Gene therapy for ocular disorders relating to SIRT1

Abstract

Recombinant adeno-associated viral vectors are provided which include a nucleic acid molecule comprising a sequence encoding SIRT1. In one aspect compositions and methods are provided for treating ocular neuropathy in a subject. In desired embodiments, the subject is human, cat, dog, sheep, or non-human primate.

Description

[0001] GENE THERAPY FOR OCULAR DISORDERS RELATING TO SIRT1

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR

[0003] DEVELOPMENT

[0004] This invention was made with government support under EY019014 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0005] INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0006] The sequence listing file, entitled “UPN-24- 10561. PCT”, created October 28, 2024, being 85,020 bytes is incorporated by reference herein in its entirety.

[0007] BACKGROUND OF THE INVENTION

[0008] Retinal ganglion cells (RGCs) are important interventional targets in neurodegenerative diseases of the eye, including optic neuritis, glaucoma, ischemic optic neuropathy, and Leber’s hereditary optic neuropathy. RGC death is the underlying cause of irreversible blindness in these and other optic neuropathies. Damage to RGCs is commonly linked to various etiologies such as inflammation of the optic nerve, reduction of trophic factors, ischemia, increased oxidative stress with deleterious effects of reactive oxygen species exposure, and compromised axon transport and electrical activity. There currently are unmet treatment needs to prevent or minimize RGC alterations and / or regenerate functioning ones under disease conditions. Neuroprotective strategies currently under intense investigations include viral vector-mediated delivery to RGCs of therapeutic recombinant transgenes, and cell- and non-cellular-based neuroprotective approaches7. Of these, AAV- based gene therapy modalities are being tested in preclinical studies and clinical trials8. There are more than 130 different naturally occurring AAV serotypes and genotypes, that vary in capsid protein sequence, structure, and organization9. This capsid diversity results in tropism to a variety of cells and tissues, which makes AAV vectors a very attractive gene delivery vehicle. Concordantly, AAVs are effectively used to treat a number of genetic and acquired human diseases; more specifically, monogenic hereditary diseases caused by mutations in a single gene10-12. Today, numerous AAV-based gene therapies are being investigated, and some have been fully approved by regulatory agencies for use in humans to ameliorate vision loss in patients with inherited retinal diseases13-15. However, there still is a need for improved vector design that can maximize their targeting of neuronal cells like RGCs with high efficiency.

[0009] SIRT1 is a ubiquitously expressed histone deacetylase that removes acetyl groups from lysine residues of targeted histones and transcription factors, altering their stability, activity, subcellular localization, DNA-binding ability and protein-protein interactions29. As such, SIRT1 has a broad range of roles in the regulation of multiple fundamental processes associated with metabolism, inflammation, stress, apoptosis, and DNA repair30. The SIRTl / PGC-la signaling pathway has an endogenous neuroprotective role against neuronal damage in the brain and retina31, 32. In addition, SIRT1 was also shown to deacetylate several apoptosis-related proteins, such as p53, Smad7, F0X03 and F0X04, and protect cells against cell death31 33.

[0010] There is a need for optimized vectors to maximize transgene expression in RGC- targeted gene therapy. Such AAV-based gene therapeutics are useful, for example, in the treatment of ocular diseases, particularly optic neuropathies, wherein therapeutic genes such as SIRT1 may be best introduced directly in RGCs.

[0011] SUMMARY OF THE INVENTION

[0012] The present invention provides highly efficient AAV vectors having excellent transduction efficiency and specificity for RGCs.

[0013] In one embodiment there is provided a recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a CMV enhancer; (c) a human SNCG promoter; (d) an SV40 intron; (e) a coding sequence encoding a human SIRT1; (f) a WPRE; (g) a bGH poly A; and (h) an AAV 3' ITR sequence.

[0014] In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto; (b) the CMV enhancer sequence having SEQ ID NO: 5 or 29 or a sequence having at least 90% sequence identity thereto; (c) the human SNCG promoter sequence having SEQ ID NO: 6 or a sequence having at least 90% sequence identity thereto; (d) the SV40 intron sequence having SEQ ID NO: 7 or a sequence having at least 90% sequence identity thereto; (e) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto; (f) the WPRE sequence having SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto; (g) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and (h) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto. Preferably, the coding sequence encoding the human SIRT1 sequence is SEQ ID NO: 1.

[0015] In a preferred embodiment, the vector genome comprises: (a) an AAV 5' ITR sequence, preferably having SEQ ID NO: 4; (b) a CMV enhancer sequence having SEQ ID NO: 5 or 29; (c) a human SNCG promoter sequence having SEQ ID NO: 6; (d) a SV40 intron sequence having SEQ ID NO: 7; (e) a coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1; (f) a WPRE sequence having SEQ ID NO: 8; (g) a bGH poly A sequence having SEQ ID NO: 9 or 30; and (h) a AAV 3' ITR sequence, preferably having SEQ ID NO: 10 or 31.

[0016] In a particularly preferred embodiment, the vector genome comprises SEQ ID NO: 11, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0017] In another embodiment of the invention, there is provided a rAAV, said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a SV40 enhancer; (c) a human SNCG promoter; (d) an SV40 intron; (e) a coding sequence encoding a human SIRT1; (f) a WPRE; (g) a bGH poly A; and (h) an AAV 3' ITR.

[0018] In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto; (b) the SV40 enhancer sequence having SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto; (c) the human SNCG promoter sequence having SEQ ID NO: 6 or a sequence having at least 90% sequence identity thereto; (d) the SV40 intron sequence having SEQ ID NO: 7 or a sequence having at least 90% sequence identity thereto; (e) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto; (f) the WPRE sequence having SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto; (g) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and (h) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto. Preferably, the coding sequence encoding the human SIRT1 sequence is SEQ ID NO: 1.

[0019] In a preferred embodiment, the vector genome comprises: (a) an AAV 5' ITR sequence, preferably having SEQ ID NO: 4; (b) a SV40 enhancer sequence having SEQ ID NO: 12; (c) a human SNCG promoter sequence having SEQ ID NO: 6; (d) a SV40 intron sequence having SEQ ID NO: 7; (e) a coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1; (f) a WPRE sequence having SEQ ID NO: 8; (g) a bGH poly A sequence having SEQ ID NO: 9 or 30; and (h) an AAV 3' ITR sequence, preferably having SEQ ID NO: 10 or 31.

[0020] In a particularly preferred embodiment, the vector genome comprises SEQ ID NO: 13, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0021] In another embodiment, there is provided a rAAV, said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a CAG promoter; (c) a coding sequence encoding a human SIRT1; (d) a WPRE; (e) a bGH poly A; and (f) an AAV 3' ITR.

[0022] In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto; (b) the CAG promoter having SEQ ID NO: 28, 33, or 35 or a sequence having at least 90% sequence identity with SEQ ID NO: 28, 33, or 35; (c) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto; (d) the WPRE sequence having SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto; (e) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and (f) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto. Preferably, the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1. In a preferred embodiment, the vector genome comprises: (a) an AAV 5' ITR sequence, preferably having SEQ ID NO: 4; (b) a CAG promoter sequence having SEQ ID NO: 28, 33, or 35; (c) a coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1; (d) a WPRE sequence having SEQ ID NO: 8; (e) a bGH poly A sequence having SEQ ID NO: 9 or 30; and (f) an AAV 3' ITR sequence preferably having SEQ ID NO: 10 or 31.

[0023] In a particularly preferred embodiment, the vector genome comprises SEQ ID NO: 18, or a sequence sharing at least 90% identity therewith.

[0024] In another embodiment, there is provided a rAAV, said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a CAG promoter; (c) a coding sequence encoding a human SIRT1; (d) a bGH poly A; and (e) an AAV 3' ITR.

[0025] In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto; (b) the CAG promoter sequence having SEQ ID NO: 37 or a sequence having at least 90% sequence identity thereto; (c) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto; (d) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and (e) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

[0026] In an embodiment, the vector genome comprises (a) an AAV 5' inverted terminal repeat (ITR) sequence, preferably having SEQ ID NO: 4; (b) a CAG promoter sequence having SEQ ID NO: 37; (c) a coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1; (d) a bGH poly A sequence having SEQ ID NO: 9 or 30; and (e) an AAV 3' ITR sequence preferably having SEQ ID NO: 10 or 31.

[0027] In an embodiment, the vector genome comprises SEQ ID NO: 23, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0028] In an embodiment, the rAAV capsid is an AAV2 capsid or AAV8 capsid.

[0029] In another aspect there is provided a cell transfected with the AAV vector of the present invention. In another aspect there is provided a pharmaceutical composition comprising the rAAV or a cell according to the present invention; and a pharmaceutically acceptable carrier or excipient.

[0030] In an embodiment, there is provided an aqueous suspension suitable for administration to a subject, said suspension comprising an aqueous suspending liquid and a recombinant adeno-associated virus (rAAV). In an embodiment, the suspension comprises a surfactant, preservative, and / or buffer dissolved in the aqueous suspending liquid. In a preferred embodiment, the pharmaceutical composition or aqueous suspension is suitable for delivery to the eye.

[0031] In another aspect of the invention there is provided a method of treating or preventing a disorder of the eye in a subject in need thereof comprising administering to the subject a rAAV, cell, or pharmaceutical composition according to the invention.

[0032] In an embodiment, the disorder is an optic neuropathy such as optic neuritis or glaucoma.

[0033] In a preferred embodiment, the disorder is glaucoma.

[0034] In an embodiment, the rAAV, cell or pharmaceutical composition of the invention is administered intraocularly.

[0035] In a preferred embodiment, the rAAV, cell or pharmaceutical composition is administered by subretinal, suprachoroidal or intravitreal injection.

[0036] In an embodiment, the rAAV is delivered at a dose of about 1 x 109to about 1 x 1013vector genomes per eye (vg / eye). In an embodiment, the rAAV is administered in a dosage of from 1 x 109to 1 x 1013rAAV in a volume comprising about or at least 100 microliters, thereby preventing vision loss in said subject. In an embodiment, the rAAV is administered in a volume comprising about 100 to 250 microliters. In one embodiment, the rAAV is administered in a volume of between 150 to 800 microliters. In one embodiment, the rAAV is administered in a volume comprising of between 250 to 500 microliters. In one embodiment, the rAAV is administered in a volume comprising about 500 microliters.

[0037] In a preferred embodiment, the subject is human.

[0038] Other aspects and advantages of the invention will be readily apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIGs. 1 A-1H show AAV transduction potential. (A) Schematic representation of the AAV vectors VI. G and V2.G. AAV2 and AAV8BP2 were modified to drive the expression of transgene (eGFP) under the control of the CBA-CMV promoter. Transgene is placed between 2 internal terminal repeats (ITRs). (B) VI. G and V2.G administration was achieved through single injection of the AAV vector into the vitreous humor of the mouse eye. (C) Fluorescence confocal scanning laser ophthalmoscopy (CSLO) images acquired from mice 2 weeks following intravitreal injection of increasing doses of either VI. G or V2.G. (D) Representative fluorescence micrographs of the RGC layer from flat mounted preparations of mouse retina 2 weeks after intravitreal injection of 1 x 109vg / eye of Vl.G or V2.G vector. RGCs were labeled with a monoclonal antibody against Bm3a. Merged eGFP (green) and Brn3a (red) signal is shown. (E-F) Transduction efficiency at week 1 and week 2 post intravitreal injection of Vl.G and V2.G determined as the percentage of Brn3a+ eGFP+ cells in relation to the total Brn3a+ positive cells averaged among all retinal areas. Data are presented as means ± SEM (*, p<0.05, n=4). (G-H) show average percentage ±SEM of brn3a+ RGCs expressing eGFP one (FIG. 1G) or two (FIG. 1H) weeks following intravitreal injection of both vectors at three different concentrations (n = 4 retinas / vector dose / time point).

[0040] FIG. 2 shows time- and dose-dependent transduction potential of the AAV2 vector. Representative fluorescence micrographs were generated of retinal flat mounts at week 1, 2 and 4 after intravitreal administration of increasing doses of V2.G vector, immunostained with Bm3a antibody (not shown). Transduction efficiency at week 1, week 2 and week 4 post intravitreal injection of V2.G was determined as the percentage of Brn3a+ eGFP+cells in relation to the total Bm3a+positive cells averaged among all retinal areas. (Data are presented as means ± SEM, n=4).

[0041] FIGs. 3 A-3F show optimization of the AAV2 vector for high efficiency delivery of transgenes to RGCs in vivo. (A) Diagram of AAV vectors containing diverse promoters and regulatory sequences to drive eGFP reporter expression. CMV.CBA: cytomegalovirus enhancer with chicken P-actin promoter; hSNCG: human gamma-synuclein promoter; WPRE: woodchuck hepatitis post-transcriptional regulatory element; iSV40: SV40 intron; eCMV: CMV-immediate early enhancer; eSV40: SV40 enhancer; Arc: activity -regulated cytoskeletal promoter; PolyA: Poly adenine nucleotide tail; ITR: internal terminal repeat; eGFP: enhanced green fluorescent protein. (B) Representative fundus fluorescence images and Bm3a immunostained flat mount retina (inset panel) of eyes injected with 3 x 109vg / eye V3.G, V4.G, V5.G, V6.G, V7.G, and V8.G vectors. (C) Transduction efficiency at week 2 post intravitreal injection with V2.G, V3.G, V4.G, V5.G, V6.G, V7.G, and V8.G. The percentage of Bm3a-positive cells (RGCs) that are GFP -positive in retinal flat is shown. Data are presented as means ± SEM (*p<0.05, n=3-4) of the percentage of EGP+ RGCs counted across all retinal regions. (D) Quantification of eGFP protein levels in retinal lysates from mouse eyes injected intravitreally with either V2.G, V3.G, V4.G, V5.G, V6.G, V7.G, or V8.G. Values shown are expressed as average ±SEM. *p<0.05 (n=4). ***p<0.001 (n=4). Two weeks post-injection (1E10 vg / eye), 6 of 8 constructs demonstrate equivalent transduction efficiency with 35-40% of bm3a+ RGCs expressing eGFP (FIG. 3E; n = 6 eyes / vector). Only the hSNCG.eGFP construct had significantly lower transduction (*p<0.05) compared with the CMV and SV40 enhancer / SNCG promoter constructs, and the Arc enhancer construct showed a trend toward lower transduction. ELISA of whole retina protein extracts (FIG. 3F; n = 3-4 retinas / vector) shows a non-significant trend of higher expression with the CMV / CBA, CMV / SNCG, and SV40 / SNCG enhancer / promoter combinations.

[0042] FIGs. 4A-4C shows RGC selectivity of AAV2 vectors. (A) Representative fluorescence micrographs of retinal cross-sections after intravitreal administration of 3 x 109vg / eye of V2.G, V4.G, V6.G or V7.G and immunostaining with Brn3a antibody. Fluorescence images of eGFP and Bm3a are shown separately and overlayed. (B) Quantification of the population of eGFP+ RGCs transduced with either V2.G, V4.G, V6.G or V7.G. Selectivity of the promoters inserted in the AAV2 vectors was calculated as the number of eGFP+ Bma3a+ cells out of the total number of eGFP+ cells. Data shown are means ± SEM (*p<0.05 versus V2.G, ANOVA with Tukey’s multiple comparison test, n=). (C) Two weeks after intravitreal injection (1E10 vg / eye), immunostaining of retinal cross sections showed that significantly fewer eGFP+ cells colocalized with the RGC marker brn3a (60%) in eyes injected with the CMV.CBA enhancer / promoter construct as compared with eyes injected with either SNCG promoter containing construct (90% each). ***p<0.001, n = 6 retinas / vector. Representative photos (right) illustrate the selective eGFP within the RGC layer in eyes injected with SNCG promoter containing constructs. FIGs. 5A-5E show AAV2-mediated expression of hSIRTl in RGCs. (A) Schematic representation of the AAV2 capsid engineered to contain the hSIRTl gene under the control of either CMV-CBA or hSNCG promoter combined with different regulatory sequences. The eGFP reporter gene in the V2.G, V6.G, and V7.G vectors (shown in Figure 3) was replaced with the codon optimized sequence of the human SIRT1 gene in the AAV vectors labeled AR0020, AR0018 (AR0020 with added WPRE element), AR0012 and AR0013, respectively. (B) Fluorescence micrographs of flat mounted preparations of mouse retinas after intravitreal injection of 3 x 109vg / eye of the AR0020, AR0018, AR0012 or AR0013 vectors. RGCs were labeled with a monoclonal antibody against Brn3a and human-specific SIRT1. Separate and merged hSIRTl (green) and Bm3a (red) images are shown. (C) Quantification of the population of SIRTl+RGCs two weeks after vector injection. Transduction efficiency was calculated as the percentage of SIRT1+Brn3a+cells out of the total number of Bm3a+ cells counted in 12 representative fields covering standardized regions across the central, midperipheral and far peripheral retina (n=6). (D) Transduction efficiency in regions of the central retina containing only the highest numbers of hSIRTl+cells was calculated as the percentage of SIRT1+Bm3a+cells out of the number of Brn3a+ cells counted in the most densely stained retinal region. Data shown are means ± SEM (n=6). (E) Quantitative (q)PCR analysis of relative quantities of hSIRTl mRNA in retinal lysates from mouse eyes injected intravitreally with either the AR0020, AR0018, AR0012 or AR0013 vectors. Data shown are means ± SEM (n=6).

[0043] FIG. 6A-6B show results from an optic neuropathy mouse model. FIG. 6 A EAE scores showed mild ascending paralysis developed in all treatment groups. FIG. 6B EAE scores showed more significant ascending paralysis, reaching a moderate level in all treatment groups.

[0044] FIG. 6C demonstrates that EAE scores from the first treatment show a slow mild increase in ascending paralysis. Mice were sham injected with PBS in one eye, and injected with vector in the contralateral eye 14 days prior to EAE induction, or injected with vector in one eye 9 days and the other eye 15 days after EAE induction (n = 10 mice / group). FIG. 6D demonstrates that OKR scores show similar decreases in visual function with or without SIRT1 gene therapy (n = 10 eyes / treatment). FIG. 6E demonstrates that RGCs / retina (n = 7- 10 retinas / treatment) show significant RGC loss induced by EAE is attenuated by AR0012 or AR0018 treatment. Effects of AR0012 or AR0018 showed a strong trend toward increased RGC survival in all groups that did not reach statistical significance when compared by ANOVA, but RGC survival significantly improved in three groups when each treatment group was compared to untreated by t-test. FIG. 6F demonstrates that EAE scores show typical moderate ascending paralysis. Mice were sham injected in one eye, and injected with vector in the contralateral eye 14 days prior to EAE induction, or injected in one eye 9 days and the other eye 15 days after EAE induction (n = 10 mice / group). OKR (FIG. 6G) shows similar visual decline with or without SIRT1 gene therapy (n = 10 eyes / treatment).

[0045] RGCs / retina (n = 10 retinas / treatment, FIG. 6H) show significant RGC loss induced by EAE is significantly attenuated by AR0012 or AR0018 treatment as compared by ANOVA.

