Methods of sorting sperm based on genotype

Abstract

The present disclosure provides a method of identifying a subset of sperm cells in a mixture of sperm cells. The method includes providing a plurality of oligonucleotides to the mixture of sperm cells, wherein the plurality of oligonucleotides binds to a target nucleic acid in the subset of sperm cells, and detecting the subset of sperm cells that are bound to the oligonucleotides.

Description

[0001] METHODS OF SORTING SPERM BASED ON GENOTYPE

[0002] TECHNICAL FIELD

[0003] The present disclosure relates to methods of sorting sperm based genotype using a binding agent to a genetic element within the sperm so as to enrich for sperm lacking a genetic mutation. The enriched sperm is used for fertilization with the objective of implantation and successful pregnancy.

[0004] DESCRIPTION OF RELATED ART

[0005] With a growing number of adults exploring information about their genetic health predispositions, many are uncovering results that can influence their decision to have biological children. For instance, a carrier of the genetic variant BRCA1 pre-disposes a cumulative breast cancer risk of 72%. See Kuchenbaecker, K.B., Hopper, J.L., Barnes, D.R., Phillips, K.-A., Mooij, T.M., Roos-Blom, M.-J., Jervis, S., Van Leeuwen, F.E., Milne, R.L., Andrieu, N., et al. (2017). Risks of Breast, Ovarian, and Contralateral Breast Cancer for BRCA1 and BRCA2 Mutation Carriers. JAMA 377, 2402. 10.1001 / jama.2017.7112. Or, a single mutation in the CFTR gene on its own may have little to no impact, but when two such mutated CFTR genes come together, it leads to an inevitable and severe diagnosis of cystic fibrosis. The development of preimplantation genetic testing gave parents the ability to prevent disease-causing genetic mutations from being passed on to their biological offspring. See De Rycke, M., and Berckmoes, V. (2020). Preimplantation Genetic Testing for Monogenic Disorders. Genes 11, 871.

[0006] 10.3390 / genesl 1080871. However, this capability comes with a steep cost and limited access, leaving out many who could benefit. This issue is especially pertinent now because more and more couples are seeking genetic guidance before conceiving, aiming to stop hereditary conditions from being passed down to their children. And many of these couples are taking the initiative to gather information themselves (see Mandelberger, A.H., Robins, J.C., Buster, J.E., Strohsnitter, W.C., and Plante, B.J. (2015). Preconception counseling: do patients learn about genetics from their obstetrician gynecologists? J Assist Reprod Genet 32, 1145-1149. 10.1007 / sl0815-015-0491-5) such as turning to Direct-To-Consumer (DTC) genetic tests like 23andMe, which only require a simple saliva sample (see Artin, M.G., Stiles, D., Kiryluk, K., and Chung, W.K. (2019). Cases in Precision Medicine: When Patients Present With Direct-to- Consumer Genetic Test Results. Ann Intern Med 170, 643. 10.7326 / MI 8-2356). Meaning, within a matter of weeks, for a one-time minimal fee anyone could find out they may be carrying a disease-causing mutation they do not want their children to inherit.

[0007] Parents who discover they carry disease-causing genetic variants and wish to prevent passing them on to their offspring currently have limited options. Some couples opt not to have children at all, while others explore options using healthy, biologically unrelated donor eggs or sperm. Alternatively, some couples take a chance and conceive naturally, only to confront a monumental decision if their unborn child does indeed inherit the specific mutation(s). Presently, the primary therapeutic avenue for addressing this challenge is preimplantation genetic testing for monogenic defects (PGT-M) during in vitro fertilization (IVF). See De Rycke, M., and Berckmoes, V. (2020). Preimplantation Genetic Testing for Monogenic Disorders. Genes 11, 871. 10.3390 / genesl 1080871. In this procedure, embryologists extract cells from the outer layer (the trophectoderm) of embryos around 5 to 6 days old. These embryos are then frozen while awaiting the sequencing outcomes from the analyzed cells. This approach focuses on the trophectoderm and not the inner layer (the epiblast), which ensures better viability of the biopsied embryo. However, given that each process is still invasive, certain research still suggests potential growth hindrances from trophectoderm biopsy. Moreover, post-conception chromosomal irregularities, which might affect epiblast cells but not the sequenced trophectoderm cells, further complicate matters. Some researchers have sought the less invasive method of sequencing the few embryo cells that have naturally sloughed off; however, these cells might not faithfully represent the true genotype of the embryo, introducing another layer of complexity to the situation. In addition, IVF was originally developed to address infertility, and carrying a genetic disorder doesn't necessarily imply infertility in the patient. In reality, only a small portion of individuals, around 10%, face fertility problems (see Chandra, A., and Stephen, E.H. (2013). Infertility and Impaired Fecundity in the United States, 1982-2010: Data From the National Survey of Family Growth), and even a smaller portion of these require IVF treatment to conceive. Thus, many more parents are undergoing IVF unnecessarily, primarily due to PGT-M being the sole available option. Therefore, a simpler approach is needed for couples whose only choice is currently PGT-M, even if they don’t have any inherent fertility issues.

[0008] PGT-M is carried out when the egg has already been fertilized with the sperm and an embryo is formed. A need exists to select for or otherwise enrich sperm lacking a particular genetic mutation, or to otherwise enrich for healthy sperm, so as to reduce the risk of the sperm used for fertilization contributing an inheritable disease to an embryo. Currently, sperm can be sorted in cases where disease prevalence exhibits sex-specific patterns. For instance, with X- linked hemophilia, a genetic bleeding disorder caused by mutations in genes located on the X chromosome, males are primarily affected because they inherit only one X chromosome, while females, who have two X chromosomes, can be carriers of the gene but usually do not show symptoms unless both X chromosomes carry the mutation. In addressing these cases, a technology known as sperm sex sorting has been developed, leveraging the efficacy of a Hoechst DNA dye. See Karabinus, D.S., Marazzo, D.P., Stem, H.J., Potter, D.A., Opanga, C.I., Cole, M.L., Johnson, L.A., and Schulman, J.D. (2014). The effectiveness of flow cytometric sorting of human sperm (MicroSort®) for influencing a child’s sex. Reprod Biol Endocrinol 72, 106. 10.1186 / 1477-7827- 12-106; Neculai-Valeanu, A.-S., and Ariton, A.M. (2021). Game-Changing Approaches in Sperm Sex-Sorting: Microfluidics and Nanotechnology. Animals 77, 1182. 10.3390 / anil 1041182; and Seidel, G.E. (2014). Update on sexed semen technology in cattle. Animal 8, 160-164. 10.1017 / S1751731114000202. This technique involves subjecting the stained sperm to a sorting machine capable of segregating X- and Y-bearing sperm on the basis of the 3% difference in total DNA between X- and Y-bearing sperm. Upon successful sorting, the desired subset of sperm is then harnessed for in utero insemination (IUI), a procedure wherein sperm is directly introduced into the uterus. Although this sex-sorting method has been in use for decades, its application in human contexts remains relatively limited. This reservation partly stems from the fact that even under the most optimized commercial circumstances, the success rate of sex-sorting remains modest. See Karabinus, D.S., Marazzo, D.P., Stern, H.J., Potter, D.A., Opanga, C.I., Cole, M.L., Johnson, L.A., and Schulman, J.D. (2014). The effectiveness of flow cytometric sorting of human sperm (MicroSort®) for influencing a child’s sex. Reprod Biol Endocrinol 72, 106. 10.1186 / 1477-7827-12-106. Moreover, ethical concerns surrounding the deliberate selection of offspring sex have prompted a number of countries to outright prohibit its use in human reproduction. See Bayefsky, M.J. (2016). Comparative preimplantation genetic diagnosis policy in Europe and the USA and its implications for reproductive tourism. Reproductive Biomedicine & Society Online 3, 41-47. 10.1016 / j.rbms.2017.01.001. It’s worth noting, however, that this technology has flourished within the domain of animal agriculture, particularly finding a niche in the dairy industry. See Seidel, G.E. (2014). Update on sexed semen technology in cattle. Animal 8, 160-164. 10.1017 / S 1751731114000202. Here, the imperative for female calves is evident, driving the utility of X-bearing sperm sorted through this technology. As advancements continue, ongoing research and innovation hold the promise of refining and expanding the applications of sperm sorting, potentially revisiting its role and reception within the realm of human reproductive options.

[0009] Recently a method of sperm sorting based on genotype was proposed - that of sorting carrier sperm with antibodies. See Adenmosun, O., Asghar, W., Matilsky, M., and Kumi-Diaka, J. (2022). P-090 Genotypic sperm sorting: A less invasive Assisted Reproductive Technology (ART) to prevent genetic disorders in newborns. Human Reproduction 37, deacl07.086. 10.1093 / humrep / deacl07.086. For this to work on a particular genetic disease, the mutation of interest must be expressed on the membrane surface in sperm cells, and the mutation must impart enough of a difference to the expressed protein to be able to design an antibody to specifically bind to the mutant versus normal version of the protein. Hence, this approach only works with a few genetic disorders, such as cystic fibrosis, so its use in the reproductive field is limited.

[0010] Accordingly, methods that allow sperm sorting based on genotypic characteristics for a broader spectrum of genetic disorders are needed to prevent disease-causing genetic mutations from being passed on to biological offspring.

[0011] SUMMARY OF THE INVENTION

[0012] The present disclosure provides a method of identifying a subset of sperm cells in a mixture of sperm cells. The method includes providing a plurality of oligonucleotides to the mixture of sperm cells, wherein the plurality of oligonucleotides binds to a target nucleic acid in the subset of sperm cells, and detecting the subset of sperm cells that are bound to the oligonucleotides. The target genetic element can be within the X-chromosome.

[0013] Aspects of the present disclosure are directed to methods of sorting live sperm based on the presence or absence of a genetic disorder. According to one aspect, the live sperm is of a species as described herein. According to one aspect, the live sperm is obtain from an animal capable of producing sperm, such as a mammal, reptile, bird, fish, etc. According to one aspect, the live sperm is mammalian sperm. According to one aspect, the live sperm is of a mammalian species as described herein. According to one aspect the mammalian sperm is human sperm (Homo sapiens).

[0014] According to one aspect, a sample of live sperm is contacted with a binding agent, such as a nucleic acid binding agent, selected to bind to a target genetic element, such as a target nucleic acid, within live sperm of the sample. The binding agent binds to the target genetic element within live sperm of the sample. Such live sperm with the bound binding agent are referred to herein as selected sperm. Such live sperm without the bound binding agent are referred to herein as non-selected sperm. The binding agent can then be used to sort or otherwise separate the selected live sperm with the bound binding agent from non-selected live sperm without the bound binding agent. According to one aspect, the separation of the selected live sperm from the nonselected live sperm from within a live sperm sample results in a first sample of live sperm enriched for the selected live sperm. According to one aspect, the separation of the selected live sperm from the non-selected live sperm results in a second sample of live sperm enriched for the nonselected live sperm. It is to be understood that further discussion of “sperm” to be subject to the separation methods within the present disclosure refers to live sperm. The term “live” sperm includes a functioning sperm cell insofar as cellular functions are being carried out. A live sperm cell is distinguished from a dead sperm cell where no cellular functions are being carried out. Those of skill in the art can readily distinguish between a live sperm cell and a dead sperm cell for purposes of the present disclosure.

[0015] According to one aspect, the target genetic element, such as a target nucleic acid, is associated with, a proxy for, or otherwise includes a mutation in a gene (“mutated gene”), compared to the normal gene without the mutation (“non-mutated gene”). It is to be understood that the target genetic element need not be a mutated nucleotide or nucleic acid (such as a mutated nucleotide (SNP) or mutated nucleic acid within a target gene, or chromosomal translocation or inversion), but can be an epigenetic element associated with a nucleic acid so as to serve as a proxy for the nucleic acid. Such an epigenetic element includes a methylated nucleotide, protein or proteins contacting DNA such as histones, or RNA, such as non-coding RNA. It is to be further understood that the target genetic element need not be within a gene of interest. The target genetic element may be upstream or downstream of the gene of interest.

[0016] According to one aspect, the target genetic element indicates the presence of a gene, such as a mutated gene. According to one aspect, the mutated gene is characteristic of a particular genetic disorder or disease. According to one aspect, the binding agent binds to the target genetic element associated with, as a proxy for, or otherwise including a particular mutated gene. The binding agent does not bind to a corresponding genetic element associated with the normal gene without the mutation (“non-mutated gene”). According to this aspect, the selected sperm with the bound binding agent includes the target genetic element associated with, a proxy for, or otherwise including a particular mutated gene. According to one aspect, the selected sperm is separated from the non-selected sperm to produce a sperm sample enriched in the non-selected sperm. The sperm sample enriched in the non-selected sperm may then be used for fertilization and embryogenesis. In this manner, the embryo lacks the particular mutated gene. According to one aspect, the sample of sperm has been subjected to the sorting procedure described herein and sperm including a particular mutated gene is removed. The remaining portion of the sample includes sperm lacking the particular mutated gene and is used for fertilization.

[0017] According to an aspect of the present disclosure, the target genetic element is associated with, a proxy for, or otherwise includes a normal gene or non-mutated gene, compared to the gene with the mutation (“mutated gene”). According to one aspect, the mutated gene is characteristic of a particular genetic disorder or disease. According to one aspect, the binding agent binds to the target genetic element associated with, a proxy for, or otherwise including a particular nonmutated gene. The binding agent does not bind to a corresponding genetic element associated with the mutated gene. According to this aspect, the selected sperm with the bound binding agent includes the target genetic element associated with, a proxy for, or otherwise including a particular normal or non-mutated gene. According to one aspect, the selected sperm is separated from the non-selected sperm to produce a sperm sample enriched in the selected sperm. The sperm sample enriched in the selected sperm may then be used for fertilization and embryo genesis. In this manner, the embryo lacks the particular mutated gene. According to one aspect, the sample of sperm has been subjected to the sorting procedure described herein and sperm including a particular non-mutated gene is removed. The sperm including the particular non-mutated gene is used for fertilization. The remaining portion of the sample includes sperm including the particular mutated gene. BRIEF DESCRIPTION OF DRAWINGS

[0018] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The foregoing and other features and advantages of the present embodiments will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings in which:

[0019] Fig. 1 shows a schematic diagram of identifying a target sequence within the genomic DNA of a living sperm cell according to an embodiment of the disclosure, (a) Designed ISH probe for use in identification and localization of specified genetic material, (b) Attachment onto probe, which may be fluorescent, fluorogenic, or another small molecule, (c) A small section of genomic DNA within a living sperm cell.

[0020] Fig. 2 shows a schematic diagram of identifying a target sequence within the genomic DNA of a living sperm cell according to an embodiment of the disclosure, (a) Designed TFO probe for use in identification and localization of specified genetic material, (b) Attachment onto probe, which may be fluorescent, fluorogenic, or another small molecule, (c) A small section of genomic DNA within a living sperm cell.

[0021] Fig. 3 shows a schematic diagram of identifying a target sequence within the genomic DNA of a living sperm cell according to an embodiment of the disclosure, (a) Designed PNA probe for use in identification and localization of specified genetic material, (b) Attachment onto probe, which may be fluorescent, fluorogenic, or another small molecule, (c) A small section of genomic DNA within a living sperm cell.

[0022] Fig. 4 is a schematic of probe localization within the X chromosome in bovine sperm in accordance with the methods described herein. Fig. 5A is an image analysis of unsorted sperm, with Hoechst facilitating nuclear visualization.

[0023] Fig. 5B is an image analysis of unsorted sperm transfected with the probe described herein, with Hoechst facilitating nuclear visualization.

[0024] Fig. 6A depict data from flow cytometry analyses of the addition of the probe on unsorted bovine sperm.

[0025] Fig. 6B depict data from flow cytometry analyses of the addition of the probe and Hoechst on unsorted bovine sperm.

[0026] Fig. 6C depict data from flow cytometry analyses of the addition of the probe and Hoechst on commercially sex sorted bovine sperm.

