Mutant microorganism with enhanced l-glutamic acid production capability and method for producing l-glutamic acid using same

By weakening or inactivating the RamB protein activity in a mutant microorganism, the production of L-glutamic acid is significantly enhanced, addressing the challenges of inconsistent improvements in existing methods for amino acid production.

WO2025110666A1PCT designated stage expired Publication Date: 2025-05-30DAESANG CORP
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/018217
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-23
Filing Date
2024-11-19
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current methods for enhancing L-glutamic acid production in microorganisms, such as Corynebacterium, involve inducing mutations in various genes related to the biosynthetic pathway, but the effectiveness of these methods is not consistently proven due to the complexity and number of proteins involved.

Method used

A mutant microorganism with improved L-glutamic acid production ability is created by weakening or inactivating the activity of the RamB protein, a transcriptional regulator involved in acetate metabolism, through genetic modifications such as gene deletion or nucleotide substitutions.

Benefits of technology

The mutant microorganism exhibits increased L-glutamic acid production compared to the parent strain, with production enhancements ranging from 1% to 100% or more, demonstrating the effectiveness of targeting the RamB protein activity for improved amino acid production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024018217_30052025_PF_FP_ABST
    Figure KR2024018217_30052025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a mutant microorganism with enhanced L-glutamic acid production capability and a method for producing L-glutamic acid using same. The mutant microorganism can exhibit improved production yield of L-glutamic acid compared to the parent strain due to the weakened or inactivated activity of the RamB protein.
Need to check novelty before this filing date? Find Prior Art

Description

Mutant microorganism with improved L-glutamic acid production ability and method for producing L-glutamic acid using the same

[0001] The present invention relates to a mutant microorganism having improved L-glutamic acid production ability and a method for producing L-glutamic acid using the same.

[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation, and its salt form, monosodium L-glutamate (MSG), adds balance and harmony to the overall taste of food, increasing the preference for foods such as meat, fish, chicken, vegetables, sauces, soups, and seasonings, and can enhance the taste of low-salt foods with up to 30% less salt, so it is widely used as a seasoning for household and processed food production.

[0003] A brief look at the fermentation pathway of L-glutamic acid reveals that glucose primarily passes through the glycolytic pathway, but some is metabolized through the pentose phosphate pathway into two molecules of pyruvate. One molecule fixes CO2 to become oxaloacetic acid, and the other combines with acetyl CoA from pyruvate to form citric acid. Oxaloacetate and citric acid then enter the citric acid cycle (TCA cycle) to become α-ketoglutaric acid. Here, the reductive amino acid oxidation of alpha-ketoglutarate proceeds efficiently to produce L-glutamic acid because the oxidative metabolic pathway from alpha-ketoglutarate to succinic acid is absent and isocitrate dehydrogenase and glutamate dehydrogenase are closely involved.

[0004] L-glutamic acid can be produced using wild-type strains obtained from nature or mutant strains modified to enhance their glutamic acid production capacity. Recently, to improve the efficiency of L-glutamic acid production, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of useful substances such as amino acids and nucleic acids. Various recombinant strains or mutant strains with excellent L-glutamic acid production capacity, as well as methods for producing L-glutamic acid using them, have been developed. In particular, attempts have been made to increase L-glutamic acid production by directly inducing mutations in genes such as enzymes, transcription factors, and transport proteins involved in the L-glutamic acid biosynthetic pathway, or by inducing mutations in promoters that regulate their expression. However, since there are dozens to hundreds of proteins, such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-glutamic acid production, much research is still needed to determine whether changes in the activity of these proteins increase L-glutamic acid production.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] (Patent Document 1) U.S. Patent No. 6,852,516

[0008] (Patent Document 2) U.S. Patent No. 6,962,805

[0009] The purpose of the present invention is to provide a mutant microorganism having improved L-glutamic acid production ability.

[0010] In addition, the present invention aims to provide a method for producing L-glutamic acid using the mutant microorganism.

[0011] One aspect of the present invention provides a mutant microorganism having improved L-glutamic acid production ability by weakening or inactivating the activity of RamB protein.

[0012] The “RamB protein” used in the present invention is a transcriptional regulator that controls the expression of genes aceA, aceB, ack, and pta involved in acetate metabolism. The RamB protein in the present invention may be a polypeptide encoded by the ramB gene or the Cgl0369 gene and having RamB protein activity, but is not limited thereto.

[0013] Nucleic acid and protein sequence information for the above RamB protein can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0014] As used herein, “weakening of activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, transport protein, etc. is reduced compared to the original microorganism, i.e., a wild-type strain or a strain before modification. Such weakening of activity includes cases where the activity of the protein itself is reduced compared to the activity of the protein possessed by the original microorganism through nucleotide substitution, insertion, deletion, or a combination thereof encoding the gene, and cases where the overall level of protein activity within the cell is lower than that of the wild-type strain or a strain before modification due to inhibition of expression or translation of the gene encoding it, and combinations thereof.