[0046] FIGs. 7A-7C show the results of Experiment 1, described in Example 4. IOP (FIG. 7A left) measurements show average IOP levels more than doubled in all MB injected treatment groups. Eyes were sham injected or injected with vector 14 days prior to MB injection or injected with vector 3 or 10 days after MB injection (n = 10 eyes / group). OKR (FIG. 7B) shows similar visual decline with or without SIRT1 gene therapy (n = 4-10 eyes / treatment), including only eyes with documented IOP elevation and did not have severe corneal staining. RGCs / retina (FIG. 7C) show a trend toward increased RGC survival in all groups (n = 6-9 eyes / treatment) that was not significant when compared by ANOVA, with RGC survival significantly improved in one group when compared to untreated by t-test (*p < 0.05). Data shown only from eyes with elevated IOP.

[0047] FIGs. 8A-8D show the results of Experiment 2, described in Example 4. IOP (FIG. 8A) measurements show average IOP levels increased 1.5-2.0-fold in all lower concentration microbead (MB) injected treatment groups. Eyes were sham injected or injected with vector 14 days prior to MB injection or injected with vector 10 days after MB injection (n = 10 eyes / group). OKR (upper right) shows significant visual decline in MB injected eyes without SIRT1 gene therapy (#p<0.0001 vs control eyes, ANOVA with LS means post-hoc analysis), including only eyes with documented IOP elevation and that did not have severe corneal staining on the day of OKR measurement (n = 5-10 eyes / treatment). All treatments significantly improved OKR responses (vs null vector; ANOVA with LS means post-hoc analysis; *p<0.05, **p<0.01 ***p<0.001). RGCs / retina (lower right) show significant RGC loss in MB injected eyes treated with null vector (#p<0.05 vs control eyes), Treatment with both V.6S and V2.wpre.S before and after MB injection led to increased RGC survival in all groups compared to control vector (n = 7-10 eyes / treatment; ANOVA with LS means post- hoc analysis; *p<0.05, **p<0.01, data including only eyes with elevated IOP). A crosssection of optic nerves from 4 randomly selected mice in each treatment group (n=4 nerves / treatment) were stained with toluidine blue, and counts of RGC axons by a masked investigator show a strong trend toward increased RGC axon density in treated vs null-treated MB injected mice (lower left).

[0048] FIGs. 9A-9D show results of experiment described in Example 5. EAE scores (FIG. 9 A) show typical moderate ascending paralysis. Eyes were injected with sham or therapeutic vector(s) 14 days prior to EAE induction. OKR (FIG. 9B) shows similar visual decline with or without SIRT1 gene therapy (n = 14-16 eyes / treatment). RGCs / retina (FIG. 9C; n = 10 retinas / treatment) show significant RGC loss induced by EAE (###p<0.001 vs EAE-sham) is only attenuated by AR0012 treatment alone (*p<0.05 vs EAE-sham) as compared by t-test. Optic nerve inflammation induced in EAE-sham mice was not significantly modified by treatment (FIG. 9D).

[0049] DETAILED DESCRIPTION OF THE INVENTION

[0050] Sirtuins are NAD-dependent protein deacetylases. Intravitreal delivery of sirtuin activators such as resveratrol have been shown to reduce deficits from optic neuritis and optic crush injury in mouse models. (Shindler et al. Invest Ophthalmol Vis Sci 48(8):3602 (2007); Zuo et al Invest Ophthalmol Vis Sci 54(7):5097-102 (2013)). Sirtuin-1, encoded by SIRT1 (herein used interchangeably for the coding sequence and expression product), links transcriptional regulation directly to intracellular energetics and participates in the coordination of several separated cellular functions such as cell cycle, response to DNA damage, metabolism, apoptosis and autophagy. Two isoforms are known. Transcript variant 1, which includes the entire 747 amino acid protein (SEQ ID NO: 2), and transcript variant 2, which lacks amino acids 454-639 (using the numbering from transcript variant 1). Exemplified herein is the use of transcript variant 1. However, similar constructs utilizing transcript variant 2 are also contemplated herein. The native SIRT1 sequence encoding sirtuin-1 is shown in SEQ ID NO: 3. A codon-optimized SIRT1 sequence encoding sirtuin-1 is shown in SEQ ID NO: 1. It has been shown that activators of SIRT1 significantly attenuated retinal ganglion cells (RGCs) in a dose-dependent manner. Shindler, KS et al, Invest Ophthalmol Vis Sci. 2007 Aug;48(8):3602-9, which is incorporated herein by reference.

[0051] Described herein are rAAV vectors capable of delivering sirtuin-1 to diseased tissue, including retinal cells in the eye. The vectors described herein are useful in the treatment of a wide variety of genetic and acquired optic nerve disorders that affect the structure or function of the optic nerve. In one embodiment, any of such optic disorders or conditions is referred to as optic neuropathy. Optic neuropathies include glaucoma, optic neuritis, retinitis pigmentosa, ischemic optic neuropathy, compressive optic neuropathy, infiltrative optic neuropathy, traumatic optic neuropathy, mitochondrial optic neuropathy, nutritional optic neuropathy, and toxic optic neuropathy. Optic neuropathies further include hereditary optic neuropathy including leber's hereditary optic neuropathy, dominant optic atrophy, Behr's syndrome, and Berk-Tabatznki syndrome. In one embodiment, the ocular disorder negatively affects the retinal ganglion cells. In another embodiment, the disorder negatively affects any of the neuronal cells.

[0052] Glaucoma is a neurodegenerative disease of the eye, and it is one of the major causes of irreversible blindness. It is estimated that, by 2020, more than 80 million people will be affected worldwide, with at least 6 to 8 million of them becoming bilaterally blind. Glaucoma is characterized by damage to the optic nerve and progressive degeneration of retinal ganglion cells (RGCs), which are critical elements for vision loss. The factors associated with pathogenesis of glaucoma include high intraocular pressure (IOP), increased oxidative stress, aging, glutamate neurotoxicity, and susceptibility genes such as optineurin and myocilin. In one embodiment, the ocular disorder or condition treated using the rAAV vectors described herein, is glaucoma. In one embodiment, the ocular disorder or condition treated using the rAAV vectors described herein, is MS.

[0053] MS is a central nervous system disease characterized by chronic inflammation and demyelination. Approximately 2.5 million people are affected globally, with an average age of onset of 30 years. About 50% of patients diagnosed after 25 years require a mobility aid. The disease is largely believed to be an autoimmune condition, with infiltration of CNS by autoreactive immune effector cells. The central “trigger” for disease onset is mostly undefined, with complex genetic modifiers and environmental factors believed to play a part. See, Dendrou et al. (Nat Rev Imm, 2009), which is incorporated herein by reference. See, McDougald et al, Investigative Ophthalmology & Visual Science March 2018, Vol.59, 1212- 1220, which is incorporated herein by reference in its entirety.

[0054] Optic neuritis is a demyelinating inflammation of the optic nerve and it typically affects young adults ranging from 18 to 45 years of age. Patients usually present with an acute reduction of visual acuity, orbital pain exacerbated by eye movements, dyschromatopsia, and an afferent papillary defect, with or without swelling of the optic nerve head. There is a strong association between optic neuritis and multiple sclerosis (MS), an acute inflammatory demyelinating disease of the central nervous system (CNS), in which optic neuritis is the initial presentation of MS for approximately 20% of MS patients and a risk of developing MS by 15 years after the onset of optic neuritis is 50%. In one embodiment, the ocular condition treated using the rAAV vectors described herein, is optic neuritis. See, Kimura et al, cited above. In another embodiment, the ocular condition is autoimmune encephalomyelitis (EAE).

[0055] The rAAV vectors of the present invention are suitable for targeting gene therapies, such as hSIRTl gene therapy, to retinal ganglion cells.

[0056] The rAAV vectors are useful, in one embodiment, to prevent loss of axons / myelin in the optic nerve when it faces inflammatory, autoimmune, inherited or acquired disease.

[0057] The rAAV vectors of the present invention are delivered to retinal ganglion cells, whose axons comprise the optic nerve. In an embodiment, the rAAV may be delivered via subretinal, intravitreal or suprachoroidal injection. Preferably the rAAV is administered directly to retinal cells via intravitreal injection or suprachoroidal injection, thereby allowing in-office treatment.

[0058] In one aspect, the rAAV vectors, methods and compositions described herein are used for delivering a nucleic acid sequence encoding SIRT1 protein to subjects in need thereof for the treatment of optic neuropathy, preferably optic neuritis or glaucoma.

[0059] In one embodiment, the rAAV, compositions and methods of the present invention involve delivery of an engineered SIRT1 coding sequence. In one embodiment, the coding sequence is that shown in SEQ ID NO: 1. Also encompassed herein are compositions which include the native SIRT1 coding sequences, as shown in SEQ ID NO: 3. Preferably, the coding sequence is that shown in SEQ ID NO: 1. Technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. The definitions contained in this specification are provided for clarity in describing the components and compositions herein and are not intended to limit the claimed invention.

[0060] The term “percent (%) identity”, “sequence identity”, “percent sequence identity”, or “percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g., of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.

[0061] Percent identity may be readily determined for amino acid sequences over the full- length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences. A suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids. Generally, when referring to “identity”, “homology”, or “similarity” between two different sequences, “identity”, “homology” or “similarity” is determined in reference to “aligned” sequences. “Aligned” sequences or “alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.

[0062] Identity may be determined by preparing an alignment of the sequences and through the use of a variety of algorithms and / or computer programs known in the art or commercially available [e.g., BLAST, ExPASy; ClustalO; FASTA; using, e.g., Needleman- Wunsch algorithm, Smith-Waterman algorithm]. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, e.g., the “Clustal Omega”, “Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999).

[0063] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include, “Clustal Omega”, “Clustal W”, “CAP Sequence Assembly”, “BLAST”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.

[0064] Useful herein is an engineered nucleic acid sequence encoding human SIRT1. Preferably, the engineered SIRT1 coding sequence is SEQ ID NO: 1 or has greater than about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identity to the full-length SIRT1 coding sequence shown in SEQ ID NO: 1. SEQ ID NO: 1 - atggccgacgaagccgcactcgcgctgcaaccagggggttccccgtctgcagcaggcgccgatagagaagcagccagctcgcca gcaggagaaccgctccggaagcgacccaggagagatggcccaggcctggaacgctcaccgggtgaaccaggaggtgccgctcc tgaacgggaagtgcccgcagctgctaggggctgtccaggagcagccgcagcagcactctggcgcgaagccgaagccgaggctgc tgcagccggaggagaacaagaagcccaagcgaccgctgcagcaggagagggcgacaacggacccggcctgcaaggaccgtcc cgcgaacctccgctggccgacaatctgtacgacgaggacgatgatgatgagggcgaagaagaagaggaagccgccgctgctgcta ttggatacagagacaaccttctcttcggcgacgagatcatcaccaatggattccactcctgtgaatctgacgaagaagatcgggcctcc catgctagcagctctgactggacgccacggccaaggatcggtccgtacaccttcgtgcagcagcacctgatgatcggcacagatccc cgcaccattctgaaggatctgctgcccgagactatcccaccccctgagctggacgacatgactctgtggcagattgtgatcaacatcctt tccgagcccccaaagcggaagaagcgcaaggatattaacaccatcgaggacgccgtgaagcttctgcaggagtgcaaaaagatcat cgtgctgactggtgcaggggtgtccgtgtcctgcggcattccggatttcagaagccgcgacggaatctacgccagactcgcggtcga ctttcccgatctgcctgaccctcaggccatgttcgatattgaatacttccgcaaggacccgaggccgttctttaagttcgccaaggagatc taccctgggcagttccaaccctccctctgccataagttcattgcgctgagcgataaggaaggaaagctgctgcggaactacacccaga acatcgacactcttgagcaagtggcgggtatccagagaatcatccaatgccacggctccttcgccactgcctcctgcctgatctgcaag tacaaggtcgattgtgaagccgtcaggggcgatatcttcaaccaagtggtcccgcgatgcccaagatgcccggcggatgaacccttg gccatcatgaagcctgaaatcgtgttcttcggggaaaacctccccgaacagtttcaccgcgccatgaagtacgacaaggacgaagtg gatctcctgattgtgattggttccagcttgaaagtccggccagtggccttgatcccctcctcgattccacacgaagtgcctcaaatccttat taaccgggaaccactgccgcatcttcacttcgatgtggaactgctgggagactgcgacgtgattattaacgaactgtgtcaccgcttgg gtggcgaatacgccaagctgtgctgcaaccctgtgaaactgtcggagatcaccgaaaagccgcccagaactcaaaaagagctggcc tacctgtccgagctccctccgactccgctgcatgtgtccgaggattcgtcgtccccggaaaggacttcgcctccggactcctccgtgat cgtgaccctgctcgaccaagccgccaagtcgaacgacgatctggacgtgtcggaatccaagggctgcatggaagaaaagcctcaag aggtgcagacttcacggaacgtggagtccatcgccgaacagatggaaaacccggacctgaagaacgtgggaagcagcactggcg aaaagaacgagagaacctccgtggccggtactgtccggaagtgctggccgaacagggtggccaaggaacagatatcccggagact tgacggcaaccagtacctcttcctcccccctaaccgctatatttttcacggggccgaggtgtacagcgactccgaggacgatgtgctgt catcctcatcatgcggttccaattccgactccggaacctgtcagagcccctccctggaggaacctatggaggacgaatccgagatcga ggaattctacaacggtctggaggacgagcctgatgtcccggaacgcgctggaggagctggcttcggaaccgacggggacgaccag gaagccatcaacgaggccatctcggtgaagcaggaagtgaccgatatgaactacccgtccaacaagtcctga

[0065] By “engineered” it is meant that the nucleic acid sequences encoding the SIRT1 protein described herein are assembled and placed into any suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the SIRT1 sequences carried thereon to a host cell, e.g., for generating non-viral delivery systems (e.g., RNA-based systems, naked DNA, or the like) or for generating viral vectors in a packaging host cell and / or for delivery to a host cells in a subject. In one embodiment, the genetic element is a plasmid. The methods used to make such engineered constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0066] As used herein, the term “host cell” may refer to the packaging cell line in which a recombinant AAV is produced from a production plasmid. In the alternative, the term “host cell” may refer to any target cell in which expression of the coding sequence is desired. Thus, a “host cell,” refers to a prokaryotic or eukaryotic cell that contains exogenous or heterologous DNA that has been introduced into the cell by any means, e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. In certain embodiments herein, the term “host cell” refers to the cells employed to generate and package the viral vector or recombinant virus. In other embodiments herein, the term “host cell” refers to cultures of ocular cells or other neuronal cells of various mammalian species for in vitro assessment of the compositions described herein.

[0067] Still in other embodiments, the term “host cell” is intended to reference the target cells of the subject being treated in vivo for optic neuropathy. In one embodiment, the host cell or target cell is an ocular cell. As used herein, the term “ocular cells” refers to any cell in, or associated with the function of, the eye. The term may refer to any one of photoreceptor cells, including rod photoreceptors, cone photoreceptors and photosensitive ganglion cells, retinal pigment epithelium (RPE) cells, Mueller cells, choroidal cells, bipolar cells, horizontal cells, and amacrine cells. In another embodiment, the host cell or target cell is a neuronal cell. In one embodiment, the host cell or target cell is a retinal ganglion cell.

[0068] In one embodiment, the nucleic acid sequence encoding SIRT1 further comprises a nucleic acid encoding a tag polypeptide covalently linked thereto. The tag polypeptide may be selected from known “epitope tags” including, without limitation, a myc tag polypeptide, a glutathione-S-transferase tag polypeptide, a green fluorescent protein tag polypeptide, a myc- pyruvate kinase tag polypeptide, a His6 tag polypeptide, an influenza virus hemagglutinin tag polypeptide, a flag tag polypeptide, and a maltose binding protein tag polypeptide. Exemplified herein is the use of a FLAG tag polypeptide. Another example is an HA tag.

[0069] As used herein, an “expression cassette” refers to a nucleic acid molecule which comprises the coding sequences for SIRT1 protein, promoter, and may include other regulatory sequences therefor, which cassette may be packaged into the capsid of a viral vector (e.g., a viral particle). Typically, such an expression cassette for generating a viral vector contains the SIRT1 sequences described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein. For example, for an AAV viral vector, the packaging signals are the 5’ inverted terminal repeat (ITR) and the 3’ ITR. When packaged into the AAV capsid, the ITRs in conjunction with the expression cassette may be referred to herein as the “recombinant AAV (rAAV) genome” or “vector genome”. In one embodiment, an expression cassette comprises a nucleic acid sequence that encodes SIRT1 protein. In one embodiment, the cassette provides the SIRT1 operatively associated with expression control sequences that direct expression of the codon optimized nucleic acid sequence that encodes SIRT1 in a host cell.

[0070] In another embodiment, an expression cassette or vector genome for use in an AAV vector is provided. In that embodiment, the AAV vector genome includes at least one AAV inverted terminal repeat (ITR) sequence. In another embodiment, the vector genome comprises 5' ITR sequences and 3' ITR sequences. In one embodiment, the 5' and 3' ITRs flank the nucleic acid sequence that encodes SIRT, optionally with additional sequences which direct expression of the nucleic acid sequence that encodes SIRT 1 in a host cell. Thus, as described herein, a AAV expression cassette is meant to describe an expression cassette as described above flanked on its 5’ end by a 5’ AAV inverted terminal repeat sequence (ITR) and on its 3’ end by a 3’ AAV ITR. Thus, this rAAV genome contains the minimal sequences required to package the expression cassette into an AAV viral particle, i.e., the AAV 5’ and 3’ ITRs. The AAV ITRs may be obtained from the ITR sequences of any AAV, such as described herein. These ITRs may be of the same AAV origin as the capsid employed in the resulting recombinant AAV, or of a different AAV origin (to produce an AAV pseudotype). In one preferred embodiment, the ITR sequences from AAV2, or the deleted version thereof (AITR), are used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. Typically, the AAV vector genome comprises an AAV 5’ ITR, the SIRT1 coding sequence and any regulatory sequences, and an AAV 3’ ITR. However, other configurations of these elements may be suitable. A shortened version of the 5’ ITR, termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. In other embodiments, the full-length AAV 5’ and 3’ ITRs are used. Each rAAV genome can be then introduced into a production plasmid.

[0071] As used herein, the term “regulatory sequences”, “transcriptional control sequence” or “expression control sequence” refers to DNA sequences, such as initiator sequences, enhancer sequences, and promoter sequences, which induce, repress, or otherwise control the transcription of protein encoding nucleic acid sequences to which they are operably linked.

[0072] As used herein, the term “operably linked” or “operatively associated” refers to both expression control sequences that are contiguous with the nucleic acid sequence encoding the SIRT1 and / or expression control sequences that act in trans or at a distance to control the transcription and expression thereof.

[0073] In one aspect, a vector comprising any of the expression cassettes or vector genomes described herein is provided. As described herein, such vectors can be plasmids of variety of origins and are useful in certain embodiments for the generation of recombinant replication defective viruses as described further herein.