[0027] DETAILED DESCRIPTION

[0028] The practice of certain embodiments or features of certain embodiments may employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and so forth which are within ordinary skill in the art. Such techniques are explained fully in the literature. See e.g., Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition (1989), OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait Ed., 1984), ANIMAL CELL CULTURE (R. I. Freshney, Ed., 1987), the series METHODS IN ENZYMOLOGY (Academic Press, Inc ); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. M. Miller and M. P. Calos eds. 1987), HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, (D. M. Weir and C. C. Blackwell, Eds ), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Siedman, J. A. Smith, and K. Struhl, eds., 1987), CURRENT PROTOCOLS IN IMMUNOLOGY (J. E. coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991); ANNUAL REVIEW OF IMMUNOLOGY; as well as monographs in journals such as ADVANCES IN IMMUNOLOGY. All patents, patent applications, and publications mentioned herein, both supra and infra, are hereby incorporated herein by reference.

[0029] Terms and symbols of nucleic acid chemistry, biochemistry, genetics, and molecular biology used herein follow those of standard treatises and texts in the field, e.g., Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like.

[0030] It is to be understood that methods steps described herein need not be performed in the order listed unless expressly stated. Method steps may be performed in any order. Further, method steps may be performed simultaneously or together and need not be performed separately or individually. To the extent that methods describe multiple probes being hybridized to various nucleic acids on separate homologs, such hybridization may be performed as a single step with all reagents combined. Individual hybridization steps need not be performed individually.

[0031] The present disclosure provides a novel technique of sorting sperm based on genotypic characteristics, such as specific genetic differences in a target gene having one or more mutations compared to the target gene without the one or more mutations. The target gene having the one or more mutations is referred to herein as the “mutated gene” and the target gene lacking the one or more mutations is referred to herein as the “non-mutated gene”. The object of the methods described herein is to separate sperm including the mutated gene from sperm including the normal gene, so that only sperm with the normal gene can be used for fertilization. As a general example, a couple who wants to conceive discover they each carry an allele that predisposes their child to the occurrence of sickle cell anemia. With the methods described herein, sperm from the male partner can be sorted as normal sperm (healthy), away from carrier sperm (sperm that contains a mutation associated with sickle cell anemia) using a binding agent associated with a particular DNA region of interest in the sperm associated with sickle cell anemia. The sperm with the bound binding agent can be separated or sorted from the sperm without the binding agent. These sorted normal sperm lacking the mutated gene can then be used in IUI with the female partner to conceive of healthy offspring, negating the need to undergo IVF.

[0032] Accordingly, methods described herein can be used to select sperm with a reduced chance of transferring a heritable disease to offspring. Accordingly, methods described herein can be used to reduce chances of an embryo inheriting a gene associate with a particular disease, such as a heritable disease.

[0033] Methods described herein are directed to the use of a binding agent to a target genetic element. According to one aspect, exemplary binding agents, such as labels or probes, are selected to be compatible with a live sperm cell in being non-toxic to the live sperm cell. According to one aspect, exemplary binding agents are selected that are able to withstand degradation that may occur within a live sperm cell due to functioning cellular processes and chemicals, at least to the extent that the binding agents are capable of binding to a target genetic element, such as genomic DNA or an epigenetic feature of genomic DNA, though they may be degraded to a certain extent, i.e. are partially degraded. Binding agents also selected that are capable of targeting endogenous DNA or RNA which may be single stranded, double stranded or associated with proteins or other bound factors.

[0034] According to one aspect, the term “labeled probe” refers to both a single molecule including a binding agent such as a probe sequence and a label attached thereto, such as by covalent attachment, or a probe sequence and a separate label component which are added as separate species but then combine to form a labeled probe, such as by hybridization or ligand / ligand or binding pair / binding pair binding. Such an embodiment may be referred to as a secondary label. Wherever reference is made to hybridization of a labeled nucleotide, such hybridization may be accomplished with the labeled nucleotide or other labeled compound being part of a hybridization probe.

[0035] According to one aspect, the sperm of the subject disclosure is mammalian sperm. According to one aspect, the sperm is of a mammalian species as described herein. According to one aspect the mammalian sperm is human sperm (Homo sapiens). According to one aspect, the sperm is laboratory animal sperm, such as European rabbit sperm (Oryctolagus cuniculus), Brown rat or Norway rat sperm (Rattus norvegicus), rat sperm (Rattus raUus), mouse sperm (Mus miisciihis). guinea pig sperm (Cavia porcellus), Syrian or golden hamster sperm (Mesocricetus auratus), Dwarf hamster sperm (e.g., Phodopus sungorus), European rabbit sperm (Oryctolagus cuniculus), Rhesus macaque sperm (Macaca mulalla), Cynomolgus monkey or crab-eating macaque sperm (Macaca fascicular is), Squirrel monkey sperm (Saimiri sciiireus). Chimpanzee sperm (Pan troglodytes), Zebrafish sperm (Danio rerio), African clawed frog sperm (Xenopus laevis), Baboon sperm (e.g. Papio spp.), African green monkey or vervet sperm (Chlorocebus spp.), European ferret sperm (Mustela putorius furo) and the like. According to one aspect, the sperm is agricultural animal sperm, such as cattle sperm (Bos taurus), zebu sperm (Bos indicus), sheep sperm (Ovis aries), goat sperm (Capra aegagrus hircus), pig sperm (e.g. Sus scrofa domestica), horse sperm (Equus ferus caballus), Chicken sperm (Gallus gallus domesticus), donkey sperm (Equus africanus asinus), Water buffalo sperm (Bubalus bubalis), African buffalo sperm (Syncerus caffer), Dromedary or Arabian camel sperm (Camelus dromedarius), Bactrian camel sperm (Camelus bactrianus), Llama sperm (Lama glama), Alpaca sperm (Vicugna pacos), yak sperm (Bos grunniens), Red deer sperm (Cervus elaphus), Fallow deer sperm (Dama dama), Reindeer sperm (Rangifer tarandus) and the like. According to one aspect, the sperm is mammalian domestic species such as dog sperm (e.g. Canis lupus familiaris), cat sperm (e.g. Felis catus) and the like. According to one aspect, sperm is from endangered or at risk of being endangered species (including extinct species) such as Sumatran tiger sperm (Panthera tigris sumatrae), Amur leopard sperm (Panthera pardus orientalis), Black rhinoceros sperm (Diceros bicornis), Javan rhinoceros sperm (Rhinoceros sondaicus), Mountain gorilla sperm (Gorilla beringei beringei), Bornean orangutan sperm (Pongo pygmaeus), Sumatran orangutan sperm (Pongo abelii), Giant panda sperm (Ailuropoda melanoleuca). Snow leopard sperm (Panthera uncia), Sumatran elephant sperm (Elephas maximus siimalranus). African wild dog sperm (Lycaon piclus). Blue whale sperm (Balaenoptera musciihis). Red wolf sperm (Canis riifiis). Saola sperm (Pseudoryx nghelinhensis). cheetah sperm (Acinonyx jubatus) and the like.

[0036] I. HERITABLE DISEASES

[0037] Heritable diseases associated with genetic abnormalities in a human or nonhuman mammal are known in the art, are readily identified by literature search, and / or may be identified by etiology. While some disorders are environmental -caused, there are thousands of known, heritable genetic disorders that could be identified for a particular individual and could be identified as creating a risk of passing to progeny. Each heritable disorder of the methods described herein has one or more cognate target genetic elements associated therewith. Target genetic elements, such as nucleotide mutations, nucleic acid mutations or epigenetic features, associated with a gene characteristics of a heritable disease are known in the art, are readily identified by literature search, and / or may be identified by known methods.

[0038] The methods of the present disclosure recognize that although each single disease might be rare in occurrence, it’s estimated 1 in 17 people are affected from a genetic disorder. See Jackson, M., Marks, L., May, G.H.W., and Wilson, J.B. (2018). The genetic basis of disease. Essays in Biochemistry 62, 643-723. 10.1042ZEBC20170053. With help from genetic counselors and take-home genetic tests such as 23andMe, patients are becoming more informed of their genetics, including any recessive carrier genes that, if combined with another recessive gene, could lead to an inherited disorder. To date, there are over 600 genetic disorders that couples can select against in PGT-M, with indications that this number will continue to rise. See Parikh, F., Athalye, A., Kulkarni, D., Sanap, R., Dhumal, S., Warang, D., Naik, D., and Madon, P. (2021). Evolution and utility of preimplantation genetic testing for monogenic disorders in assisted reproduction - A narrative review. J Hum Reprod Sci 14, 329. 10.4103 / jhrs.jhrs_148_21. A majority of these are single nucleotide polymorphisms, though some are as large as chromosomal translocations.

[0039] Exemplary heritable diseases include monogenic disorders such as those where the nuclear loci may have an autosomal dominant inheritance pattern with a 50% risk of transmitting the gene mutation to the progeny, e.g., Huntington disease or hereditary cancers due to pathogenic variations in genes such as breast cancer 1 (BRCA1), BRCA2, adenomatous polyposis coli, ataxia telangiectasia mutated, MutL homolog 1 (MLH1) and MutS homolog 2 (MLH2). Autosomal recessive disorders have a 25% risk of recurrence in each pregnancy as in beta-thalassaemia and sickle cell anaemia, while X-linked recessive disorders such as Duchenne muscular dystrophy (DMD), haemophilia, adrenoleukodystrophy and fragile-X syndrome have a 50% chance of males being affected and a 50% chance of females being carriers. X-linked dominant disorders include Rett syndrome, X-linked lissencephacy and double-cortex syndrome. Y-linked (Holandric) disorders include hypertrichosis. Other exemplary heritable diseases include chromosomal translocations which occur due to reciprocal translocations, nonreciprocal translocations, Robertsonian translocations, and the like. Disorders include Alagille syndrome. Other exemplary heritable diseases include chromosomal duplications or deletions such as Trisomy 21, Trisomy 18, Trisomy 13, Turner syndrome, and Triple X syndrome. These also include the disorders occurring from uniparental disomy (UPD) where two copies of a chromosome are inherited from one parent, and zero copies from the other parent. Other exemplary heritable diseases include mitochondrial disorders, where mutations occur in the mitochondrial DNA. Mitochondrial disorders include Leber hereditary optic neuropathy (LHON) and Neuropathy, ataxia, and retinitis pigmentosa (NARP). Of note, mitochondrial disorders can also occur from mutations in nuclear loci, such as Carnitine palmitoyltransferase I deficiency, Carnitine palmitoyltransferase II deficiency, HSD10 disease, and MPV17-related hepatocerebral mitochondrial DNA depletion syndrome. Other exemplary heritable diseases include epigenetic disorders, such as Angelman’s syndrome and Prader-Willin syndrome. These disorders may be caused by a single known variant, or a multitude of variants that cause the disorder. There are other types of inheritance patterns of disorders including codominance, incomplete dominance, locus heterogenetity, allelic heterogeneity, phenotypic heterogeneity, anticipation (the likelihood of a genetic disorder to occur, such as is common in Huntington’s Disease), digenic inheritance (including any and all forms of polygenic inheritance, where two or more mutations result in the disorder), mosaicism and epistasis. The genetic disorder need not occur within a gene, and may be in any number of other genetic elements such as the promoter, genomic exons, genomic introns, untranslated 5’ region (5’ UTR), untranslated 3’ region (3’ UTR), enhancers, silencers, regulatory RNAs (including including mRNA, noncoding, microRNAs, small interfering RNAs, long non-coding RNAs, circRNA and the like), repetitive DNA sequences (including short tandem repeats, microsatellites and transposable elements and the like), centromeres, telomeres, pseudogenes, imprinted regions, insulators, and the like. Other disorders include achondroplasia, cystic fibrosis, epidermolysis bullosa, Tay-Sachs disease, ichthyosis, long QT syndrome, mucopolysaccharidosis, osteogenesis imperfecta, phenylketonuria, polycystic kidney disease, retinoblastoma, retinitis pigmentosa, Rett syndrome, spinal muscular atrophy, spinocerebellar ataxia, tuberous sclerosis RhD blood typing, Marfan syndrome, ornithine transcarbamylase deficiency, myotinic dystrophy, muscular dystrophy, haemoglobinopathy, solid tumor, immunodeficiency, immune disorder, haematological disorder, Franconi anaemia, adrenoleukodystrophy, polycystic kidney disease, endocrine diseases, mitochondrial disorders, heritable cancer, neurofibromatosis, Leigh syndrome, Norrie’s Disease, retinoblastoma, cardiac disorders, propionic academia, hereditary inclusion body myopathy, Huntington chorea, G6PD deficiency and Usher syndrome. See Parikhy, et al., J. Human Reproductive Sciences, Vol. 14, Issue 4, October-December 2021, PP. 330-339 hereby incorporated by reference in its entirety for the teaching of heritable diseases contemplated by the present disclosure.

[0040] II. TARGET GENETIC ELEMENT

[0041] According to one aspect, the target genetic element includes a hereditary element associated with, a proxy for or, or otherwise including a nucleic acid mutation or nucleotide mutation characteristic of a mutated gene. A hereditary element is an element that can be inherited by progeny from a parent. This element need not be in all cells of the parent, such as in cases of mosaicism and de novo mutations. The target genetic element can also be the X-chromosome. According to one aspect, the present disclosure provides methods that can sort sperm on the genetic basis of hereditary element(s) within sperm. A target genetic element includes a single nucleotide, an oligonucleotide, a nucleic acid, a chromosomal translocation, an entire chromosome, methylated nucleotide or nucleotides, epigenetic proteins such as histones, other proteins, noncoding RNA and the like. Such target genetic elements include single nucleotide polymorphisms (SNPs), repeat elements, RNA (including mRNA, noncoding, microRNA, small interfering RNA, long non-coding RNA, circRNA and the like). In addition, the genetic elements can also be within mitochondrial DNA. Target genetic elements include epigenetic proteins and other proteins associated or otherwise with a heritable disease. According to one aspect, a target genetic element can be detected by being bound by a binding agent for the target genetic element. The target genetic element can be present in one or multiple copies. According to one aspect, more than one genetic element can be targeted at a time.

[0042] Target genetic elements can be identified from known gene mutations, known methylation patterns, known epigenetic factors, and the like. Target genetic elements can be identified by sequencing genes believed to be responsible for a heritable disease and / or otherwise identifying methylation patterns and epigenetic factors, and the like, associated with a heritable disease. Target genetic elements include probes, such as oligonucleotide probes, capable of binding to a nucleic acid sequence associated with, a proxy for, or otherwise including a particular mutated gene, should the method be directed to using the binding agent to separate out sperm with the heritable disease. According to the present disclosure, the target genetic element can be associated with, a proxy for, or otherwise including a nonmutated element, should the method be directed to using the binding agent to separate out sperm without the heritable disease.

[0043] Exemplary target genetic elements include single nucleotide variants in autosome chromosomes, such as the Glu7Val missense mutation (nucleotide T changed to A) in the HBB gene which can lead to sickle cell anemia, the Phe508del deletion mutation in the CFTR gene which can lead to cystic fibrosis. Exemplary target genetic elements include single nucleotide variants in sex chromosomes, such as the L203P missense mutation (608T>C) in the gene Factor 8 which can lead to hemophilia A, most commonly in males. Target genetic elements can include repetitive elements, such as the extended CAG repeats in the HTT gene which can lead to Huntington’s Disease. Target genetic elements can include chromosomal duplication events, such as duplication of chromosome 21 which can lead to Trisomy 21 or duplication of chromosome X which can lead to Triple X syndrome. Target genetic elements can also include inter-gene variants, such as deletion of a PAX6 enhancer can lead to Aniridia. Target genetic elements can also include large deletions or insertions, such as the deletion of a part of chromosome 22 (22ql l.2) which can lead to DiGeorge syndrome. The target genetic element can be dependent on epigenetic patterning, such as in Prader-Willi and Angelman syndromes.

