Novel glnh protein mutant and method for producing l-glutamic acid by using same

By introducing a novel GlnH protein variant with specific amino acid substitutions into Corynebacterium glutamicum, the production of L-glutamic acid is significantly enhanced, addressing inefficiencies in current microbial fermentation methods.

WO2025110665A1PCT designated stage expired Publication Date: 2025-05-30DAESANG CORP
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/018215
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-23
Filing Date
2024-11-19
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current methods for producing L-glutamic acid through microbial fermentation are limited by the inefficiencies in the oxidative metabolic pathway from α-ketoglutaric acid to succinic acid, and there is a need for improved strains with enhanced production capabilities.

Method used

Development of a novel GlnH protein variant with specific amino acid substitutions, such as threonine to isoleucine at position 11 and threonine to alanine at position 165, which are introduced into recombinant microorganisms like Corynebacterium glutamicum to enhance L-glutamic acid production.

Benefits of technology

The introduction of the GlnH protein variant into Corynebacterium glutamicum strains results in improved L-glutamic acid production, with increases ranging from 13.0% to 22.2% compared to the parent strain, demonstrating enhanced productivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024018215_30052025_PF_FP_ABST
    Figure KR2024018215_30052025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a novel GlnH protein mutant and a method for producing L-glutamic acid by using same. In the GlnH protein mutant, one or more amino acids from among amino acid sequences constituting a GlnH protein are substituted to change protein activity, and thus L-glutamic acid can be efficiently produced from a recombinant microorganism comprising the mutant.
Need to check novelty before this filing date? Find Prior Art

Description

Novel GLNH protein variant and method for producing L-glutamic acid using the same

[0001] The present invention relates to a novel GlnH protein variant and a method for producing L-glutamic acid using the same.

[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation, and its salt form, monosodium L-glutamate (MSG), adds balance and harmony to the overall taste of food, increasing the preference for foods such as meat, fish, chicken, vegetables, sauces, soups, and seasonings, and can enhance the taste of low-salt foods with up to 30% less salt, so it is widely used as a seasoning for household and processed food production.

[0003] A brief look at the fermentation pathway of L-glutamic acid reveals that glucose primarily passes through the glycolytic pathway, but some is metabolized through the pentose phosphate pathway into two molecules of pyruvate. One molecule fixes CO2 to become oxaloacetic acid, and the other combines with acetyl CoA from pyruvate to form citric acid. Oxaloacetate and citric acid then enter the citric acid cycle (TCA cycle) to become α-ketoglutaric acid. Here, the reductive amino acid oxidation of alpha-ketoglutarate proceeds efficiently to produce L-glutamic acid because the oxidative metabolic pathway from alpha-ketoglutarate to succinic acid is absent and isocitrate dehydrogenase and glutamate dehydrogenase are closely involved.

[0004] L-glutamic acid can be produced using wild-type strains obtained from nature or mutant strains modified to enhance their glutamic acid production capacity. Recently, to improve the efficiency of L-glutamic acid production, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of useful substances such as amino acids and nucleic acids. Various recombinant strains or mutant strains with excellent L-glutamic acid production capacity, as well as methods for producing L-glutamic acid using them, have been developed. In particular, attempts have been made to increase L-glutamic acid production by directly inducing mutations in genes such as enzymes, transcription factors, and transport proteins involved in the L-glutamic acid biosynthetic pathway, or by inducing mutations in promoters that regulate their expression. However, since there are dozens to hundreds of proteins, such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-glutamic acid production, much research is still needed to determine whether changes in the activity of these proteins increase L-glutamic acid production.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] (Patent Document 1) U.S. Patent No. 6,852,516

[0008] (Patent Document 2) U.S. Patent No. 6,962,805

[0009] The present invention aims to provide a novel GlnH protein variant.

[0010] In addition, the present invention aims to provide a polynucleotide encoding the above mutant.