[0074] A “vector” as used herein is a nucleic acid molecule into which an exogenous or heterologous or engineered nucleic acid transgene may be inserted which can then be introduced into an appropriate host cell. Vectors preferably have one or more origin of replication, and one or more site into which the recombinant DNA can be inserted. Vectors often have means by which cells with vectors can be selected from those without, e.g., they encode drug resistance genes. Common vectors include plasmids, viral genomes, and (primarily in yeast and bacteria) “artificial chromosomes.” Certain plasmids are described herein.

[0075] In one embodiment, the vector is a non-viral plasmid that comprises an expression cassette described thereof, e.g., “naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and / or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774-787; web publication: March 21, 2011; WO2013 / 182683, WO 2010 / 053572 and WO 2012 / 170930, all of which are incorporated herein by reference. Such non-viral SIRT1 vector may be administered by the routes described herein. The viral vectors, or non-viral vectors, can be formulated with a physiologically acceptable carrier for use in gene transfer and gene therapy applications.

[0076] In another embodiment, the vector is a viral vector that comprises an expression cassette described therein. “Virus vectors” are defined as replication defective viruses containing the exogenous or heterologous SIRT1 nucleic acid transgene. In one embodiment, an expression cassette as described herein may be engineered onto a plasmid which is used for drug delivery or for production of a viral vector. Suitable viral vectors are preferably replication defective and selected from amongst those which target ocular cells. Viral vectors may include any virus suitable for gene therapy, including but not limited to adenovirus; herpes virus; lentivirus; retrovirus; parvovirus, etc. In a preferred embodiment, the virus vector is an adeno-associated virus vector.

[0077] A “replication-defective virus” or “viral vector” refers to a synthetic or recombinant viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be “gutless” - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.

[0078] In another embodiment, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV compromises an AAV capsid, and a vector genome packaged therein. The vector genome comprises, in one embodiment: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding a human SIRT; and (d) an AAV 3' ITR. In another embodiment, the vector genome is the expression cassette described herein. In one embodiment, the SIRT1 sequence encodes a full-length protein. In one embodiment, the SIRT1 sequence is the protein sequence of SEQ ID NO: 2. In another preferred embodiment, the coding sequence is SEQ ID NO: 1 or a variant thereof sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0079] Adeno-associated virus (AAV), a member of the Parvovirus family, is a small nonenveloped, icosahedral virus with single-stranded linear DNA genomes of 4.7 kilobases (kb) to 6 kb. Among known AAV serotypes are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and others. The ITRs or other AAV components may be readily isolated or engineered using techniques available to those of skill in the art from an AAV. Such AAV may be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, the AAV sequences may be engineered through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like. AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.

[0080] Fragments of AAV may be readily utilized in a variety of vector systems and host cells. Among desirable AAV fragments are the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a novel AAV sequence of the invention (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from another AAV serotype (known or novel), non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid.

[0081] The term “AAV” or “AAV serotype” as used herein refers to the dozens of naturally occurring and available adeno-associated viruses, as well as artificial AAVs. Among the AAVs isolated or engineered from human or non-human primates (NHP) and well characterized, human AAV2 is the first AAV that was developed as a gene transfer vector; it has been widely used for efficient gene transfer experiments in different target tissues and animal models. Unless otherwise specified, the AAV capsid, ITRs, and other selected AAV components described herein, may be readily selected from among any AAV, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, variants of any of the known or mentioned AAVs or AAVs yet to be discovered or variants or mixtures thereof. See, e.g., WO 2005 / 033321, which is incorporated herein by reference. Any AAV capsid may be used that has tropism for ocular cells. Preferably the AAV capsid has tropism for retinal ganglion cells.

[0082] Among all known AAVs, AAV2 is the predominant serotype used in preclinical testing and clinical trials, as 50-96% of the human population is seropositive to it16. However, it was not linked to any disease in humans nor other species. The AAV2 genome is approximately 4.7 kb single-stranded DNA, including the rep (replication) and cap (capsid) genes, flanked by inverted terminal repeats (ITRs), all packed into an icosahedral, nonenveloped capsid17AAV2 uses heparan sulfate proteoglycan (HSPG) as its primary receptor18, as well as other coreceptors including fibroblast growth factor receptor19, hepatocyte growth factor receptor20, integrins21, and CD922. AAV2 has vast tissue tropisms for tissues of rodents, humans and non-human primates23. Broader tissue tropisms for AAV2 have been expanded to most tissues by cross packaging and cross-typing the AAV2 genome into a capsid of another serotype24In addition, synthetic AAV vectors have been derived from the AAV2 serotype to improve transduction efficiency or immunological profile in vivo. The recombinant AAV8BP2 is an AAV2-derivative shown to target RGCs following intravitreal administration25

[0083] In one embodiment, the AAV capsid is an AAV2 capsid. In another embodiment, the AAV capsid is an AAV8 capsid. In another embodiment, the AAV capsid is an AAV8bp capsid. See, WO 2014 / 024282, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV7m8 capsid, which has shown preferential delivery to the outer retina. See, Dalkara et al, In Vivo-Directed Evolution of a New Adeno- Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous, Sci Transl Med 5, 189ra76 (2013), which is incorporated herein by reference. In another embodiment, the rAAV capsid is selected from an AAV8 capsid or variant thereof, an AAV6 capsid or variant thereof, an AAV9 capsid or variant thereof, an AAV7 capsid or variant thereof, an AAV5 capsid or variant thereof, an AAV2 capsid or variant thereof, an AAV1 capsid or variant thereof, an AAV3 capsid or variant thereof, and an AAV4 capsid or variant thereof.

[0084] In one embodiment, a recombinant adeno-associated virus (rAAV) vector is provided which comprises an AAV capsid and an expression cassette described herein, wherein said expression cassette comprises nucleic acid sequences encoding SIRT1, inverted terminal repeat sequences and expression control sequences that direct expression of SIRT1 in a host cell.

[0085] In one embodiment, the vector genome comprises a 5’ ITR, a CMV enhancer, a human SNCG promoter, an SV40 intron, the hSIRTl coding sequence of SEQ ID NO: 1, a WPRE, a bGH poly A, and a 3’ ITR. In certain instances, this construct is referred to as AR0012. In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (b) the CMV enhancer sequence having SEQ ID NO: 5 or 29 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (c) the human SNCG promoter sequence having SEQ ID NO: 6 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (d) the SV40 intron sequence having SEQ ID NO: 7 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (e) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (f) the WPRE sequence having SEQ ID NO: 8 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (g) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and (h) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0086] In certain embodiments, the vector genome has the sequence of SEQ ID NO: 11, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith. In certain embodiments, the expression cassette has the sequence of SEQ ID NO: 24, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0087] In one embodiment, the vector genome comprises a 5’ ITR, a SV40 enhancer, a human SNCG promoter, an SV40 intron, the hSIRTl coding sequence of SEQ ID NO: 1, a WPRE, a bGH poly A, and a 3’ ITR. In certain instances, this construct is referred to as AR0013. In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (b) the SV40 enhancer sequence having SEQ ID NO: 12 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (c) the human SNCG promoter sequence having SEQ ID NO: 6 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (d) the SV40 intron sequence having SEQ ID NO: 7 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (e) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (f) the WPRE sequence having SEQ ID NO: 8 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (g) the bGH poly A sequence having SEQ ID NO: 9- or 30 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and (h) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0088] In certain embodiments, the vector genome has the sequence of SEQ ID NO: 13, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith. In certain embodiments, the expression cassette has the sequence of SEQ ID NO: 25, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0089] In one embodiment, the vector genome comprises a 5’ ITR, a CAG promoter, the hSIRTl coding sequence of SEQ ID NO: 1, a WPRE, a bGH poly A, and a 3’ ITR. In certain instances, this construct is referred to as AR0018. In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (b) the CAG promoter sequence having SEQ ID NO: 28, 33, or 35 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 28, 33, or 35; (c) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (d) the WPRE sequence having SEQ ID NO: 8 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (e) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and (f) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0090] In certain embodiments, the vector genome has the sequence of SEQ ID NO: 18, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith. In certain embodiments, the expression cassette has the sequence of SEQ ID NO:

[0091] 26, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith.

[0092] In one embodiment, the vector genome comprises a 5’ ITR, a CAG promoter, the hSIRTl coding sequence of SEQ ID NO: 1, a bGH poly A, and a 3’ ITR. In certain instances, this construct is referred to as AR0020. In an embodiment, the vector genome comprises one or more of: (a) the AAV 5' inverted terminal repeat (ITR) sequence having SEQ ID NO: 4 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (b) the CAG promoter sequence comprising SEQ ID NOs: 37or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (c) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (d) the bGH poly A sequence having SEQ ID NO: 9 or 30 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and (e) the AAV 3' ITR sequence having SEQ ID NO: 10 or 31 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0093] In certain embodiments, the vector genome has the sequence of SEQ ID NO: 23, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith. In certain embodiments, the expression cassette has the sequence of SEQ ID NO:

[0094] 27, or a sequence sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity therewith. As used herein, relating to AAV, the term variant means any AAV sequence which is derived from a known AAV sequence, including those sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity over the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes variants which may include up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9 % identity, about 95% to about 99% identity or about 97% to about 98% identity to an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining the percent identity of an AAV capsid, the comparison may be made over any of the variable proteins (e.g., vpl, vp2, or vp3). In one embodiment, the AAV capsid shares at least 95% identity with the AAV7m8 over the vpl, vp2 or vp3. In one embodiment, the AAV capsid shares at least 95% identity with the AAV2 over the vpl, vp2 or vp3. In another embodiment, the AAV capsid shares at least 95% identity with the AAV8BP2 over the vpl, vp2 or vp3. In another embodiment, the capsid is an AAV8 capsid with Y447F, Y733F and T494V mutations (also called “AAV8(C&G+T494V)” and “rep2-cap8(Y447F+733F+T494V)”), as described by Kay et al, Targeting Photoreceptors via Intravitreal Delivery Using Novel, Capsid-Mutated AAV Vectors, PLoS One. 2013; 8(4): e62097. Published online 2013 Apr 26, which is incorporated herein by reference.

[0095] In one embodiment, it is desirable to utilize an AAV capsid, which shows tropism for the desired target cell, e.g., retinal ganglion cell or other ocular cell. In one embodiment, the AAV capsid is a tyrosine capsid-mutant in which certain surface exposed tyrosine residues are substituted with phenylalanine (F). Such AAV variants are described, e.g., in Mowat et al, Tyrosine capsid-mutant AAV vectors for gene delivery to the canine retina from a subretinal or intravitreal approach, Gene Therapy 21, 96-105 (January 2014), which is incorporated herein by reference.

[0096] In one embodiment, the AAV capsid is chosen from those that effectively transduce neuronal cells. In one embodiment, the AAV capsid is selected from AAV1, AAV2, AAV7, AAV8, AAV9, AAVrh.10, AAV5, AAVhu.l l, AAV8DJ, AAVhu.32, AAVhu.37, AAVpi.2, AAVrh.8, AAVhu.48R3 and variants thereof. See, Royo, et al, Brain Res, 2008 Jan, 1190: 15- 22; Petrosyan et al, Gene Therapy, 2014 Dec, 21(12):991-1000; Holehonnur et al, BMC Neuroscience, 2014, 15:28; and Cearley et al, Mol Ther. 2008 Oct; 16(10): 1710-1718, each of which is incorporated herein by reference.

[0097] As used herein, “artificial AAV” means, without limitation, an AAV with a non- naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non-contiguous portions of the same AAV, from a non- AAV viral source, or from a non-viral source. An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful in the invention. In one embodiment, AAV2 / 8 is an exemplary pseudotyped vector.

[0098] In an embodiment single-stranded AAV is used. In another embodiment, a self- complementary AAV is used. “Self-complementary AAV” refers a plasmid or vector having an expression cassette in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, e.g., D M McCarty et al, “Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis”, Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described in, e.g., U.S. Patent Nos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0099] The term “exogenous” as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the position in which it exists in a chromosome, or host cell. An exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same host cell or subject, but which is present in a nonnatural state, e.g. a different copy number, or under the control of different regulatory elements. The term “heterologous” as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein was derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed. The term “heterologous” when used with reference to a protein or a nucleic acid in a plasmid, expression cassette, or vector, indicates that the protein or the nucleic acid is present with another sequence or subsequence which with which the protein or nucleic acid in question is not found in the same relationship to each other in nature.

[0100] In still another embodiment, the expression cassette, including any of those described herein is employed to generate a recombinant AAV genome.

[0101] In one embodiment, the expression cassette described herein is engineered into a suitable genetic element (vector) useful for generating viral vectors and / or for delivery to a host cell, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the SIRT1 sequences carried thereon. The selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

[0102] For packaging an expression cassette or rAAV genome or production plasmid into virions, the ITRs are the only AAV components required in cis in the same construct as the expression cassette. In one embodiment, the coding sequences for the replication (rep) and / or capsid (cap) are removed from the AAV genome and supplied in trans or by a packaging cell line in order to generate the AAV vector.

[0103] Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., US Patent 7790449; US Patent 7282199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and US 7588772 B2], In a one system, a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding the transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus. More recently, systems have been developed that do not require infection with helper virus to recover the AAV - the required helper functions (i.e., adenovirus El, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system. In these newer systems, the helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscri phonal level.

[0104] The term “isolated” means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated, even if subsequently reintroduced into the natural system. Such polynucleotides could be part of a vector and / or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

[0105] In yet another system, the expression cassette flanked by ITRs and rep / cap genes are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al., 2009, “Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production,” Human Gene Therapy 20:922-929, the contents of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of each of which is incorporated herein by reference in its entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005, “Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications,” Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008, “Recent developments in adeno-associated virus vector technology,” J. Gene Med. 10:717-733; and the references cited below, each of which is incorporated herein by reference in its entirety. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, (1993) J. Virol., 70:520-532 and US Patent No. 5,478,745.

[0106] “Plasmids” generally are designated herein by a lower case p preceded and / or followed by capital letters and / or numbers, in accordance with standard naming conventions that are familiar to those of skill in the art. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art. Moreover, those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those of skill from the present disclosure.

[0107] In one embodiment, the production plasmid is that described herein, or as described in WO2012 / 158757, which is incorporated herein by reference. Various plasmids are known in the art for use in producing rAAV vectors, and are useful herein. The production plasmids are cultured in the host cells which express the AAV cap and / or rep proteins. In the host cells, each rAAV genome is rescued and packaged into the capsid protein or envelope protein to form an infectious viral particle.

[0108] In one embodiment, the rAAV vector genome is of a size between about 3 kilobases (kb) to about 6 kb, about 4.7 kb to about 6 kb, about 3 kb to about 5.5kb, or about 4.7 kb to 5.0 kb. In certain embodiments, the vector genome is about 5. kb.

[0109] The expression cassettes, vectors and plasmids include other components that can be optimized for a specific species using techniques known in the art including, e.g., codon optimization, as described herein. The components of the cassettes, vectors, plasmids and viruses or other compositions described herein include a promoter sequence as part of the expression control sequences. In another embodiment, the promoter is cell-specific. The term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the SIRT1 coding sequence in a particular cell type. In one embodiment, the promoter is specific for expression of the transgene in ocular cells. In one embodiment, the promoter is specific for expression of the transgene in retinal ganglion cells. In one embodiment, the promoter is specific for expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in the rods and cones. In another embodiment, the promoter is specific for expression in the rods. In another embodiment, the promoter is specific for expression in the cones. In one embodiment, the promoter is modified to add one or more restriction sites to facilitate cloning.

[0110] In one embodiment, the hSIRTl coding sequence is placed under the control of a hybrid chicken P actin (CB A) promoter, sometimes referred to herein as the CAG promoter, such as that shown in SEQ ID NO: 28, 33, or 35. This promoter consists of the cytomegalovirus (CMV) immediate early enhancer, the proximal chicken P actin promoter, and optionally, the CBA exon 1 flanked by intron 1 sequences.

[0111] In one embodiment, the CMV enhancer has the sequence of SEQ ID NO: 14 CCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCC ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCA AGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCC GCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACA TCTACGTATTAGTCATCGCTATTACCATGG.

[0112] In another embodiment, the CMV enhancer has the sequence of SEQ ID NO: 32 ATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAG TGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGC CTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCT ACGTATTAGTCATCGCTATTACCATGG.

[0113] In one embodiment, the CBA promoter has the sequence of SEQ ID NO: 15 TCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCC CCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGG GGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGG GCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTT CCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGG CGGGCGG In one embodiment, the CBA exon 1 has the sequence of SEQ ID NO: 16 GAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCG CCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAG

[0114] In one embodiment, the CBA intron 1 has the sequence of SEQ ID NO: 17 GTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAAT GACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGG CCCTTTGTGCGGGGGGAGCGGCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTC GGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTA GAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAAC GTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTGGATCC.

[0115] In one embodiment, the CBA intron 1 has the sequence of SEQ ID NO: 38 GTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAAT GACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGG CCCTTTGTGCGGGGGGAGCGGCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTC GGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTA GAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTT.

[0116] In another embodiment, the promoter is the human gamma-synuclein gene (SNCG) promoter, such as that shown in SEQ ID NO: 6. cacccacaagccagttcctgtccctgaggacttggctcagggactctgggaatgtggtagacatggggtggccccaccaaatgcatc cttatgggaacctgctccctgggagccatgaaaagagcgtggacttcgaggtggggccacaggaagtggtcaggtccatctcaggg gacctgctgcccatccacactgctggccaggaaatggggggcaattcatgcctcctcagcaccttcagcactgggcggctcaaagaa ggcaagggactattctggggtcacacagcatgcagccagaggccaaggcatgaggaagtccttcatttccccacccccacccacctc agatcctccaaccggtttcatggcagcccagggtccagcggcatccaggatgctggtgggtagctgcacagcccaggccgcggga ggttggctgctctcacctaacaggcctatgtggccctgacccctacctaggaagctggggacaatggccaaggcgcctcccctctctg tgcctgtctgtccaggtgcagcatagacacagcacccctggggccaagagcacccagccagggctgcccccatgggtgggcaggg cagtaaatgaatgagggacaggttgggaggtggccagccccctccagcccatggagggcacggggcaggagagctgggctgagc cagcaggagcccagggagcctggtctctgccttcctatcctggaggaaggtgaggctgaacctccttccctccctccctccctccccg cccccactgcacgcagggctggctgggctccagctggcctccgcatcaatatttcatcggcgtcaataggaggcatcggggacagcc gctgcggcagcactcgagccagctcaagcccgcagctcgcagggagatccagctccgtcctgcctgcagcagcacaaccctgcac accc Also see, e.g., Chaffiol A et al. A New Promoter Allows Optogenetic Vision Restoration with Enhanced Sensitivity in Macaque Retina. Mol Ther. 2017 Nov 1;25(11):2546-2560. doi:

[0117] 10.1016 / j.ymthe.2017.07.011. Epub 2017 Jul 20.

[0118] In other embodiments, the expression cassette, vector, plasmid and virus described herein contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; TATA sequences; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); introns; sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. The expression cassette or vector may contain none, one or more of any of the elements described herein.

