Method for enhancing crispr / cas9-geminivirus replicon-based homology-directed repair efficiency in rice

Abstract

The present invention relates to a method for enhancing CRISPR / Cas9-geminivirus replicon-based homology-directed repair efficiency in rice and, more specifically, to a method for enhancing homology-directed repair efficiency in plants, the method comprising a step of subjecting plant cells to heat shock, the plant cells being transformed with a recombinant vector carrying a geminivirus replicon containing an endonuclease protein coding sequence and a template DNA sequence for genome editing.

Description

A method to improve the efficiency of CRISPR / Cas9-geminivirus replicon-based homology-directed repair in rice.

[0001] The present invention relates to a method for enhancing the efficiency of CRISPR / Cas9-geminivirus replicon-based homology-directed repair (HDR) in rice, and more particularly, to a method for enhancing HDR efficiency comprising a step of treating callus with heat shock after infection with Agrobacterium.

[0002]

[0003] This work was supported by the Rural Development Administration's Next-Generation Crop New Breeding Technology Development Project and the National Research Foundation of Korea's Individual Basic Research Program (Project Numbers: RS-2024-00458045 and 2022R1A2C1092904).

[0004] Pre-harvest sprouting (PHS) is a crucial phenomenon associated with the germination of parent plant seeds before harvest under relatively humid conditions. Shortening the dormancy period significantly reduces grain yield and quality. Therefore, crop breeders are focusing significant efforts on improving PHS tolerance as a breeding goal, and a genetic understanding of seed dormancy and breaking is crucial for controlling PHS in cereal crops. To date, major genes involved in seed dormancy and germination in crops have been linked to the biosynthesis, catabolism, perception, and signaling of abscisic acid, which plays a key role in regulating seed dormancy. In rice, Sdr4 (seed dormancy 4) is regulated by OsVP1 (Oryza sativa Viviparous-1), an intermediate regulator of seed dormancy, and overexpression of the Osdr4 gene results in PHS tolerance. Previous studies have reported that mutations in genes involved in the biosynthesis of the carotenoid precursor of ABA cause PHS in rice. Furthermore, qSD12, obtained through quantitative trait locus (QTL) analysis for rice seed dormancy, contains two candidate genes: PIL5 (phytochrome interaction factor 3-like 5) and bHLH (basic helix-loop-helix). Several QTL-based fine mapping analyses and mutation studies have linked seed dormancy and PHS to proper dormancy break. However, the molecular mechanisms of dormancy break and PHS remain unclear. Therefore, to help breeders overcome PHS problems in crops subject to unpredictable climatic conditions, it is necessary to isolate numerous genes and alleles associated with seed dormancy and PHS.

[0005] Targeted gene editing is a technology that modifies targeted genes by deleting, inserting, or replacing DNA. Therefore, it is becoming a crucial tool in plant breeding, surpassing random mutagenesis and recombination techniques previously used to generate novel genetic variations. The CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR-associated protein 9) system is currently the most popular gene editing tool due to its efficiency and bioapplication. CRISPR / Cas9 tends to form InDels (Independent Deletions) rather than substitutions, leading to gene knockouts, which can be deleterious depending on the gene or its location within the gene. To date, numerous studies have demonstrated the potential of CRISPR / Cas9-mediated gene editing to induce specific InDel mutations, gene targeting (GT), and regulated gene expression. However, while the CRISPR / Cas9 system is capable of GT and gene substitution, its low frequency still makes it a less common method. Over the years, various methods have been reported to increase the frequency of Homology Directed Repair (HDR) between genomic targets and extrachromosomal homologous donors. HDR and gene replacement in plants require not only the induction of double-strand breaks (DSBs) in the target DNA but also the regulation of the intracellular donor copy number. Successful HDR in plants requires reliable intracellular delivery of the donor repair template (DRT) and its stability. However, HDR in plants presents significant challenges in inducing DSBs in the target DNA and delivering DRT. Recently, base-editing (BE) technologies have been developed to induce localized, targeted nucleotide substitutions.Recently, a report has been published on improving HDR efficiency using a geminiviral replicon-based donor template delivery system. In a previous HDR experiment, the inventors confirmed that homologous recombination (HR) mutants obtained through the geminiviral replicon-based template delivery system had an orange phenotype and a frequency of 1.32% of transformed calli.

[0006] Meanwhile, Korean Patent Registration No. 2002443 discloses a 'method for increasing the efficiency of gene editing based on homologous recombination in plants', and Korean Publication Patent No. 2023-0089306 discloses a 'gene editing composition for increasing germination resistance in wheat and a gene editing method using the same', but the 'method for increasing the efficiency of homologous directed repair based on CRISPR / Cas9-geminivirus replicon in rice' of the present invention is not described.