[0044] III. BINDING AGENT TO THE TARGET GENETIC ELEMENT

[0045] The present disclosure provides a binging agent to a target genetic element. Exemplary binding agents for target genetic elements include an oligonucleotide probe, a molecular beacon, an in-situ hybridization probe, a triplex forming oligonucleotide, a peptide nucleic acid, and the like. According to one aspect, the binding agent may include a label that allows detection of the bound binding agent to a target genetic element within sperm and / or separation of the sperm with the target genetic element having the binding agent bound thereto. According to one aspect, the binding agent is used to label sperm including the target genetic element, and to distinguish the labeled sperm from nonlabeled sperm. The target genetic element may be the X-chromosome, which is useful in separating sperm including the X-chromosome from sperm lacking the X- chromosome. According to one aspect, the binding agent is used to label sperm including the target genetic element, and to distinguish and / or separate the labeled sperm from nonlabeled sperm. According to one aspect, the target genetic element may be associated with, a proxy for or, or otherwise including a nucleic acid mutation or nucleotide mutation characteristic of a mutated gene characteristic of a heritable disease. The binding agent may label such a target genetic element and therefore sperm capable of passing a heritable disease. Such sperm may be separated from sperm which do not pass the heritable disease, based on the presence of the binding agent or label. According to one aspect, the target genetic element may be associated with, a proxy for or, or otherwise including a nucleic acid lacking a nucleotide mutation characteristic of a mutated gene characteristic of a heritable disease, i.e. a normal nonmutated nucleic acid. The binding agent may label such a target genetic element and therefore sperm not capable of passing a heritable disease. Such sperm may be separated from sperm which pass the heritable disease, based on the presence of the binding agent or label.

[0046] According to one aspect, a first binding agent can be used to bind to a target genetic element associated with, a proxy for or, or otherwise including a nucleic acid mutation or nucleotide mutation characteristic of a mutated gene. According to one aspect, a second binding agent can be used to bind to a target genetic element associated with, a proxy for or, or otherwise including a nucleic acid lacking a mutation or nucleotide mutation characteristic of a mutated gene. In this manner, sperm capable of passing a heritable disease are labeled and sperm not capable of passing the heritable disease are labeled. The sperm capable of passing a heritable disease and the sperm not capable of passing the heritable disease are separated based on the presence of the respective binding agent or label. A. Oligonucleotide Probes

[0047] According to one aspect, a binding agent can be an oligonucleotide probe, such as oligonucleotide probes described in US2014 / 0364333 hereby incorporated by reference in its entirety and as set forth herein. In certain exemplary embodiments, an oligonucleotide probe is a length of nucleotides designed to bind or hybridize to a target nucleic acid sequence. An oligonucleotide probe can be of between about 5 bases and about 100 bases long, between about 5 to about 10 bases, between about 5 to about 15 bases, between about 5 to about 20 bases, between about 5 to about 25 bases, between about 5 to about 30 bases, between about 5 to about 35 bases, between about 5 to about 40 bases, between about 5 to about 45 bases, between about 5 to about 50 bases, between about 5 to about 55 bases, between about 5 to about 60 bases, between about 5 to about 65 bases, between about 5 to about 70 bases, between about 5 to about 75 bases, between about 5 to about 80 bases, between about 5 to about 85 bases, between about 5 to about 90 bases, or between about 5 to about 95 bases. According to one aspect, oligonucleotide probes described herein can pass into a sperm cell, can pass into the nucleus, and / or can hybridize with nucleic acid targets, or target nucleic acids that are partially bound by one or more proteins, etc. Such unbound oligonucleotide probes can be washed away so as to reduce background detection. As used herein, the term target nucleic acid refers to a target nucleotide sequence (e.g., a nucleic acid sequence including a SNP or other mutation, inversion or translocation if the target is the mutated gene, or a normal nonmutated nucleic acid sequence if the target is the nonmutated gene) or region of a target nucleotide sequence (e.g., a sub- chromosomal region), respectively, that has hybridized thereto one or more oligonucleotide probes.

[0048] According to one aspect, a probe can include a peptide sequence that aids entry into a cell. Such peptide sequences are known to those of skill in the art and include one or more nuclear localization signals or sequences (see Lu et al., Cell Commun Signal, 2021, 19:60) and one or more a cell-penetrating peptides (see Patel et al., Scientific Reports (2019) 9:6298), an exemplary exemplary cell penetrating peptide being a Tat cell-penetrating peptide, an example of which is YGRKKRRQRRR. According to one aspect, the probe can also include a label as further described herein, such as a detectable label. According to one aspect, the nucleic acid hybridizing portion of the probe can be modified to include one or more peptide nucleic acids.

[0049] The terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” “oligonucleotide” and “polynucleotide” are used interchangeably and are intended to include, but not limited to, a polymeric form of nucleotides that may have various lengths, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The labeled probes described herein may include or be a “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” “oligonucleotide” or “polynucleotide.” Oligonucleotides or polynucleotides useful in the methods described herein may comprise natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or a combination of such sequences. Oligonucleotides or polynucleotides may be single stranded or double stranded.

[0050] A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA). Thus, the term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule; alternatively, the term may be applied to the polynucleotide molecule itself. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. Polynucleotides may optionally include one or more non-standard nucleotide(s), nucleotide analog(s) and / or modified nucleotides.

[0051] The terms “nucleotide analog,” “altered nucleotide” and “modified nucleotide” refer to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. In certain exemplary embodiments, nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide yet retain the ability of the nucleotide analog to perform its intended function. Examples of positions of the nucleotide which may be derivitized include the 5 position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine, 5- propyne uridine, 5-propenyl uridine, etc.; the 6 position, e.g., 6-(2-amino) propyl uridine; the 8- position for adenosine and / or guanosines, e.g., 8-bromo guanosine, 8-chloro guanosine, 8- fluoroguanosine, etc. Nucleotide analogs also include deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyl adenosine, or as otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0052] Nucleotide analogs may also comprise modifications to the sugar portion of the nucleotides. For example the 2' OH-group may be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NEE, NHR, NR2, COOR, or OR, wherein R is substituted or unsubstituted Ci-Ce alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Pat. Nos. 5,858,988, and 6,291,438.

[0053] The phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev . 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev . 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and U.S. Pat. No. 5,684,143. Certain of the above-referenced modifications (e.g., phosphate group modifications) decrease the rate of hydrolysis of, for example, polynucleotides comprising said analogs in vivo or in vitro.

[0054] Examples of modified nucleotides include, but are not limited to diaminopurine, S2T, 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4- acetyl cytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5- oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, 2,6- diaminopurine and the like. Nucleic acid molecules may also be modified at the base moiety (e.g., at one or more atoms that typically are available to form a hydrogen bond with a complementary nucleotide and / or at one or more atoms that are not typically capable of forming a hydrogen bond with a complementary nucleotide), sugar moiety or phosphate backbone. Nucleic acid molecules may also contain amine-modified groups, such as aminoallyl-dUTP (aa- dUTP) and aminohexhylacrylamide-dCTP (aha-dCTP) to allow covalent attachment of amine reactive moieties, such as N-hydroxy succinimide esters (NHS).

[0055] Non-naturally occurring nucleotides and polymerases which can be used with such bases include those described in Gommers-Ampt et al., The FASEB Journal, Vol. 9, pp. 1034-1042 (1995); Leconte, et al., J. Am. Chem. Soc, 127(36), pp. 12470-12471 (2005); Leconte et al., Angew. Chem. Int. Ed. 2010, 49, pp. 5921-5924; Malyshev et al., J. Am. Chem. Soc. 2009, 131, 14620-14621; Metzker, Genome Research 15: 1767-1776 (2005); Metzker, Nature Reviews / Genetics, Vol. 11, pp. 31-46 (2010); and Yang et al., Angew. Chem. Int. Ed, 2010, 49, 177-180 each of which is hereby incorporated by reference in its entirety for all purposes.

[0056] In certain exemplary embodiments, nucleotide analogs or derivatives will be used, such as nucleosides or nucleotides having protecting groups on either the base portion or sugar portion of the molecule, or having attached or incorporated labels, or isosteric replacements which result in monomers that behave in either a synthetic or physiological environment in a manner similar to the parent monomer. The nucleotides can have a protecting group which is linked to, and masks, a reactive group on the nucleotide. A variety of protecting groups are useful in the invention and can be selected.

[0057] Oligonucleotide sequences, such as single stranded oligonucleotide sequences to be used for labeled probes, may be isolated from natural sources, synthesized or purchased from commercial sources. In certain exemplary embodiments, oligonucleotide sequences may be prepared using one or more of the phosphoramidite linkers and / or sequencing by ligation methods known to those of skill in the art. Oligonucleotide sequences may also be prepared by any suitable method, e.g., standard phosphoramidite methods such as those described herein below as well as those described by Beaucage and Carruthers ((1981) Tetrahedron Lett. 22: 1859) or the triester method according to Matteucci et al. (1981) J. Am. Chem. Soc. 103:3185), or by other chemical methods using either a commercial automated oligonucleotide synthesizer or high-throughput, high-density array methods known in the art (see U.S. Patent Nos. 5,602,244, 5,574,146, 5,554,744, 5,428,148, 5,264,566, 5,141,813, 5,959,463, 4,861,571 and 4,659,774, incorporated herein by reference in its entirety for all purposes). Pre-synthesized oligonucleotides may also be obtained commercially from a variety of vendors.

[0058] In certain exemplary embodiments, oligonucleotide sequences may be prepared using a variety of microarray technologies known in the art. Pre-synthesized oligonucleotide and / or polynucleotide sequences may be attached to a support or synthesized in situ using light-directed methods, flow channel and spotting methods, inkjet methods, pin-based methods and bead-based methods set forth in the following references: McGall et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93: 13555; Synthetic DNA Arrays In Genetic Engineering, Vol. 20: 111, Plenum Press (1998); Duggan et al. (1999) Nat. Genet. S21 : 10; Microarrays: Making Them and Using Them In Microarray Bioinformatics, Cambridge University Press, 2003; U.S. Patent Application Publication Nos. 2003 / 0068633 and 2002 / 0081582; U.S. Patent Nos. 6,833,450, 6,830,890, 6,824,866, 6,800,439, 6,375,903 and 5,700,637; and PCT Application Nos. WO 04 / 031399, WO 04 / 031351, WO 04 / 029586, WO 03 / 100012, WO 03 / 066212, WO 03 / 065038, WO 03 / 064699,

[0059] WO 03 / 064027, WO 03 / 064026, WO 03 / 046223, WO 03 / 040410 and WO 02 / 24597.

[0060] Polymerase recognition sites, cleavage sites and / or label or detectable moiety addition sites may be added to the single stranded oligonucleotides during synthesis using known materials and methods.

[0061] Nucleic acid probes according to the present disclosure may be labeled or unlabeled. Certain nucleic acid probes may be directly labeled or indirectly labeled.

[0062] According to certain aspects, nucleic acid probes may include a primary nucleic acid sequence that is non-hybridizable to a target nucleic acid sequence in addition to the sequence of the probe that hybridizes to the target nucleic acid sequence. Exemplary primary nucleic acid sequences or target non-hybridizing nucleic acid sequences include between about 10 nucleotides to about 100 nucleotides, between about 10 nucleotides to about 70 nucleotides, between about 15 nucleotides to about 50 nucleotides, between about 20 nucleotides to about 60 nucleotides and all ranges and values in between whether overlapping or not.

[0063] According to certain aspects, the primary nucleic acid sequence is hybridizable with one or more secondary nucleic acid sequences. According to certain aspects, the secondary nucleic acid sequence may include a label. According to this aspect, the nucleic acid probes are indirectly labeled as the secondary nucleic acid binds to the primary nucleic acid thereby indirectly labeling the probe which hybridizes to the target nucleic acid sequence. According to certain aspects, a plurality of nucleic acid probes is provided with each having a common primary nucleic acid sequence. That is, the primary nucleic acid sequence is common to a plurality of nucleic acid probes, such that each nucleic acid probe in the plurality has the same or substantially similar primary nucleic acid sequence. According to one aspect, the primary nucleic acid sequence is a single sequence species. In this manner, a plurality of common secondary nucleic acid sequences is provided which hybridize to the plurality of common primary nucleic acid sequences. That is, each secondary nucleic acid sequence has the same or substantially similar nucleic acid sequence. According to one exemplary embodiment, a single primary nucleic acid sequence is provided for each of the nucleic acid probes in the plurality. Accordingly, only a single secondary nucleic acid sequence which is hybridizable to the primary nucleic acid sequence need be provided to label each of the nucleic acid probes. According to certain aspects, the common secondary nucleic acid sequences may include a common label. According to this aspect, a plurality of nucleic acid probes are provided having substantially diverse nucleic acid sequences hybridizable to different target nucleic acid sequences and where the plurality of nucleic acid probes have common primary nucleic acid sequences. Accordingly, a common secondary nucleic acid sequence having a label may be used to indirectly label each of the plurality of nucleic acid probes. According to this aspect, a single or common primary nucleic acid sequence and secondary nucleic acid sequence pair can be used to indirectly label diverse nucleic acid probe sequences. Such an embodiment is provided where a plurality of nucleic acid probes having primary nucleic acid sequences are commercially synthesized, such as on an array. Labeled secondary nucleic acid sequences can also be commercially synthesized so that they are hybridizable with the primary nucleic acid sequences. The nucleic acid probes may be combined with the labeled secondary nucleic acids and one or more or a plurality of target nucleic acid sequences under conditions such that the nucleic acid probe or probes hybridize to the target nucleic acid sequence or sequences while the primary nucleic acid sequence is nonhybridizable to the target nucleic acid sequence or sequences. A labeled secondary nucleic acid sequence hybridizes with a corresponding primary nucleic acid sequence to indirectly label the nucleic acid probe, thereby labeling the target nucleic acid sequence. According to one aspect, the nucleic acid probes may be combined with the labeled secondary nucleic acids and one or more or a plurality of target nucleic acid sequences together in a one pot method. According to one aspect, the nucleic acid probes may be combined with the labeled secondary nucleic acids and one or more or a plurality of target nucleic acid sequences sequentially, such as the nucleic acid probes are combined with the target nucleic acid to form a mixture and then the labeled secondary nucleic acid is combined with the mixture or the nucleic acid probes are combined with the labeled secondary nucleic acids to form a mixture and then the target nucleic acid is combined with the mixture.

[0064] According to certain aspects, the primary nucleic acid sequence is modifiable with one or more labels. According to this aspect, one or more labels may be added to the primary nucleic acid sequence using methods known to those of skill in the art.

[0065] According to an additional embodiment, nucleic acid probes may include a first half of a ligand-ligand binding pair, such as biotin-avidin. Such nucleic acid probes may or may not include a primary nucleic acid sequence. The first half of a ligand-ligand binding pair may be attached directly to the nucleic acid probe. According to certain aspects, a second half of the ligand-ligand binding pair may include a label. Accordingly, the nucleic acid probe may be indirectly labeled by the use of a ligand-ligand binding pair. According to certain aspects, a common ligand-ligand binding pair may be used with a plurality of nucleic acid probes of different nucleic acid sequences. Accordingly, a single species of ligand-ligand binding pair may be used to indirectly label a plurality of different nucleic acid probe sequences. The common ligand-ligand binding pair may include a common label or a plurality of common ligand-ligand binding pairs may be labeled with different labels. Accordingly, a plurality of nucleic acid probes of different nucleic acid sequences may be labeled with a single species of label using a single species of a ligand-ligand binding pair.

[0066] According to one aspect, the primary nucleic acid sequences may include one or more subsequences that are hybridizable with one or more different secondary nucleic sequences. The one or more secondary nucleic acid sequences may include one or more subsequences that hybridize with one or more tertiary nucleic acid sequences, and so on. Each of the primary nucleic acid sequences, the secondary nucleic acid sequences, the tertiary nucleic acid sequences and so on may be directly labeled with a label or may be indirectly labeled with a label. In this manner, an exponential labeling of the nucleic acid probe can be achieved. A label according to the present disclosure includes a functional moiety directly or indirectly attached or conjugated to a nucleic acid which provides a desired function. According to certain aspects, a label may be used for detection. Detectable labels or moieties are known to those of skill in the art. According to certain aspects, a label may be used to retrieve a particular molecule. Retrievable labels or moieties are known to those of skill in the art. According to certain aspects, a label may be used to target a particular molecule to a target nucleic acid of interest for a desired function. Targeting labels or moieties are known to those of skill in the art. According to certain aspects, a label may be used to react with a target nucleic acid of interest. Reactive labels or moieties are known to those of skill in the art. According to certain aspects, a label may be an antibody, ligand, hapten, radioisotope, therapeutic agent and the like, as is known in the art.