[0119] Examples of suitable polyA sequences include, e.g., a synthetic polyA or from bovine growth hormone (bGH), human growth hormone (hGH), SV40, rabbit P-globin (RGB), or modified RGB (mRGB). In one embodiment, the polyA is a bGH poly A, optionally having a nucleic acid sequence of SEQ ID NO: 9 Ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaat aaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattg ggaagacaatagcaggcatgctgggga, or SEQ ID NO: 30 CGActgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttc ctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggag gattgggaagacaatagcaggcatgctggggaT GC GGT GGGC TC T AT GG

[0120] In one embodiment, he expression cassette, vector, plasmid and virus described herein comprise a post-transcriptional regulatory element. In one embodiment, the post- transcriptional regulatory element is Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE). In one embodiment, the WPRE has the sequence of SEQ ID NO: 8 aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcct ttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtca ggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggact ttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactga caattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgc tacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccct cagacgagtcggatctccctttgggccgcctccccgc

[0121] Examples of suitable enhancers include, e.g., the CMV enhancer and the SV40 enhancer. In one embodiment, the CMV enhancer has the sequence of SEQ ID NO: 5 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGC CCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCC ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCA AGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCC GCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACA TCTACGTATTAGTCATCGCTATTACCATG

[0122] In one embodiment, the CMV enhancer has the sequence of SEQ ID NO: 29 ATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAG TGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGC CTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCT ACGTATTAGTCATCGCTATTACCATG

[0123] In one embodiment, the SV40 enhancer has the sequence of SEQ ID NO: 12 GGCCTGAAATAACCTCTGAAAGAGGAACTTGGTTAGGTACCTTCTGAGGCTGAA AGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCC CAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTG GAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATT AGTCAGCAACCATAGTCCC

[0124] In one embodiment, an SV40 intron is included, such as that having the sequence of SEQ ID NO: 7

[0125] GTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTG CAAATCAAAGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCTAG

[0126] In one embodiment, the expression cassette, the vector, the plasmid and the virus contain a CMV enhancer, hSNCG promoter, SV40 intron, human SIRT1 coding sequence, WPRE, and bGH poly A. In certain embodiments, the expression cassette includes nt 181 to 4717 of SEQ ID NO: 11, or nt 238 to 4717 of SEQ ID NO: 11. In another embodiment, the vector genome comprises the expression cassette flanked by ITRs. In certain embodiments, the 5’ ITR has a nucleic acid sequence from nt 1 to nt 130 of SEQ ID NO: 11 and the 3’ITR has a nucleic acid sequence from nt 4767 to nt 4896 of SEQ ID NO: 11.

[0127] In one embodiment, the expression cassette, the vector, the plasmid and the virus contain a SV40 enhancer, hSNCG promoter, SV40 intron, human SIRT1 coding sequence, WPRE, and bGH poly A. In certain embodiments, the expression cassette includes nt 181 to 4648 of SEQ ID NO: 13. In another embodiment, the vector genome comprises the expression cassette flanked by ITRs. In certain embodiments, the 5’ ITR has a nucleic acid sequence from nt 1 to nt 130 of SEQ ID NO: 13 and the 3’ITR has a nucleic acid sequence from nt 4698 to nt 4827 of SEQ ID NO: 13.

[0128] In one embodiment, the expression cassette, the vector, the plasmid and the virus contain a CMV enhancer, CBA promoter, with exon and intron sequences, human SIRT1 coding sequence, WPRE, and bGH poly A. In certain embodiments, the expression cassette includes nt 191 to 4236 of SEQ ID NO: 18 or 193 to 4236 of SEQ ID NO: 18. In another embodiment, the vector genome comprises the expression cassette flanked by ITRs. In certain embodiments, the 5’ ITR has a nucleic acid sequence from nt 1 to nt 130 of SEQ ID NO: 18 and the 3’ITR has a nucleic acid sequence from nt 4286 to nt 4415 of SEQ ID NO: 18.

[0129] In some embodiments, where a WPRE sequence is included in the vector genome, an alternate embodiment is contemplated wherein the WPRE is absent.

[0130] In another aspect, a method for treating ocular neuropathy and / or restoring visual function in a subject having in need thereof comprises delivering to a subject in need thereof a vector (such as rAAV) which encodes hSIRTl, as described herein, or a cell or composition as described herein. In one embodiment, a method of treating a subject having ocular neuropathy with a rAAV described herein is provided. In an embodiment a method for treating optic neuritis in a subject having in need thereof comprises delivering to a subject in need thereof a vector (such as rAAV) which encodes hSIRTl, as described herein. In certain embodiments, the rAAV is AR0012. In other embodiments, the rAAV is AR0013. In other embodiments, the rAAV is AR0018. In other embodiments, the rAAV is AR0020.

[0131] In another embodiment, a method for treating glaucoma in a subject having in need thereof comprises delivering to a subject in need thereof a vector (such as rAAV) which encodes hSIRTl, as described herein. In certain embodiments, the rAAV is AR0012. In other embodiments, the rAAV is AR0013. In other embodiments, the rAAV is AR0018. In other embodiments, the rAAV is AR0020.

[0132] In another aspect, a method of preserving retinal ganglion cell (RGC) function in a subject, comprising administering an rAAV as described herein, is provided. In certain embodiments, the rAAV is AR0012. In other embodiments, the rAAV is AR0013. In other embodiments, the rAAV is AR0018. In other embodiments, the rAAV is AR0020.

[0133] In another embodiment, a method of i) improving or restoring vision or visual acuity, ii) preventing loss of vision or visual acuity, or iii) slowing or reducing the rate of vision loss or loss of visual acuity comprises delivering to a subject in need thereof a vector (such as rAAV) which encodes hSIRTl, as described herein. In certain embodiments, the rAAV is AR0012. In other embodiments, the rAAV is AR0013. In other embodiments, the rAAV is AR0018. In other embodiments, the rAAV is AR0020.

[0134] By “administering” as used in the methods means delivering the composition to the target cell. In one embodiment, the method involves delivering the composition by subretinal injection to the ganglion or other ocular cells. In another embodiment, intravitreal injection to the subject is employed. In another embodiment, suprachoroidal administration is employed. In another embodiment, subretinal injection to the subject is employed. In still another method, intravascular injections, such as injection via the palpebral vein may be employed. Still other methods of administration may be selected by one of skill in the art given this disclosure.

[0135] By “administering” or “route of administration” is meant delivery of a composition described herein, with or without a pharmaceutical carrier or excipient, to the subject. Routes of administration may be combined, if desired. In some embodiments, the administration is repeated periodically. The pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes. In some embodiments, direct delivery to the eye (optionally via ocular delivery, subretinal injection, intra-retinal injection, intravitreal, suprachori dal, topical), or delivery via systemic routes is employed, e.g., intravascular, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. The nucleic acid molecules, the expression cassette and / or vectors described herein may be delivered in a single composition or multiple compositions. Optionally, two or more different AAV may be delivered, or multiple viruses [see, e.g., WO20 2011 / 126808 and WO 2013 / 049493], In another embodiment, multiple viruses may contain different replication-defective viruses (e.g., N and adenovirus), alone or in combination with proteins.

[0136] Also provided herein are pharmaceutical compositions comprising a rAAV or cell according to the present invention and a pharmaceutically acceptable carrier or excipient. In a preferred embodiment, the pharmaceutical compositions are suitable for administration to a human subject and comprise a therapeutically effective amount of rAAV according to the invention. The pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes. In some embodiments, these delivery means are designed to avoid direct systemic delivery of the suspension containing the AAV composition(s) described herein. Suitably, this may have the benefit of reducing dose as compared to systemic administration, reducing toxicity and / or reducing undesirable immune responses to the AAV and / or transgene product. The pharmaceutical compositions described herein are suitable for intraocular injection.

[0137] In yet other aspects, these nucleic acid sequences, vectors, expression cassettes and rAAV viral vectors of the present invention are useful in a pharmaceutical composition, which also comprises a pharmaceutically acceptable carrier, excipient, buffer, diluent, surfactant, preservative and / or adjuvant, etc. Such pharmaceutical compositions are used to express the SIRT1 in the host cells through delivery by such recombinantly engineered AAVs or artificial AAVs.

[0138] To prepare these pharmaceutical compositions containing the nucleic acid sequences, vectors, expression cassettes and rAAV viral vectors, the sequences or vectors or viral vector is preferably assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for administration to the eye. Such formulation involves the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly one suitable for administration to the eye, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, surfactant, or excipient etc. For injection, the carrier will typically be a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen- free, phosphate buffered saline. A variety of such known carriers are provided in US Patent Publication No. 7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20.

[0139] In certain embodiments, there is provided a pharmaceutically acceptable aqueous solution comprising an aqueous suspending liquid and a therapeutically effective amount of a recombinant adeno-associated virus (rAAV). The aqueous solution is suitable for administration to a human patient. In certain embodiments, the suspension further comprises a surfactant, preservative, and / or buffer dissolved in the aqueous suspending liquid. In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. As the pH of the cerebrospinal fluid is about 7.28 to about 7.32, for intrathecal delivery, a pH within this range may be desired; whereas for intravitreal or subretinal delivery, a pH of 6.8 to about 7.2 may be desired. However, other pHs within the broadest ranges and these subranges may be selected for other route of delivery.

[0140] A suitable surfactant, or combination of surfactants, may be selected from among non-ionic surfactants that are nontoxic. In one embodiment, a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Pluronic® F68 [BASF], also known as Pol oxamer 188, which has a neutral pH, has an average molecular weight of 8400. Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxy stearate), LABRASOL (Poly oxy capryllic glyceride), poly oxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a pol oxamer. These copolymers are commonly named with the letter “P” (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the poly oxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content. In one embodiment Pol oxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension.

[0141] In one example, the formulation may contain, e.g., buffered saline solution comprising one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate -7H2O), potassium chloride, calcium chloride (e.g., calcium chloride -2H2O), dibasic sodium phosphate, and mixtures thereof, in water. In other embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, e.g., mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.

[0142] In another embodiment, the composition includes a carrier, diluent, excipient and / or adjuvant. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the transfer virus is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should include a component that prevents the rAAV, from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.

[0143] Optionally, the compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0144] The compositions according to the present invention may comprise a pharmaceutically acceptable carrier, such as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAV suspended in a pharmaceutically suitable carrier and / or admixed with suitable excipients designed for delivery to the subject via injection, osmotic pump, intrathecal catheter, or for delivery by another device or route. In one example, the composition is formulated for intravitreal delivery. In one example, the composition is formulated for subretinal delivery. In one example, the composition is formulated for suprachoroidal delivery. In one exemplary specific embodiment, the composition of the carrier or excipient contains 180 mM NaCl, 10 mM NaPi, pH7.3 with 0.0001% - 0.01% Pluronic F68 (PF68). The exact composition of the saline component of the buffer ranges from 160 mM to 180 mM NaCl. Optionally, a different pH buffer (potentially HEPES, sodium bicarbonate, TRIS) is used in place of the buffer specifically described. Still alternatively, a buffer containing 0.9% NaCl is useful.

[0145] According to the invention, the composition is formulated to deliver a therapeutically effective dose of rAAV to the subject. In the case of AAV viral vectors, quantification of the genome copies (“GC”), vector genomes (“VG”), or virus particles may be used as the measure of the dose contained in the formulation or suspension. Any method known in the art can be used to determine the genome copy (GC) number of the replication-defective virus compositions of the invention. One method for performing AAV GC number titration is as follows: Purified AAV vector samples are first treated with DNase to eliminate un- encapsidated AAV genome DNA or contaminating plasmid DNA from the production process. The DNase resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genomes are then quantitated by real-time PCR using primer / probe sets targeting specific region of the viral genome (usually poly A signal). In another method the effective dose of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the SIRT1 coding sequence is measured as described in S.K. McLaughlin et al, 1988 J. Virol., 62: 1963, which is incorporated by reference in its entirety.

[0146] In one embodiment, cells are manufactured in a suitable cell culture (e.g., HEK 293) cells. Methods for manufacturing the gene therapy vectors described herein include methods well known in the art such as generation of plasmid DNA used for production of the gene therapy vectors, generation of the vectors, and purification of the vectors. In some embodiments, the gene therapy vector is an AAV vector and the plasmids generated are an AAV cis-plasmid encoding the AAV genome and the gene of interest, an AAV trans-plasmid containing AAV rep and cap genes, and an adenovirus helper plasmid. The vector generation process can include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with the plasmid DNA, post-transfection medium exchange to serum free medium, and the harvest of vector-containing cells and culture media. The harvested vector-containing cells and culture media are referred to herein as crude cell harvest. In yet another system, the gene therapy vectors are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al., 2009, “Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production,” Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of each of which is incorporated herein by reference in its entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.

[0147] The crude cell harvest may thereafter be subject method steps such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare bulk vector.

[0148] A two-step affinity chromatography purification at high salt concentration followed anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids. These methods are described in more detail in International Patent Publication No. WO 2017 / 160360, which is incorporated by reference herein. Purification methods for AAV8, International Patent Publication No. WO 2017 / 100676, and rhlO, International Patent Publication No. WO 2017 / 100704, and for AAV1, International Patent Publication No. WO 2017 / 100674 are all incorporated by reference herein.

[0149] To calculate empty and full particle content, VP3 band volumes for a selected sample (e.g., in examples herein an iodixanol gradient-purified preparation where # of GC = # of particles) are plotted against GC particles loaded. The resulting linear equation (y = mx+c) is used to calculate the number of particles in the band volumes of the test article peaks. The number of particles (pt) per 20 pL loaded is then multiplied by 50 to give particles (pt) / mL. Pt / mL divided by GC / mL gives the ratio of particles to genome copies (pt / GC). Pt / mL-GC / mL gives empty pt / mL. Empty pt / mL divided by pt / mL and x 100 gives the percentage of empty particles. Generally, methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6: 1322-1330; Sommer et al., Molec. Ther. (2003) 7: 122-128. To test for denatured capsid, the methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon. Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the Bl anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281- 9293). A secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti- IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase. A method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or coomassie stains. In one embodiment, the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqMan™ fhiorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used.

[0150] In one aspect, an optimized q-PCR method is used which utilizes a broad spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2-fold or higher. Typically, proteinase K treatment is about 0.2 mg / mL, but may be varied from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000 fold) and subjected to TaqMan analysis as described in the standard assay.

[0151] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089 / hgtb.2013.131. Epub 2014 Feb 14.

[0152] As used herein, the term “dosage” can refer to the total dosage delivered to the subject in the course of treatment, or the amount delivered in a single unit (or multiple unit or split dosage) administration. The pharmaceutical virus compositions can be formulated in dosage units to contain an amount of replication-defective virus carrying the nucleic acid sequences encoding SIRT1 as described herein that is in the range of about 1.0 x 109GC to about 1.0 x 1015GC per dose including all integers or fractional amounts within the range. In one embodiment, the compositions are formulated to contain at least IxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7xl09, 8xl09, or 9xl09GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO10, 2xlO10, 3xlO10, 4xlO10, 5xlO10, 6xlO10, 7xlO10, 8xlO10, or 9xlO10GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO11, 2xlOn, 3xlOn, 4xlOn, 5xlOn, 6xlOn, 7xlOn, 8xlOn, or 9xlOnGC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO12, 2xl012, 3xl012, 4xl012, 5xl012, 6xl012, 7xl012, 8xl012, or 9xl012GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO13, 2xl013, 3xl013, 4xl013, 5xl013, 6xl013, 7xl013, 8xl013, or 9xl013GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO14, 2xl014, 3xl014, 4xl014, 5xl014, 6xl014, 7xl014, 8xl014, or 9xl014GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO15, 2xl015, 3xl015, 4xl015, 5xl015, 6xl015, 7xl015, 8xl015, or 9xl015GC per dose including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from IxlO10to about IxlO12GC per dose including all integers or fractional amounts within the range. All dosages may be measured by any known method, including as measured by oqPCR or digital droplet PCR (ddPCR) as described in, e.g., M. Lock et al, Hum Gene Ther Methods. 2014 Apr;25(2): l 15-25. doi: 10.1089 / hgtb.2013.131, which is incorporated herein by reference.

[0153] In one embodiment, an aqueous suspension suitable for administration to a patient with an ocular disorder is provided. The suspension comprises an aqueous suspending liquid and about I xlO9GC or viral particles to about 1 xlO13GC or viral particles per eye of a recombinant adeno-associated virus (rAAV) described herein useful as a therapeutic for an ocular disorder described herein. In one embodiment, the ocular disorder is optic neuritis. In another embodiment, the ocular disorder is glaucoma.

[0154] It may also be desirable to administer multiple “booster” dosages of the pharmaceutical compositions of this invention. For example, depending upon the duration of the transgene within the ocular target cell, one may deliver booster dosages at 6 month intervals, or yearly following the first administration. The fact that AAV-neutralizing antibodies were not generated by administration of the rAAV vector should allow additional booster administrations. Such booster dosages and the need therefor can be monitored by the attending physicians, using, for example, the retinal and visual function tests and the visual behavior tests described in the examples below. Other similar tests may be used to determine the status of the treated subject over time. Selection of the appropriate tests may be made by the attending physician. Still alternatively, the method of this invention may also involve injection of a larger volume of virus-containing solution in a single or multiple injection to allow levels of visual function close to those found in wildtype retinas.

[0155] In another embodiment, the pharmaceutical compositions of the invention are administered once only i.e., without the need for repeat administration.

[0156] In another embodiment, the amount of the vectors, the virus and the replicationdefective virus described herein carrying the codon optimized nucleic acid sequences encoding SIRT1 are in the range of about 1.0 x 107VG per eye to about 1.0 x 1015VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, or 9xl07VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO8, 2xl08, 3xl08, 4xl08, 5xl08, 6xl08, 7xl08, 8xl08, or 9xl08VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7xl09, 8xl09, or 9xl09VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO10, 2xlO10, 3xlO10, 4xlO10, 5xlO10, 6xlO10, 7xlO10, 8xlO10, or 9xlO10VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO11, 2xlOn, 3xl0n, 4xlOn, 5xl0n, 6xlOn, 7xlOn, 8xl0n, or 9xlOnVG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO12, 2xl012, 3xl012, 4xl012, 5xl012, 6xl012, 7xl012, 8xl012, or 9xl012VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO13, 2xl013, 3xl013, 4xl013, 5xl013, 6xl013, 7xl013, 8xl013, or 9xl013VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO14, 2xl014, 3xl014, 4xl014, 5xl014, 6xl014, 7xl014, 8xl014, or 9xl014VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least IxlO15, 2xl015, 3xl015, 4xl015, 5xl015, 6xl015, 7xl015, 8xlO15, or 9xl015VG per dose including all integers or fractional amounts within the range. In a preferred embodiment, the method comprises administering a dose ranging from IxlO9to about IxlO13VG per eye per dose. In another embodiment, the method comprises delivery of the vector in an aqueous suspension. In another embodiment, the method comprises administering the rAAV described herein in a dosage of from 1 x 109to 1 x 1013GC in a volume about or at least 150 microliters, thereby restoring visual function in said subject. All dosages may be measured by any known method, including as measured by oqPCR or digital droplet PCR (ddPCR) as described in, e.g., M. Lock et al, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089 / hgtb.2013.131 , which is incorporated herein by reference.