[0007] The present invention was derived from the above needs, and in the present invention, an HDR mutant line having one SNP (C / T) and a 6 bp insertion (GGCGGC) mutation in the OsERF1 (Oryza sativa Ethylene Response Factor 1) gene to enhance water germination (PHS) resistance was generated using the CRISPR / Cas9 system and the geminivirus replicon system. In addition, to improve the frequency of HDR, heat shock treatment was performed on the callus for 4 hours after infection with Agrobacterium. The ERF1-hdr1 line produced through the above process was confirmed to have significantly improved seed dormancy and water germination resistance, thereby completing the present invention.

[0008] To solve the above problem, the present invention provides a method for improving the efficiency of homology-directed repair in a plant, comprising the steps of: (a) transforming Agrobacterium with a recombinant vector comprising a geminiviral replicon comprising an endonuclease protein coding sequence and a template DNA sequence for genome correction; (b) co-culturing the transformed Agrobacterium with plant cells; and (c) heat-shock-treating the co-cultured plant cells.

[0009] In addition, the present invention provides a method for producing a genome-corrected rice plant with enhanced pre-harvest sprouting resistance, comprising the steps of: introducing a recombinant vector including a geminiviral replicon including a template DNA sequence consisting of a base sequence of SEQ ID NO: 4 for correcting the rice-derived ERF1 (Ethylene Response Factor 1) gene into a rice plant cell to correct the genome; and redifferentiating the plant from the rice plant cell in which the genome has been corrected.

[0010] In addition, the present invention provides a genome-edited rice plant with enhanced germination resistance produced by the above method and a seed having its genome edited.

[0011] The present invention provides a method for improving the efficiency of homology-directed repair (HDR) in plants and a rice-edited plant having improved germination resistance by correcting the ERF1 gene (Os04g0546800) of rice using a CRISPR / Cas9-geminiviral replicon system. Therefore, the method and the rice-edited plant of the present invention can be usefully used not only for improving existing varieties but also for breeding new varieties.

[0012] Figure 1(A) is a Manhattan plot of a genome-wide association scan for PHS resistance, (B) shows potential single nucleotide polymorphisms (SNPs) associated with PHS resistance in the OsERF1 gene (Os04g0546800), and (C) shows the PHS severity of various haplotype groups.

[0013] Figure 2 shows an overview of the HDR vector configuration used in the present invention, (A) shows the ERF1 gene and the target site, the nucleotides highlighted by the square boxes in (B) correspond to the intended modifications for SNPs and insertions, the circled portions represent silent mutations to avoid re-cleavage and generate CAPS (cleaved amplified polymorphic sequence) markers, and the cleavage sites of the two guide RNAs used in the present invention are indicated by two arrows with PAMs. Figure 2(C) shows the configuration of the CRISPR / Cas9 vector and the homologous DNA donor template.

[0014] Figure 3 shows the design of the donor template for the ERF1 gene used in the CRISPR / Cas9 and geminiviral replicon systems.

[0015] Figure 4 shows the construction of Ti-plasmid vectors of CRISPR / Cas9 and geminivirus replicon systems. (A) is a pGemBos vector map, (B) is the result of confirming the donor template in the pGemBos::ERF1 vector, and (C) is the result of confirming the sgRNA sequence by Sanger sequencing analysis.

[0016] Figure 5 shows the confirmation of T-DNA insertion in calli obtained through HDR experiments in rice. (A) shows the phenotype of the edited callus line using the CRISPR / Cas9-based geminivirus replicon system in rice, and (B) shows the results of PCR analysis of the Bar gene and the NOS terminator region (NOS-bar F / R primer set) in rice calli introduced with the pGemBos:ERF1 vector. M: 1 kb DNA ladder; W: wild-type rice calli; P: pGemBos:ERF1 plasmid vector.

[0017] Figure 6 shows the detection of HDR mutants. (A) shows the positions of PCR primers and restriction enzymes for HDR confirmation, (B) shows the results of screening HDR mutant strains using PCR and restriction enzyme analysis (M: 1 kb DNA ladder; N: negative control; Plasmid: pGemBos::ERF1 plasmid vector; WT: wild type), and (C) shows the results of mutation pattern analysis of the target sequence region through deep sequencing. The target DNA sequence of ERF1 in WT at the top of the aligned sequence is indicated by a dotted box, the PAM sequence is underlined, and base deletions are indicated by dashes, insertions by lowercase letters, and substitutions by shades.

[0018] Figure 7 shows the structural comparison results of wild-type OsERF1 and ERF1-hdr-mutant version OsERF1, (A) Thr 2 (B) is the wild type OsERF1 showing the location of Met 2 Wow Gly 34,35 The structure of mutant OsERF1 showing its location.