[0011] In addition, the present invention aims to provide a non-human transformant comprising the mutant or polynucleotide.

[0012] In addition, the present invention aims to provide a method for producing L-glutamic acid using the transformant.

[0013] One aspect of the present invention provides a GlnH protein variant selected from the group consisting of the following (1) to (3):

[0014] (1) A GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 4, in which the 11th threonine in the amino acid sequence of SEQ ID NO: 2 is replaced with isoleucine;

[0015] (2) A GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 6, in which the 165th threonine in the amino acid sequence of SEQ ID NO: 2 is replaced with alanine; and

[0016] (3) A GlnH protein variant consisting of the amino acid sequence of sequence number 8, in which the 11th threonine in the amino acid sequence of sequence number 2 is substituted with isoleucine and the 165th threonine is substituted with alanine.

[0017] The “GlnH protein” used in the present invention is a periplasmic binding protein that is involved in material transport and is known to function as an extracellular sensor in particular. The GlnH protein in the present invention may be a polypeptide encoded by the glnH gene or the Cgl2750 gene and having GlnH protein activity, but is not limited thereto.

[0018] Nucleic acid and protein sequence information for the above GlnH protein can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0019] According to one specific example of the present invention, the GlnH protein may be encoded by the base sequence of SEQ ID NO: 1 and may be composed of the amino acid sequence of SEQ ID NO: 2.

[0020] The amino acid sequence of the GlnH protein according to the present invention or the base sequence encoding the same may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity compared to each sequence, and may have an original function. Here, “homology” or “identity” means the rate of agreement (%) between a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence when they are aligned and analyzed to correspond as much as possible.

[0021] According to one specific example of the present invention, the GlnH protein or the gene encoding it may be derived from wild type Corynebacterium glutamicum.

[0022] The term "variant" as used herein refers to a protein whose amino acid sequence is different from the original amino acid sequence due to a change in the base sequence of the gene encoding the protein. More specifically, a gene sequence variation is a change in one or more bases or nucleotides in the sequence constituting the gene due to substitution, insertion, deletion, etc., and the resulting translated polypeptide or protein is a protein variant in which one or more amino acids in the N-terminus, C-terminus, and / or internal portion of the amino acid sequence are conservatively substituted and / or modified, so that the polypeptide or protein differs from the amino acid sequence before the mutation, but the functions or properties are maintained. Here, a "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties, and may have little or no effect on the activity of the protein or polypeptide. The amino acids are selected from alanine (Ala), isoleucine (Ile), valine (Val), leucine (Leu), methionine (Met), asparagine (Asn), cysteine ​​(Cys), glutamine (Gln), serine (Ser), threonine (Thr), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), aspartic acid (Asp), glutamic acid (Glu), arginine (Arg), histidine (His), lysine (Lys), glycine (Gly), and proline (Pro).

[0023] Additionally, variants include those in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted, or portions are deleted from the N- and / or C-terminus of the mature protein.

[0024] Such variants may have increased (enhanced), unchanged, or decreased (weakened) abilities compared to the pre-mutation protein. Here, "increased or enhanced" includes cases where the activity of the protein itself is increased compared to the pre-mutation protein, cases where the overall enzyme activity level in the cell is higher than that of the wild-type strain or the strain expressing the pre-mutation protein due to increased expression or translation of the gene encoding the protein, and combinations thereof. In addition, "decreased or weakened" includes cases where the activity of the protein itself is decreased compared to the pre-mutation protein, cases where the overall enzyme activity level in the cell is lower than that of the wild-type strain or the strain expressing the pre-mutation protein due to inhibition of expression or translation of the gene encoding the protein, and combinations thereof. In the present invention, the term "variant" may be used interchangeably with "variant," "modification," "variant polypeptide," "mutated protein," "mutant," etc.