[0157] These above doses may be administered in a variety of volumes of carrier, excipient or buffer formulation, ranging from about 25 to about 1000 microliters, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of carrier, excipient or buffer is at least about 25 pL. In one embodiment, the volume is about 50 pL. In another embodiment, the volume is about 75 pL. In another embodiment, the volume is about 100 pL. In another embodiment, the volume is about 125 pL. In another embodiment, the volume is about 150 pL. In another embodiment, the volume is about 175 pL. In yet another embodiment, the volume is about 200 pL. In another embodiment, the volume is about 225 pL. In yet another embodiment, the volume is about 250 pL. In yet another embodiment, the volume is about 275 pL. In yet another embodiment, the volume is about 300 pL. In yet another embodiment, the volume is about 325 pL. In another embodiment, the volume is about 350 pL. In another embodiment, the volume is about 375 pL. In another embodiment, the volume is about 400 pL. In another embodiment, the volume is about 450 pL. In another embodiment, the volume is about 500 pL. In another embodiment, the volume is about 550 pL. In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 650 pL. In another embodiment, the volume is about 700 pL. In another embodiment, the volume is about 800 pL. In another embodiment, the volume is about or at least 100 pL. In another embodiment, the volume is between about 100 to 250 pL. In another embodiment, the volume is between about 150 and 800 pL. In another embodiment, the volume is between about 700 and 1000 pL. In another embodiment, the volume is between about 250 and 500 pL.

[0158] In one embodiment, the viral constructs may be delivered in doses of from at least lxl09to about least IxlO11GCs in volumes of about IpL to about 3 pL for small animal subjects, such as mice. For larger veterinary subjects having eyes about the same size as human eyes, the larger human dosages and volumes stated above are useful. See, e.g., Diehl et al, J. Applied Toxicology, 21 : 15-23 (2001) for a discussion of good practices for administration of substances to various veterinary animals. This document is incorporated herein by reference.

[0159] It is desirable that the lowest effective concentration of virus or other delivery vehicle be utilized in order to reduce the risk of undesirable effects, such as toxicity, retinal dysplasia and detachment. Still other dosages in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the ocular condition and the degree to which the disorder, if progressive, has developed.

[0160] Yet another aspect described herein is a method for treating or preventing an optic neuropathy in a subject in need thereof comprising administering to the subject a rAAV, cell, or pharmaceutical composition according to the invention. In a preferred embodiment, the optic neuropathy is optic neuritis or glaucoma. In a preferred embodiment, the subject to be treated is a mammalian subject, preferably a human subject. In one embodiment, an rAAV carrying the SIRT1 sequence, preferably suspended in a physiologically compatible carrier, diluent, excipient and / or adjuvant, may be administered to a desired subject including a human subject. This method comprises administering to a subject in need thereof any of the nucleic acid sequences, expression cassettes, rAAV genomes, plasmids, vectors or rAAV vectors or compositions containing them. In one embodiment, the composition is delivered subretinally. In another embodiment, the composition is delivered intravitreally. In still another embodiment, the composition is delivered using a combination of administrative routes suitable for treatment of optic neuropathy or optic neuritis, and may also involve administration via the palpebral vein or other intravenous or conventional administration routes. The methods of the present invention deliver a therapeutically effective dose of rAAV to the subject. For use in these methods, the volume and viral titer of each dosage is determined individually, as further described herein, and may be the same or different from other treatments performed in the same, or contralateral, eye. The dosages, administrations and regimens may be determined by the attending physician given the teachings of this specification. In one embodiment, the composition is administered in a single dosage selected from those above listed in an affected eye. In another embodiment, the composition is administered as a single dosage selected from those above listed in a both affected eyes, either simultaneously or sequentially. Sequential administration may imply a time gap of administration from one eye to another from intervals of minutes, hours, days, weeks or months. In another embodiment, the method involves administering the compositions to an eye two or more dosages (e.g., split dosages). In another embodiment, multiple injections are made in different portions of the same eye. In another embodiment, a second administration of an rAAV including the selected expression cassette (e.g., SIRT1 -containing cassette) is performed at a later time point. Such time point may be weeks, months or years following the first administration. Such second administration is, in one embodiment, performed with an rAAV having a different capsid than the rAAV from the first administration. In another embodiment, the rAAV from the first and second administration have the same capsid.

[0161] In still other embodiments, the compositions described herein may be delivered in a single composition or multiple compositions. Optionally, two or more different AAV may be delivered, or multiple viruses [see, e.g., WO 2011 / 126808 and WO 2013 / 049493], In another embodiment, multiple viruses may contain different replication-defective viruses (e.g., AAV and adenovirus).

[0162] In certain embodiments of the invention, it is desirable to perform non-invasive retinal imaging and functional studies to identify areas of the ganglion cells to be targeted for therapy as well as to test the efficacy of treatment. In these embodiments, clinical diagnostic tests are employed to determine the precise location(s) for one or more subretinal injection(s). These tests may include electroretinography (ERG), perimetry, topographical mapping of the layers of the retina and measurement of the thickness of its layers by means of confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographical mapping of cone density via adaptive optics (AO), functional eye exam, Multi- electrode array (MEA), Pupillary Light Responses, etc, depending upon the species of the subject being treated, their physical status and health and the dosage. In view of the imaging and functional studies, in some embodiments of the invention one or more injections are performed in the same eye in order to target different areas of the affected eye. The volume and viral titer of each injection is determined individually, as further described herein, and may be the same or different from other injections performed in the same, or contralateral, eye. In another embodiment, a single, larger volume injection is made in order to treat the entire eye. In one embodiment, the volume and concentration of the rAAV composition is selected so that only the region of damaged ocular cells is impacted. In another embodiment, the volume and / or concentration of the rAAV composition is a greater amount, in order reach larger portions of the eye, including non-damaged ganglion cells.

[0163] In another embodiment, the method includes performing additional studies, e.g., functional and imaging studies to determine the efficacy of the treatment. For examination in animals, such tests include retinal and visual function assessment via electroretinograms (ERGs) looking at rod and cone photoreceptor function, optokinetic nystagmus, pupillometry, water maze testing, light-dark preference, optical coherence tomography (to measure thickness of various layers of the retina), histology (retinal thickness, rows of nuclei in the outer nuclear layer, immunofluorescence to document transgene expression, cone photoreceptor counting, staining of retinal sections with peanut agglutinin - which identifies cone photoreceptor sheaths).

[0164] Specifically for human subjects, following administration of a dosage of a composition described in this specification, the subject is tested for efficacy of treatment using electroretinograms (ERGs) to examine rod and cone photoreceptor function, pupillometry visual acuity, contrast sensitivity color vision testing, visual field testing (Humphrey visual fields / Goldmann visual fields), perimetry mobility test (obstacle course), and reading speed test. Other useful post-treatment efficacy test to which the subject is exposed following treatment with a pharmaceutical composition described herein are functional magnetic resonance imaging (fMRI), full-field light sensitivity testing, retinal structure studies including optical coherence tomography, fundus photography, fundus autofluorescence, adaptive optics laser scanning ophthalmoscopy, mobility testing, test of reading speed and accuracy, microperimetry and / or ophthalmoscopy. These and other efficacy tests are described in US Patent No. 8,147,823; in co-pending International patent application publication WO 2014 / 011210 or WO 2014 / 124282, incorporated by reference.

[0165] In one embodiment of the methods described herein, a one-time intra-ocular delivery of a composition as described herein, e.g., delivery of an rAAV according to the present invention is useful in treating optic neuropathy, preferably optic neuritis or glaucoma in a subject. In another embodiment of the methods described herein, a one-time intra-ocular delivery of a composition as described herein, e.g., an rAAV according to the present invention, is useful in treating optic neuropathy, preferably optic neuritis or glaucoma in a subject at risk. In certain embodiments, the rAAV is AR0012. In other embodiments, the rAAV is AR0013. In other embodiments, the rAAV is AR0018. In other embodiments, the rAAV is AR0020.

[0166] Thus, in one embodiment, the composition is administered before disease onset. In another embodiment, the composition is administered prior to the initiation of vision impairment or loss. In another embodiment, the composition is administered after initiation of vision impairment or loss. In yet another embodiment, the composition is administered when less than 90% of the RGCs are functioning or remaining, as compared to a non-diseased eye.

[0167] In another embodiment, the composition is readministered at a later date. Optionally, more than one readministration is permitted. Such readministration may be with the same type of vector, a different viral vector, or via non-viral delivery as described herein. In one embodiment, the vector is readministered to the patient to a different portion of the initially injected retina. In one embodiment, the vector is readministered to the patient to the same portion of the initially injected retina.

[0168] In yet another embodiment, any of the above-described methods is performed in combination with another, or secondary, therapy. The secondary therapy may be any now known, or as yet unknown, therapy which helps prevent, arrest or ameliorate these mutations or defects or any of the effects associated therewith. The secondary therapy can be administered before, concurrent with, or after administration of the compositions described above. In one embodiment, a secondary therapy involves non-specific approaches for maintaining the health of the retinal cells, such as administration of neurotrophic factors, antioxidants, anti-apoptotic agents. The non-specific approaches are achieved through injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter could include genetically modified cells that are encapsulated.

[0169] In one embodiment, a method of generating a recombinant rAAV comprises obtaining a plasmid containing an AAV expression cassette as described above and culturing a packaging cell carrying the plasmid in the presence of sufficient viral sequences to permit packaging of the AAV viral genome into an infectious AAV envelope or capsid. Specific methods of rAAV vector generation are described above and may be employed in generating a rAAV vector that can deliver the SIRT1 coding sequence in the expression cassettes and genomes described above and in the examples below.

[0170] In certain embodiments of this invention, a subject has optic neuropathy or optic neuritis or other ocular condition described herein, for which the components, compositions and methods of this invention are designed to treat. As used herein, the term “subject” as used herein means a mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research. In one embodiment, the subject of these methods and compositions is a human. Still other suitable subjects include, without limitation, murine, rat, canine, feline, porcine, bovine, ovine, non-human primate and others. As used herein, the term “subject” is used interchangeably with “patient”.

[0171] As used herein, the term “treatment” or “treating” is defined encompassing administering to a subject one or more compounds or compositions described herein for the purposes of amelioration of one or more symptoms of the ocular disorders described herein. “Treatment” can thus include one or more of reducing onset or progression of the ocular disorders described herein, preventing disease, reducing the severity of the disease symptoms, or retarding their progression, including the progression of blindness, removing the disease symptoms, delaying onset of disease or monitoring progression of disease or efficacy of therapy in a given subject.

[0172] It is to be noted that the term “a” or “an” refers to one or more. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein.

[0173] The words “comprise”, “comprises”, and “comprising” are to be interpreted inclusively rather than exclusively. The words “consist”, “consisting”, and its variants, are to be interpreted exclusively, rather than inclusively. While various embodiments in the specification are presented using “comprising” language, under other circumstances, a related embodiment is also intended to be interpreted and described using “consisting of’ or “consisting essentially of’ language.

[0174] As used herein, “disease”, “disorder” and “condition” are used interchangeably, to indicate an abnormal state in a subject. As used herein, the term “about” means a variability of 10% from the reference given, unless otherwise specified.

[0175] The term “regulation” or variations thereof as used herein refers to the ability of a composition to inhibit one or more components of a biological pathway.

[0176] Unless defined otherwise in this specification, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. Examples

[0177] The following examples are illustrative only and are not intended to limit the present invention.

[0178] Example 1 : MATERIALS AND METHODS

[0179] Animals

[0180] C57B1 / 6J mice were obtained from the Jackson Laboratory (Bar Harbor, ME, USA) and raised in a 12-h light / dark cycle. Both male and female mice were indiscriminately used in all experiments. Mice were housed at the animal facility at the University of Pennsylvania in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, as well as with institutional and federal regulations.

[0181] AAV vector construction and production

[0182] The following AAV vectors were produced and packaged by the University of Pennsylvania Research Vector Core at the Center for Advanced Retinal and Ocular Therapeutics: AAV2.CMV.CBA.eGFP (i.e., V2.G), AAV2.hSNCG.eGFP (i.e., V3.G), AAV2.hSNCG.eGFP.WPRE (i.e., V4.G), AAV2.hSNCG.iSV40.eGFP.WPRE (i.e.,V5.G), AAV2.eCMV.hSNCG.iSV40.eGFP.WPRE (i.e., V6.G), AAV2.iSV40.hSNCG.iSV40.eGFP.WPRE (i.e., V7.G), AAV2.Arc.hSNCG.iSV40.eGFP.WPRE (i.e., V8.G), AAV2.CMV.CBA.hSIRTl (i.e.,AR0020), AAV2.CMV.CBA.hSIRTLWPRE (i.e., AR0018), AAV2.eCMV.hSNCG.iSV40.hSITRTl.WPRE (i.e.,AR0012), and AAV2.eSV40.hSNCG.iSV40.hSITRTl.WPRE (i.e., AR0013). The original proviral vector consisted of the CMV enhancer / CBA promoter derived from Invivogen pDRIVE CAG plasmid (San Diego, CA, USA), or the codon optimized SNCG (gamma-synuclein promoter) 34, the cDNA encoding enhanced GFP (eGFP) protein, the WPRE element (i.e., nucleotides 1093-1685, GenBank accession no. J04514), and the bovine growth hormone (bGH) polyadenylation signal. Human (h)SIRTl (transcript variant 1) cDNA clones were obtained from OriGene (Rockville, MD, USA). AAV expression cassettes were flanked by the AAV2 inverted terminal repeats. Sequences were amplified with DNA polymerase (New England Biolabs, Ipswich, MA, USA) and cloned into AAV expression plasmid using a commercial cloning kit (Clontech Laboratories, Mountain View, CA, USA). All AAV vectors were packaged using previously described methods and purified with CsCl gradient 35. Alternatively, the AAV8BP2 capsid plasmid from our prior studies 25 was used where indicated. Vectors were stored in 0.001% Pluronic F-68 at -80°C until just before use, and then diluted to the concentration indicated in the text.

[0183] Intravitreal injection of AAV vectors

[0184] 4-week-old mice were anesthetized by isoflurane inhalation. Proparacaine (0.5% Alcaine; Alcon Laboratories, Belgium) was topically applied for local anesthesia. A 33 ’A gauge needle was used to create a small incision at the limbus. A 10-uL Hamilton syringe (701 RN; Hamilton Company, Reno, NV, USA) attached to a 33-gauge blunt-end needle was inserted into the vitreous cavity 1 mm behind the ora serrata to avoid lens damage. Two ul of AAV preparation (at concentrations indicated in the text) were injected into each eye. Injection was given slowly to allow diffusion of the virus solution. Vehicle treated eyes were injected with an equivalent volume of vector dilution buffer (0.001% Pluronic F68 in PBS).

[0185] Live retina fundus imaging

[0186] In vivo imaging was performed with a confocal scanning laser ophthalmoscope to visualize the GFP-positive cells after intravitreal injection of AAV vectors expressing the eGFP reporter. Mice were anesthetized systemically with xylazine and ketamine and topically with 0.5% proparacaine eye drops. Pupils were dilated with one drop of 0.5% tropicamide and one drop of 2.5% phenylephrine hydrochloride. Ophthalmic gel and a custom-made polymethyl methacrylate piano contact lens were used to maintain corneal hydration and improve image quality. Fluorescence images were then acquired with a 488 nm excitation laser and bandpass filter of 505-545 nm.

[0187] Immunohistochemistry and quantification of eGFP or hSIRTl expressing cells and RGC density

[0188] Mouse eyes were enucleated and fixed in 4% paraformaldehyde for 30 min at 4 °C. Retinas were dissected, permeabilized and blocked in 2% Triton X-100, 10% normal donkey serum, and PBS. For RGC and hSIRTl staining, tissues were incubated at 4 °C with a rabbit anti-Bm3a antibody (Synaptic systems, Cat# 411 003) diluted 1 : 1000 and a goat anti-hSIRTl antibody (ProSci, Poway, CA, USA) used at 1 : 1000 dilution. Retinas were then washed three times and incubated with secondary antibody solution containing donkey anti-rabbit Al exaFluor 488 and anti-goat Al exaFluor 594 (1 : 1000 dilutions each) for one hour at room temperature. After several washes, retinas were flat-mounted onto glass slides with an aqueous mounting medium (SouthernBiotech, Birmingham, AL, USA), covered with a coverslip and sealed. Immunofluorescence was detected using a Nikon Fluorescence microscope. Retinal images were taken with a 40x objective in 12 standard fields (1 / 6, 3 / 6, and 5 / 6 of the retinal radius from the center of the retina in each quadrant). Total RGCs counted in the 12 fields were recorded in the experimental and control groups using ImageJ software (http: / / imagej.nih.gov / ij / ; provided in the public domain by the National Institutes of Health, Bethesda, MD, USA). Mice injected with the AAV vectors expressing the eGFP reporter were stained with anti-Bm3a antibody only for RGC colocalization with eGFP signal. The number of retinal eGFP+ and / or Brn3+ cells was determined as described above for the Brn3a+ SIRT1+ cells.

[0189] Quantitative real-time PCR (qRT-PCR) for hSIRTl expression

[0190] Retinas were dissected and immediately snap frozen in liquid nitrogen. Total RNA was extracted using an RNeasy kit (Qiagen, Valenca, CA, USA) and converted into cDNA using the PrimeScript 1st Strand cDNA Synthesis Kit (Takara Biotechnology, CA, USA). GAPDH and hSIRTl mRNA were analyzed using premade master mix containing primers and probe for either hSIRTl or GAPDH obtained from Integrated DNA Technologies (Coralville, Iowa, USA). The relative mRNA level was determined through calculation of the Ct and AACt values.

[0191] Enzyme-linked immunosorbent assay (ELISA) for quantitative analysis of eGFP in retinal lysates

[0192] The eGFP protein levels were determined in retina lysates using the GFP ELISA kit according to the manufacturer’s instructions (Abeam, Waltham, MA, USA).

[0193] Statistical analyses

[0194] Differences between treatment groups with respect to Bm3a+, hSIRTl + and eGFP+ cell counts were compared using a 1-way ANOVA followed by Tukey’s honest significant difference test. Data were input and analyzed using the GraphPad Prism 5.0 Software (GraphPad Software Company, Boston, MA, USA). Differences were considered statistically significant at P < 0.05. Data meet the assumption of normal distribution of tests with variances between groups being compared.