[0019] Figure 8 shows the evaluation of water germination tolerance in rice plants in which the OsERF1 gene was corrected using the CRISPR / Cas9-geminivirus replicon system. (A, C, E) Ears collected at 35 days after pollination (DAP) of the ERF1-hdr line and wild-type plants (Dongjinbyeo) were soaked in water (A), 10 uM ABA (C), or 20 mM hydrogen peroxide (E) for 4 days, and seed germination was confirmed. (B, D, F) show the results of analyzing the germination rate over time under the conditions of (A), (C), and (E), respectively. Each analysis was performed repeatedly using four biological replicas, and the error bars represent the standard error of the mean (SEM).

[0020] Figure 9 shows the results of germination evaluations in rice plants corrected using the CRISPR / Cas9-geminivirus replicon system targeting the OsERF1 gene. (A, C) are photographs showing seed germination rates of Dongjin and ERF1-hdr lines after artificial dormancy breaking by heat treatment, and (B, D) are graphs showing seed germination rates of Dongjin and ERF1-hdr lines after 6 months of storage. Each analysis was repeated using four biological replicates, and error bars represent SEM.

[0021] Figure 10 is a heatmap of genes related to abscisic acid (ABA), ethylene, and gibberellin (GA) signaling in rice. Immature seeds collected from the spike at 14 days post-pollination (DAP) in the ERF1-hdr line and Dongjin were analyzed. The color gradient represents the log2 fold change in expression.

[0022] Figure 11 shows the relative expression levels of ABA, ethylene, and GA signaling-related genes in the Dongjin and ERF1-hdr lines as a result of qRT-PCR analysis.

[0023] Figure 12 shows the phenotype of the Dongjin and ERF1-hdr lineage plants.

[0024] In order to achieve the object of the present invention, the present invention provides a method for improving the efficiency of homology-directed repair (HDR) in a plant, comprising the steps of: (a) transforming Agrobacterium with a recombinant vector comprising a geminiviral replicon comprising an endonuclease protein coding sequence and a template DNA sequence for genome correction; (b) co-culturing the transformed Agrobacterium with plant cells; and (c) heat-shock-treating the co-cultured plant cells.

[0025] In the present invention, the term "homology-directed repair" refers to a cellular mechanism that repairs double-stranded DNA breaks, lesions, etc., and the most common form of homology-directed repair is homologous recombination. Homology-directed repair refers to one of the cellular mechanisms for repairing double-stranded DNA breaks, lesions, etc., when homologous fragments of DNA are present in the nucleus, mainly during the G2 and S phases of the cell cycle. Homology-directed repair uses donor DNA that programs the repair as a template and can be used to create specific sequence changes in the genome, including the intended addition of genes. If the donor template is provided with a site-specific nuclease, the cellular machinery will repair the double-stranded break by homologous recombination, and this mechanism is enhanced in the presence of DNA double breaks. When donor DNA is present, homologous directed repair and non-homologous end joining compete and occur simultaneously, whereas when donor DNA is absent, only non-homologous end joining occurs.

[0026] In a method for improving HDR efficiency according to one embodiment of the present invention, the endonuclease of step (a) may preferably be an RNA-guided DNA endonuclease, and may be, but is not limited to, Cas9 (CRISPR associated protein 9), Cas12a (formerly known as Cpf1, CRISPR from Prevotella and Francisella 1) or a functional analog thereof.

[0027] The above Cas9 protein may be at least one selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from S. thermophilus or S. aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, and the like, but is not limited thereto. The Cas9 protein or its genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). The above Cas9 genetic information may use a known sequence as is, or may use a sequence optimized for the codon of the target (organism) to be transduced, but is not limited thereto.

[0028] In addition, in the HDR efficiency enhancement method according to one embodiment of the present invention, the geminivirus replicon of step (a) may additionally include a sequence encoding a guide RNA specific to the base sequence of the gene to be corrected.

[0029] The term "guide RNA" refers to a short single-stranded RNA that is specific to a target DNA among the base sequences encoding a target gene, and refers to a ribonucleic acid that complementarily binds to all or part of the target DNA base sequence and guides an endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA), as components; Or, it refers to a single-stranded guide RNA (sgRNA) form that includes a first portion that includes a sequence that is completely or partially complementary to a base sequence in a target gene and a second portion that includes a sequence that interacts with an endonuclease (particularly, an RNA-guided nuclease). However, if the endonuclease is in a form that can be active in the target base sequence, it can be included in the scope of the present invention without limitation, and can be manufactured and used according to a technique known in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease is derived.

[0030] The above guide RNA may be, but is not limited to, a guide RNA transcribed from a plasmid template, a guide RNA transcribed in vitro (e.g., an oligonucleotide double strand), or a synthetic guide RNA.

[0031] The term "replicon" in the present invention refers to a replication unit that performs autonomous control. A replication unit is a continuous DNA molecule, and replication begins at a specific site within the molecule and proceeds sequentially until it is completed. Plasmids, viral DNA, and bacterial chromosomes are all replication units.