[0025] The GlnH protein variant according to the present invention may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with respect to the amino acid sequence of SEQ ID NO: 4, 6 or 8, excluding the mutation position (the 11th and / or 165th amino acid residue), and may include, without limitation, any amino acid sequence that maintains the function or property of the variant.

[0026]

[0027] Another aspect of the present invention provides a polynucleotide encoding the GlnH protein variant.

[0028] The "polynucleotide" used in the present invention refers to a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, and is a DNA or RNA strand of a certain length or longer, and more specifically, refers to a polynucleotide fragment encoding the protein variant.

[0029] According to one specific example of the present invention, the polynucleotide comprises a base sequence encoding an amino acid sequence of SEQ ID NO: 4, 6 or 8, for example, may comprise a base sequence of SEQ ID NO: 3, 5 or 7.

[0030]

[0031] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the GlnH protein variant.

[0032] In addition, another aspect of the present invention provides a transformant comprising the GlnH protein variant or polynucleotide.

[0033] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a host cell. Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0034] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0035] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0036] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0037] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0038] A transformant can be created by inserting a recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0039] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, various strains of Escherichia coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, strains of Corynebacterium, strains of Bacillus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas species.

[0040] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0041] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0042] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0043] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0044] The transformant of the present invention may be other than a human.

[0045] According to one specific example of the present invention, the transformant may be a strain of the genus Corynebacterium.

[0046] The above-mentioned strains of the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium. Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium Corynebacterium pollutisoli, Corynebacterium imitans,It may be, but is not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi or Corynebacterium flavescens.

[0047] The transformant in the present invention may be, but is not limited to, a strain comprising the above-described GlnH protein variant or a polynucleotide encoding the same, or a vector comprising the same, a strain expressing the GlnH protein variant or polynucleotide, or a strain having activity against the GlnH protein variant.

[0048] The transformant of the present invention may include other protein variants or genetic mutations in addition to the GlnH protein variant.

[0049] According to one specific example of the present invention, the transformant may have the ability to produce L-glutamic acid.

[0050] The above transformant may have a natural ability to produce L-glutamic acid, or may have an artificial ability to produce L-glutamic acid.

[0051] According to one specific example of the present invention, the transformant may have an improved L-glutamic acid production ability due to a change in the activity of the GlnH protein mutant.

[0052] As used herein, "improved productivity" means increased productivity of L-glutamic acid compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a strain that is directly the target of mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium strain that does not have L-glutamic acid production ability or has L-glutamic acid production ability, or a Corynebacterium strain that is mutated therefrom.

[0053] The transformant according to the present invention exhibits increased L-glutamic acid production ability compared to a strain (parent strain) containing the protein before the mutation, due to changes in the activity of the GlnH protein mutant introduced into the transformant. More specifically, the transformant may have an increase in L-glutamic acid production of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or may have an increase of 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold, but is not limited thereto. For example, a transformant including the GlnH protein variant may have an increase in L-glutamic acid production of 5% or more, specifically 5 to 50% (preferably 10 to 40%) compared to the parent strain.

[0054] A composition comprising a transformant according to the present invention can be used as a composition for producing L-glutamic acid.

[0055]

[0056] Another aspect of the present invention provides a method for producing L-glutamic acid, comprising the steps of culturing the transformant in a medium; and recovering L-glutamic acid from the transformant or the medium in which the transformant is cultured.

[0057] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0058] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0059] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0060] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0061] According to one specific example of the present invention, the step of recovering L-glutamic acid from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-glutamic acid produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0062] According to one specific example of the present invention, the step of recovering the L-glutamic acid may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0063] According to one specific example of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid.

[0064] The GlnH protein variant according to the present invention has protein activity changed by substituting one or more amino acids in the amino acid sequence constituting the GlnH protein, so that L-glutamic acid can be efficiently produced from a recombinant microorganism including the variant.

[0065] Figure 1 shows the structure of plasmid pK19msb according to one embodiment of the present invention.