[0067] As used herein, the term “retrievable moiety” refers to a moiety that is present in or attached to a polynucleotide that can be used to retrieve a desired molecule or factors bound to a desired molecule (e.g., one or more factors bound to a targeting moiety). As used herein, the term “retrievable label” refers to a label that is attached to a polynucleotide and can, optionally, be used to specifically and / or nonspecifically bind a target protein, peptide, DNA sequence, RNA sequence, carbohydrate or the like at or near the nucleotide sequence to which one or more oligonucleotide probes have hybridized. In certain aspects, target proteins include, but are not limited to, proteins that are involved with gene regulation such as, e.g., proteins associated with chromatin (See, e.g., Dejardin and Kingston (2009) Cell 136: 175), proteins that regulate (upregulate or downregulate) methylation, proteins that regulate (upregulate or downregulate) histone acetylation, proteins that regulate (upregulate or downregulate) transcription, proteins that regulate (upregulate or downregulate) post-transcriptional regulation, proteins that regulate (upregulate or downregulate) RNA transport, proteins that regulate (upregulate or downregulate) mRNA degradation, proteins that regulate (upregulate or downregulate) translation, proteins that regulate (upregulate or downregulate) post-translational modifications and the like, as is known in the art.

[0068] As used herein, the term “targeting moiety” refers to a moiety that is present in or attached to a polynucleotide that can be used to specifically and / or nonspecifically bind one or more factors that associate with, modify or otherwise interact with a nucleic acid sequence of interest (e.g., DNA (e.g., nuclear, mitochondrial, transfected and the like) and / or RNA), including, but not limited to, a protein, a peptide, a DNA sequence, an RNA sequence, a carbohydrate, a lipid, a chemical moiety or the like at or near the nucleotide sequence of interest to which the polynucleotide has hybridized. In certain aspects, factors that associate with a nucleic acid sequence of interest include, but are not limited to histone proteins (e.g., Hl, H2A, H2B, H3, H4 and the like, including monomers and oligomers (e.g., dimers, tetramers, octamers and the like)) scaffold proteins, transcription factors, DNA binding proteins, DNA repair factors, DNA modification proteins (e.g., acetylases, methylases and the like), as is known in the art.

[0069] In other aspects, factors that associate with, modify or otherwise interact with a nucleic acid sequence of interest are proteins including, but not limited to, proteins that are involved with gene regulation such as, e.g., proteins associated with chromatin (See, e.g., Dejardin and Kingston (2009) Cell 136: 175), proteins that regulate (upregulate or downregulate) methylation, proteins that regulate (upregulate or downregulate) acetylation, proteins that regulate (upregulate or downregulate) histone acetylation, proteins that regulate (upregulate or downregulate) transcription, proteins that regulate (upregulate or downregulate) post-transcriptional regulation, proteins that regulate (upregulate or downregulate) RNA transport, proteins that regulate (upregulate or downregulate) mRNA degradation, proteins that regulate (upregulate or downregulate) translation, proteins that regulate (upregulate or downregulate) post-translational modifications and the like.

[0070] In certain aspects, a targeting and / or retrievable moiety is activatable. As used herein, the term “activatable” refers to a targeting and / or retrievable moiety that is inert (i.e., does not bind a target) until activated (e.g., by exposure of the activatable, targeting and / or retrievable moiety to light, heat, one or more chemical compounds or the like). In other aspects, a targeting and / or retrievable moiety can bind one or more targets without the need for activation of the targeting and / or retrievable moiety. Exemplary methods for attaching proteins, lipids, carbohydrates, nucleic acids and the like are known to those of skill in the art. In certain aspects, a targeting moiety can be a non-targeting moiety that is cross-linked or otherwise modified to bind one or more factors that associate with, modify or otherwise interact with a nucleic acid sequence.

[0071] In certain exemplary embodiments, a targeting moiety, a retrievable moiety and / or polynucleotide has a detectable label bound thereto. As used herein, the term “detectable label” refers to a label that can be used to identify a target (e.g., a factor associated with a nucleic acid sequence of interest, a chromosome or a sub-chromosomal region). Typically, a detectable label is attached to the 3'- or 5'-end of a polynucleotide. Alternatively, a detectable label is attached to an internal portion of an oligonucleotide. Detectable labels may vary widely in size and compositions; the following references provide guidance for selecting oligonucleotide tags appropriate for particular embodiments: Brenner, U.S. Patent No. 5,635,400; Brenner et al., Proc. Natl. Acad. Set., 97: 1665; Shoemaker et al. (1996) Nature Genetics, 14:450; Morris et al., EP Patent Pub. 0799897A1; Wallace, U.S. Patent No. 5,981,179; and the like.

[0072] Methods for incorporating detectable labels into nucleic acid probes are well known. Typically, detectable labels (e.g., as hapten- or fluorochrome-conjugated deoxyribonucleotides) are incorporated into a nucleic acid, such as a nucleic acid probe during a polymerization or amplification step, e.g., by PCR, nick translation, random primer labeling, terminal transferase tailing (e.g., one or more labels can be added after cleavage of the primer sequence), and others (see Ausubel et al., 1997, Current Protocols In Molecular Biology, Greene Publishing and Wiley- Interscience, New York).

[0073] In certain aspects, a suitable targeting moiety, retrievable moiety or detectable label includes, but is not limited to, a capture moiety such as a hydrophobic compound, an oligonucleotide, an antibody or fragment of an antibody, a protein, a peptide, a chemical crosslinker, an intercalator, a molecular cage (e.g., within a cage or other structure, e.g., protein cages, fullerene cages, zeolite cages, photon cages, and the like), or one or more elements of a capture pair, e.g., biotin-avidin, biotin-streptavidin, NHS-ester and the like, a thioether linkage, static charge interactions, van der Waals forces and the like (See, e.g., Holtke et al., U.S. Patent Nos. 5,344,757; 5,702,888; and 5,354,657; Huber et al., U.S. Patent No. 5,198,537; Miyoshi, U.S. Patent No. 4,849,336; Misiura and Gait, PCT publication WO 91 / 17160). In certain aspects, a suitable targeting label, retrievable label or detectable label is an enzyme (e.g., a methylase and / or a cleaving enzyme). In one aspect, an antibody specific against the enzyme can be used to retrieve or detect the enzyme and accordingly, retrieve or detect an oligonucleotide sequence or factor attached to the enzyme. In another aspect, an antibody specific against the enzyme can be used to retrieve or detect the enzyme and, after stringent washes, retrieve or detect a factor or first oligonucleotide sequence that is hybridized to a second oligonucleotide sequence having the enzyme attached thereto.

[0074] Biotin, or a derivative thereof, may be used as an oligonucleotide label (e.g., as a targeting moiety, retrievable moiety and / or a detectable label), and subsequently bound by an avidin / streptavidin derivative (e.g., detectably labelled, e.g., phycoerythrin-conjugated streptavidin), or an anti -biotin antibody (e.g., a detectably labelled antibody). Digoxigenin may be incorporated as a label and subsequently bound by a detectably labelled anti-digoxigenin antibody (e.g., a detectably labelled antibody, e.g., fluoresceinated anti-digoxigenin). An aminoallyl-dUTP residue may be incorporated into an oligonucleotide and subsequently coupled to an N-hydroxy succinimide (NHS) derivatized fluorescent dye. In general, any member of a conjugate pair may be incorporated into a retrievable moiety and / or a detectable label provided that a detectably labelled conjugate partner can be bound to permit detection. As used herein, the term antibody refers to an antibody molecule of any class, or any sub-fragment thereof, such as an Fab. Other suitable labels (targeting moieties, retrievable moieties and / or detectable labels) include, but are not limited to, fluorescein (FAM), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phosphor-amino acids (e.g. P-tyr, P- ser, P-thr) and the like. In one embodiment the following hapten / antibody pairs are used for reaction, retrieval and / or detection: biotin / a-biotin, digoxigenin / a-digoxigenin, dinitrophenol (DNP) / a-DNP, 5 -Carboxyfluorescein (FAM) / a-FAM.

[0075] Additional suitable labels (targeting moieties, retrievable moieties and / or detectable labels) include, but are not limited to, chemical cross-linking agents. Cross-linking agents typically contain at least two reactive groups that are reactive towards numerous groups, including, but not limited to, sulfhydryls and amines, and create chemical covalent bonds between two or more molecules. Functional groups that can be targeted with cross-linking agents include, but are not limited to, primary amines, carboxyls, sulfhydryls, carbohydrates and carboxylic acids. Protein molecules have many of these functional groups and therefore proteins and peptides can be readily conjugated using cross-linking agents. Cross-linking agents are well known in the art and are commercially available (Thermo Scientific (Rockford, IL)).

[0076] A detectable moiety, label or reporter can be used to detect a nucleic acid or nucleic acid probe as described herein. Oligonucleotide probes or nucleic acid probes described herein can be labeled in a variety of ways, including the direct or indirect attachment of a detectable moiety such as a fluorescent moiety, hapten, colorimetric moiety and the like. A location where a label may be attached is referred to herein as a label addition site or detectable moiety addition site and may include a nucleotide to which the label is capable of being attached. One of skill in the art can consult references directed to labeling DNA. Examples of detectable moieties include various radioactive moieties, enzymes, prosthetic groups, fluorescent markers, luminescent markers, bioluminescent markers, metal particles, protein-protein binding pairs, protein-antibody binding pairs and the like. Examples of fluorescent moieties include, but are not limited to, yellow fluorescent protein (YFP), green fluorescence protein (GFP), enhanced green fluorescence protein (eGFP), cyan fluorescence protein (CFP), red fluorescence protein (RFP), mCherry, DAPI, FITC, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, cyanines, dansyl chloride, phycocyanin, phycoerythrin and the like. Examples of bioluminescent markers include, but are not limited to, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, aequorin and the like. Examples of enzyme systems having visually detectable signals include, but are not limited to, galactosidases, glucorinidases, phosphatases, peroxidases, cholinesterases and the like. Identifiable markers also include radioactive compounds such as1251,35S,14C, or3H. Identifiable markers are commercially available from a variety of sources.

[0077] Fluorescent labels and their attachment to nucleotides and / or oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRE Press, Oxford, 1991); and Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991). Particular methodologies applicable to the invention are disclosed in the following sample of references: U.S. Patent Nos. 4,757,141, 5,151,507 and 5,091,519. In one aspect, one or more fluorescent dyes are used as labels for labeled target sequences, e.g., as disclosed by U.S. Patent Nos. 5,188,934 (4,7-dichlorofluorescein dyes); 5,366,860 (spectrally resolvable rhodamine dyes); 5,847,162 (4,7-dichlororhodamine dyes); 4,318,846 (ether- substituted fluorescein dyes); 5,800,996 (energy transfer dyes); Lee etal., ' 5,066,580 (xanthine dyes); 5,688,648 (energy transfer dyes); and the like. Labeling can also be carried out with quantum dots, as disclosed in the following patents and patent publications: U.S. Patent Nos. 6,322,901, 6,576,291, 6,423,551, 6,251,303, 6,319,426, 6,426,513, 6,444,143, 5,990,479, 6,207,392, 2002 / 0045045 and 2003 / 0017264. As used herein, the term “fluorescent label” includes a signaling moiety that conveys information through the fluorescent absorption and / or emission properties of one or more molecules. Such fluorescent properties include fluorescence intensity, fluorescence lifetime, emission spectrum characteristics, energy transfer, and the like.

[0078] Commercially available fluorescent nucleotide analogues readily incorporated into nucleotide and / or oligonucleotide sequences include, but are not limited to, Cy3-dCTP, Cy3- dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), fluorescein- 12-dUTP, tetramethylrhodamine-6-dUTP, TEXAS RED™-5-dUTP, CASCADE BLUE™-7-dUTP, BODIPY TMFL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TMTR-14-dUTP, RHODAMINE GREEN™-5-dUTP, OREGON GREENR™ 488-5-dUTP, TEXAS RED™-12- dUTP, BODIPY TM 630 / 650-14-dUTP, BODIPY TM 650 / 665-14-dUTP, ALEXA FLUOR™ 488-5-dUTP, ALEXA FLUOR™ 532-5-dUTP, ALEXA FLUOR™ 568-5-dUTP, ALEXA FLUOR™ 594-5-dUTP, ALEXA FLUOR™ 546-14-dUTP, fluorescein- 12-UTP, tetramethylrhodamine-6-UTP, TEXAS RED™-5-UTP, mCherry, CASCADE BLUE™-7-UTP, BODIPY TM FL-14-UTP, BODIPY TMR-14-UTP, BODIPY TM TR-14-UTP, RHODAMINE GREEN™-5-UTP, ALEXA FLUOR™ 488-5-UTP, ALEXA FLUOR™ 546- 14-UTP (Molecular Probes, Inc. Eugene, OR) and the like. Alternatively, the above fluorophores and those mentioned herein may be added during oligonucleotide synthesis using for example phosphoroamidite or NHS chemistry. Protocols are known in the art for custom synthesis of nucleotides having other fluorophores (See, Henegariu et al. (2000) Nature BiotechnoL 18:345). 2-Aminopurine is a fluorescent base that can be incorporated directly in the oligonucleotide sequence during its synthesis. Nucleic acid could also be stained, a priori, with an intercalating dye such as DAPI, YOYO-1, ethidium bromide, cyanine dyes (e.g. SYBR Green) and the like.

[0079] Other fluorophores available for post-synthetic attachment include, but are not limited to ATTO dyes such as ATTO 488, ATTO 520, ATTO 532, ATTO 550, ATTO 565, ATTO 590, ATTO 594, ATTO 633, ATTO 647, ATTO 647N, ATTO 655, ATTO 680 and ATTO 700 aggregation-induced emission (AIE) fluorophores as described in Zhu et al, ACS Applied Bio Materials 2018, 1, 6, 1768-1786 hereby incorporated by reference in its entirety, ALEXA FLUOR™ 350, ALEXA FLUOR™ 405, ALEXA FLUOR™ 430, ALEXA FLUOR™ 488, ALEXA FLUOR™ 532, ALEXA FLUOR™ 546, ALEXA FLUOR™ 555, ALEXA FLUOR™ 568, ALEXA FLUOR™ 594, ALEXA FLUOR™ 610, ALEXA FLUOR™ 633, ALEXA FLUOR™ 635, ALEXA FLUOR™ 647, ALEXA FLUOR™ 660, ALEXA FLUOR™ 680, ALEXA FLUOR™ 700, ALEXA FLUOR™ 750, ALEXA FLUOR™ 790, BODIPY 493 / 503, BODIPY FL, BODIPY R6G, BODIPY 530 / 550, BODIPY TMR, BODIPY 558 / 568, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY TR, BODIPY 630 / 650, BODIPY 650 / 665, Cascade Blue, Cascade Yellow, Dansyl, lissamine rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Pacific Orange, rhodamine 6G, rhodamine green, rhodamine red, tetramethyl rhodamine, Texas Red (available from Molecular Probes, Inc., Eugene, OR), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7 (Amersham Biosciences, Piscataway, NJ) and the like. FRET tandem fluorophores may also be used, including, but not limited to, PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, APC- Cy7, PE- Alexa dyes (610, 647, 680), APC-Alexa dyes and the like.

[0080] FRET tandem fluorophores may also be used, such as PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, and APC-Cy7; also, PE-Alexa dyes (610, 647, 680) and APC-Alexa dyes.

[0081] Metallic silver or gold particles may be used to enhance signal from fluorescently labeled nucleotide and / or oligonucleotide sequences (Lakowicz et al. (2003) BioTechniques 34:62).