[0032] Baltes et al. (2014, Plant Cell 26(1):151-163) previously demonstrated a dramatic increase in HR efficiency in tobacco plants by amplifying the HR template using a geminivirus-based viral replicon and zinc finger nuclease (ZFN) that induces double-strand breaks (DSBs).

[0033] In the method for increasing HDR efficiency according to the present invention, the replicon is included between the LB (left border) and RB (right border) sequences of the Ti plasmid, and the replicon may be operably linked to components such as a long intergenic region (LIR); a promoter; a Rep / RepA protein coding sequence; a terminator; a short intergenic region (SIR); and a multiple cloning site (MCS) into which a foreign gene to be expressed can be inserted, but is not limited thereto. The LIR has functions such as an origin of replication and a promoter, and the SIR has functions such as a terminator.

[0034] In general, the smaller the size of the replicon, the larger the copy number, and the probability of homologous recombination increases as the copy number of the donor template increases, so the composition of the replicon can be adjusted by considering various factors.

[0035] The MCS according to the present invention may clone a template DNA sequence for genome editing, or may clone a template DNA sequence for genome editing; an endonuclease coding sequence; and a guide RNA capable of directing the endonuclease to a target genome site to be edited, but is not limited thereto.

[0036] The term "recombinant" as used herein refers to a cell replicating a heterologous nucleic acid, expressing said nucleic acid, or expressing a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell can express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. Furthermore, a recombinant cell can express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0037] Additionally, the term "vector" is used to refer to a vehicle capable of delivering DNA fragment(s), or genetic molecules, into a cell. A vector can replicate DNA independently in a host cell and reproduce. The term "vehicle" is often used interchangeably with "vector." The term "expression vector" refers to a recombinant vector containing a desired coding sequence and the appropriate genetic sequences necessary to express the coding sequence operably linked to it in a particular host organism. A recombinant vector may be a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus vector, or other vector. In general, any plasmid or vector can be used as long as it can replicate and stabilize in the host.

[0038] In addition, in the method for improving HDR efficiency of the present invention, the heat shock treatment in step (c) may preferably be treatment at a temperature of 40 to 44°C for 3 to 5 hours, more preferably treatment at a temperature of 41 to 43°C for 3.5 to 4.5 hours, and most preferably treatment at a temperature of 42°C for 4 hours, but is not limited thereto. Due to the heat shock treatment, the efficiency of HDR may be improved compared to a condition without heat shock treatment.

[0039] The efficiency enhancement method according to the present invention may more specifically include, but is not limited to, (a) a step of transforming Agrobacterium with a recombinant vector including a geminivirus replicon including an RNA-guided DNA endonuclease protein coding sequence, a sequence encoding a guide RNA specific to the base sequence of a gene to be corrected, and a template DNA sequence for genome correction; (b) a step of co-cultivating the transformed Agrobacterium with plant cells for 10 to 14 hours; and (c) a step of heat shocking the co-cultured plant cells at a temperature of 40 to 44°C for 3 to 5 hours.

[0040] In addition, in the HDR efficiency enhancing method of the present invention, the plant may be rice, barley, wheat, rye, corn, sugarcane, oats or onions, preferably rice, but is not limited thereto.

[0041] The present invention also provides a method for producing a genome-corrected rice plant with enhanced pre-harvest sprouting resistance, comprising the steps of: introducing a recombinant vector including a geminiviral replicon including a template DNA sequence consisting of the base sequence of SEQ ID NO: 4 for correcting the rice-derived ERF1 (Ethylene Response Factor 1) gene into a rice plant cell to correct the genome; and redifferentiating the plant from the rice plant cell in which the genome has been corrected.

[0042] The term "genome / gene editing" as used herein refers to a technology capable of introducing targeted mutations into the genome sequence of plant and animal cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, or substitution of one or more nucleic acid molecules by DNA cleavage, or by introducing mutations into non-coding DNA sequences that do not produce proteins. For the purposes of the present invention, the genome editing may be, in particular, introducing mutations into plants using an endonuclease, such as Cas9 protein, and guide RNA. In addition, 'gene editing' may be used interchangeably with 'gene editing'.

[0043] Plant transformation refers to any method for transferring DNA into plants. Such transformation methods do not necessarily require regeneration and / or tissue culture. Transformation of plant species is now commonplace, encompassing both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA of the present invention into a suitable progenitor cell. Methods include calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), electroporation of protoplasts (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection with plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumefaciens by infiltration of plants or transformation of mature pollen or microspores tumefaciens) mediated gene transfer, infection by (non-complete) viruses (EP 0 301 316), etc. A preferred method according to the present invention comprises Agrobacterium mediated DNA transfer.

[0044] The "plant cell" used in plant transformation may be any plant cell. A plant cell may be a cultured cell, cultured tissue, cultured organ, or a whole plant. "Plant tissue" includes differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, and cancer tissues, as well as various types of cells used in culture, such as single cells, protoplasts, shoots, and callus tissues. The plant tissue may be in planta, organ culture, tissue culture, or cell culture.