[0015] According to one specific example of the present invention, the weakening of the activity of the RamB protein may be due to insertion, substitution, deletion or a combination thereof of all or part of the gene encoding the RamB protein.

[0016] “Inactivation” as used in the present invention means a case where the expression of a gene encoding a protein such as an enzyme, transcription factor, or transport protein is not expressed at all compared to the original microorganism, i.e., a wild type strain or a strain before modification, or where the expression is not active.

[0017] According to one specific example of the present invention, the gene encoding the RamB protein may include the base sequence of SEQ ID NO: 1.

[0018] Additionally, according to one specific example of the present invention, the RamB protein may be composed of an amino acid sequence of SEQ ID NO: 2.

[0019] The base sequence or amino acid sequence of the RamB protein according to the present invention may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity compared to each sequence, and may have an original function. Here, “homology” or “identity” means the rate of agreement (%) between a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence when they are aligned and analyzed to correspond as much as possible.

[0020] As used herein, “improved productivity” means increased productivity of L-glutamic acid compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a strain that is directly the target of mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that does not have L-glutamic acid production ability or has L-glutamic acid production ability, and is a wild type Corynebacterium or a Corynebacterium that has been mutated from the wild type.

[0021] The above-mentioned strains of the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium. Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium Corynebacterium pollutisoli, Corynebacterium imitans,It may be, but is not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi or Corynebacterium flavescens.

[0022] According to one specific example of the present invention, the mutant microorganism may be a strain of the genus Corynebacterium.

[0023] The mutant microorganism according to the present invention can have improved L-glutamic acid production ability by weakening or inactivating the activity of the RamB protein.

[0024] According to one specific example of the present invention, the mutant microorganism may have a deletion of a gene encoding the RamB protein.

[0025] Specifically, the mutant microorganism with enhanced L-glutamic acid production ability exhibits increased L-glutamic acid production ability compared to the parent strain, and in particular, the L-glutamic acid production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or by 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, It may be increased by 9.5 times or 10 times, but is not limited thereto. For example, the mutant microorganism in which the activity of the RamB protein is weakened or inactivated may have an L-glutamic acid production increased by 5% or more, specifically 5 to 50% (preferably 10 to 40%) compared to the parent strain.

[0026] A composition comprising a mutant microorganism according to the present invention can be used as a composition for producing L-glutamic acid.

[0027]

[0028] A mutant microorganism according to one specific example of the present invention can be implemented through a recombinant vector that deletes a gene encoding RamB protein from a parent strain.

[0029] The term “vector” as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene into a host cell. Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory sequences operably linked to enable expression of the gene insert, and “operably linked” means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and “regulatory sequence” includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that regulates the termination of transcription and translation.

[0030] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0031] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0032] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0033] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0034] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0035] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, various strains of Escherichia coli such as E. coliDH5α, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, strains of Corynebacterium, strains of Bacillus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas species.

[0036] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0037] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0038] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0039] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0040] The transformant of the present invention may be other than a human.

[0041] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0042] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0043]

[0044] In addition, another aspect of the present invention provides a method for producing L-glutamic acid, comprising the steps of culturing the mutant microorganism in a medium; and recovering L-glutamic acid from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0045] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0046] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for microorganisms of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0047] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0048] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0049] According to one specific example of the present invention, the step of recovering L-glutamic acid from the cultured Corynebacterium microorganism and the medium in which the microorganism is cultured may collect or recover the L-glutamic acid produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0050] According to one specific example of the present invention, the step of recovering the L-glutamic acid may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0051] According to one specific example of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid.

[0052] The mutant microorganism according to the present invention can improve the production yield of L-glutamic acid compared to the parent strain by weakening or inactivating the activity of the RamB protein.

[0053] Figure 1 shows the structure of plasmid pK19msb according to one embodiment of the present invention.

[0054] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0055]

[0056] Example 1. Production of a strain with a disrupted RamB protein gene.

[0057] To determine the effect of inactivation of the RamB protein on L-glutamic acid production, a vector lacking part of the gene and a strain into which the vector was introduced were constructed.

[0058]

[0059] 1-1. Recombinant vector

[0060] Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using the primer pairs of primers 1 and 2 and primer pairs of primers 3 and 4, respectively. Two PCR products of approximately 0.5 kb and 0.6 kb in size amplified through PCR were mixed and used as templates, and overlapping PCR was performed with the primer pairs of primers 1 and 4 to link them into a single fragment. After treating the pK19msb vector (SEQ ID NO: 3) with the restriction enzyme smaI (NEB), the fragment was cloned using T4 ligase. The vector constructed in this way was named pK_△ramB.