[0082] Biotin, or a derivative thereof, may also be used as a label on a nucleotide and / or an oligonucleotide sequence, and subsequently bound by a detectably labeled avi din / streptavidin derivative (e.g. phycoerythrin-conjugated streptavidin), or a detectably labeled anti-biotin antibody. Biotin / avidin is an example of a ligand-ligand binding pair. An antibody / antigen binging pair may also be used with methods described herein. Other ligand-ligand binding pairs or conjugate binding pairs are well known to those of skill in the art. Digoxigenin may be incorporated as a label and subsequently bound by a detectably labeled anti-digoxigenin antibody (e.g. fluoresceinated anti-digoxigenin). An aminoallyl -dUTP or aminohexylacrylamide-dCTP residue may be incorporated into an oligonucleotide sequence and subsequently coupled to an N- hydroxy succinimide (NHS) derivatized fluorescent dye. In general, any member of a conjugate pair may be incorporated into a detection oligonucleotide provided that a detectably labeled conjugate partner can be bound to permit detection. As used herein, the term antibody refers to an antibody molecule of any class, or any sub-fragment thereof, such as an Fab.

[0083] Other suitable labels for an oligonucleotide sequence may include fluorescein (FAM, FITC), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phosphor-amino acids (e.g. P-tyr, P-ser, P-thr) and the like. In one embodiment the following hapten / antibody pairs are used for detection, in which each of the antibodies is derivatized with a detectable label: biotin / a-biotin, digoxigenin / a-digoxigenin, dinitrophenol (DNP) / a-DNP, 5-Carboxyfluorescein (FAM) / a-FAM.

[0084] In certain exemplary embodiments, a nucleotide and / or an oligonucleotide sequence can be indirectly labeled, especially with a hapten that is then bound by a capture agent, e.g., as disclosed in U.S. Patent Nos. 5,344,757, 5,702,888, 5,354,657, 5,198,537 and 4,849,336, PCT publication WO 91 / 17160 and the like. Many different hapten-capture agent pairs are available for use. Exemplary haptens include, but are not limited to, biotin, des-biotin and other derivatives, dinitrophenol, dansyl, fluorescein, CY5, digoxigenin and the like. For biotin, a capture agent may be avidin, streptavidin, or antibodies. Antibodies may be used as capture agents for the other haptens (many dye-antibody pairs being commercially available, e.g., Molecular Probes, Eugene, OR).

[0085] According to certain aspects, detectable moieties described herein are spectrally resolvable. “Spectrally resolvable” in reference to a plurality of fluorescent labels means that the fluorescent emission bands of the labels are sufficiently distinct, i.e., sufficiently nonoverlapping, that molecular tags to which the respective labels are attached can be distinguished on the basis of the fluorescent signal generated by the respective labels by standard photodetection systems, e.g., employing a system of band pass filters and photomultiplier tubes, or the like, as exemplified by the systems described in U.S. Patent Nos. 4,230,558; 4,811,218, or the like, or in Wheeless et al., pgs. 21-76, in Flow Cytometry: Instrumentation and Data Analysis (Academic Press, New York, 1985). In one aspect, spectrally resolvable organic dyes, such as fluorescein, rhodamine, and the like, means that wavelength emission maxima are spaced at least 20 nm apart, and in another aspect, at least 40 nm apart. In another aspect, chelated lanthanide compounds, quantum dots, and the like, spectrally resolvable means that wavelength emission maxima are spaced at least 10 nm apart, and in a further aspect, at least 15 nm apart.

[0086] In certain embodiments, the detectable moieties can provide higher detectability when used with an electron microscope, compared with common nucleic acids. Moieties with higher detectability are often in the group of metals and organometals, such as mercuric acetate, platinum dimethylsulfoxide, several metal-bipyridyl complexes (e.g. osmium-bipy, ruthenium-bipy, platinum-bipy). While some of these moieties can readily stain nucleic acids specifically, linkers can also be used to attach these moieties to a nucleic acid. Such linkers added to nucleotides during synthesis are acrydite- and a thiol-modified entities, amine reactive groups, and azide and alkyne groups for performing click chemistry. Some nucleic acid analogs are also more detectable such as gamma-adenosine-thiotriphosphate, iododeoxycytidine-triphosphate, and metallonucleosides in general (see Dale et al., Proc. Nat. Acad. Sci. USA, Vol. 70, No. 8, pp. 2238-2242 (1973)). The modified nucleotides are added during synthesis. Synthesis may refer by example to solid support synthesis of oligonucleotides. In this case, modified nucleic acids, which can be a nucleic acid analog, or a nucleic acid modified with a detectable moiety, or with an attachment chemistry linker, are added one after each other to the nucleic acid fragments being formed on the solid support, with synthesis by phosphoramidite being the most popular method. Synthesis may also refer to the process performed by a polymerase while it synthesizes the complementary strands of a nucleic acid template. Certain DNA polymerases are capable of using and incorporating nucleic acids analogs, or modified nucleic acids, either modified with a detectable moiety or an attachment chemistry linker to the complementary nucleic acid template.

[0087] Detection method(s) used will depend on the particular detectable labels used in the reactive labels, retrievable labels and / or detectable labels. In certain exemplary embodiments, target nucleic acids such as nucleic acid including a mutation or mutations, translocation or inversion, chromosomes and sub-chromosomal regions of chromosomes having one or more reactive labels, retrievable labels, or detectable labels bound thereto by way of the probes described herein may be selected for and / or screened for using a microscope, a spectrophotometer, a tube luminometer or plate luminometer, x-ray film, a scintillator, a flow cytometry apparatus, a fluorescence activated cell sorting (FACS) apparatus, a microfluidics apparatus or the like.

[0088] When fluorescently labeled targeting moieties, retrievable moieties, or detectable labels are used, fluorescence photomicroscopy can be used to detect and record the results of in situ hybridization using routine methods known in the art. Alternatively, digital (computer implemented) fluorescence microscopy with image-processing capability may be used. Two well-known systems for imaging FISH of chromosomes having multiple colored labels bound thereto include multiplex-FISH (M-FISH) and spectral karyotyping (SKY). See Schrock et al. (1996) Science 273:494; Roberts et al. (1999) Genes Chrom. Cancer 25:241; Fransz et al. (2002) Proc. Natl. Acad. Sci. USA 99: 14584; Bayani et al. (2004) Curr. Protocol. Cell Biol. 22.5.1- 22.5.25; Danilova et al. (2008) Chromosoma 117:345; U.S. Patent No. 6,066,459; and FISH TAG™ DNA Multicolor Kit instructions (Molecular probes) for a review of methods for binding nucleic acid probes to target nucleic acid sequences within chromosomes and detecting target nucleic acid sequences within chromosomes.

[0089] In certain exemplary embodiments, images of fluorescently labeled chromosomes are detected and recorded using a computerized imaging system such as the Applied Imaging Corporation CytoVision System (Applied Imaging Corporation, Santa Clara, Calif.) with modifications (e.g., software, Chroma 84000 filter set, and an enhanced filter wheel). Other suitable systems include a computerized imaging system using a cooled CCD camera (Photometries, NU200 series equipped with Kodak KAF 1400 CCD) coupled to a Zeiss Axiophot microscope, with images processed as described by Ried et al. (1992) Proc. Natl. Acad. Set. USA 89: 1388). Other suitable imaging and analysis systems are described by Schrock et al., supra, and Speicher et al., supra.

[0090] B. Molecular Beacons to Identify DNA Region(s)

[0091] According to one aspect, a binding agent can be a molecular beacon and the target genetic element can be a target nucleic acid which includes or lacks a genetic mutation characteristic of a heritable disease. The molecular beacon includes a label as described herein. Molecular beacons are hairpin shaped molecules with an internally quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid sequence. Molecular beacons are known to those of skill in the art as described in Guo et a ., Anal. Bioanal. Chem. (2012) 402:3115- 3125 hereby incorporated by reference in its entirety.

[0092] More specifically, the molecular beacon can target either the healthy allele, or the diseased allele. According to one aspect, each allele can be specifically targeted by a cognate molecular beacon. In addition, the target genetic element may actually be upstream or downstream from the actual genetic element of interest, as desired, for example due to design constraints and haplotype occurrences. In one embodiment, the targeted genetic element is present in the carrier sperm that is carrying the disease-causing allele. In another embodiment, the target genetic element is in a healthy allele in the normal sperm that does not carry the disease-causing allele. Exemplary molecular beacons can include oligonucleotide probes that are fluorescent, fluorogenic, and / or release a chemical upon binding to the target nucleic acid.

[0093] Molecular beacons, or molecular beacon probes, are oligonucleotide hybridization probes that can report the presence of specific nucleic acids. Molecular beacons are hairpin-shaped molecules with an internally quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid sequence.

[0094] An exemplary molecular beacon probe may be 25 nucleotides long, for example, although shorter or longer molecular beacon probes are envisioned. The middle nucleotides, for example the middle 15 nucleotides, are complementary to target DNA or RNA and do not base pair with one another, while nucleotides at each terminus, such as 5 nucleotides at each terminus, are complementary to each other rather than to the target DNA or RNA. An exemplary molecular beacon structure can be divided in 4 parts: 1) loop, an 18-30 base pair region of the molecular beacon that is complementary to the target sequence; 2) stem formed by the attachment to both termini of the loop of two short (5 to 7 nucleotide residues) oligonucleotides that are complementary to each other; 3) 5' fluorophore at the 5' end of the molecular beacon, a fluorescent dye is covalently attached; 4) 3' quencher (non fluorescent) dye that is covalently attached to the 3' end of the molecular beacon. When the beacon is in closed loop shape, the quencher resides in proximity to the fluorophore, which results in quenching the fluorescent emission of the latter.

[0095] If the nucleic acid to be detected is complementary to the strand in the loop, the event of hybridization occurs. The duplex formed between the nucleic acid and the loop is more stable than that of the stem because the former duplex involves more base pairs. This causes the separation of the stem and hence of the fluorophore and the quencher. Once the fluorophore is no longer next to the quencher, illumination of the hybrid with light results in the fluorescent emission. The presence of the emission reports that the event of hybridization has occurred and hence the target nucleic acid sequence is present in the test sample.

[0096] Molecular beacons can be used for SNP detection, nucleic acid detection, PCR quantification, allelic discrimination and identification, multiplex PCR assays, and diagnostic clinical assays. Representative publications describing molecular beacons and their use include Shekdar K, Langer J, Venkatachalan S, Schmid L, Anobile J, Shah P, et al. (March 2021). "Cell engineering method using fluorogenic oligonucleotide signaling probes and flow cytometry". Biotechnology Letters. doi: 10.1007 / sl0529-021-03101-5. PMC 7937778. PMID 33683511; Tyagi S, Kramer FR (March 1996). "Molecular beacons: probes that fluoresce upon hybridization". Nature Biotechnology. 14 (3): 303-8. doi: 10.1038 / nbt0396-303. PMID 9630890. S2CID 27010207; Tapp I, Malmberg L, Rennel E, Wik M, Syvanen AC (April 2000). "Homogeneous scoring of single-nucleotide polymorphisms: comparison of the 5'-nuclease TaqMan assay and Molecular Beacon probes". BioTechniques. 28 (4): 732-8. doi: 10.2144 / 00284rr02. PMID 10769752; and Okamoto A (December 2011). "ECHO probes: a concept of fluorescence control for practical nucleic acid sensing". Chemical Society Reviews.

[0097] 40 (12): 5815-28. doi: 10.1039 / clcsl5025a. PMID 21660343.

[0098] ECHO probes useful in the methods described herein are sequence-specific, hybridization-sensitive, quencher-free fluorescent probes for RNA detection, which have been designed using the concept of fluorescence quenching caused by intramolecular excitonic interaction of fluorescent dyes. ECHO probes are known to those of skill in the art as described in Kubota et al., PLoS ONE, Vol. 5, Issue 9, el3003 (2010); Okamoto, Chem. Soc. Rev., 2011, 40, 5815-5828, Wang et al., RNA (2012), 18: 166-175, each of which are hereby incorporated by reference in their entireties.

[0099] C. In Situ Hybridization Probe

[0100] According to one aspect, a binding agent can be an in situ hybridization probe or oligonucleotide probe and the target genetic element can be a target nucleic acid which includes or lacks a genetic mutation characteristic of a heritable disease. The in situ hybridization probe includes a label as described herein. In situ hybridization is a powerful molecular biology technique that enables the precise localization of specific nucleic acid sequences (such as DNA or RNA) within cells or tissues. The concept of their usage is based on harnessing the innate complementary base-pairing properties of said nucleic acids. Methods for producing a probe that binds to the target nucleic acid in a complementary manner are known. The proceeding steps depend on what is previously affixed to the probe. For instance, a small fluorescent molecule / moiety can be attached to the probe (a “fluorescent in situ hybridization” or “FISH” probe), which fluoresces under proper excitation conditions, enabling the identifying of subcellular localizations and the presence of intended nucleic acid targets. FISH has been used to investigate the localization of specific genes, the dynamics of chromatin organization, and the identification of genetic variations, such as translocations, amplifications, and deletions.

[0101] In one embodiment, the present disclosure provides a “fluorescent in situ hybridization” or “FISH” probe. FISH is a cytogenetic technique that is used to detect and localize the presence or absence of specific DNA sequences on chromosomes. FISH uses fluorescent probes that bind to only those parts of the chromosome with which they show a high degree of sequence complementarity. Fluorescence microscopy can be used to find out where the fluorescent probe is bound to the chromosomes.

[0102] The “FISH” probe is used to target the genetic variant in the carrier sperm (Fig. 1). A probe is designed to specifically complement the carrier genetic variant. This probe is applied to prepared sperm, allowed to hybridize, and then sperm are sorted based on the methods described herein. The FISH probe can be synthesized from a number of commercially available companies with various modifications allowed. The exact engineering of the sequence is optimized from readily available algorithms, such as the mathFISH algorithm (See Yilmaz, L.S., Parnerkar, S., and Noguera, D.R. (2011). mathFISH, a Web Tool That Uses Thermodynamics-Based Mathematical Models for In Silico Evaluation of Oligonucleotide Probes for Fluorescence In Situ Hybridization. Appl Environ Microbiol 77, 1118-1122. 10.1128 / AEM.01733-10), paying special attention to specificity, melting temperature, solubility and strand structure.

[0103] In situ hybridization has already been in use in sperm, most routinely to detect aneuploidy. See Hwang, K., Weedin, J.W., and Lamb, D.J. (2010). The use of fluorescent in situ hybridization in male infertility. Therapeutic Advances in Urology 2, 157-169. 10.1177 / 1756287210373758. In this method, the sperm cell nuclei are reduced with DTT and the sperm washed with FISH probes engineered to hybridize to chromosomal structures. This approach is widely used to detect chromosomal abnormalities in male sperm, which are indicative of poor sperm quality and possible infertility. Traditionally, the usage of FISH such as in the above case has required cells to be in a “fixed” state, which is not compatible with living cells or genetic material capable of fertilization. Recent advances have enabled researchers to be able to visualize probe binding in live bacteria cells with complete recovery following observation and subsequent washing of the probe. See Batani, G., Bayer, K., Bbge, J., Hentschel, U., and Thomas, T. (2019). Fluorescence in situ hybridization (FISH) and cell sorting of living bacteria. Sci Rep 9, 18618. 10.1038 / s41598- 019-55049-2. The present disclosure provides a method of labeling live sperm cells using “FISH” probes.