[0045] Additionally, in the manufacturing method of the present invention, any method known in the art can be used to regenerate transformed plants from the transformed plant cells. The transformed plant cells must be regenerated into whole plants. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous different species.

[0046] In a method for producing a genome-edited rice plant with enhanced germination resistance according to one embodiment of the present invention, the rice-derived ERF1 gene, which is a gene to be corrected, may be composed of the base sequence of SEQ ID NO: 1, but is not limited thereto. The recombinant vector may include an endonuclease protein coding sequence and a sequence encoding a guide RNA specific to the target base sequence of the rice-derived ERF1 gene, and the target base sequence of the rice-derived ERF1 gene may be SEQ ID NO: 2 and SEQ ID NO: 3, but is not limited thereto.

[0047] In addition, in the manufacturing method according to one embodiment of the present invention, the template DNA sequence consisting of the base sequence of SEQ ID NO: 4 is a donor template for homology-directed repair-based correction of the rice-derived ERF1 gene, and includes mutation information that changes C to T at position 5 of the rice-derived ERF1 gene (SEQ ID NO: 1) and inserts two glycine units (GGCGGC) between positions 96 and 97, and a rice plant in which the ERF1 gene is corrected by homologous recombination with the donor template DNA has enhanced resistance to water germination compared to a wild type.

[0048] The present invention also provides a genome-edited rice plant with enhanced germination resistance produced by the above method and a seed having its genome edited.

[0049] The genome-edited rice plant with enhanced germination resistance according to the present invention is a genome-edited rice plant in which the ERF1 gene is edited using the CRISPR / Cas9 system, and has a trait of enhanced germination resistance compared to a rice plant in which the genome is not edited.

[0050]

[0051] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0052]

[0053] Materials and Methods

[0054] 1. Vector construction

[0055] pGemBos, a plant binary vector for CRISPR-induced homology-directed repair (HDR), was modified from pTC217 (Addgene, #70018). The AtU6 promoter and GT donor were removed in vitro by Cas9-RNP cleavage, and a multiple cloning site (MSC) for insertion of the sgRNA cassette and donor, controlled by the OsU3 promoter, was introduced using Gibson assembly. For antibiotic selection in plants, phosphinothricin acetyltransferase, a Baster resistance gene controlled by the NOS promoter and terminator, was also introduced by MluI digestion and Gibson assembly. Two CRISRP-Cas9 target sites in the OsERF1 gene (Table 1) were selected using Cas-designer (http: / www.rgenome.net / cas designer / , accessed January 12, 2020). For the CRISPR target sequences involved in cloning, annealed oligonucleotide pairs synthesized by Bioneer Co., Ltd. (Korea) were cloned into pGemBos by BsaI digestion. The HDR donor sequence with golden SNP substitution mutations and silent mutations at the target site was synthesized by Bioneer Co., Ltd. and introduced into MCS by SmaI digestion. The construct obtained through the above process was transformed into rice embryogenic callus using Agrobacterium tumefaciens strain EHA105. The primers used for vector construction are shown in Table 2.

[0056] OsERF1 sgRNANameSequence (5' to 3') of the geneSequence number sgRNA1CATGTTGCGGAACCACCCGGAGG2 sgRNA2TGCGGGACGCGTTCTCGTGCGGG3

[0057] Primer information used in vector construction Name Sequence (5' to 3') Purpose Sequence number ERF1 1 st FwGAGAGAGCCGAGCTAACGACdonor Write outer area5ERF1 1 st RvGGAGGATGAGGAGGAGAAGGdonor Write outside area6ERF1 2 nd FwtacccgggCGACCCCAACAAAAGAAATGdonor area creation7ERF1 2 nd RvtatctagaGGAGCGGGAAGTTGAGGAGdonor area creation8ERF1 4 th RVGCCGTCTTCCTTGCTGAsection 1 written by 9ERF1 4 th FwGGAGGCGAGCTTCGGGAsection 3 written by 10ERF1 5 th FWTCAGCAAGGAAGACGGCsection 2+3 Write11ERF1 5 th RvTCCCGAAGCTCGCCTCCsection 1+2 written 12ERF1 6 th FWTTCagcTGCGGaTGGCTGCCCGAsection 4 Create13ERF1 6 th RvTCGGGCAGCCAtCCGCAgctGAAsection 1+2+3 written14

[0058]

[0059] 2. Agrobacterium-mediated transformation and heat treatment of rice

[0060] Dongjin rice (Oryza sativacv. Dongjin) was used as a transgenic recipient for OsERF1 gene editing using two genome-editing vectors. Rice seeds were sterilized and cultured on modified solid MS medium at 28°C in the absence of light for 14 days. Embryogenic calli were used following Agrobacterium-mediated transformation. To verify target site mutations, PCR amplicons were subjected to MiniSeq paired-end read sequencing (Illumina, San Diego, CA, USA) and analyzed using Cas-Analyzer (https: / / www.rgenoime.net / cas-analyzer). All transgenic callus lines were maintained on 2N6 medium and regenerated into plants as previously reported (Kim JH et al., 2022, Int. J. Mol. Sci. 23(18):10383).