[0066] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0067]

[0068] Example 1. Production of a strain expressing a GlnH protein mutant

[0069] In order to confirm the effects of a mutant in which threonine at position 11 in the amino acid sequence of the GlnH protein (SEQ ID NO: 2) is substituted with isoleucine (T11I, SEQ ID NO: 4), a mutant in which threonine at position 165 is substituted with alanine (T165A, SEQ ID NO: 6), and a mutant in which threonine at position 11 is substituted with isoleucine and threonine at position 165 is substituted with alanine (T11I+T165A, SEQ ID NO: 8) on the production of L-glutamic acid, a vector expressing the GlnH protein mutant and a strain into which the vector was introduced were constructed.

[0070]

[0071] 1-1. Production of vectors for transformation

[0072] Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, each PCR was performed using the primer pairs of primers 1 and 2 and primer pairs of primers 3 and 6. Two PCR products of approximately 0.5 kb and 1 kb in size amplified through PCR were mixed and used as templates, and overlapping PCR was performed with the primer pairs of primers 1 and 6 to link them into one fragment (P1).

[0073] Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using the primer pairs of primers 1 and 4 and primer pairs of primers 5 and 6, and fragments of approximately 1 kb and 0.5 kb in size were obtained. These were mixed and used as a template, and overlapping PCR was performed using the primer pair of primers 1 and 6 to obtain one fragment (P2).

[0074] Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using the primer pairs of primers 1 and 2, primer pairs of primers 3 and 4, and primer pairs of primers 5 and 6, resulting in three PCR products of approximately 0.5 kb in size. These were mixed and used as templates, and overlapping PCR was performed with the primer pair of primers 1 and 6 to link them into a single fragment (P3).

[0075] After treating the pK19msb vector (SEQ ID NO: 9) with the restriction enzyme smaI (NEB), each fragment P1, P2, and P3 was cloned using T4 ligase. The three vectors constructed in this way were named pK_glnH(T11I), pK_glnH(T165A), and pk_glnH(T11I+T165A).

[0076] All PCRs used pfu premix (bioneer), and were denatured at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by a final extension at 72°C for 5 minutes.

[0077] The primer sequences used for vector construction are as shown in Table 1 below.

[0078] Primer nameSequence numberPrimer sequence (5'-3')Primer 1Sequence number 10GAGACGTTGTCGTTGGTGCGPrimer 2Sequence number 11CGCGTGATGAGTGGAGGGPrimer 3Sequence number 12CCCTCCACTCATCACGCGPrimer 4Sequence number 13GTCGGTGATCGCGACGGAACPrimer 5Sequence number 14GTTCCGTCGCGATCACCGACPrimer 6Sequence number 15TTATCCTTCATCGTTTTCTGTCCC

[0079]

[0080] 1-2. Production of L-glutamic acid producing strain with GlnH protein mutant introduced

[0081] Using the three types of vectors above, mutant strains were produced as follows.

[0082] The final concentration of each vector was prepared to be 1 μg / μl or higher, and electroporated into Corynebacterium glutamicum U3 (KCCM13218P) (Ref. Tauch et al., FEMS Microbiology letters 123 (1994) 343-347). 1 ml of regeneration medium (containing 18.5 g / ℓ of Brain Heart infusion and 91 g / ℓ of sorbitol) was added and heat-treated at 46°C for 6 minutes. After treatment, the cells were transferred to a 15-ml cap tube, cultured at 30°C for 2 hours, and plated on selection medium (containing 5 g / ℓ of tryptone, 5 g / ℓ of NaCl, 2.5 g / ℓ of yeast extract, 18.5 g / ℓ of Brain Heart infusion powder, and 15 g / ℓ of agar) containing 20 mg / ℓ of kanamycin. Colonies generated by culturing at 30°C for 72 hours were cultured in BHI medium (Brain Heart infusion powder 18.5 g / ℓ) for 15 hours to induce secondary recombination, and 10 -2 ~ 10 -3 The strains were diluted to 10% sucrose and plated on a selective medium to isolate colonies. The isolated colonies were cultured on two types of selective media each containing kanamycin and sucrose, and strains that were not resistant to kanamycin and could grow on a medium containing sucrose were selected. These were named glnH(T11I), glnH(T165A), and glnH(T11I+T165A), respectively.