[0104] In addition to the fluorescent application of FISH probes, the probe of the present disclosure can also be fluorogenic. That is, it only fluoresces upon successful hybridization. This technique is described as “ECHO-FISH” (See Wang, D.O., Matsuno, H., Ikeda, S., Nakamura, A., Yanagisawa, H., Hayashi, Y., and Okamoto, A. (2012). A quick and simple FISH protocol with hybridization-sensitive fluorescent linear oligodeoxynucleotide probes. RNA 7S, 166-175. 10.1261 / ma.O28431.111) and is a recent advancement to FISH procedures. It will be appreciated that numerous variations of in situ hybridization protocols and conditions are known and may be used in conjunction with the present invention by practitioners following the guidance provided herein. Various references describing FISH probes and their use include Gall and Pardue (1981) Meth. EnzymoL H AIC, Henderson (1982) Int. Review of Cytology 76: 1; O'Connor, Clare. "Fluorescence In Situ Hybridization (FISH)". Nature Education; Gall, JG; Pardue, ML (June 1969). "Formation and detection of RNA-DNA hybrid molecules in cytological preparations". Proceedings of the National Academy of Sciences of the United States of America. 63 (2): 378- 83. Bibcode: 1969PNAS...63..378G. doi: 10.1073 / pnas.63.2.378. PMC 223575. PMID 4895535; Lehmann, Ruth; Tautz, Diethard (1994-01-01), Goldstein, Lawrence S. B.; Fyrberg, Eric A. (eds.), Chapter 30 In Situ Hybridization to RNA, Methods in Cell Biology, vol. 44, Academic Press, pp. 575-598, doi: 10.1016 / s0091-679x(08)60933-4, ISBN 9780125641456, PMID 7535885; Brown, Lindsay A.; Huntsman, David (2007-05-01). "Fluorescent in situ hybridization on tissue microarrays: challenges and solutions". Journal of Molecular Histology. 38 (2): 151— 157. doi: 10.1007 / sl0735-006-9069-y. ISSN 1567-2387. PMID 17216303. S2CID 6363208; Panoskaltsis-Mortari, A.; Bucy, R. P. (February 1995). "In situ hybridization with digoxigenin- labeled RNA probes: facts and artifacts". BioTechniques. 18 (2): 300-307. ISSN 0736-6205. PMID 7727134; and Jin, L; Lloyd, RV (1997). "In situ hybridization: methods and applications". Journal of Clinical Laboratory Analysis. 11 (1): 2-9. doi : 10.1002 / (SICI) 1098- 2825(1997)11 : 1<2::AID-JCLA2>3.0.CO;2-F. PMC 6760707. PMID 9021518.

[0105] For purposes of the present disclosure, a labeled binding agent or labeled probe to both a single molecule including a binding agent or probe sequence and a label attached thereto, such as by covalent attachment, or a binding agent or probe sequence and a separate label component which are added as separate species but then combine to form a labeled probe. Such an embodiment may be referred to as a secondary label. Wherever reference is made to hybridization of a labeled nucleotide, such hybridization may be accomplished with the labeled nucleotide or other labeled compound being part of a hybridization probe.

[0106] D. Triplex Forming Oligonucleotide (TFO)

[0107] In one embodiment, the present disclosure provides the use of triplex-forming oligonucleotides (TFOs) for labeling sperm cells. The triplex forming oligonucleotide includes a label as described herein. TFOs are short, single-stranded DNA or RNA molecules designed to bind to a specific double-stranded DNA target through hydrogen bonding, creating a three- stranded DNA structure. TFOs work by forming a stable complex with the target DNA through sequence-specific interactions. This process involves the TFO binding to the major groove of the DNA double helix in a sequence-dependent manner, leading to the formation of a triple-stranded structure known as a DNA triplex. Although this interaction is specific, it is transient, meaning that it is not a persistent lasting change to the target DNA structure. In one embodiment, the present disclosure provides TFOs as probes designed to localize the target genetic variant in carrier sperm (Fig. 2).

[0108] In some embodiments, the TFO probe can have modifications to increase specificity, stability, and the like. These include substituting 2'-deoxythymidine with 5-(l-propynyl)-2'- deoxyuridine, increasing 2'-O-methyl (OMe), 2'-O-aminoethyl (AE) substitution, cytosine substitution for 5-methylcytosine. The following references provide guidance for selecting modifications appropriate for particular embodiments: Knauert et al. (2001) Hum Mol Gen. Volume 10, Issue 20, Pages 2243-2251; Ikeda et al. (2013) Artificial DNA. 4: 1, 19-27; Bekkouche et al. (2023) Polymers. 15: 858.

[0109] In some embodiments, the TFO probe can have fluorescent or fluorogenic attachments to facilitate detection of bound targets. See Ikeda, S., Yanagisawa, H., Yuki, M., and Okamoto, A. (2013). Fluorescent tripl ex -forming DNA oligonucleotides labeled with a thiazole orange dimer unit. Artificial DNA: PNA & XNA 4, 19-27. 10.4161 / adna.24102. Traditionally, TFOs could only be synthesized to target limited sequences of nucleotides, for instance, only purine nucleobases in specific nucleotide triplet sets. See Bekkouche, I., Shishonin, A.Y., and Vetcher, A. A. (2023). Recent Development in Biomedical Applications of Oligonucleotides with Triplex- Forming Ability. Polymers 75, 858. 10.3390 / polyml5040858. However, recent advances in computing triplex formation have enabled countless target sites to be designed throughout the genome. In addition, TFOs do not require the same stringent conditions as FISH to strongly bind to its target, enabling easier usage in living cells. Also, endogenous triplex-forming RNAs are known to form complexes with chromatin, which is tightly packed DNA like we would find within the sperm. The present disclosure provides a method of labeling live sperm cells using TFOs probes.

[0110] E. Peptide Nucleic Acid (PNA) The present disclosure provides a method of labeling live sperm cells using PNAs probes. Peptide nucleic acids (PNAs) are synthetic molecules that combine nucleobases with a neutral, peptide-like backbone, making them highly stable and specific for binding to complementary DNA or RNA sequences. Peptide nucleic acids include a label as described herein. Numerous studies have shown PNAs offer greater signal intensity and sequence discrimination than traditional FISH-based methods. See Pellestor, F., and Paulasova, P. (2004). The peptide nucleic acids (PNAs), powerful tools for molecular genetics and cytogenetics. Eur J Hum Genet 72, 694- 700. 10.1038 / sj.ejhg.5201226. In addition, given the faster rate of hybridization of PNAs compared to DNA oligos, less time is required in the protocol for allowing the hybridization to occur which is critical for the application of this technology to living sperm. PNAs have been used to label specific chromosomes in fixed sperm samples. See Pellestor, F., Andreo, B., Taneja, K., and Williams, B. (2003). PNA on human sperm: a new approach for in situ aneuploidy estimation. Eur J Hum Genet 77, 337-341. 10.1038 / sj.ejhg.5200958. Locked nucleic acid probes and peptide nucleic acid probes are known to those of skill in the art and are described in Briones et al., Anal Bioanal Chem (2012) 402:3071-3089 hereby incorporated by reference in its entirety.

[0111] According to certain aspects, labeled toe-hold probes are useful in the methods described herein. Toe-hold probes are known to those of skill in the art as described in Zhang et al., Optimizing the Specificity of Nucleic Acid Hybridization, Nature Chemistry, DOI: 10.1038 / NCHEM.1246 (published online January 22, 2012) hereby incorporated by reference in its entirety for all purposes.

[0112] The present disclosure provides a method of designing PNAs to label the target genetic variant in carrier sperm. (Fig. 3).

[0113] Synthesis of custom PNA constructs is commercially available. Designing an effective PNA structure relies on optimizing various parameters such as melting temperature, stem and loop structure, purine content and length. The optimized structure is adequately labeled (either 5’ or 3’ end) with a detectable or sorting moiety such as a fluorescent or other molecule of choice. The stability and specificity, combined with ease of manipulating the structure, make PNAs an important tool for detecting genetic variants in living sperm. Modifications that can be added before, during or after the construction of a PNA include modification of the N-(2aminoethyl) glycine backbone (including replacement with a noncharged peptide backbone). The following references provide guidance for selecting modifications appropriate for particular embodiments: Bekkouche et al. (2023) Polymers. 15: 858; Pellestor and Paulasova. (2004) Euro J Hum Gen. 12, 694-700.

[0114] EXAMPLE I

[0115] Collection of Sperm

[0116] Semen from a male carrier is collected. According to one aspect, semen from a male carrier parent is collected, such as under the guidance of a fertility specialist. It is to be understood that one aspect of the present disclosure relates to the use of human sperm in the methods described herein. Additional embodiments relate to the use of animal sperm or mammalian sperm in general, and to non-human mammalian species and other animal species as described herein. Standard sample analysis is done to determine concentration, motility and morphology of the sample(s). Following sperm separation from the seminal fluid, the sperm is divided into cryopreserving vials and frozen through traditional (slow-freezing) or vitrification means where it can remain frozen for decades, if needed. See Tao, Y., Sanger, E., Saewu, A., and Leveille, M - C. (2020). Human sperm vitrification: the state of the art. Reprod Biol Endocrinol 7S, 17. 10.1186 / sl2958-020-00580-5. Frozen sperm is transported to the facility where the separation of carrier and normal sperm will occur. Where appropriate, HIIPA rules are carefully followed to ensure patient confidentiality.

[0117] EXAMPLE II

[0118] Binding of a Binding Agent to a Target Genetic Element within Sperm According to certain aspects, live sperm cells are placed into media with a labeled probe for a period of time sufficient for the probe to internalize within the live sperm cell and bind to a target genetic element such as a target nucleic acid sequence. Standard media and conditions (including controlled physiological conditions such as in a bioreactor) for sperm cells are well known to those of skill in the art. The temperature conditions required can be any temperature. Exemplary temperature include 4°C, 10°C, 12°C, 15°C, 20°C, 25°C, 30°C, 35°C, 37°C, 40°C, 42°C. The time period for combining the labeled probe and the sperm cell can be any desired time period. Exemplary time periods include 30 minutes, 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 10 hours, 12 hours, 24 hours, 2 days, 7 days and longer if desired. Sperm cells may be washed according to methods known to those of skill in the art to remove unbound labeled probe and so as to reduce background signal. Suitable washing fluids are commercially available. Washing may also include centrifugation and resuspension one or more times in probe free media. Probe concentration will vary depending on probe type, target size, and target complexity. For instance, LNAs have high affinity for their targets, and so would likely be applied at lower concentrations compared to other probes. Also, as repetitive targets are more easily detected, they would likely require lower concentrations of probe, even when targeted with smaller numbers of oligos, as compared to targets consisting of a unique sequence and, therefore, requiring complex libraries of oligos. Exemplary probe concentrations may be within the range of about 0.1 pmol to about lOnm / ml. However, one of skill in the art will realize that useful concentrations may be outside of this range.

[0119] EXAMPLE III Separation of Carrier vs Normal Sperm

[0120] According to one aspect, the present disclosure provides a method to separate out sperm having a binding agent bound to a target genetic element from sperm lacking the binding agent, i.e. the labeled sperm from unlabeled sperm. In one embodiment, the carrier sperm is labeled. In another embodiment, healthy, normal sperm is labeled. Two main issues in sorting these sperm are the sensitivity of detection of the label, such as a fluorescent signal and the throughput (efficiency) of the method. In some embodiments, advanced microscopy methods are used in most applications to allow the detection of very small changes in fluorescence of fluorescently labeled probes in the sperm cell. In addition, although there is no threshold for total motile sperm count (TMSC) for which IUI should be performed. However, best practices are a TMSC of equal to or greater than >9 * 10 (see Karabinus, D.S., Marazzo, D.P., Stern, H.J., Potter, D.A., Opanga, C.I., Cole, M.L., Johnson, L.A., and Schulman, J.D. (2014). The effectiveness of flow cytometric sorting of human sperm (MicroSort®) for influencing a child’s sex. Reprod Biol Endocrinol 72, 106. 10.1186 / 1477-7827-12-106), though pregnancies have been achieved with 36-fold lower counts. See Muthigi, A., Jahandideh, S., Bishop, L.A., Naeemi, F.K., Shipley, S.K., O’Brien, J.E., Shin, P.R., Devine, K., and Tanrikut, C. (2021). Clarifying the relationship between total motile sperm counts and intrauterine insemination pregnancy rates. Fertility and Sterility 775, 1454- 1460. 10.1016 / j.fertnstert.2021.01.014. Thus, the throughput of each method is important for being able to use the sorted sperm with IUI. The present disclosure contemplates the following exemplary methods to separate sperm labeled with a fluorescent probe.

[0121] A. Fluorescent -Activated Cell Separation (FACS)

[0122] According to one aspect, the present disclosure provides a method of sorting fluorescently labeled sperm using fluorescence-activated cell sorting (FACS). A fluorescence-activated cell sorting (FACS) machine separates and analyzes individual cells based on their optical and fluorescence characteristics. In one embodiment, the target sperm is fluorescently-labeled. After providing the fluorescent probes to the sperm, the sperm are diluted to the proper concentration for use in FACS. This suspension is then introduced into a narrow, pressurized stream of sheath fluid. As each sperm in the suspension passes through a flow cell, it is subjected to a focused laser beam. When the appropriate wavelength of laser light interacts with each sperm, it excites any possible fluorophores present within the cell, causing them to emit fluorescent signals. These emitted signals are collected by photodetectors and converted into electrical signals, which are then processed by a computer. The computer analyzes the fluorescence emissions in real-time and, based on predefined criteria, it activates an electrostatic charging mechanism that imparts an electric charge to each cell. The charged cells then pass through an electric field, causing them to deflect towards different collection tubes or plates based on their charge, allowing for the rapid sorting of cells with specific fluorescence profiles. The present disclosure provides a highly efficient and precise method for isolating and purifying sperm cells that are fluorescently labeled.

[0123] Sperm sorting is currently in use to sort male and female sperm based on DNA coverage with the fluorescent Hoechst dye which binds indiscriminately to DNA. The type of FACS machine used to sort sperm for genotypic use requires a specific laser configuration and gentler sorting method. See Karabinus, D.S., Marazzo, D.P., Stern, H.J., Potter, D.A., Opanga, C.I., Cole, M.L., Johnson, L.A., and Schulman, J.D. (2014). The effectiveness of flow cytometric sorting of human sperm (MicroSort®) for influencing a child’s sex. Reprod Biol Endocrinol 72, 106. 10.1186 / 1477-7827-12-106. Standard, commercially available FACS machines can be configured to sort sperm. Recently, new techniques to calibrate FACS machines enable the detection of single fluorescent molecules. See Sabines-Chesterking, J., Burenkov, I. A., and Polyakov, S.V. (2022). In Situ Flow Cytometer Calibration and Single-Molecule Resolution via Quantum Measurement. Sensors 22, 1136. 10.3390 / s22031136. An exemplary flow cytometry imaging method used with sperm is disclosed in Umirbaeva et al., Front Vet Sci. 2024 Apr 24; 11 : 1371568 hereby incorporated by reference in its entirety. Other techniques exist such as labeling nucleic acid targets with multiple distinct fluorophores and then optimizing multiparametric thresholds to increase chance of detection. See Smith, L.D., Liu, Y., Zahid, M.U., Canady, T.D., Wang, L., Kohli, M., Cunningham, B.T., and Smith, A.M. (2020). High-Fidelity Single Molecule Quantification in a Flow Cytometer Using Multiparametric Optical Analysis. ACS Nano / - / , 2324-2335. 10.1021 / acsnano.9b09498) When fluorescently labeled targeting moieties, retrievable moieties, or detectable labels are used, FACS there may be a detection strategy for flow cytometry that is grounded in quantum measurements. Utilizing principles of quantum optics, specifically the second-order autocorrelation measurement, this approach offers low resolution capture of labels, as described by Sabines-Chesterking et al. (2022) Sensors. 22, 1136. The present disclosure provides FACS methods that harbor these and other advances in FACS to sort sperm.