[0061]

[0062] 3. Homology modeling and protein structure analysis

[0063] The OsERF1 sequence was translated, and the mature ERF1 polypeptide (318 amino acids) was aligned with the mutant version of the ERF1-hdr line using the Unipro UGEN alignment platforms Kalign (https: / www.ebi.ac.uk / Tools / msa / kalign), MUSCLE (https: / www.ebi.ac.uk / Tools / msa / muscle), and ClusteralW (https: / www.genome.jp / tools-bin / clustalw). Homology modeling was performed using Phyre2 (http: / www.sbg.bio.ic.ac.uk / phyre2). The mutant protein model was overlaid on the wild-type version using DS Visualizer (https: / discover.3ds.com / discovery-studio-visualizer-download).

[0064]

[0065] 4. Mutation detection by PCR-restriction enzyme pattern and base sequence analysis

[0066] HDR efficiency was examined by PCR-restriction pattern analysis. Total DNA was extracted from rice calli as previously reported. The extracted genomic DNA was then used as a template to amplify relevant fragments from each target gene using primers flanking the target region (Table 3). Standard PCR conditions were as follows: 94°C for 4 min; 35 cycles of 94°C for 40 s, 55°C for 50 s, and 72°C for 50 s; and 72°C for 10 min. The PCR products were incubated with the restriction enzyme SnaBI at 37°C for 3 h. The amplified bands were digested with the restriction enzyme, loaded onto a 1.5% agarose gel, and developed. Positive DNA fragments were selected and directly sequenced using internal sequencing primers using next-generation sequencing (NGS) technology to confirm HDR. The mutation rate for each target was calculated as the ratio of the number of HDR-edited transformed calli for each target to the total number of transformed calli obtained.

[0067]

[0068] Primer information for target region amplification Name Sequence (5' to 3') Purpose Sequence number ERF1 NGS 1 st FwCTATCTGGCCTGGCTCACTCNGS Analysis Primary PCR15ERF1 NGS 1 st RvAGCAAGAGGTACCCGTCGTA16ERF1 NGS 2 nd Second PCR for analysis of FwACACTCTTTCCCTACACGACGCTCTTCCGATCTCTCGAACACACCACACACTGNGS 17ERF1 NGS 2 nd RvGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGTCGCTCCACATGTCGG18

[0069]

[0070] 5. Phenotypic evaluation of seed dormancy and germination

[0071] Seeds were harvested from tagged panicles approximately 35 days post-anthesis (DPA) and germination rates were analyzed. Germination was measured in a growth chamber with a temperature and photoperiod of 30°C, 14 h during the day and 26°C, 10 h at night, and germination rates (GR) were measured after 7 days of incubation. For ABA and hydrogen peroxide treatments, freshly harvested panicles at 35 DAP were soaked in water, 10 μM ABA, or 20 mM hydrogen peroxide solutions for approximately 4 h and then placed in an incubator at 27°C for 7 days to maintain PHS characteristics. During the incubation period, panicle moisture was checked daily to maintain high humidity and prevent desiccation. In addition, freshly harvested panicles were heat-treated at 50°C to artificially break dormancy and then germination rates were investigated, and seeds stored in natural conditions were also examined after 6 months. Sprouted grains were counted after 7 days of incubation, and germination was assessed as the ratio of germinated grains to the total number of filled grains in the ear. Seeds that had just emerged from the seed coat were considered germinated for germination characteristics.

[0072]

[0073] 6. Quantitative RT-PCR (qRT-PCR) analysis

[0074] Reverse transcription reaction was performed using HiScript II First Strand cDNA synthesis kit (Promega, USA). Real-time qPCR analysis was performed using ChamQ Universal SYBR ® qPCR Master Mix (Vazyme, China) was used for analysis on a CFX Connect Real-Time system (Bio-Rad, USA). The rice Ubiquitin gene (LOC_Os03g13170) was used as an internal control. Primer information used in the qPCR analysis is shown in Table 4.

[0075] Primer information used in qPCR analysis Name Sequence (5' to 3') Sequence number OsActin qPCR FwCAACACCCCTGCTATGTACG19 OsActin qPCR RvATCACCAGAGTCCAACACAA20 OsERF1 qPCR FwCGACGACATGGTGGTGTT21 OsERF1 qPCR RvTCGTACGACGACGAGTCC22

[0076]

[0077] 7. Measurement of abscisic acid (ABA) concentration

[0078] ABA was extracted from 35 DAP seeds using 2 mL of methanol according to a previously reported method (Fu J et al., 2012, Anal Sci. 28(11):1081-1087), and the ABA concentration was measured by UPLC-MS / MS (ultra-high-performance liquid chromatography triple quadrupole mass spectrometry).