[0083]

[0084] Experimental Example 1. Evaluation of L-glutamic acid production capacity of strains introduced with GlnH protein variants.

[0085] The L-glutamic acid production ability of the parent strain, Corynebacterium glutamicum U3, and mutant strains introduced with GlnH protein mutants (glnH(T11I), glnH(T165A), and glnH(T11I+T165A)) was compared.

[0086] Each strain (parent strain or mutant) was inoculated at 1% of the volume into a 100 mL flask containing 10 mL of the glutamic acid production medium in Table 2 below, and cultured with shaking at 30°C, 200 rpm, for 48 hours. After completion of culture, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0087] Ingredient content: Glucose 70 g / L (NH4) 2 SO 4 5 g / LM gSO 4 0.4 g / LUrea 2 g / L Soybean hydrolyzate 15 ml / LK H2 PO 4 1 g / LF eSO 4 10 mg / LM nSO 4 10 mg / LThiamine_HCl 200 ug / LBiotin 2 ug / LCaCO 35%

[0088] Strain L-glutamic acid production (g / L) L-glutamic acid concentration increase rate (%) U3 16.2-glnH(T11I) 18.3 13.0glnH(T165A) 18.5 14.2glnH(T11I+T165A) 19.8 22.2

[0089]

[0090] As shown in Table 3 above, the mutant strains glnH(T11I), glnH(T165A), and glnH(T11I+T165A), into which the GlnH protein variant was introduced, were confirmed to have an improved L-glutamic acid production of at least 13.0% and at most 22.2% compared to the parent strain by substituting the 11th threonine with isoleucine and / or the 165th threonine with alanine in the amino acid sequence of the GlnH protein.

[0091]

[0092] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0093] [Accession number]

[0094] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0095] Accession number: KCCM13218P

[0096] Date of acceptance: 20220629

[0097]

Claims

1. A GlnH protein variant selected from the group consisting of (1) to (3): (1) A GlnH protein mutant consisting of an amino acid sequence of sequence number 4, in which the 11th threonine in the amino acid sequence of sequence number 2 is substituted with isoleucine; (2) A GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 6, in which the 165th threonine in the amino acid sequence of SEQ ID NO: 2 is replaced with alanine; and (3) A GlnH protein mutant consisting of an amino acid sequence of sequence number 8, in which the 11th threonine in the amino acid sequence of sequence number 2 is substituted with isoleucine and the 165th threonine is substituted with alanine.

2. A polynucleotide encoding a variant of claim 1.

3. A transformant comprising a variant of claim 1 or a polynucleotide of claim 2.

4. In claim 3, The above transformant is a transformant that is a strain of the genus Corynebacterium.

5. In claim 3, The above transformant is a transformant having the ability to produce L-glutamic acid.

6. A step of culturing the transformant of claim 3 in a medium; and A method for producing L-glutamic acid, comprising a step of recovering L-glutamic acid from the transformant or the medium in which the transformant is cultured.

Citation Information

Patent Citations

  • Method for producing L-glutamic acid by fermentation

    US6852516B2

  • Method of constructing amino acid producing bacterial strains, and method of preparing amino acids by fermentation with the constructed amino acid producing bacterial strains

    US6962805B2

  • L-glutamic acid-producing microorganism and method for producing l-glutamic acid

    JP2007097573A

  • Microoragnism of Corynbacterium genus with an enhanced L-glutamic acid productivity and method of producing L-glutamic acid using the microorganism

    KR100837844B1

  • Microorganism capable of producing L-amino acid, and method for producing L-amino acid

    KR1020110074521A