 or an integer ranging from 1 to 6; y is 0 or an integer ranging from 1 to 16; and z is 0 or an integer ranging from 1 to 6.

122. The DNA vector of claim 121, wherein when v is 1, w is 0, q is 1, o is 1, p is 1, N is the diamino acid -D-I-, M is the diamino acid -L-K-, [B] comprises an amino acid selected from SEQ ID NOS: 177-182, Fc comprises SEQ ID NO: 230, and x is 0, then [E]ydoes not comprise ten to sixteen contiguous aspartic acid residues.

123. The DNA vector of claims 121-122, wherein E comprises 3 amino acids.

124. The DNA vector of claims 121-123, wherein E is -D-S-S-.

125. The DNA vector of claims 121-123, wherein E is -D-S-S-, and y ranges from 1 to16.

126. The DNA vector of claims 121-123, wherein E is -D-S-S-, y is 6, z is 1, q is 0, and x is 0.

127. The DNA vector of claims 121-123, wherein E is -D-S-S-, y is 6, z is 1, q is 0, and x is 2.

128. The DNA vector of claims 121-123, wherein E is -D-S-S-, y is 6, z is 1, x is 2, and q is 1.

129. The DNA vector of claim 121, wherein when v is 1, w is 0, q is 1, o is 1, p is 1, N is the diamino acid -D-I-, M is the diamino acid -L-K-, [B] comprises SEQ ID NO: 182, Fc comprises SEQ ID NO: 231, and x is 0, then [E]ydoes not comprise ten to sixteen contiguous aspartic acid residues.

130. The DNA vector of claims 121-129, wherein [A] comprises the amino acid sequence of SEQ ID NO: 234, or an amino acid sequence at least about 95% identical thereto.

131. The DNA vector of claims 121-129, the nucleic acid sequence encoding [A] comprises the nucleic acid sequence of SEQ ID NO: 233, or a nucleic acid sequence at least about 95% identical thereto.

132. The DNA vector of claims 121-129, wherein [A]V[B] is encoded by the nucleic acid sequence of SEQ ID NO: 197, or a nucleic acid sequence at least about 95% identical thereto.

133. The DNA vector of claims 121, 123-128, or 130-131, wherein M comprises the dipeptide -L-K- and o is 1.

134. The DNA vector of claim 133, wherein M is encoded by the nucleic acid sequence of ctgaaa.

135. The DNA vector of claims 121, 123-128, or 130-134, wherein (Fc) comprises the amino acid sequence of SEQ ID NO: 231, or an amino acid sequence at least about 95% identical thereto.

136. The DNA vector of claims 121-127, or 129-135, wherein N comprises the dipeptide -D-I- and p is 1.

137. The DNA vector of claim 136, wherein N is encoded by the nucleic acid sequence of gatatt.

138. The DNA vector of claim 121, wherein the polypeptide comprises the Formula (IE).

139. The DNA vector of claims 121-138, wherein the promoter is selected from the group consisting of EF1A, MND, CDlb, CD68LPP, EFlal, EFS, and UbC.

140. The DNA vector of claims 121 -139, wherein the promoter is a long elongation factor 1-alpha promoter (EF1L).

141. The DNA vector of claims 121-140, wherein the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding the one or more therapeutic proteins.

142. The DNA vector of claim 141, wherein the polyadenylation site is a bGH or bGH2 poly(A) sequence.

143. The DNA vector of claims 121-142, wherein the non-viral vector further comprises a WPRE element.

144. The DNA vector of claims 121-143, wherein the second portion of the DNA vector is capable of forming one or more specialized secondary structures.

145. The DNA vector of claim 144, wherein the one or more specialized secondary structures is an extended cruciform structure.

146. The DNA vector of claims 121-145, wherein Y comprises one or more additional DNA sequences selected from small runs of extraneous and or spacer nucleotide sequences of from about 1 bp to about 20 bps, cloning or recombination sites, or a LoxP site, FRT site, attB and attP site, attL or attR sire, or alternative recombination target sites derived from Lox511 or Lox66 sites.

147. The DNA vector of claims 121-146, wherein Y does not comprise a bacterial selection marker.

148. An isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein the one or more nucleic acid sequences comprise a nucleic acid sequence selected from SEQ ID NOs: 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, or 229, or a nucleic acid sequence at least 80% identical thereto, and wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprises two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequencesare capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker.