[0079]

[0080] 8. Statistical Analysis

[0081] Data were analyzed by one-way analysis of variance (ANOVA) using SAS Statistical Analysis System (SAS version 9.4). Values ​​are means ± SE (n = 3), and statistical significance was set at p < 0.05 using Duncan's multiple range test.

[0082]

[0083] Example 1. Efficient allelic substitution by geminivirus replicon.

[0084] A previous rice genome-wide association study (GWAS) demonstrated that phobic germination (PHS) resistance is caused by two single nucleotide polymorphisms (SNPs) and one intragenic delta (InDel) (Fig. 1). Therefore, we improved upon the existing method to accurately replace alleles present in the genome with elite alleles. First, we mutated the protospacer adjacent motif (PAM) site in the core sequence of the donor repair template (DRT) to prevent Cas9 / gRNA from leaving the DRT when HDR is successful. In addition, we created a recognition site for SnaBI in the DRT to create a marker that can identify HDR events. We synthesized a DRT for HDR by changing C to T at position 5 of the ERF1 gene and inserting two glycine units between positions 96 and 97, and constructed a Cas9-gemini replicon vector (Figs. 2, 3, and 4). Transformed calli for HDR were passaged three times on 2N6 medium containing 6 mg / L phosphinothricin. First, to confirm the introduction of the T-DNA region, PCR analysis using the primer set NOS-barF / R resulted in amplification of the expected size product in 95% of cases (Fig. 5). To confirm the HDR event, a total of 463 transformed calli were digested with SnaBI or deep-sequenced, and 12 calli showed the intended, precise HDR event (Fig. 6). In addition, most mutants showed the NHEJ mutation type at a frequency of 58.1% (Fig. 6). The HDR event T1 generation individual was selected for further study and analysis and named ERF1-hdr.

[0085]

[0086] Example 2. Enhancing HDR efficiency through heat shock treatment

[0087] In the present invention, in order to improve HDR efficiency, the OsERF1 (Os04g0546800) gene related to germination resistance was corrected under the conditions of ① geminivirus replicon vector system, ② Agrobacterium-mediated transformation method, and ③ cell cycle induction through heat shock treatment. For the HDR experiment, a geminivirus replicon vector was constructed in which three SNPs regions in the OsERF1 gene sequence were replaced, and 1,000 embryogenic calli derived from Dongjinbyeo were transformed. Then, the calli were heat-shocked at 42℃ for 2, 4, or 6 hours, respectively, and subcultured on a selection medium. First, the presence or absence of insertion of the T-DNA region was examined using a portion of the proliferated calli, and approximately 80% of the calli were found to be transformants. Deep sequencing analysis of transgenic calli to determine whether they exhibited HDR revealed that no HDR occurred in the 2- and 6-h heat shock treatment groups, but HDR occurred in four calli in the 4-h treatment group (Table 5). Analysis of the efficiency revealed that it was 1.49%, which is relatively higher than previously reported results (Kim JH et al., 2022).

[0088]

[0089] Subsequently, a repeat experiment was conducted in the 4-hour treatment group, which showed the highest HDR efficiency, and 463 calli were obtained through transformation. DNA was extracted from the transformed calli, digested with SnaBI, or deep-sequencing was performed. Of the 463 calli, 12 calli exhibited the intended, accurate HDR event.

[0090]

[0091] Example 3. Protein model according to 1-bp SNP and 6-bp insertion in the OsERF1 gene.

[0092] By examining the ERF1-hdr line, we discovered changes at the protein level that could explain the changes in ERF1 activity. By translating the HDR mutant sequence and aligning it with the wild-type ERF1, we were able to identify key functional residues. Homology modeling was used to determine the effect of the mutation on the enzyme structure and key functional residues (Fig. 7). The ERF1-hdr line has a TM change in the second amino acid residue of the ERF1 protein. Comparative models of the wild-type ERFI and ERF1-hdr versions suggest that the frameshift is important for Thr, which plays a role in stabilizing the catalytic triad and the catalytic center. 2 showed that it was caused by the replacement of residues. In addition, the wild-type ERF1 structure contained Gly 29 , Gly 30 , Gly 31 , Gly 32 In contrast to the ERF1 structure of the ERF1-hdr line, two peptide chains were added to the ERF1 structure. The ERF1-hdr line resulted in a significant difference in the ERF1 protein structure due to the effect of replacing one SNP and adding two Gly in the ERF1 motif domain. Therefore, the change in ERF1 activity in the ERF1-hdr line reflects the de novo acquisition of the regulatory C-terminal domain that determines the substrate specificity of the catalytic core.