[0195] Example 2: RESULTS AAV transduction potential in RGCs

[0196] The synthetic AAV2-derived AAV8BP2 vector has previously been designed to provide a robust tropism for cells of the inner retina25,36. Infection efficiency of retinal cells with the AAV8BP2 and its parental AAV2 vector was assessed following intravitreal injection to adult mice (FIG. 1 A). The viral vectors carry the eGFP marker under the control of the CBA-CMV promoter37, a strong ubiquitous expression cassette, to effectively infect retinal cells without inducing retinal detachment or other adverse effects. Increasing amounts [1 x 108, 1 x 109, and 1 x 109vector genomes (vg)] of either AAV2.CMV.CBA-eGFP or AAV8BP2.CMV.CBA.eGFP were delivered into each eye (FIG. IB). Fundus photography was used to assess the extent of eGFP expression in the retina of live animals. The eGFP fluorescence was detectable in all mice at week 1 and week 2 post-injection. Examples of images acquired 2 weeks after viral vector injection are shown in FIG. 1C. The density of eGFP -labeled cells for both vectors followed a similar trend for the three amounts tested for both AAV2.CMV.CBA-eGFP and AAV8BP2.CMV.CBA.eGFP vectors, as a dose-dependent increase of eGFP expressing cells can be seen at each time point. Transduction efficiency was assessed by dual Bm3a immunohistochemical staining and eGFP fluorescence of retinal flat mounts. FIG. ID shows an example of merged fluorescence micrographs of Brn3a- immunostained retinas of mice transduced with either AAV2.CMV.CBA-eGFP or AAV8BP2.CMV.CBA.eGFP. Given the non-selective activity of the ubiquitous promoter used, eGFP positive cells co-localized with both Bm3a-positive and -negative cells. The percentage of Bm3a+ eGFP+ cells was determined in relation to the total Bm3a+ positive cells averaged among all retinal areas. RGC transduction with the AAV2.CMV.CBA-eGFP vector showed a trend toward higher transduction for all AAV amounts tested. The differences between the AAV2.CMV.CBA-eGFP and AAV8BP2.CMV.CBA.eGFP vectors were not statistically significant due largely to intra-group variability of Bm3a-labeled and eGFP -positive cells. The overall infection efficacy of the AAV2.CMV.CBA-eGFP and AAV8BP2.CMV.CBA.eGFP at the clinically acceptable concentration of 1 x 109vg / eye was 25% and 15%, respectively, at week 2 post injection.

[0197] FIGs. 1E-1H show average transduction efficiency of treatment groups. Data show both AAV2 and AAV8BP2 serotypes transduce more RGCs at lelO concentration than at lower doses. The le9 dose of AAV2 shows increased transduction 2 weeks after injection vs 1 week. AAV8BP2 does not appear to offer an advantage over AAV2 as transduction rates are similar or trending toward worse, thus AAV2 serotype was chosen.

[0198] Time- and dose-dependent transduction potential of the AAV2.CMV.CBA-eGFP vector

[0199] Transduction efficiency of the AAV2.CMV.CBA-eGFP vector was further analyzed using clinically relevant concentrations of the vector (1 x 109, 3 x 109, and 1 x IO10vg / eye) at either week 1, 2 or 4 post injection. At each time point, retinal flat mounts were prepared, and immunolabeled with the RGC marker, Brn3a (data not shown). Cells with colocalized eGFP and Bm3a signals were counted. RGC transduction efficiency was determined by calculating the % of Bm3a+ cells that co-expressed eGFP. The lowest transduction efficiency was observed at week 1 at 1 x 109vg / eye. Transduction efficiency was higher at week 2 and 4 than week 1 for all concentrations tested (FIG. 2), although differences were not statistically significant.

[0200] Optimization of AAV vectors for efficient delivery of transgenes to RGCs

[0201] One potential drawback of AAV-based gene therapy is the propensity of these vectors to transduce RGCs with low efficiency when injected intraocularly, e.g., intravitreally38. Selective and successful transduction of RGCs may be enhanced by incorporating an RGC- specific promoter ahead of the transgene. A minimal promoter has been developed from the human gamma-synuclein gene (hSNCG) that was shown to drive selective gene expression in RGCs26. The hSNCG promoter was inserted into the AAV2 backbone to drive the expression of the eGFP reporter and compared expression within RGCs to eyes injected intravitreally with vector (3 x 109vg / eye) containing the constitutive CMV enhancer and CBA promoter (FIG. 3 A). In the absence of any additional elements, the CBA-CMV promoter showed a higher trend, although not significant, average transduction efficiency as compared with the hSNCG promoter (FIG. 3D; AAV vector V2.G versus V3.G; 31% and 25%, respectively). The normalized eGFP protein levels determined by ELISA were significantly higher in eyes transfected with vector V2.G as compared with V3.G vector (FIG. 3D).

[0202] To enhance the transduction efficiency of the hSNCG promoter, a series of recombinant AAV2 vectors was generated in which additional regulatory sequences were introduced as shown in Fig 3). One vector (V4.G) has the hSNCG promoter driving the reporter gene flanked at the 3’ end by the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). The latter contains additional c / .s-acting sequences that substantially increase gene expression levels in a transgene-, promoter- and vectorindependent manner39. WPRE functions by modifying RNA polyadenylation and exporting mRNA partly linked to the CRM-1 dependent nuclear export pathway40. Moreover, since introns can regulate gene expression in eukaryotic cells41we generated a vector in which an SV40 intron element (iSV40)42was positioned downstream of the hSNCG promoter (V5.G). The hSNCG promoter was further modified by placing an enhancer element from either the human CMV immediate-early promoter (V6.G construct), SV40 (V7.G construct), or activity-regulated cytoskeletal (Arc) (V8.G construct) upstream from it in a forward orientation. These enhancer elements have been shown to strengthen cell type-specific or ubiquitous promoters in different tissues43, 44. Following intravitreal injection of the AAV vectors (3 x 109vg / eye), eGFP fluorescence was readily detectable by in vivo fundus imaging. The eGFP fluorescence was evident in cells across the majority of the retinal surface upon inclusion of WPRE sequence in the AAV2 vector (i.e., Vector V4.G) (data not shown). However, of all tested vectors, the AAV construct wherein the hSNCG promoter was flanked with CMV enhancer and SV40 intron (V6.G vector) showed the highest density of eGFP expressing cells (p<0.05). The hSNCG promoter flanked with the Arc enhancer and SV40 intron (i.e., V8.G vector) exhibited lower density of eGFP expressing cells. Immunohistochemical labeling of retinal flat mounts with Brn3a antibody showed colocalization of eGFP positive cells with Bm3a in the GCL (FIG. 3B inset panels). Turkey’s multiple comparison test showed that transduction efficiency with the AAV constructs wherein the hSNCG promoter was flanked with SV40 intron and either CMV (i.e., V6.G) or SV40 enhancer (i.e., V7.G) was significantly higher when compared with the AAV vector containing the hSNCG alone (i.e., V3.G) (FIG. 3C). The mean average of transduction efficiency was the highest in the group that received the V6.G vector. ELISA-based measurement of eGFP levels in protein lysates corroborated the transduction efficiency levels (FIG. 3D).

[0203] The AAV2 serotype was selected for construction of vectors containing RGC- selective plasmids with varying enhancers, using eGFP transgene as a reporter to compare expression specificity and efficiency in mice. Constructs were tested in vivo via intravitreal injection at MOI 1E10 vg / eye and evaluated using immunohistochemistry and eGFP expression by ELISA to quantify transduction efficiency (FIG. 3E and 3F).

[0204] RGC-selective expression of the eGFP reporter gene driven by hSNCG promoter flanked by the CMV enhancer and SV40 intron

[0205] To examine AAV construct selectivity and efficiency of transducing RGCs, we performed immunohistochemical staining of retinal cross sections prepared from mice two weeks after intravitreal injection with AAV constructs with constitutive CMV-CBA promoter (V2.G), or hSNCG promoter with a CMV enhancer (V6.G), a SV40 enhancer (V7.G), or no enhancer (V4.G). The co-localization of eGFP positive cells in the ganglion cell layer with the Bm3a marker is shown in FIG. 4A. The eGFP reporter expression driven by the CMV- CBA promoter (i.e., V2.G) was less selective for RGCs (-62.5%; 13.0 Brn3a+ RGCs out of 20.8 eGFP+ cells per imaged retinal cross section, n=5) than constructs containing the hSNCG promoter (FIG. 4B). Conversely, eGFP expression driven by the hSNCG promoter and CMV enhancer was highly selective for RGCs (-90.4%; 15.67 Brn3a+ RGCs out of 17.33 eGFP+ cells per imaged retinal cross section, n=5). Similarly, eGFP expression driven by the hSNCG promoter and SV40 enhancer was highly selective for RGCs (92.2%; 11.8 Brn3a+ RGCs out of 12.8 eGFP+ cells per imaged retinal cross section, n=5).

[0206] The ability of the top three eGFP expressing constructs to selectively transduce RGCs was also examined. As expected, constructs containing the SNCG promoter demonstrated highly selective expression within RGCs, whereas the construct containing the CBA promoter was significantly less RGC-selective (FIG. 4C).

[0207] AAV vectors with optimal promoter-driven expression of the therapeutic gene hSIRTl

[0208] The maximal genome that can be packaged into an AAV vector is - 4.7 kb45. Since the combined CMV enhancer (0.304 kb)-SNCG promoter (0.953 kb)-SV40 intron DNA fragment (0.097 kb) together with the poly(A) tail (0.208 kb) and WPRE (0.589 kb) sequence is - 2.151 kb in length, it can still hold a therapeutic gene of up to 2.549 kb. The AAV2 vector version containing the SV40 enhancer instead of CMV enhancer is 2.082 kb in length and can hold a transgene of up to 2.618 kb. We generated new AAV vectors (AR0020, AR0012 and AR0013) in which the eGFP reporter gene in the V2.G, V6.G, and V7.G vectors was replaced with the codon optimized sequence of the hSIRTl gene (2.244 kb), as shown in FIG. 5A. Because the WPRE element showed a strong trend toward increased reporter gene expression, we also generated a new AAV vector with the WPRE element added to the AR0020 vector (AR0018; FIG. 5A). Mice received intravitreal injection of the AR0020, AR0018, AR0012 or AR0013 vectors. Two weeks later, retinas were harvested from all groups and processed for hSIRTl expression at the protein and mRNA levels. FIG. 5B shows representative photographs of flat mounted preparations of retina immunolabeled with SIRT1 antibody that recognizes hSIRTl only. AAV-mediated hSIRTl transduction efficiency in RGCs was similar between the hSNCG promoter-containing AAV constructs and the CMV-CBA-promoter-containing AAV vector containing WPRE, with just a nonsignificant trend toward lower efficiency without the WPRE element as measured both across the entire retina (FIG. 5C), as well in the most highly transduced regions of the central retina (FIG. 5D). Similarly, expression levels of the hSIRTl gene were not significantly different between retinal lysates from eyes injected with CMV-CBA promoter-containing vectors as compared with hSNCG promoter-containing vectors (FIG. 5E).

[0209] Example 3: Therapeutic efficacy of SIRT1 gene therapy in experimental optic neuritis EAE was induced by immunization with MOG peptide in 8-week-old C57BL / 6 mice and disease severity monitored by EAE ascending paralysis scores. This experiment was repeated twice, once with a mild degree of EAE disease induced (FIG. 6 A), and a second time with moderately severe EAE disease induced (FIG. 6B).

[0210] In experiment 1 (FIG. 6C-6E), EAE scores, assessed on a relative 5-point scale by a masked investigator, showed mild ascending paralysis developed in all treatment groups with no significant differences. Vision loss also showed no significant differences between treatment groups similar to prior studies where SIRT1 therapies have varied between mediating no visual benefit or a small improvement. The primary outcome of RGC survival showed that AR0012 and AR0018 both significantly reduced RGC loss when injected prior to disease induction, and AR0018 significantly reduced RGC loss when administered at the peak of optic neuritis disease.

[0211] In experiment 2 (FIG. 6F-6H), EAE scores, assessed on a relative 5-point scale by a masked investigator, showed more significant ascending paralysis developed, reaching a moderate level, in all treatment groups with no significant differences. Vision loss also showed no significant differences between treatment groups similar to experiment 1 and to prior studies where SIRT1 therapies have varied between mediating no visual benefit or a small improvement. The primary outcome of RGC survival showed that AR0012 and AR0018 both significantly reduced RGC loss when injected prior to disease induction, and when administered at the onset and peak of optic neuritis disease.

[0212] Immunohistochemistry and quantification of RGC density

[0213] Mouse eyes were enucleated and fixed in 4% paraformaldehyde for 30 min at 4 °C. Retinas were dissected, permeabilized and blocked in 2% Triton X-100, 10% normal donkey serum, and PBS. For RGC staining, tissues were incubated at 4 °C with a rabbit anti-Bm3a antibody (Synaptic systems, Cat# 411 003) diluted 1 : 1000. Retinas were then washed three times and incubated with secondary antibody solution containing donkey anti-rabbit AlexaFluor 488 (1 : 1000 dilution) for one hour at room temperature. After several washes, retinas were flat-mounted onto glass slides with an aqueous mounting medium (SouthernBiotech, Birmingham, AL, USA), covered with a coverslip and sealed. Immunofluorescence was detected using a Nikon Fluorescence microscope. Retinal images were taken with a 40x objective in 12 standard fields (1 / 6, 3 / 6, and 5 / 6 of the retinal radius from the center of the retina in each quadrant). Total RGCs counted in the 12 fields were recorded in the experimental and control groups using Imaged software.

[0214] Optic nerve axon staining and quantification

[0215] Optic nerves were bisected at the level of the optic nerve head and fixed in 2.5% glutaraldehyde with 2.0% paraformaldehyde in a 1 M sodium cacodylate buffer at a pH of 7.4. Optic nerves were further fixed in 2% osmium tetroxide and the tissue was dehydrated in increasing concentrations of ethanol. After dehydration, the tissue was embedded in epoxy resin Embed 812 (Electron Microscopy Science, Hatfield, PA), cut in 0.75 uM cross sections, and stained with 1% toluidine blue. Sections were obtained at approximately 1 mm from the proximal tip of the optic nerve head. The majority of each optic nerve section was captured with one centrally oriented image at 40X magnification and axons were manually counted by a masked observer using ImageJ software. Three adjacent sections were counted for each optic nerve.

[0216] Induction and Scoring of EAE

[0217] 8 weeks old female C57BL / 6J mice were anesthetized with isoflurane and injected subcutaneously on the upper and lower back with a total of 200 pg of myelin oligodendrocyte glycoprotein (MOG) peptide (MOG35-55; Genscript, Piscataway, NJ, USA) emulsified in Complete Freund’s Adjuvant (Difco, Detroit, MI, USA) containing 2.5 mg / ml mycobacterium tuberculosis (Difco). Control mice were injected with an equal volume of phosphate buffer saline (PBS) instead of MOG and Complete Freund’s Adjuvant. All animals received 200 ng pertussis toxin (List Biological, Campbell, CA, USA) in 0.1 ml PBS by intraperitoneal injection at 0 h and 48 h post-immunization. Severity of EAE was scored using a 5-point scale: 0=no disease; 0.5=partial tail paralysis; 1.0=tail paralysis or waddling gait; 1.5=partial tail paralysis and waddling gait; 2.0=tail paralysis and waddling gait;

[0218] 2.5= partial limb paralysis; 3.0=paralysis of one limb; 3.5=paralysis of one limb and partial paralysis of another; 4.0=paralysis of two limbs; 4.5=moribund state; 5.0=death.

[0219] EAE scores (FIG. 6) demonstrate that the EAE disease was successfully induced in mice, with milder and later onset disease in the experiment on left than the experiment on the right. RGC counts from control mice, EAE mice without treatment, and EAE mice treated with indicated vectors at varying time points are shown for both experiments.

[0220] Example 4: Therapeutic efficacy of SIRT1 gene therapy in experimental glaucoma.

[0221] Magnetic Microbead Occlusion Model / Microbead Preparation

[0222] A published magnetic MB mouse model of glaucoma was used to induce and sustain elevated intraocular pressure (IOP). Stock magnetic microbead (MB) solution (4.5 pm diameter, 4 x 108beads / mL; Dynabeads M-450 Epoxy, ThermoFisher Scientific, Cat# 14011, Waltham, MA, USA) was vortexed to evenly distribute MBs in solution. Next, 1 mL of the stock MB solution was pipetted into 50 mL of 0.02 M sodium hydroxide (NaOH, MW 39.997 g / mol) in Tris lOx buffer (MW 121.4 g / mol) and rotated for 24 hr at RT to remove protective epoxy groups from the MBs. A magnet was attached to the bottom of the tube to collect the magnetic MBs. The tube was then oriented horizontally and rotated for an additional 4 hr at RT. The supernatant of the MB solution was removed using a micropipette, while the magnetic MBs were resuspended in 50 mL of Tris lOx buffer until evenly resuspended. MBs were washed three times with 5 mL of ultra-pure laboratory-grade water by vortexing for 2 mins. A magnet was attached to the bottom of the tube to collect the MBs. MBs were further washed three times in a laminar flow hood with BSS by aspiration with a micropipette. MBs were resuspended in BSS to a final concentration of 2.4 x 106beads / pL (high concentration) or 1.6 x 106beads / pL (low concentration) to allow 3.6 x 106beads / pL or 2.4 x 106beads, respectively, to be injected into the anterior chamber with a final volume of 1.5 pL. The MBs were stored at 4 °C until usage. Mice received an intracameral injection of 1.5 uL of magnetic MBs in the experimental model eye on day 0. IOPS were measured using Icare TONOLAB tonometry (Icare TONOVET, Vantaa, Finland). An average of 3 measurements per eye were used at each time point. IOP was considered successfully elevated if IOP increased to either >18 or >double the baseline IOP of that eye (whichever was lower) on a minimum of two separate time points after MB injection.

[0223] Optokinetic response recordings (OKRs)

[0224] Visual function was assessed by measuring the OKR using commercial software and apparatus (OptoMetry; CerebralMechanics, Inc., Medicine Hat, AB, Canada). OKR was determined as the highest spatial frequency where mice track a 100% contrast grating that is projected at different spatial frequencies. Briefly, mice were placed unrestrained on a platform in the center of four computer monitors with a video camera above the platform to capture the movement of the mouse. A rotating cylinder with vertical sine wave grating was computed and projected to the monitors. The sine wave grating, consisting of black and white bars at 100% contrast and 12 degrees / second, provides a virtual -reality environment to measure the spatial acuity of the left eye when it rotates clockwise and the right eye when it rotates counterclockwise. Thus, the asymmetry of the optokinetic motor reflex allows for testing of visual function for each eye separately. Testing was performed by a masked investigator: OKR responses were recorded for both eyes, and the presence of any central media opacity (either corneal staining or visible cataract) was noted. Two experiments were performed. Experiment 1 used a high concentration of MBs to induce severe IOP elevation, but resulted in significant corneal staining from the MBs, thus limiting the ability to follow visual function. Experiment 2 used two concentrations of MBs and still resulted in significant IOP elevation, but with reduced corneal staining at the lower MB concentration.