149. An isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein the one or more therapeutic proteins comprise an amino acid sequence selected from SEQ ID NOs: 198, 200, 202, 204, 206, 208, 210, 212, 214, 218, 220, 222, 224, 226, or 228, or a nucleic acid sequence at least 80% identical thereto, and wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins are operatively linked to a promoter; and(ii) a second portion comprises two repeating sequences and a non-repeating sequence contained between the two repeating sequences, wherein the repeating sequences are capable of aligning to form two double-stranded arms of significant length of at least about 80 base-pairs (bps) with a loop formed at the end of each extended arm by the non-repeating sequence, wherein the non-repeating sequence is between about 225 bps and about 460 bps and comprises a bacterial origin of replication (Ori) or fragment thereof, and wherein the second portion lacks a bacterial selection marker.

150. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

151. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence;wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

152. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

153. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and secondAAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

154. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

155. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence isflanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

156. A method for the treatment of a disorder in a human patient that minimizes deleterious transcription responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6I<y) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence;wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in a transcription-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

157. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of a first adeno-associated virus (AAV) inverted repeat sequence, an R6Ky bacterial origin of replication (oriR6Ky) sequence, and a second AAV inverted repeat sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from transcription-related gene ontology (GO) group selected from mouse G0:0045944 (positive regulation of transcription from RNA polymerase II promoter), mouse GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), mouse G0:0006397 (mRNA processing), mouseG0:0008380 (RNA splicing), mouse G0:0006357 (regulation of transcription from RNA polymerase II promoter), mouse GO: 0006355 (regulation of transcription, DNA- templated), mouse G0:0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

158. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Kv sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours postDNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

159. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Ky sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

160. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Ky sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

161. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Ky sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencingfrom liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

162. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Ky sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

163. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Ky sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

164. A method for the treatment of a disorder in a human patient that minimizes deleterious transcription responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Ky sequence; and(c) a second AAV inverted repeat sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in a transcription-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

165. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence consisting essentially of, operably linked in a 5' to a 3' direction:(a) a first AAV inverted repeat sequence;(b) an oriR6Kv sequence; and(c) a second AAV inverted repeat sequence; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and,wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

166. The method of claims 150-165, wherein the AAV inverted repeat sequences are selected from a sequence of SEQ ID NOs: 1-19, or a sequence at least about 95% identical thereto.

167. The method of claims 150-165, wherein the first AAV ITR nucleic acid sequence is any one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a sequence at least about 95% identical thereto; wherein the oriR6Ky has the nucleic acid sequence of any one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and wherein the second AAV ITR nucleic acid repeating sequence is any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 19, or a sequence at least about 95% identical thereto.

168. The method of claims 150-165, wherein the second portion of the DNA vector comprises a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto.

169. The method of claims 150-165, wherein the second portion of the DNA vector comprises a first AAV inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 160, 161, or a sequence at least 95% identical thereto; wherein the oriR6Ky is one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and a second AAV inverted repeat comprising one or more repeat sequences selected from SEQ ID NOs: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 159, 160, 162, or a sequence at least about 95% identical thereto.

170. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X1are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from Ankhdl, Atg9a, Cls2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl, Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

171. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an innate immune response, wherein the genes are selected from mouse orthologs Ankhdl, Atg9a,Cl s2, C3, Card9, Cd84, Cfh, Fes, Fga, Jchain, Klrkl, Map3k5, Maspl , Naip5, Nlrc5, Oas2, Sla2, Slamfl, Trdc, Triml 1, Txk, Zbtbl, or a combination thereof; wherein expression levels of the genes involved in the innate immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level.

172. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector to the patient, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein the first AAV inverted repeat sequence, R6Kyori sequence, and second AAV inverted repeat sequence are contiguous, and wherein the R6Kyori sequence is flanked by, and in between, the first AAV inverted repeat sequence and the second AAV inverted repeat sequence; wherein administration of the DNA vector induces in the patient an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

173. A method for the treatment of a disorder in a patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effectiveamount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from mouse orthologs Enpp3, Iglvl, 116, Map3kl4, Oas2, Pf4, Ppbp, Tnfrsfl lb, Tnfrsf22, or a combination thereof, wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

174. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X';wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in an immune-related gene ontology (GO) group selected from G0:0045087 (innate immune response), G0:0002376 (immune system process), or G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

175. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X' are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from an immune-related gene ontology (GO) group selected from mouse G0:0045087 (innate immune response), mouse G0:0002376 (immune system process), or mouse G0:0006955 (immune response), or a combination thereof; wherein expression levels of the genes involved in the immune response are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level;wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

176. A method for the treatment of a disorder in a human patient that minimizes deleterious transcription responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X1are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector induces an expression change by a factor of about 2 or greater in mRNA transcript levels in no more than 5 expressed genes in a transcription-related gene ontology (GO) group selected from GO: 0045944 (positive regulation of transcription from RNA polymerase II promoter), GO: 0000122 (negative regulation of transcription from RNA polymerase II promoter), 0006397 (mRNA processing), 0008380 (RNA splicing), 0006357 (regulation of transcription from RNA polymerase II promoter), 0006355 (regulation of transcription, DNA-templated), 0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mRNA transcript levels as measured by RNA-sequencing 24 hours post DNA vector administration and compared to a baseline mRNA transcript level measured prior to administration of the DNA vector.