[0093]

[0094] Example 4. Evaluation of PHS resistance of the ERF1-hdr line

[0095] To evaluate the PHS tolerance of the ERF1-hdr line, mature seeds were harvested at 35 DPA, and germination experiments were performed using Dongjin as a control (Fig. 8). Dongjin seeds began to germinate 4 days after soaking, with a germination rate of ~30% at 11 DAI (day after imbibition), whereas the ERF1-hdr line seeds germinated more slowly, with a germination rate of <10% at 11 DAI. In addition, germination rates were examined over time in the ERF1-hdr line and Dongjin after soaking with ABA and hydrogen peroxide at 35 DPA, respectively. As a result, the ERF1-hdr line germinated more slowly, with a germination rate of <10% at 15 DAI after ABA treatment, whereas the germination rate of the ERF1-hdr line improved after hydrogen peroxide treatment. Furthermore, after artificially breaking dormancy through heat shock treatment, the germination rates of the Dongjin and ERF1-hdr lines were nearly identical, at 97%. Furthermore, the seed survival rates of Dongjin and seeds naturally aged for 6 months were compared. As a result, the germination rate of Dongjin exceeded 86%, while that of the ERF1-hdr line was less than 73% (Fig. 9).

[0096]

[0097] Example 5. Evaluation of transcription levels of genes related to ABA, ethylene, and GA.

[0098] Since transcriptional reprogramming plays an important role in seed dormancy and PHS resistance, in this study, we investigated qRT-PCR analysis of 16 genes in the ABA, ethylene, and GA signaling pathways reported in rice so far. First, for ABA signaling-related genes, the expression levels of ABI3, ABI5, and Sdr4 were higher in the ERF1-hdr line than in Dongjin (Figs. 10, 11). In addition, for ethylene and GA signaling-related genes, the expression levels of EIN3, ERT1, GID1, and CTR1, excluding the EIN2 gene, were significantly lower in the ERF1-hdr line than in Dongjin (Figs. 10, 11).

[0099]

[0100] Example 6. Agricultural trait survey

[0101] To observe the growth of the ERF1-hdr line in the field, major agronomic characteristics such as plant height, culm length, panicle length, and number of tillers were investigated for 3 years (Fig. 12). The plant height, culm length, and number of tillers of the ERF1-hdr line were no different from those of Dongjin, but the panicle length (length of the ear) was approximately 4.8 cm shorter than that of Dongjin.

Claims

1. (a) A step of transforming Agrobacterium with a recombinant vector comprising a geminiviral replicon comprising an endonuclease protein coding sequence and a template DNA sequence for genome correction; (b) a step of co-culturing the transformed Agrobacterium with plant cells; and (c) A method for improving the efficiency of homology-directed repair in a plant, comprising the step of heat shock treating the co-cultured plant cells.

2. A method for improving efficiency, characterized in that the endonuclease of step (a) in paragraph 1 is an RNA-guided DNA endonuclease.

3. A method for improving efficiency, characterized in that the geminivirus replicon of step (a) in paragraph 1 includes a sequence encoding a guide RNA specific to the base sequence of the gene to be corrected.

4. A method for improving efficiency, characterized in that the heat shock treatment in step (c) in paragraph 1 is performed at a temperature of 40 to 44°C for 3 to 5 hours.

5. In paragraph 1, (a) a step of transforming Agrobacterium with a recombinant vector comprising a geminivirus replicon comprising an RNA-guided DNA endonuclease protein coding sequence, a sequence encoding a guide RNA specific for the base sequence of a gene to be corrected, and a template DNA sequence for genome correction; (b) a step of co-cultivating the transformed Agrobacterium with plant cells for 10 to 14 hours; and (c) A method for improving the efficiency of homologous linkage repair in plants, comprising the step of heat shocking the co-cultured plant cells at a temperature of 40 to 44°C for 3 to 5 hours.

6. A method for increasing efficiency, characterized in that the plant in paragraph 1 is a monocotyledonous plant.

7. A step of correcting the genome by introducing a recombinant vector containing a geminiviral replicon including a template DNA sequence consisting of the base sequence of SEQ ID NO: 4 for correcting the rice-derived ERF1 (Ethylene Response Factor 1) gene into a rice plant cell; and A method for producing a genome-corrected rice plant with enhanced pre-harvest sprouting resistance, comprising a step of redifferentiating the plant from the genome-corrected rice plant cell.

8. A manufacturing method according to claim 7, wherein the recombinant vector comprises an endonuclease protein coding sequence and a sequence encoding a guide RNA specific to the target base sequence of the rice-derived ERF1 gene.

9. A manufacturing method according to claim 8, characterized in that the target base sequence of the rice-derived ERF1 gene is SEQ ID NO: 2 and SEQ ID NO:

3.

10. A genome-edited rice plant with enhanced germination resistance manufactured by the method of Article 7.

11. Seeds in which the genome of a plant has been corrected according to Article 10.

Images