[0061] All PCRs used pfu premix (bioneer), and were denatured at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by a final extension at 72°C for 5 minutes.

[0062] The primer sequences used for vector construction are as shown in Table 1 below.

[0063] Primer NameSequence NumberPrimer Sequence (5'-3')Primer 1Sequence Number 4TGTACGTCCCAGATCGAGGPrimer 2Sequence Number 5ACATATGTGGGGTCCAGGTACCTGTGGATCTCACGCPrimer 3Sequence Number 6GCGTGAGATCCACAGGTACCTGGACCCCACATATGTPrimer 4Sequence Number 7CAGCACGTTGAATCTCAAGC

[0064]

[0065] 1-2. L-glutamic acid producing strain with a disrupted RamB protein gene

[0066] Using the above vector, mutant strains were produced as follows.

[0067] The final concentration of pK_△ramB vector was prepared to be 1 ㎍ / ㎕ or higher, and electroporated into Corynebacterium glutamicum U3 (KCCM13218P) (Reference: Tauch et al., FEMS Microbiology letters 123 (1994) 343-347). 1 ㎖ of regeneration medium (containing 18.5 g / ℓ of Brain Heart infusion and 91 g / ℓ of sorbitol) was immediately added and heat-treated at 46°C for 6 minutes. After treatment, the medium was transferred to a 15 ㎖ cap tube, cultured at 30°C for 2 hours, and plated on selection medium (containing 5 g / ℓ of tryptone, 5 g / ℓ of NaCl, 2.5 g / ℓ of yeast extract, 18.5 g / ℓ of Brain Heart infusion powder, and 15 g / ℓ of agar) containing 20 mg / ℓ of kanamycin. Colonies generated by culturing at 30°C for 72 hours were cultured in BHI medium (Brain Heart infusion powder 18.5 g / ℓ) for 15 hours to induce secondary recombination, and 10 -2 ~ 10 -3The culture was diluted to 10% sucrose and plated on a selective medium to isolate colonies. The isolated colonies were cultured on two types of selective media each containing kanamycin and sucrose, and a strain that was not resistant to kanamycin and could grow on a medium containing sucrose was selected. This strain was named △ramB.

[0068]

[0069] Experimental Example 1. Evaluation of L-glutamic acid production ability with a disrupted RamB protein gene.

[0070] The L-glutamic acid production ability of the parent strain, Corynebacterium glutamicum U3, and the RamB protein disruption mutant strain △ramB produced in Example 1 were compared.

[0071] Each strain (parent strain or mutant) was inoculated at 1% of the volume into a 100 mL flask containing 10 mL of the glutamic acid production medium in Table 2 below, and cultured with shaking at 30°C, 200 rpm, for 48 hours. After completion of culture, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0072] Ingredient content: Glucose 70 g / L (NH4) 2 SO 4 5 g / LM gSO 4 0.4 g / LUrea 2 g / L Soybean hydrolyzate 15 ml / LK H2 PO 4 1 g / LF eSO 4 10 mg / LM nSO 4 10 mg / LThiamine_HCl 200 ug / LBiotin 2 ug / LCaCO 35%

[0073] Strain L-glutamic acid production (g / L) L-glutamic acid concentration increase rate (%) U316.0-△ramB18.314.4

[0074]

[0075] As shown in Table 3 above, it was confirmed that the production of L-glutamic acid increased by approximately 14.4% compared to the parent strain U3 when the gene encoding the RamB protein was disrupted.

[0076]

[0077] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0078] [Accession number]

[0079] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0080] Accession number: KCCM13218P

[0081] Date of acceptance: 20220629

[0082]

Claims

1. A mutant microorganism with enhanced L-glutamic acid production ability due to weakened or inactivated activity of the RamB protein.

2. In claim 1, The above RamB protein activity is weakened in a mutant microorganism in which all or part of the gene encoding the RamB protein is inserted, substituted, deleted, or a combination thereof.

3. In claim 2, A mutant microorganism, wherein the gene encoding the RamB protein comprises the base sequence of sequence number 1.

4. In claim 1, The above mutant microorganism is a mutant microorganism that is a strain of the genus Corynebacterium.

5. A step of culturing the mutant microorganism of claim 3 in a medium; and A method for producing L-glutamic acid, comprising a step of recovering L-glutamic acid from the mutant microorganism or the medium in which the mutant microorganism is cultured.

Citation Information

Patent Citations

  • RamB mutant and method for constructing lysine production strain by ramB mutant

    CN114478724A

  • Mutant corynebacterium glutamicum strain with enhanced l-glutamic acid production

    KR1020120140636A

  • Novel ABC transporter ATP-binding protein variant and a method for producing L-glutamic acid using the same

    KR102266233B1

  • Method for producing l-amino acid

    US20100099152A1

  • Method for producing l-amino acid

    US20120237985A1