177. A method for the treatment of a disorder in a human patient that minimizes deleterious immune responses to the treatment in the patient, comprising administering an effective amount of an isolated, circular, non-integrating, non-viral DNA vector, wherein the DNA vector comprises:(i) a first portion comprising an expression cassette comprising a nucleic acid sequence encoding a therapeutic protein, wherein the nucleic acid sequence encoding the therapeutic protein is operably linked to a promoter; and(ii) a second portion comprising a nucleic acid sequence comprising the Formula X- Y-X'; wherein X and X1are each separately an AAV inverted repeat sequence and Y consists essentially of oriR6Ky sequence; wherein administration of the DNA vector to adult BALB / c mice induces in the mice an expression change of a factor of about 2 or less of genes involved in an immune response, wherein the genes are selected from transcription-related gene ontology (GO) group selected from mouse G0:0045944 (positive regulation of transcription from RNA polymerase II promoter), mouse G0:0000122 (negative regulation of transcription from RNA polymerase II promoter), mouse G0:0006397 (mRNA processing), mouse G0:0008380 (RNA splicing), mouse G0:0006357 (regulation of transcription from RNA polymerase II promoter), mouse G0:0006355 (regulation of transcription, DNA- templated), mouse G0:0006351 (transcription, DNA-templated), or a combination thereof, wherein expression levels of the genes are determined by mean mRNA transcript levels of the mice as measured by RNA-sequencing from liver samples of the mice and compared to a mock control mean mRNA transcript level; wherein the change in mean transcript level is determined at 2-hours postadministration, 24-hours post administration, or 2-hours and 24-hours post-administration; and, wherein the expressed genes are measured based on the mean transcript level of the genes as determined by RNA sequencing (RNA-SEQ) of liver samples of the mice.

178. The method of claims 170-177, wherein X and X’ are independently selected from the group consisting of SEQ ID NOS: 1 - 19, or a sequence at least about 95% identical thereto.

179. The method of claims 170-177, wherein the first AAV ITR nucleic acid sequence is any one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or a sequence at least about 95% identical thereto; wherein Y has the nucleic acid sequence of any one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and wherein X’ is any one ofSEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 19, or a sequence at least about 95% identical thereto.

180. The method of claims 170-177, wherein the second portion of the DNA vector comprises a nucleic acid sequence having any one of SEQ ID NOS: 168, 173, 175, or 176, or a sequence at least about 95% identical thereto.

181. The method of claims 170-177, wherein X comprises one or more repeat sequences selected from SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 160, 161, or a sequence at least 95% identical thereto; wherein Y is one of SEQ ID NOS: 163-167, or a sequence at least about 95% identical thereto; and wherein X’ comprises one or more repeat sequences selected from SEQ ID NOs: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 159, 160, 162, or a sequence at least about 95% identical thereto.

182. The method of claims 150-181, wherein the therapeutic protein is selected from tissue-nonspecific alkaline phosphatase (TNALP), proprotein convertase subtilisin / kexin type 9 (PCSK9), proprotein convertase subtilisin / kexin type 7 (PCSK7), alpha- 1 antitrypsin, ATP Binding Cassette Subfamily B Member 4 (ABCB4), ATPase Copper Transporting Beta (ATP7B), bile salt export pump (BSEP), antiCD 19-antiCD3, B-domain deleted FVIII, phosphate-regulating neutral endopeptidase, l-acylglycerol-3 -phosphate O- acyltransferase, transmembrane 6 superfamily member 2 (TM6SF2), laminin- 111, laminin subunit alpha-1 (LAMA-1), laminin subunit alpha-2 (LAMA-2), fibroblast growth factor 21 (FGF21), laminin beta-1 (LAMB-1), laminin gamma-1 (LAMC-1), anti-FGF23 antibody or fragment thereof, fragment of FGF23, Collagen IVa345, COL4A3, COL4A4, or COL4A5.

Images