[0124] B. Immunomagnetic Cell Sorting

[0125] Immunomagnetic cell sorting is also known as immunomagnetic cell separation, immunomagnetic cell enrichment, or magnetic-activated cell sorting. Immunomagnetic cell sorting is based on separation of beads passing a magnetic field. A variety of companies offer different solutions for enrichment or depletion of cell populations. Immunomagnetic cell sorting provides a method for enriching a heterogeneous mixture of cells based on cell-surface protein expression (antigens). This technology is based on the attachment of small, inert, supra-magnetic particles to mAbs specific for antigens on the target cell population. Cells labelled to these antibody-bead conjugates are then separated via a column containing a ferromagnetic matrix. By applying a magnetic field to the matrix, the beads stick to the matrix inside the column and the bead-carrying cells are held back from passing through. Unlabelled cells can pass through the matrix and are collected in the flow-through. To elute the trapped cells from the column, the magnetic field is simply removed. Immunomagnetic cell sorting therefore enables different strategies for positive enrichment or depletion of cells. See Zychlinsky, et al., (October 2019). "Guidelines for the use of flow cytometry and cell sorting in immunological studies (second edition)". Eur J Immunol. 49 (10): 1457-1973. Immunomagnetic beads are small and usually do not interfere with downstream assays, however for some applications it may be necessary to remove them. Using this separation method up-scaling the cell numbers does not significantly increase processing times and the sterility of the sample is guaranteed if the cell sorting is performed inside a biosafety cabinet. On the other hand, this technique allows to separate the cells based on a single marker. Immunomagnetic cell sorting has shown to cause minimal damage to live cells. See Goate, et. al., (27 March 2019). "Reduced variability of neural progenitor cells and improved purity of neuronal cultures using magnetic activated cell sorting". PLOS ONE. 14 (3): e0213374. doi: 10.1371 / journal.pone.0213374. PMC 6436701. PMID 30917153.

[0126] C. Microfluidics

[0127] According to one aspect, the present disclosure provides a method of sorting fluorescently labeled sperm using microfluidic cell sorting. Microfluidic devices designed for the separation of cells such as sperm operate on principles of hydrodynamics and surface interactions within microscale channels. These devices consist of a network of microchannels and chambers etched into a substrate. As a sample containing cells, often labeled with fluorescent markers, is introduced into the device, it is driven through the microchannels by controlled fluid flow. To separate based on morphology, inertial forces within the microchannels cause cells with different sizes and shapes to experience different lateral forces. As a result, cells migrate to specific positions within the channel based on their morphological characteristics, ultimately leading to their separation. In parallel, fluorescence-based separation is facilitated by incorporating integrated optical elements, such as excitation lasers and detectors, within the microfluidic system. As the labeled particles flow through the detection region, the fluorescence emitted by the markers is excited by the laser and captured by the detectors. The fluorescence signals are then processed and analyzed in real-time to identify and sort particles based on their fluorescence characteristics. The present disclosure integrates these two principles into microfluidic devices, which can effectively separate cells with a high degree of precision with simultaneous sorting based on both morphology and fluorescence.

[0128] The present disclosure provides microfluidic cell sorting technology to separate carrier vs normal sperm. Currently, microfluidic technology is being trialed to sort sperm based on physiological characteristics such as motility and morphology. See Huang, J., Chen, H., Li, N., and Zhao, Y. (2023). Emerging microfluidic technologies for sperm sorting. Engineered Regeneration , 161-169. 10.1016 / j.engreg.2023.02.001. It has the advantage over FACS given its gentler method of separation, which is critical for sperm-based applications. An additional benefit of microfluidic devices is that they typically utilize disposable chips or cartridges. This technology applied to sperm sorting reduces contamination risk (of other sperm as well as non- cellular artifacts), establishes consistency, is more convenient and suitable for use in technology barren locations. Thus, the present disclosure provides methods that combine fluorescence detection with the capture of physiological characteristics in order to sort normal sperm that have favorable characteristics for successful fertilization.

[0129] D. Separation Based on Inactivation of Carrier Sperm

[0130] According to one aspect, the present disclosure provides a method to inactivate certain sperm within a sample of sperm, so as to be able to separate inactivated sperm from sperm which has not been inactivated, i.e., active sperm. Instead of mechanically separating out carrier from normal sperm, this technique relies on incapacitating the carrier sperm, thus allowing only the normal sperm to be able to correctly swim and thus fertilize an egg. In this technique, a specific compound is placed onto the binding agent, such as an oligonucleotide probe, molecular beacon, and the like, which is targeted to the genetic variant of interest. Upon successful hybridization of the binding agent to its target, this inhibitor compound is released and incapacitates the sperm.

[0131] An example of this is the inhibition of soluble adenylyl cyclase (sAC), an enzyme critical for sperm motility. The chemical compound TDI-11861 is a specific inhibitor of this enzyme and can successfully incapacitate sperm. See Balbach, M., Rossetti, T., Ferreira, J., Ghanem, L., Ritagliati, C., Myers, R.W., Huggins, D.J., Steegbom, C., Miranda, I.C., Meinke, P.T., et al. (2023). On-demand male contraception via acute inhibition of soluble adenylyl cyclase. Nat

[0132] Commun 14, 637. 10.1038 / s41467-023-36119-6. In one embodiment, this molecule or similar is placed onto the binding agent as a label awaiting its release upon successful hybridization of the target. According to one aspect, certain binding agents like oligonucleotide probes or molecular beacons bind transiently, in theory enough of the chemical compound could be released to incapacitate the sperm. Importantly, this procedure could be performed same-day in a fertility clinic, without the need for any additional instruments. This would widespread economical implementation of this technique in regions previously inaccessible to fertility treatment.

[0133] E. Separation by Manual Manipulation

[0134] The present disclosure provides methods that further apply manual selection of sorted sperm. Embryologists routinely employ microscopy and handler techniques to extract the healthiest sperm to then fertilize each egg through IVF. With the aid of a microscope with fluorescence ability, technicians precisely locate fluorescently-labeled carrier sperm separate from normal sperm. In addition, they selectively choose normal sperm with favorable phenotypic characteristics including morphology and motility. The chosen sperm can either be introduced near the egg (to allow ‘natural’ conception) or directly implanted into the ovum, a process known as intracytoplasmic sperm injection (ICSI). This meticulous approach, though low throughput, ensures not only the fluorescence but also the physiological quality of each chosen sperm. In general, IVF is required given the low throughput nature of this method. This approach is advantageous for patients who naturally have low sperm count or morphology defects, or otherwise could not conceive with IUI.

[0135] EXAMPLE III

[0136] Quality Control Measurements

[0137] A. Sperm Quality

[0138] In one embodiment, following separation, the carrier sperm is analyzed for motility, concentration and morphology to determine acceptability within reason to pre-sorting quality. Examples of such analyses include detailed microscopy imaging of sorted sperm and calculated TMSC (total motile sperm count). There are various additional quantitative and qualitative measurements, such as the swim-up test. See Tao, Y., Sanger, E., Saewu, A., and Leveille, M.-C. (2020). Human sperm vitrification: the state of the art. Reprod Biol Endocrinol 18, 17. 10.1186 / S12958-020-00580-5.

[0139] B. Separation Efficiency

[0140] In one embodiment, to determine the success of separation of the carrier sperm away from the healthy, normal sperm, the resulting sorted sperm DNA is sequenced. There are various methods to confirm the presence or absence of a particular genetic element, most predominantly traditional PCR to amplify nucleic acid, followed by sequencing of the sperm sample.

[0141] Exemplary methods for amplifying nucleic acids include the polymerase chain reaction (PCR) (see, e.g., Mullis et al. (1986) Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1 :263 and Cleary et al. (2004) Nature Methods 1 :241; and U.S. Patent Nos. 4,683,195 and 4,683,202), anchor PCR, RACE PCR, ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241 : 1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91 :360-364), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87: 1874), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86: 1173), Q-Beta Replicase (Lizardi et al. (1988) BioTechnology 6: 1197), recursive PCR (Jaffe et al. (2000) J. Biol. Chem. 275:2619; and Williams et al. (2002) J. Biol. Chem. 277:7790), the amplification methods described in U.S. Patent Nos. 6,391,544, 6,365,375, 6,294,323, 6,261,797, 6,124,090 and 5,612,199, isothermal amplification (e.g., isothermal bridge amplification (IBA), rolling circle amplification (RCA), hyperbranched rolling circle amplification (HRCA), strand displacement amplification (SDA), helicase-dependent amplification (HD A), PWGA or any other nucleic acid amplification method using techniques well known to those of skill in the art. “Polymerase chain reaction,” or “PCR,” refers to a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates. Usually, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. Particular temperatures, durations at each step, and rates of change between steps depend on many factors well-known to those of ordinary skill in the art, e.g., exemplified by the references: McPherson et al., editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional PCR using Taq DNA polymerase, a double stranded target nucleic acid may be denatured at a temperature greater than 90 °C, primers annealed at a temperature in the range 50-75 °C, and primers extended at a temperature in the range 72-78 °C. In certain aspects, a double stranded target nucleic acid may be denatured at a temperature greater than 90 °C in a conventional PCR using Taq DNA polymerase, or by adding formamide at 60 °C in isothermal bridge amplification using Bst polymerase.

[0142] The term “PCR” encompasses derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, assembly PCR and the like. Reaction volumes range from a few hundred nanoliters, e.g., 200 nL, to a few hundred microliters, e.g., 200 microliters. “Reverse transcription PCR,” or “RT-PCR,” means a PCR that is preceded by a reverse transcription reaction that converts a target RNA to a complementary single stranded DNA, which is then amplified, e.g., Tecott et al., U.S. Patent No. 5,168,038. “Real-time PCR” means a PCR for which the amount of reaction product, i.e., amplicon, is monitored as the reaction proceeds. There are many forms of real-time PCR that differ mainly in the detection chemistries used for monitoring the reaction product, e.g., Gelfand et al., U.S. Patent No. 5,210,015 (“Taqman”); Wittwer et al., U.S. Patent Nos. 6,174,670 and 6,569,627 (intercalating dyes); Tyagi et al., U.S. Patent No. 5,925,517 (molecular beacons). Detection chemistries for real-time PCR are reviewed in Mackay et al., Nucleic Acids Research, 30: 1292- 1305 (2002). “Nested PCR” means a two-stage PCR wherein the amplicon of a first PCR becomes the sample for a second PCR using a new set of primers, at least one of which binds to an interior location of the first amplicon. As used herein, “initial primers” in reference to a nested amplification reaction mean the primers used to generate a first amplicon, and “secondary primers” mean the one or more primers used to generate a second, or nested, amplicon. “Multiplexed PCR” means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g. Bernard et al. (1999) Anal. Biochem., 273:221-228 (two-color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. “Quantitative PCR” means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Techniques for quantitative PCR are well-known to those of ordinary skill in the art, as exemplified in the following references: Freeman et al., Biotechniques, 26: 112-126 (1999); Becker-Andre et al., Nucleic Acids Research, 17:9437-9447 (1989); Zimmerman et al., Biotechniques, 21 :268-279 (1996); Diviacco et al., Gene, 122:3013-3020 (1992); Becker-Andre et al., Nucleic Acids Research, 17:9437-9446 (1989); and the like.

[0143] Determination of the sequence of a nucleic acid sequence of interest can be performed using variety of sequencing methods known in the art including, but not limited to, sequencing by hybridization (SBH), sequencing by ligation (SBL), quantitative incremental fluorescent nucleotide addition sequencing (QIFNAS), stepwise ligation and cleavage, fluorescence resonance energy transfer (FRET), molecular beacons, TaqMan reporter probe digestion, pyrosequencing, and multiplex sequencing (Porreca et al (2007) Nat. Methods 4:931). Commercially available high-throughput sequencing methods, e.g., on cyclic array sequencing using platforms such as Roche 454, Illumina Solexa, AB-SOLiD, Helicos, Polonator, Ion Torrent semiconductor sequencing technology, single-molecule real-time (SMRT) sequencing from Pacific Biosciences, Nanopore-based sequencing from Oxford Nanopore Technologies, platforms and the like, can be utilized. Exemplary sequencing platforms useful with the present disclosure and adaptable to the methods described herein are described in Reuter et al., High-Throughput Sequencing Technologies, Mol. Cell (2015); 58(4): 586-597 hereby incorporated by reference in its entirety.

[0144] The present disclosure provides analysis of the resulting sorted sperm with droplet sequencing. Droplet sequencing, also known as droplet-based single-cell sequencing, is a cutting- edge technology used in genomics research to analyze the genetic material of individual cells with exceptional precision and throughput. In this method, individual sperm are encapsulated in tiny water droplets, each containing a unique molecular barcode and a sperm’s genetic material. These droplets serve as isolated reaction chambers, allowing for simultaneous processing of numerous cells. Within each droplet, DNA is reverse-transcribed into complementary DNA (cDNA) and tagged with the unique molecular barcode. After this, the droplets are broken, and all the resulting cDNA molecules are pooled together for sequencing. This approach enables the parallel analysis of a large number of cells, providing insights into the gene expression profiles or genomic variations of individual sperm. A recent study shows success in using this type of method to isolate individual sperm genetic material (See Carioscia, S.A., Weaver, K.J., Bortvin, A.N., Pan, H., Ariad, D., Bell, A.D., and McCoy, R.C. (2022). A method for low-coverage single-gamete sequence analysis demonstrates adherence to Mendel’s first law across a large sample of human sperm. eLife 11, e76383. 10.7554 / eLife.76383).

[0145] Although the goal of the method is to obtain 100% precision for sorting the normal sperm, it is to be understood that less than 100% precision, such as 95-99% precision to select for normal embryos is contemplated. C. Genomic and Epigenomic Integrity

[0146] The present disclosure contemplates that the methods described herein limit or otherwise do not affect the genomic and epigenomic integrity of the sorted sperm. Genome sequencing involves mapping out the entire DNA sequence of an organism, which can help identify any genetic mutations, alterations, or anomalies that may have occurred during the procedure. Whereas epigenome sequencing delves deeper into the epigenetic modifications that regulate gene expression without altering the underlying DNA sequence. These techniques are applied to a portion of the pre-sorted and sorted sperm and provide comprehensive insights into any changes the sorting procedure(s) could have done.

[0147] Genome sequencing involves several key steps, starting with the extraction of DNA from the specific sperm and the creation of a sequencing library through fragmentation and adapter ligation. Various sequencing technologies are then employed to read the DNA’s nucleotide sequence. Bioinformatics pipelines are used to align the sequencing reads to a reference genome, enabling the identification of genetic variations like single nucleotide polymorphisms and structural changes. This data comparison between pre- and post-procedure genomes allows researchers to assess genetic integrity. On the other hand, epigenome sequencing involves distinct techniques for different epigenetic features. For DNA methylation analysis, bisulfite sequencing is commonly used. Bisulfite sequencing (BS-Seq) or whole-genome bisulfite sequencing (WGBS) is a well-established protocol to detect methylated cytosines in genomic DNA. In this method, genomic DNA is treated with sodium bisulfite and then sequenced, providing single-base resolution of methylated cytosines in the genome. Upon bisulfite treatment, unmethylated cytosines are deaminated to uracils which, upon sequencing, are converted to thymidines. Simultaneously, methylated cytosines resist deamination and are read as cytosines. The location of the methylated cytosines can then be determined by comparing treated and untreated sequences. See Feil et. al., (1994) Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res 22: 695-696; Berman et. al., (2012) Regions of focal DNA hypermethylation and long-range hypomethylation in colorectal cancer coincide with nuclear lamina-associated domains. Nat Genet 44: 40-46; Lister et. al., (2009) Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462: 315-322.

[0148] The combination of these approaches, and thorough analyses of adequate numbers of technical and biological replicates is contemplated for determining safety and effectiveness of methods to sort sperm to be used in human reproduction.

[0149] EXAMPLE IV

[0150] Fertilization and Follow-Up

[0151] Once separated, normal sperm may be transferred to a fertility clinic, where the licensed fertility professional inserts the sperm through IUI into the receiving uterus, or for use to fertilize an egg for IVF. This method can be done with or without ovulation tracking or fertility hormones. In addition, the method of IUI can be instead performed at home by a trained midwife, further allowing couples the choice in how to conceive.

[0152] Following IUI or IVF treatment, conception success is evaluated closely. This is especially critical early on to ensure that any fertilized eggs are not ectopic, and growing in the correct place. When appropriate, blood-based DNA testing is performed to determine key aspects of the genetics of the growing embryo, in particular to confirm the sperm separation successfully resulted in a normal embryo.

[0153] The following Examples V-IX describe use of a probe to distinguish and separate sperm having a target genetic element from sperm lacking the target genetic element, using the X- chromosome as an example.