[0225] In experiment 1 (FIGs. 7A-7C), lOPs, measured by a masked investigator, showed large IOP elevations in all treatment groups with no significant differences. Unlike prior studies, vision loss also showed no significant differences between treatment group; however, OKR responses were likely reduced due to corneal staining induced by MBs. Even after removing eyes with the most severe corneal staining resulting in no visual responses detected, milder corneal staining in other eyes likely explain why vision declined even in SIRT1 treated groups. The primary outcome of RGC survival showed a trend toward AR0012 and AR0018 both reducing RGC loss when injected prior to or after disease induction.

[0226] IOP measurements (FIG. 8A-8D) demonstrate that the elevated IOP disease was successfully induced in mice injected with microbead (MB). OKR scores show visual function in control mice, MB mice without treatment, and MB mice treated with indicated vectors at stated time points. Counts of RGC S and their axons from control mice, MB mice without treatment, and MB mice treated with indicated vectors at stated time points are shown.

[0227] IOP (FIG. 8A) measurements show average IOP levels increased 1.5-2.0-fold in all lower concentration MB injected treatment groups. Eyes were sham injected or injected with vector 14 days prior to MB injection or injected with vector 10 days after MB injection (n = 10 eyes / group). OKR (FIG. 8B) shows significant visual decline in MB injected eyes without SIRT1 gene therapy (***p<0.001 vs control eyes), including only eyes with documented IOP elevation and that did not have severe corneal staining on the day of OKR measurement (n = 5-10 eyes / treatment). AR0012 treatment administered 14 days prior to MB injection, and AR0018 treatment administered 14 days prior or 10 days after MB injection, each significantly improved OKR responses (*p<0.05 and **p<0.01 vs MB injected eyes treated with control vector), and AR0012 administered 10 days after MB injection showed a similar strong trend toward improved OKR responses. RGCs / retina (FIG. 8C) show significant RGC loss in MB injected eyes treated with a control vector (#p<0.05 vs control eyes), and treatment with both AR0012 and AR0018 before and after MB injection led to increased RGC survival in all groups (n = 7-10 eyes / treatment; *p<0.05 and **p<0.01 vs MB injected eyes with control vector) when compared by ANOVA. Data shown from MB injected eyes with elevated IOP. A cross-section of optic nerves from 4 randomly selected mice in each treatment group (n=4 nerves / treatment) were stained with toluidine blue, and counts of RGC axons by a masked investigator show a strong trend toward increased RGC axon density in treated vs control -treated MB injected mice (FIG. 8D).

[0228] The degree of RGC neuroprotection in both EAE optic neuritis and MB glaucoma models was impressive, with all hSIRTl gene therapy candidates preventing more than 80% of the disease-induced RGC loss in EAE and more than 90% of the disease-induced RGC loss in glaucoma (FIGs. 8A-8D). We consider this impressive based not only on the magnitude of the effect, but also because this large effect is seen with hSIRTl transduction detected in 65-75% of RGCs near the injection site and just 40% of RGCs across the entire retina. Possible reasons for observing effects that are stronger than the detected transduction efficiency include: 1) potential limitations with our detection of hSIRTl (i.e. some RGCs may be transduced but have a lower level of hSIRTl expression that is not detected on immunohistochemistry); and / or 2) there may be a bystander effect whereby surviving RGCs that were successfully transduced then secrete survival -promoting factors that may help support neighboring RGCs.

[0229] In EAE experiments, we find the RGC survival data very compelling. The failure of hSIRTl gene therapy to also consistently prevent a drop in OKR scores is not unexpected and is consistent with more than a decade of experience using various methods to promote SIRT1 as a means to reduce RGC loss in this model. Our published work has shown consistently that SIRT1 prevents RGC death by mechanisms that are independent of suppressing the optic nerve inflammation that induces RGC loss. This inflammation also interferes with visual function, thus OKR scores can continue to be suppressed in this EAE model which induces chronic inflammation. In human patients with optic neuritis, the inflammation is transient, and studies show that only patients who develop significant RGC loss end up with permanent vision loss after the inflammation resolves. Thus, the promotion of RGC survival seen in this model suggests a strong potential for clinically relevant improved visual outcomes in patients.

[0230] Example 5: DISCUSSION This study was undertaken to address the need to better understand features that enhance AAV-mediated recombinant therapeutic transgene expression in RGCs, key targets of gene therapy in optic neuropathies. Previous studies have shown that utilization of the AAV2 serotype helped deliver genes to neuronal and some non-neuronal cells in various anatomical locations of the central nervous system including the retina46. Inclusion of the CMV promoter helped provide rapid and stronger recombinant gene expression, although the latter remained prone to fading over time. Decline in transgene expression was believed to result from silencing of the CMV promoter by hypermethylation, loss of transduced cells, and / or loss of AAV vector in the absence of genome integration46‘47. AAV vectors with CMV early enhancer / CBA promoter were shown to provide long term and robust transgene expression37However, the ubiquitousness of this promoter was a hindrance to targeting therapeutic gene expression to RGCs with high efficacy while excluding it from other retinal cells. A major challenge in refining the efficiency and selectivity of the AAV vectors was to combine a minimal RGC-selective promoter with other optimal regulatory sequences to provide robust, RGC-selective, long-term, and widespread expression of the therapeutic gene upon intravitreal injection of the recombinant AAV vector. The choice of regulatory elements is always limited by the packaging capacity of AAV vector which cannot exceed approximately 4.7 kb45.

[0231] To overcome these challenges, we designed a series of constructs in which a RGC- selective promoter and transgene were flanked by various regulatory sequences. RGC selectivity was achieved with a human promoter containing a 0.953 kb regulatory region of the SNCG gene shown previously to allow strong expression in ganglion cells across species34Our data show that the hSNCG promoter allowed targeted expression of the eGFP reporter into RGCs in the GCL unlike the CBA-CMV promoter which induced the eGFP reporter gene in cells of multiple retinal layers. Although a small number of cells in the GCL and INL expressed the hSNCG promoter-driven eGFP reporter, these cells may either be displaced RGCs or Brn3a-negative RGCs since a fraction of RGCs (<10%) do not express Brn3a48'50. Previous studies have tested the suitability of other promoters like mouse phosphoglycerate kinase, and human synapsin for direct gene transfer into RGCs34. However, the hSNCG promoter has higher degree of RGC specificity and transduction efficiency than the synapsin promoter, for instance, which yielded a mere 30% expression efficacy throughout the retina. Interestingly, a study by Wang et al showed that the activity of a 1.4-kb mouse SNCG promoter exceeded that of human SNCG promoter in RGCs from various sources, and that truncation of the mouse SNCG promoter to 1.03, 0.66, or 0.27-kb progressively led to significant reduction in RGC specificity51. However, the functionality and effectiveness of the mouse SNCG promoter in the context of human and non-human primate retina remains to be addressed. Comparatively, the 0.963-kb hSNCG promoter tested in our studies provided strong RGC selectivity and extra packaging capacity that will enable packaging larger therapeutic genes. It also is noteworthy that RGC selectivity of the hSNCG promoter may be translatable to clinical settings for which the mouse SNCG promoter would not be applicable.

[0232] When inserted at the 3 ’ end of the reporter gene, the WPRE sequence induced a noticeable trend toward improved transgene expression intensity and distribution throughout the retina. Our fundus imaging of the retina suggested that including the post-transcriptional WPRE element in the expression cassette increased the functionality of all vectors containing the hSNCG promoter. In agreement with this, the eGFP transduction efficiency detected in retinal flat mounts following intravitreal injection consistently trended higher for all AAV vectors designed with the WPRE sequence when compared to those without it. The positive effect associated with the insertion of the WPRE into the 3’ UTR is consistent with prior studies optimizing gene expression cassette designs52-55. Functionally, WPRE position in the gene cassette can be crucial as it may affect proper folding of the mRNA. Thus, our results suggest that introduction of WPRE into the 3’ UTR is useful for improving RGC-selective transgene expression.

[0233] Other elements that positively impacted transduction efficiency of eGFP expression were identified when the hSNCG promoter was flanked with the CMV enhancer and SV40 intron. Although we did not quantify the fluorescence intensity of eGFP in fundus images of live mice following transduction with recombinant vectors, qualitative assessment as shown in representative images suggest that the eGFP reporter was intensely and widely expressed in the retina of mice transduced with the V6.G vector harboring theses regulatory sequences, possibly more so than the vectors containing other sequences such as the SV40 enhancer or Arc promoter. The use of the CMV early enhancer has been introduced previously by Gruh et al56who demonstrated the usefulness of this enhancer to confer efficient and durable cell type-specific gene expression when inserted upstream of a cell type-specific promoter. The CMV enhancer potentiates transcription both in vitro and in vivo even though it has no cell type- or species-specific preferences itself. It contains several binding sites recognized by various nuclear factors that further interact with the basic transcriptional machinery assembled at the promoter to increase transcription57. Despite these properties, we observed that the CMV enhancer was able to maintain the specificity of cell-specific promoters used, rendering it suitable for AAV-mediated RGC-selective expression of therapeutic genes.

[0234] Similarly, the introduction of the SV40 intron sequence upstream of the reporter gene produced high transfection efficiency.

[0235] To further validate our findings and investigate the effects on the expression of a transgene of interest, we evaluated the expression of a hSIRTl. Upregulation of SIRT1 activity by pharmacologic, genetic, cell-based, and gene therapy approaches has consistently shown that this deacetylase can mediate RGC neuroprotection in a variety of optic neuropathies26-28>60-63while several of these studies have already demonstrated therapeutic potential of RGC-selective hSIRTl gene therapy26, 27, 61, these studies did not optimize the AAV vector such as the regulatory elements included with the hSNCG promoter. Here, following analysis of varying regulatory elements, the eGFP reporter gene was replaced by the codon optimized hSIRTl in the AAV2 cassette. Upon intravitreal injection, we found that hSIRTl expression was widespread, reaching almost 40% of RGCs counted in standardized regions across the entire retina, similar to expression of eGFP delivered in corresponding vector constructs. Importantly, hSIRTl expression was detected in over 70% of RGCS in the central retinal regions with highest observed transduction efficiency, suggesting that some RGC populations may be more receptive to the AAV vector, or perhaps proximity to the injection site may influence the percentage of RGCs transduced. The vectors tested herein showed excellent transduction efficiency. The AAV vector containing the hSIRTl gene flanked by the WPRE at the 3’ end and the eCMV-hSNCG-iSV40 enhancer-promoter-intron combination at the 5’ end showed a trend toward highest focal expression levels of hSIRTl. The ability to replace eGFP with a therapeutic gene of interest such as hSIRTl and maintain strong transduction efficiency suggests that this vector design may be useful for introducing other potential therapeutic genes into RGCs in the future. In summary, these studies demonstrate the advantages of the hSNCG promoter when combined with other regulatory sequences in increasing maximizing transduction efficiency and maximizing specificity for RGCs. We conclude that the vectors tested herein, for example, eCMV-hSNCG-iSV40 enhancer-promoter-intron together with a WPRE sequence are advantageous overall in conveying recombinant AAV vector selectivity, distribution in the retina, and strength of expression of a recombinant gene. The specific combination of the most selective minimal RGC-specific promoter, with highly efficient enhancer, intronic, Poly(A) and translational elements, enhances suitability of the vector while maximizing the remaining space for a therapeutic transgene coding sequence like that of SIRT1. All in all, identification of the highly efficient AAV vectors provide proof of concept for its usefulness in clinical applications for AAV-based gene therapy to provide neuroprotection in neurodegenerative diseases.

[0236] Example 6: Therapeutic evaluation of combination therapy with optimized SIRT1 AAV construct co-administered with complement modulating gene therapies in experimental optic neuritis.

[0237] SIRT1 upregulation reduces RGC loss in multiple preclinical optic neuropathy models, likely by promoting mitochondrial biogenesis and reducing oxidative stress within injured neurons. Modulating complement also reduces neuronal loss in multiple models, including RGC loss in EAE and glaucoma models, likely by reducing inflammatory responses that induce neuronal damage. By targeting distinct mechanisms of RGC loss, we hypothesize these two therapies can provide synergistic effects leading to improved efficacy.

[0238] C57BL / 6 mice were transduced two weeks prior to EAE induction with a single intravitreal injection in each eye with a dose of 3E9 vg / eye of either the SIRT1 AAV2 vector AR0012, AAV2.CR1, or AAV2.FHL1 alone, or a single injection with 3E9 vg / eye of each of two vectors: AR0012 + AAV2.CR1 or AR0012 + AAV2.FHL1. eGFP expressing AAV vector was injected as a sham control. EAE was induced by immunization with MOG peptide in 8-week-old C57B1 / 6 mice and disease severity was monitored by EAE ascending paralysis scores. Efficacy was assessed based on RGC survival 8 weeks post-EAE induction. Secondary outcomes assessed visual function by weekly OKR, and optic nerve inflammation scored on a relative 4-point scale of H&E-stained longitudinal optic nerve sections. In addition, vitreous fluid samples and retinas from 4 eyes in each treatment group were sent to Gyroscope for molecular studies.

[0239] EAE scores showed typical moderate ascending paralysis developed (FIGs. 9A-9D) in all treatment groups. Vision loss showed no significant differences between treatment groups similar to earlier studies of SIRT1 gene therapy alone. The primary outcome of RGC survival showed that only AR0012 significantly reduced RGC loss, and no improvement in optic nerve inflammation was found with any of the treatments alone or in combination.

[0240] All publications cited in this specification are incorporated herein by reference. Similarly, the SEQ ID NOs which are referenced herein and which appear in the appended Sequence Listing are incorporated by reference. US Provisional Patent Application No. 63 / 593,435, filed October 26, 2023 is incorporated herein by reference in its entirety. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

[0241] 1. Wong KA, Benowitz LI. Retinal Ganglion Cell Survival and Axon Regeneration after Optic Nerve Injury: Role of Inflammation and Other Factors. Int J Mol Sci 2022; 23(17).

[0242] 2. Sanz-Morello B, Ahmadi H, Vohra R, Saruhanian S, Freude KK, Hamann S et al. Oxidative Stress in Optic Neuropathies. Antioxidants (Basel) 2021; 10(10).

[0243] 3. Newman NJ, Yu-Wai -Man P, Biousse V, Carelli V. Understanding the molecular basis and pathogenesis of hereditary optic neuropathies: towards improved diagnosis and management. Lancet Neurol 2023; 22(2): 172-188.

[0244] 4. Quigley HA. Glaucoma. Lancet 2011; 377(9774): 1367-77.

[0245] 5. Shu DY, Chaudhary S, Cho KS, Lennikov A, Miller WP, Thom DC et al. Role of Oxidative Stress in Ocular Diseases: A Balancing Act. Metabolites 2023; 13(2).

[0246] 6. Fague L, Liu YA, Marsh- Armstrong N. The basic science of optic nerve regeneration. Ann Transl Med 2021; 9(15): 1276.

[0247] 7. Levin LA, Patrick C, Choudry NB, Sharif NA, Goldberg JL. Neuroprotection in neurodegenerations of the brain and eye: Lessons from the past and directions for the future. Front Neurol 2022; 13: 964197.

[0248] 8. Wang D, Tai PWL, Gao G. Adeno-associated vims vector as a platform for gene therapy delivery. Nat Rev Drug Discov 2019; 18(5): 358-378.

[0249] 9. Zinn E, Vandenberghe LH. Adeno-associated vims: fit to serve. Curr Opin Virol 2014; 8: 90-7.

[0250] 10. Cwerman-Thibault H, Augustin S, Ellouze S, Sahel JA, Corral -Debrinski M. Gene therapy for mitochondrial diseases: Leber Hereditary Optic Neuropathy as the first candidate for a clinical trial. C R Biol 2014; 337(3): 193-206.

[0251] 11. Martin KR, Quigley HA. Gene therapy for optic nerve disease. Eye (Lond) 2004; 18(11): 1049-55.

[0252] 12. Mak KY, Rajapaksha IG, Angus PW, Herath CB. The Adeno-associated Vims - A Safe and Promising Vehicle for Liverspecific Gene Therapy of Inherited and Non-inherited Disorders. Curr Gene Ther 2017; 17(1): 4-16.

[0253] 13. Bennett J. Taking Stock of Retinal Gene Therapy: Looking Back and Moving Forward. Mol Ther 2017; 25(5): 1076-1094. 14. Gao J, Hussain RM, Weng CY. Voretigene Neparvovec in Retinal Diseases: A Review of the Current Clinical Evidence. Clin Ophthalmol 2020; 14: 3855-3869.

[0254] 15. Russell S, Bennett J, Wellman JA, Chung DC, Yu ZF, Tillman A et al. Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: a randomised, controlled, open-label, phase 3 trial. Lancet 390(10097): 849-860.

[0255] 16. Buning H, Perabo L, Coutelle O, Quadt-Humme S, Hallek M. Recent developments in adeno-associated virus vector technology. J Gene Med 2008; 10(7): 717-33.

[0256] 17. Srivastava A. In vivo tissue-tropism of adeno-associated viral vectors. Curr Opin Virol 2016; 21 : 75-80.

[0257] 18. O'Donnell J, Taylor KA, Chapman MS. Adeno-associated virus-2 and its primary cellular receptor— Cry o-EM structure of a heparin complex. Virology 2009; 385(2): 434-43.

[0258] 19. Hadaczek P, Mirek H, Bringas J, Cunningham J, Bankiewicz K. Basic fibroblast growth factor enhances transduction, distribution, and axonal transport of adeno-associated virus type 2 vector in rat brain. Hum Gene Ther 2004; 15(5): 469-79.

[0259] 20. Kashi wakura Y, Tamayose K, Iwabuchi K, Hirai Y, Shimada T, Matsumoto K et al. Hepatocyte growth factor receptor is a coreceptor for adeno-associated virus type 2 infection. J Virol 2005; 79(1): 609-14.

[0260] 21. Asokan A, Hamra JB, Govindasamy L, Agbandj e-McKenna M, Samulski RJ. Adeno- associated virus type 2 contains an integrin alpha5betal binding domain essential for viral cell entry. J Virol 2006; 80(18): 8961-9.

[0261] 22. Kurzeder C, Koppold B, Sauer G, Pabst S, Kreienberg R, Deissler H. CD9 promotes adeno-associated virus type 2 infection of mammary carcinoma cells with low cell surface expression of heparan sulphate proteoglycans. Int JMolMed T, 19(2): 325-33.

[0262] 23. Van Vliet KM, Blouin V, Brument N, Agbandj e-McKenna M, Snyder RO. The role of the adeno-associated virus capsid in gene transfer. Methods Mol Biol 2008; 437: 51-91.

[0263] 24. Rabinowitz JE, Rolling F, Li C, Conrath H, Xiao W, Xiao X et al. Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J Virol 2002; 76(2): 791-801. 25. Ramachandran PS, Lee V, Wei Z, Song JY, Casal G, Cronin T et al. Evaluation of Dose and Safety of AAV7m8 and AAV8BP2 in the Non-Human Primate Retina. Hum Gene Ther 2QYl 28(2): 154-167.

[0264] 26. Ross AG, Chaqour B, McDougald DS, Dine KE, Duong TT, Shindler RE et al. Selective Upregulation of SIRT1 Expression in Retinal Ganglion Cells by AAV-Mediated Gene Delivery Increases Neuronal Cell Survival and Alleviates Axon Demyelination Associated with Optic Neuritis. Biomolecules 2022; 12(6).

[0265] 27. Yue J, Khan RS, Duong TT, Dine KE, Cui QN, O'Neill N et al. Cell-Specific Expression of Human SIRT1 by Gene Therapy Reduces Retinal Ganglion Cell Loss Induced by Elevated Intraocular Pressure. Neurotherapeutics 2023.

[0266] 28. McDougald DS, Dine KE, Zezulin AU, Bennett J, Shindler KS. SIRT1 and NRF2 Gene Transfer Mediate Distinct Neuroprotective Effects Upon Retinal Ganglion Cell Survival and Function in Experimental Optic Neuritis. Invest Ophthalmol Vis Sci 2018; 59(3): 1212- 1220.

[0267] 29. Alam F, Syed H, Amjad S, Baig M, Khan TA, Rehman R. Interplay between oxidative stress, SIRT1, reproductive and metabolic functions. Curr Res Physiol 2021; 4: 119-124.

[0268] 30. Singh V, Ubaid S. Role of Silent Information Regulator 1 (SIRT1) in Regulating Oxidative Stress and Inflammation. Inflammation 2020; 43(5): 1589-1598.

[0269] 31. Li L, Zhi D, Cheng R, Li J, Luo C, Li H. The neuroprotective role of SIRT1 / PGC-

[0270] 1 alpha signaling in limb postconditioning in cerebral ischemia / reperfusion injury. Neurosci Lett 2021 749: 135736.

[0271] 32. Nita M, Grzybowski A. Interplay between reactive oxygen species and autophagy in the course of age-related macular degeneration. EXCLI J 2020; 19: 1353-1371.

[0272] 33. Samarin J, Wessel J, Cicha I, Kroening S, Warnecke C, Goppelt-Struebe M. FoxO proteins mediate hypoxic induction of connective tissue growth factor in endothelial cells. J Biol Chem 2010; 285(7): 4328-36.

[0273] 34. Chaffiol A, Caplette R, Jaillard C, Brazhnikova E, Desrosiers M, Dubus E et al. A New Promoter Allows Optogenetic Vision Restoration with Enhanced Sensitivity in Macaque Retina. Mol Ther 2017; 25(11): 2546-2560. 35. Bennicelli J, Wright JF, Komaromy A, Jacobs JB, Hauck B, Zelenaia O et al. Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2 -mediated gene transfer. Mol Ther 2008; 16(3): 458-65.

[0274] 36. Cronin T, Vandenberghe LH, Hantz P, Juttner J, Reimann A, Kacso AE et al. Efficient transduction and optogenetic stimulation of retinal bipolar cells by a synthetic adeno- associated virus capsid and promoter. EMBO Mol Med 2014; 6(9): 1175-90.

[0275] 37. Xu L, Daly T, Gao C, Flotte TR, Song S, Byrne BJ et al. CMV-beta-actin promoter directs higher expression from an adeno-associated viral vector in the liver than the cytomegalovirus or elongation factor 1 alpha promoter and results in therapeutic levels of human factor X in mice. Hum Gene Ther 2001; 12(5): 563-73.

[0276] 38. Boye SE, Alexander JJ, Witherspoon CD, Boye SL, Peterson JJ, Clark ME et al. Highly Efficient Delivery of Adeno-Associated Viral Vectors to the Primate Retina. Hum Gene Ther 2016; 27(8): 580-97.

[0277] 39. Loeb JE, Cordier WS, Harris ME, Weitzman MD, Hope TJ. Enhanced expression of transgenes from adeno-associated virus vectors with the woodchuck hepatitis virus posttranscriptional regulatory element: implications for gene therapy. Hum Gene Ther 1999; 10(14): 2295-305.

[0278] 40. Popa I, Harris ME, Donello JE, Hope TJ. CRM 1 -dependent function of a cis-acting RNA export element. Mol Cell Biol 2002; 22(7): 2057-67.

[0279] 41. Gravel ey BR, Hertel KJ, Maniatis T. The role of U2AF35 and U2AF65 in enhancerdependent splicing. RNA 2001; 7(6): 806-18.

[0280] 42. Xu DH, Wang XY, Jia YL, Wang TY, Tian ZW, Feng X et al. SV40 intron, a potent strong intron element that effectively increases transgene expression in transfected Chinese hamster ovary cells. J Cell Mol Med 2018; 22(4): 2231-2239.

[0281] 43. Rotondaro L, Mele A, Rovera G. Efficiency of different viral promoters in directing gene expression in mammalian cells: effect of 3'-untranslated sequences. Gene 1996; 168(2): 195-8.

[0282] 44. Xu ZL, Mizuguchi H, Ishii-Watabe A, Uchida E, Mayumi T, Hayakawa T. Optimization of transcriptional regulatory elements for constructing plasmid vectors. Gene 2001; 272(1-2): 149-56. 45. Hermonat PL, Quirk JG, Bishop BM, Han L. The packaging capacity of adeno- associated virus (AAV) and the potential for wild-type-plus AAV gene therapy vectors. FEBS Let 1997; 407(1): 78-84.

[0283] 46. Tenenbaum L, Chtarto A, Lehtonen E, Velu T, Brotchi J, Levivier M. Recombinant AAV-mediated gene delivery to the central nervous system. J Gene Med 2004; 6 Suppl 1 : S212-22.

[0284] 47. Prosch S, Stein J, Staak K, Liebenthal C, Volk HD, Kruger DH. Inactivation of the very strong HCMV immediate early promoter by DNA CpG methylation in vitro. Biol Chem Hoppe Seyler 1996; 377(3): 195-201.

[0285] 48. Chintalapudi SR, Morales-Tirado VM, Williams RW, Jablonski MM. Multipronged approach to identify and validate a novel upstream regulator of Sncg in mouse retinal ganglion cells. FEBS .72016; 283(4): 678-93.

[0286] 49. Claes M, Moons L. Retinal Ganglion Cells: Global Number, Density and Vulnerability to Glaucomatous Injury in Common Laboratory Mice. Cells 2022; 11(17).

[0287] 50. Rodriguez AR, de Sevilla Muller LP, Brecha NC. The RNA binding protein RBPMS is a selective marker of ganglion cells in the mammalian retina. J Comp Neurol 2014; 522(6): 1411-43.

[0288] 51. Wang Q, Zhuang P, Huang H, Li L, Liu L, Webber HC et al. Mouse gamma-Synuclein Promoter-Mediated Gene Expression and Editing in Mammalian Retinal Ganglion Cells. J Neurosci 2020; 40(20): 3896-3914.

[0289] 52. Ge J, Jin L, Tang X, Gao D, An Q, Ping W. Optimization of eGFP expression using a modified baculovirus expression system. J Biotechnol 2014; 173: 41-6.

[0290] 53. Martin KR, Quigley HA, Zack DJ, Levkovitch- Verbin H, Kielczewski J, Valenta D et al. Gene therapy with brain-derived neurotrophic factor as a protection: retinal ganglion cells in a rat glaucoma model. Invest Ophthalmol Vis Sci 2003; 44(10): 4357-65.

[0291] 54. Powell SK, Rivera-Soto R, Gray SJ. Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy. Discov Med 2015; 19(102): 49- 57.

[0292] 55. Wang L, Wang Z, Zhang F, Zhu R, Bi J, Wu J et al. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element. Int J Med Sci 2016; 13(4): 286-91. 56. Gruh I, Wunderlich S, Winkler M, Schwanke K, Heinke J, Blomer U et al. Human CMV immediate-early enhancer: a useful tool to enhance cell-type-specific expression from lentiviral vectors. J Gene Med 2008; 10(1): 21-32.

[0293] 57. Ghazal P, Lubon H, Hennighausen L. Multiple sequence-specific transcription factors modulate cytomegalovirus enhancer activity in vitro. Mol Cell Biol 1988; 8(4): 1809-11.

[0294] 58. Le Hir H, Nott A, Moore MJ. How introns influence and enhance eukaryotic gene expression. Trends Biochem Sci 2003; 28(4): 215-20.

[0295] 59. Huang MT, Gorman CM. Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA. Nucleic Acids Res 1990; 18(4): 937-47.

[0296] 60. Fonseca-Kelly Z, Nassrallah M, Uribe J, Khan RS, Dine K, Dutt M et al. Resveratrol neuroprotection in a chronic mouse model of multiple sclerosis. Front Neurol 2012; 3: 84.

[0297] 61. Ross AG, McDougald DS, Khan RS, Duong TT, Dine KE, Aravand P et al. Rescue of retinal ganglion cells in optic nerve injury using cell-selective AAV mediated delivery of SIRT1. Gene Ther 2021; 28(5): 256-264.

[0298] 62. Shindler KS, Ventura E, Rex TS, Elliott P, Rostami A. SIRT1 activation confers neuroprotection in experimental optic neuritis. Invest Ophthalmol Vis Sci 2007; 48(8): 3602- 9.

[0299] 63. Zuo L, Khan RS, Lee V, Dine K, Wu W, Shindler KS. SIRT1 promotes RGC survival and delays loss of function following optic nerve crush. Invest Ophthalmol Vis Sci 2013; 54(7): 5097-102

Claims

WHAT IS CLAIMED IS:

1. A recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a CMV enhancer;(c) a human SNCG promoter(d) an SV40 intron;(e) a coding sequence encoding a human SIRT1;(f) a WPRE;(g) a bGH poly A; and(h) an AAV 3' ITR sequence.

2. The rAAV according to claim 1, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the CMV enhancer sequence is SEQ ID NO: 5 or 29 or a sequence having at least 90% sequence identity thereto;(c) the human SNCG promoter sequence is SEQ ID NO: 6 or a sequence having at least 90% sequence identity thereto;(d) the SV40 intron sequence is SEQ ID NO: 7 or a sequence having at least 90% sequence identity thereto;(e) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(f) the WPRE sequence is SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto;(g) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(h) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

3. The rAAV according to claim 1 or 2 wherein the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1.

4. The rAAV according to claim 1, wherein the vector genome comprises:(a) the AAV 5' ITR sequence, preferably having SEQ ID NO: 4(b) the CMV enhancer sequence having SEQ ID NO: 5 or 29(c) the human SNCG promoter sequence having SEQ ID NO: 6(d) the SV40 intron sequence having SEQ ID NO: 7(e) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1;(f) the WPRE sequence having SEQ ID NO: 8(g) the bGH poly A sequence having SEQ ID NO: 9 or 30; and(h) the AAV 3' ITR sequence, preferably having SEQ ID NO: 10 or 31.

5. The rAAV of any one of claims 1, 2, or 4, wherein the vector genome comprises SEQ ID NO: 11, or a sequence sharing at least 90% identity therewith.

6. A recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a SV40 enhancer;(c) a human SNCG promoter(d) an SV40 intron;(e) a coding sequence encoding a human SIRT1;(f) a WPRE;(g) a bGH poly A; and(h) an AAV 3' ITR.

7. The rAAV according to claim 6, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the SV40 enhancer sequence is SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto;(c) the human SNCG promoter sequence is SEQ ID NO: 6 or a sequence having at least 90% sequence identity thereto;(d) the SV40 intron sequence is SEQ ID NO: 7 or a sequence having at least 90% sequence identity thereto;(e) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(f) the WPRE sequence is SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto;(g) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(h) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

8. The rAAV according to claim 6 or 7 wherein the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1.

9. The rAAV according to claim 6, wherein the vector genome comprises:(a) the AAV 5' ITR sequence, preferably having SEQ ID NO: 4(b) the SV40 enhancer sequence having SEQ ID NO: 12(c) the human SNCG promoter sequence having SEQ ID NO: 6(d) the SV40 intron sequence having SEQ ID NO: 7(e) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1;(f) the WPRE sequence having SEQ ID NO: 8(g) the bGH poly A sequence having SEQ ID NO: 9 or 30; and(h) the AAV 3' ITR sequence, preferably having SEQ ID NO: 10 or 31.

10. The rAAV of any one of claims 6, 7, or 9, wherein the vector genome comprises SEQ ID NO: 13, or a sequence sharing at least 90% identity therewith.

11. A recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a CAG promoter;(c) a coding sequence encoding a human SIRT1;(d) a WPRE;(e) a bGH poly A; and(f) an AAV 3' ITR.

12. The rAAV according to claim 11, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the CAG promoter is a sequence having SEQ ID NO: 28, 33, or 35 or a sequence having at least 90% sequence identity with SEQ ID NO: 28, 33, or 35;(c) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(d) the WPRE sequence is SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto;(e) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(f) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

13. The rAAV according to claim 11 or 12 wherein the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1.

14. The rAAV according to claim 11, wherein the vector genome comprises:(a) the AAV 5' ITR sequence, preferably having SEQ ID NO: 4;(b) the CAG promoter sequence having SEQ ID NO: 28, 33, or 35;(c) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1;(c) the WPRE sequence having SEQ ID NO: 8(e) the bGH poly A sequence having SEQ ID NO: 9 or 30; and(f) the AAV 3' ITR sequence preferably having SEQ ID NO: 10 or 31.

15. The rAAV of any one of claims 11, 12 or 14, wherein the vector genome comprises SEQ ID NO: 18, or a sequence sharing at least 90% identity therewith.

16. A recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a CAG promoter;(c) a coding sequence encoding a human SIRT1;(d) a bGH poly A; and(e) an AAV 3' ITR.

17. The rAAV according to claim 16, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the CAG promoter sequence is SEQ ID NO: 37 or a sequence having at least 90% sequence identity thereto;(c) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(d) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(e) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

18. The rAAV according to claim 16 or 17 wherein the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1.

19. The rAAV according to claim 16, wherein the vector genome comprises:(a) the AAV 5' ITR sequence, preferably having SEQ ID NO: 4;(b) the CAG promoter sequence having SEQ ID NO: 37;(c) the coding sequence encoding a human SIRT1 sequence having SEQ ID NO: 1;(d) the bGH poly A sequence having SEQ ID NO: 9 or 30; and(e) the AAV 3' ITR sequence preferably having SEQ ID NO: 10 or 31.

20. The rAAV of any one of claims 1 to 19, wherein the rAAV capsid is an AAV2 capsid or AAV8 capsid.

21. A cell transfected with the AAV vector of any one of claims 1-20.

22. A pharmaceutical composition comprising the rAAV of any of claims 1 to 20 or a cell according to claim 21; and a pharmaceutically acceptable carrier or excipient23. An aqueous suspension suitable for administration to subject, said suspension comprising an aqueous suspending liquid and a recombinant adeno-associated virus (rAAV), said rAAV having an AAV capsid, and having packaged therein a vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a CMV enhancer;(c) a human SNCG promoter(d) an SV40 intron;(e) a coding sequence encoding a human SIRT1;(f) a WPRE;(g) a bGH poly A; and(h) an AAV 3' ITR.

24. The aqueous suspension according to claim 23, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the CMV enhancer sequence is SEQ ID NO: 5 or 29 or a sequence having at least 90% sequence identity thereto;(c) the human SNCG promoter sequence is SEQ ID NO: 6 or a sequence having at least 90% sequence identity thereto;(d) the SV40 intron sequence is SEQ ID NO: 7 or a sequence having at least 90% sequence identity thereto;(e) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(f) the WPRE sequence is SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto;(g) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(h) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

25. An aqueous suspension suitable for administration to subject, said suspension comprising an aqueous suspending liquid and a recombinant adeno-associated virus (rAAV), said rAAV having an AAV capsid, and having packaged therein a vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a SV40 enhancer;(c) a human SNCG promoter;(d) an SV40 intron;(e) a coding sequence encoding a human SIRT1;(f) a WPRE;(g) a bGH poly A; and(h) an AAV 3' ITR.

26. The rAAV according to claim 25, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the SV40 enhancer sequence is SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto;(c) the human SNCG promoter sequence is SEQ ID NO: 6 or a sequence having at least 90% sequence identity thereto;(d) the SV40 intron sequence is SEQ ID NO: 7 or a sequence having at least 90% sequence identity thereto;(e) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(f) the WPRE sequence is SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto;(g) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(h) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

27. An aqueous suspension suitable for administration to subject, said suspension comprising an aqueous suspending liquid and a recombinant adeno-associated virus (rAAV), said rAAV having an AAV capsid, and having packaged therein a vector genome comprising:(a) an AAV 5' inverted terminal repeat (ITR) sequence;(b) a CAG promoter(c) a coding sequence encoding a human SIRT1;(d) a WPRE;(e) a bGH poly A; and(f) an AAV 3' ITR.

28. The aqueous suspension according to claim 27, wherein one or more of:(a) the AAV 5' inverted terminal repeat (ITR) sequence is SEQ ID NO: 4 or a sequence having at least 90% sequence identity thereto;(b) the CAG promoter sequence is SEQ ID NO: 28, 33, or 35 or a sequence having at least 90% sequence identity with SEQ ID NO: 28, 33, or 35(c) the coding sequence encoding a human SIRT1 sequence is SEQ ID NO: 1 or a sequence having at least 90% sequence identity thereto;(d) the WPRE sequence is SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto;(e) the bGH poly A sequence is SEQ ID NO: 9 or 30 or a sequence having at least 90% sequence identity thereto; and(f) the AAV 3' ITR sequence is SEQ ID NO: 10 or 31 or a sequence having at least 90% sequence identity thereto.

29. The suspension according to claims 23 to 28, wherein the suspension further comprises a surfactant, preservative, and / or buffer dissolved in the aqueous suspending liquid.

30. The pharmaceutical composition or aqueous suspension according to claims 22 to 29, wherein the composition is suitable for delivery to the eye.

31. A method of treating or preventing a disorder of the eye in a subject in need thereof comprising administering to the subject a rAAV, cell, or pharmaceutical composition according to any of claims 1 to 30.

32. The method according to claim 31, wherein the disorder is an optic neuropathy.

33. The method according to claim 32, wherein the disorder is optic neuritis or glaucoma, preferably glaucoma.

34. The method according to any of claims 31 to 33, wherein said rAAV, cell or pharmaceutical composition is administered intraocularly.

35. The method according to claim 34, wherein said rAAV, cell or pharmaceutical composition is administered by subretinal, suprachoroidal, or intravitreal injection.

36. The method according to any of claims 31 to 35, wherein the rAAV is delivered at a dose of about 1 x 109to about 1 x 1013vector genomes per eye (vg / eye).

37. The method according to any of claim 36, wherein said rAAV is administered in a dosage of from 1 x 109to 1 x 1013rAAV in a volume comprising about or at least 100 microliters, thereby preventing vision loss in said subject.

38. The method according to any of claims 31 to 37, wherein said rAAV is administered in a volume comprising about 100 to 250 microliters.

39. The method according to any of claims 31 to 37, wherein said rAAV is administered in a volume of between 150 to 800 microliters.

40. The method according to any of claims 31 to 37, wherein said rAAV is administered in a volume comprising of between 250 to 500 microliters.

41. The method according to any of claims 31 to 37, wherein said rAAV is administered in a volume comprising about 500 microliters.

42. The method according to any of claims 31 to 41, wherein said subject is human.

Images