[0154] EXAMPLE V Sperm Processing

[0155] Media

[0156] Sperm preparation media for bovine sperm (Bos taurus) used for diluting and washing sperm samples during preparation was Dulbecco’s Phosphate Buffered Saline (DPBS, lx). DPBS contains 137 mM NaCl, 2.7 mM KC1, 1.5 mM KH2PO4, and 8.1 mM Na2HPO4 at pH 7.4, equilibrated at room temperature (RT). It is contemplated that the composition of DPBS can be varied such as by addition of BSA. In addition, it is contemplated that the pH and equilibration temperature can also be varied.

[0157] Semen Samples

[0158] Semen straws containing bovine semen were sourced from a commercial bovine semen repository and stored in liquid nitrogen at -196 °C to preserve viability. Semen was purchased either as unmodified, or having undergone sex selection (“sex sorted”) using standard Hoechstbased techniques.

[0159] Semen Processing

[0160] Frozen straws were thawed by immersion in a 37 °C water bath for ten seconds. Thawed samples were immediately transferred to sterile Eppendorf tubes for processing. Initially, 950 pL of DPBS (lx) was added to dilute the semen, reducing fluid viscosity and facilitating removal of excess proteins. Samples were then centrifuged at 500 RCF for 10 minutes at room temperature (RT), and the supernatant was carefully discarded to avoid disturbing the remaining sperm well.

[0161] The sperm pellet was gently resuspended in 950 pL of DPBS (lx) by pipetting up and down 10 times to achieve a uniform suspension. Following this, the sample underwent a second centrifugation at 500 RCF for five minutes at RT to ensure further removal of residual seminal fluid. After this final wash, the pellet was resuspended in 1000 pL of DPBS (lx). To remove clumps, the sperm suspension was passed through a 40 pm filter. The filtered solution was then gently resuspended to ensure even distribution as well as to obtain the volume of each sample. A small aliquot was taken for cell counting and diluted 1 : 10 to facilitate counting. An automated cell counter was employed to determine the concentration via brightfield imaging, using spermspecific settings for accuracy. Each count was verified for consistency and accuracy. For experimental applications, the target sperm concentration was set at 5 million cells / mL, with dilution adjustments made accordingly based on initial concentration measurements.

[0162] EXAMPLE VI

[0163] Probe Design and Generation

[0164] A computational approach was employed to design the probe used in the experiments described herein, specifically targeting repetitive elements unique to the X chromosome in the bovine genome (Bos taurus genome assembly ARS-UCD2.0). The probe includes a DNA-binding nucleic acid portion, a detectable label and a cell penetrating peptide. Specifications of each DNA-binding nucleic acid portion of the probe (candidate) were between 15-20 nucleotides and present in at least 50 duplicates in the X chromosome, and present 0 times in any other chromosome. Care was taken to ensure each candidate was specific up to two nucleotides on each 5’ and 3’ end, and that reverse complementarity was considered. BLAST analyses confirmed the specificity of each candidate. Candidates were assessed for optimal length, purine stretch, purine content, G content, and the presence of secondary structures, such as hairpins from complementary sequences. One identified nucleic acid portion, TCACGTGCGTGCCTCGGCGC, is complementary to an X chromosome-specific repetitive element present 98 times within the bovine X chromosome, with no occurrences in other bovine chromosomes, including the Y chromosome and mitochondrial DNA. This candidate was selected for the DNA-binding nucleic acid portion of the probe.

[0165] To visualize the probe, an ATTO647N fluorophore was attached to the probe. This fhiorophore allows visualization of the probe with an excitation peak of 644 nm and an emission peak of 669 nm. For efficient entry into sperm cells, a cell-penetrating peptide was attached to the probe, such as a Tat cell-penetrating peptide (sequence: YGRKKRRQRRR). According to one aspect, the probe was designed where the fluorophore was attached to the cell-penetrating peptide using an -O- linker and the cell-penetrating peptide was attached to the DNA-binding nucleic acid portion using an -O- linker. According to one aspect, to enhance the solubility and stability of the probe, miniPEG gamma-modified PNA units were incorporated at specific positions within the DNA-binding nucleic acid portion. The complete sequence for the X chromosome-targeting PNA probe was ATTO647N-O-YGRKKRRQRRR-O- TCACGT*GCGT*GCCT*CGGCGC, where the asterisk (*) indicates positions with gamma- PNA modifications.

[0166] The probe was synthesized by PNA Bio, Inc. using standard Fmoc-based solid-phase peptide synthesis with PNA monomers. Following synthesis, the probe was purified using high- performance liquid chromatography (HPLC). Quality control was verified using nuclear magnetic resonance (NMR) spectroscopy. After purification, the probe was lyophilized and shipped on dry ice, where it was reconstituted in molecular-grade water to a stock concentration of 100 pM. Working concentrations were prepared by diluting the stock to 0.5 pM. The diluted aliquots were dispensed into amber tubes to protect against photodegradation and stored at -80°C to maintain stability until use.

[0167] EXAMPLE VII

[0168] Transfection of a Probe into Sperm Cells and

[0169] Targeting of the Probe to a Target Sequence Within the X Chromosome of the Sperm Cells

[0170] Probe Preparation

[0171] The probe stock solution was thawed and briefly heated to 56°C for 5 minutes to promote solubility. Following heating, the solution was centrifuged at maximum speed for 10 minutes to pellet any insoluble material. The supernatant, containing soluble probe, was carefully collected for use in transfection.

[0172] Transfection Setup

[0173] For each reaction, 200 uL of bovine sperm suspension (5 million cells / mL) was aliquoted into individual tubes. Individual control tubes were prepared for each probe and untransfected control. Hoechst 33342 was added to all reactions with unsorted bovine sperm at a 1 : 1000 dilution from the original stock (0.9 mM), resulting in a final concentration of 0.9 pM. Probe was added at a 1 :200 dilution from the original stock (0.5 pM), resulting in a final concentration of 0.0025 pM. Each reaction was mixed thoroughly with the sperm by gentle pipetting to ensure even distribution.

[0174] Incubation and Washing:

[0175] After preparation, samples were incubated in a 37 °C water bath for 15 minutes to allow for uptake. Following incubation, each sperm sample was washed once with DPBS (lx) to remove unbound molecules. Sperm were then resuspended in fresh DPBS (lx) for subsequent analysis.

[0176] EXAMPLE VIII

[0177] Probe Detection

[0178] Microscopy Imaging

[0179] Aliquots of each condition were pipetted onto glass microscope slides, followed by gentle placement of a glass cover slip to ensure partial immobilization suitable for high-resolution imaging. Slides were then visualized on Abberior STEDYCON STED & Confocal microscope. The microscope was configured for the following excitation lines: 405 nm (Hoechst) and 640nm (probe). Images were captured with a 20x 0.5 na AIR objective, with laser power and exposure times optimized to avoid photobleaching while maintaining signal clarity. Each slide was imaged in multiple fields to ensure representative sampling.

[0180] Captured images were exported in TIFF format for post-imaging analysis. Fiji (Imaged) software was used to analyze fluorescence intensity and signal localization, and facilitate overlay co-localization analyses.

[0181] Flow Cytometry Analysis

[0182] Flow cytometry was conducted using the Sony SH800S Cell Sorter, equipped with Filter Set 2, allowing for the detection of fluorescently labeled sperm cells. A 100 pm sorting chip was utilized, optimized for the size and morphology of sperm cells. The instrument was configured to detect fluorescence in two channels: FL1 was used to capture Hoechst fluorescence, and FL4 was used to detect the probe. Voltages for each channel were fine-tuned to maximize signal intensity while minimizing background fluorescence.

[0183] Samples were analyzed sequentially as per the experimental conditions. Forward Scatter Area (FSC-A) and Side Scatter Area (SSC-A) were used to distinguish sperm from debris and other particles based on size. To ensure analysis of only single-cell sperm, a gate using SSC-A (Side Scatter Area) and SSC-H (Side Scatter Height) was applied to exclude any events deviating from linearity. Finally, the FL4 channel was utilized to detect fluorescence from the probe (PNA probe). A control sample was first analyzed without the probe (PNA probe) to establish baseline fluorescence levels, setting a gate that would exclude any background or autofluorescence signal. This gate was then applied to the experimental conditions, allowing identification of sperm with fluorescence from the probe (PNA probe).

[0184] Fig. 4 is a schematic of probe localization within the X chromosome in bovine sperm in accordance with the methods described herein. Fig. 5A is an image analysis of unsorted sperm, with Hoechst facilitating nuclear visualization. As can be seen in this negative control sample, no significant fluorescence was detected in the channel designated for ATTO647N fluorescence.

[0185] Fig. 5B is an image analysis of unsorted sperm transfected with the probe described herein, with Hoechst facilitating nuclear visualization. As can be seen, the probe has been successfully transfected into sperm cells where it can be visualized in a subset of sperm which are presumed to contain an X-chromosome. Sperm lacking probe visualization are presumed sperm which lack an X-chromosome.

[0186] Fig. 6A depict data from flow cytometry analyses of the addition of the probe on unsorted bovine sperm. FL4-A+ gating demonstrates population that is positive for the uptake of the probe, demonstrating that a probe can be designed to bind to a target sequence within sperm cells and which resolves differences between living bovine sperm.

[0187] Fig. 6B depict data from flow cytometry analyses of the addition of the probe and Hoechst on unsorted bovine sperm. FL4-A+ gating demonstrates population that is positive for the uptake of the probe, demonstrating that a probe can be designed to bind to a target sequence within sperm cells and which resolves differences between living bovine sperm, with differentiation observable even in the presence of Hoechst staining.

[0188] Fig. 6C depict data from flow cytometry analyses of the addition of the probe and Hoechst on commercially sex sorted bovine sperm. FL4-A+ gating demonstrates population that is positive for the uptake of the probe, demonstrating that a probe can be designed to bind to a target sequence within sperm cells and which resolves differences between living bovine sperm. Notably, the population shows an increased shift in the FL4-A channel, suggesting higher uptake of the PNA probe as compared to unsorted bovine sperm.

[0189] EXAMPLE IX

[0190] Separation of Sperm Cells Based on Probe Binding As described herein, a sample of sperm cells can be produced with one or more or a plurality of sperm cells having a fluorescent probe hybridized to a target nucleic acid sequence within the sperm cells. According to certain aspects, the sperm cells with the fluorescent probe hybridized to a target nucleic acid sequence therein can be separated from sperm cells lacking the probe using methods known to those of skill in the art, such as FACS, microfluidic cell sorting, mechanical separation based on manual manipulation using microscopy and handling techniques. In this manner, a sperm sample can be produced which is enriched in sperm lacking the probe. In this manner, a sperm sample can be produced which is enriched in sperm including the probe. According to one aspect, the sperm sample which is enriched in sperm lacking the probe can be used for fertilization. According to one aspect, the sperm sample which is enriched in sperm including the probe can be used for fertilization.

[0191] EMBODIMENTS

[0192] The present disclosure provides a method of sorting sperm cells including the steps of contacting a sample of sperm cells with a binding agent to a target genetic element within the sperm cells in a manner for the binding agent to bind to target genetic element, separating sperm cells with the bound binding agent from sperm cells lacking the bound binding agent, based on the presence of the bound binding agent. The present disclosure provides a method of sorting sperm cells capable of transmitting a heritable disease from sperm cells incapable of transmitting the heritable disease including the steps of contacting a sample of sperm cells with a binding agent to a target genetic element within the sperm cells in a manner for the binding agent to bind to target genetic element, separating sperm cells with the bound binding agent from sperm cells lacking the bound binding agent, based on the presence of the bound binding agent. According to one aspect, the sperm cells with the bound binding agent include a genetic variant associated with a heritable genetic disorder. According to one aspect, the sperm cells with the bound binding agent lack a genetic variant associated with a heritable genetic disorder. According to one aspect, the binding agent comprises an oligonucleotide including a fluorescent moiety attached thereto. According to one aspect, the binding agent comprises an oligonucleotide probe including a fluorescent moiety attached thereto, and sperm cells with the oligonucleotide are separated from sperm cells lacking the oligonucleotide based on the presence of the fluorescent moiety. According to one aspect, the oligonucleotide probe is a fluorescent in situ hybridization (FISH) probe, a molecular beacon probe, a triplex-forming oligonucleotide, or a peptide nucleic acid (PNA). According to one aspect, separating the sperm cells with the oligonucleotide probe from sperm cells lacking the oligonucleotide probe comprises fluorescent-activated cell sorting (FACS), microfluidic cell sorting or manual cell sorting. According to one aspect, the binding agent comprises an inactivating agent, wherein the inactivating agent inactivates the sperm having the inactivating agent therein, and wherein inactivated sperm is separated from active sperm. According to one aspect, the inactivating agent is an inhibitor of soluble adenylyl cyclase (sAC). According to one aspect, the sperm cells are mammalian sperm cells. According to one aspect, the sperm cells are human sperm cells. According to one aspect, the sperm cells are bull sperm cells.

[0193] EQUIVALENTS

[0194] Other embodiments will be evident to those of skill in the art. It is to be understood that the embodiments of the present invention which have been described are merely illustrative of some of the applications of the principles of the present invention. Numerous modifications may be made by those skilled in the art based upon the teachings presented herein without departing from the true spirit and scope of the invention. It should be understood that the foregoing description is provided for clarity only and is merely exemplary. The spirit and scope of the present invention are not limited to the above example, but are encompassed by the claims. The specific details of particular embodiments may be combined in any suitable manner without departing from the spirit and scope of embodiments of the invention. However, other embodiments of the invention may be directed to specific embodiments relating to each individual aspect, or specific combinations of these individual aspects. All publications, patents and patent applications cited above are incorporated by reference herein in their entirety for all purposes to the same extent as if each individual publication or patent application were specifically indicated to be so incorporated by reference.

Claims

Claims:

1. A method of sorting sperm cells comprising contacting a sample of sperm cells with a binding agent to a target genetic element within the sperm cells in a manner for the binding agent to bind to target genetic element, separating sperm cells with the bound binding agent from sperm cells lacking the bound binding agent, based on the presence of the bound binding agent.

2. The method of claim 1 wherein the sperm cells with the bound binding agent include a genetic variant associated with a heritable genetic disorder.

3. The method of claim 1 wherein the sperm cells with the bound binding agent lack a genetic variant associated with a heritable genetic disorder.

4. The method of claim 1 wherein the binding agent comprises an oligonucleotide including a fluorescent moiety attached thereto.

5. The method of claim 1 wherein the binding agent comprises an oligonucleotide probe including a fluorescent moiety attached thereto, and sperm cells with the oligonucleotide are separated from sperm cells lacking the oligonucleotide based on the presence of the fluorescent moiety.

6. The method of claim 5 wherein the oligonucleotide probe is a fluorescent in situ hybridization (FISH) probe, a molecular beacon probe, a triplex-forming oligonucleotide, or a peptide nucleic acid (PNA).

7. The method of claim 6 wherein separating the sperm cells with the oligonucleotide probe from sperm cells lacking the oligonucleotide probe comprises fluorescent-activated cell sorting (FACS), microfluidic cell sorting or manual cell sorting.

8. The method of claim 1 wherein the binding agent comprises an inactivating agent, wherein the inactivating agent inactivates the sperm having the inactivating agent therein, and wherein inactivated sperm is separated from active sperm.

9. The method of claim 8 wherein the inactivating agent is an inhibitor of soluble adenylyl cyclase (sAC).

10. The method of claim 1 wherein the sperm cells are mammalian sperm cells.

11. The method of claim 1 wherein the sperm cells are human sperm cells.12 The method of claim 1 wherein the sperm cells are bull sperm cells.

13. The method of claim 1 wherein the target genetic element is within an X- chromosome of sperm cells and sperm cells including an X-chromosome are separated from sperm cells lacking an X-chromosome, based on the presence of the bound binding agent.

14. A method of sorting sperm cells capable of transmitting a heritable disease from sperm cells incapable of transmitting the heritable disease comprising contacting a sample of sperm cells with a binding agent to a target genetic element within the sperm cells in a manner for the binding agent to bind to target genetic element, separating sperm cells with the bound binding agent from sperm cells lacking the bound binding agent, based on the presence of the bound binding agent.

Images