Single-chromosome self-sufficient finite-state machine

Abstract

Disclosed herein are two implementations of a binary cassette (e.g., for controlling expression of one or more exogenous elements of a cassette introduced in a cell). The first implementation uses unique reversible recombinases, where each recombinase is encoded in the cassette and two recombinases are introduced for each additional bit. The second is implemented using RNAs and their cognate recombinases where the individual RNAs are encoded in the binary cassette and an additional cassette hosts the constitutively expressed recombinase(s). Each implementation involves a biological counter that proceeds over clock cycles, the lengths of which are determined according to the underlying biological process. When the binary counter is completed, the terminal activity, such as a self-excision of a gene, can be performed.

Description

SINGLE-CHROMOSOME SELF-SUFFICIENT FINITE-STATE MACHINECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 602,210 filed November 22, 2023, the entire disclosure of which is hereby incorporated by reference in its entirety for all purposes.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said Sequence Listing, created on November 18, 2024, is named EAB-001WO_SL.XML. and is 332,234 bytes in size.BACKGROUND

[0003] Terraforming and geoengineering involve the safe release of genetically engineered organisms into the wild. From bacteria that can reduce perchlorates on Mars to algae engineered to be rapidly consumed into the marine food chain, control of edited life is valuable for major ecological development projects. Efforts have been made toward kill switches, auxotrophy, and lab-restricted genetic codes, but a stably edited lifeform capable of spontaneously reverting to its pre-edited lifestate on command remains yet to be observed. Additionally, if edited lifeforms escape containment, there are no mechanisms beyond antibiotics and pesticides as a means to undo ecological change. Gene drives present one potential mechanism, but pose pause-worthy potential consequences in that uncontrolled propagation of a homing genetic element could induce untold ecologic shockwaves, if not an extinction event. Towards these designs and others, a haploid finite state machine would greatly uplift.SUMMARY

[0004] A potential solution to the aforementioned problems is genetic timers. By serving as a means to keep track of biological events inheritably, haploid genetic timers allow an organism to spontaneously revert to wildtype after a defined number of cell cycles, day / night cycles, generations, or other biologically accessible event. Distinctly, haploid genetic timers permit these devices to function irrespective of their chassis, from bacteria to mammals. Such a device could be integrated with other genetic instruments such as gene drives. A self deediting gene drive would thus terminate after a chosen number of events and any offspringcontaining the activated tinier would de-edit in-vivo. Any of their ancestors would continue to breed and produce more offspring with timed-out timers, continuing to de-edit in-vivo, until the ancestors died and no source alleles remained. This form of rapid and effective population management would be highly desirable globally as a means to combat medical and agricultural outbreaks and plagues if satisfactory control systems were available. In addition to disease and pest control, it would also be highly desirable to be able to temporarily give a species a fitness advantage to aid in ecological restoration of coral reefs, forest systems, and other degraded ecologies.

[0005] Disclosed herein is a binary genetic counter comprising one or more bits, at least one of the one or more bits encoded by a genomic sequence comprising: a central controller sequence; a first flanking arm comprising a first flanking sequence comprising a first set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a second flanking arm comprising a second flanking sequence comprising a second set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the central controller sequence is flippable to express one of the first or second flanking arms.

[0006] In various embodiments, the binary genetic counter of claim 1, wherein expression of the first flanking sequence controls recombination of a sequence of the second flanking sequence. In various embodiments, expression of the second flanking sequence controls recombination of a sequence of the first flanking sequence. In various embodiments, expression of the recombined sequence of the first or second flanking sequence is operably linked to a modification of activity of a cell. In various embodiments, the modification of activity of a cell comprises a termination of expression of one or more exogenous elements introduced through a cassette in the cell. In various embodiments, methods disclosed herein further comprise a second bit of the one or more bits encoded by a second genomic sequence comprising: a second central controller sequence; a third flanking arm comprising a third flanking sequence comprising a third set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a fourth flanking sequence comprising a fourth flanking sequence comprising a fourth set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the second central controller sequence is flippable to express one of the third flanking sequence or fourth flanking sequence.

[0007] In various embodiments, expression of the third flanking sequence controls recombination of a sequence of the fourth flanking sequence. In various embodiments, expression of the fourth flanking sequence controls recombination of a sequence of the thirdflanking sequence. In various embodiments, expression of the first flanking sequence or expression of the second flanking sequence controls an orientation of the second central controller sequence. In various embodiments, expression of the first flanking sequence or expression of the second flanking sequence controls for recombination of a sequence of the second central controller sequence. In various embodiments, a recombinase of the third flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence. In various embodiments, a recombinase of the fourth flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence. In various embodiments, the opposingly-oriented recombinase sequence of the first or second flanking sequence encodes for a recombinase. In various embodiments, the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site. In various embodiments, the RNA comprises a sequence that is at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site. In various embodiments, the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site. In various embodiments, the RNA comprises a sequence that is at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site. In various embodiments, the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a first RNA that guides a first recombinase to a first corresponding recombinase recognition site, and wherein the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a second RNA that guides a second recombinase to a second corresponding recombinase recognition site. In various embodiments, the first recombinase and the second recombinase are a same type of recombinase. In various embodiments, the same type of recombinase is a cpC31 recombinase. In various embodiments, the first recombinase and the second recombinase are different typesof recombinases. In various embodiments, the binary genetic counter comprises 2 bits, 3 bits, 4 bits, 5 bits, 6 bits, 7 bits, 8 bits, 9 bits, 10 bits, 11 bits, 12 bits, 13 bits, 14 bits, 15 bits, 16 bits, 17 bits, 18 bits, 19 bits, 20 bits, 21 bits, 22 bits, 23 bits, 24 bits, 25 bits, 26 bits, 27 bits, 28 bits, 29 bits, 30 bits, 31 bits, 32 bits, 33 bits, 34 bits, 35 bits, 36 bits, 37 bits, 38 bits, 39 bits, 40 bits, 41 bits, 42 bits, 43 bits, 44 bits, 45 bits, 46 bits, 47 bits, 48 bits, 49 bits, or 50 bits. In various embodiments, each of the one or more bits comprises a left and right arm and a central controller wherein for each bit, the left arm controls the right arm and the right arm controls the left arm. In various embodiments, for each of the one or more bits, at least one of the left arm or the right arm controls a controller of a different bit of the one or more bits. In various embodiments, except for a first bit of the one or more bits, the central controller for every other bit is dependent on another one of the one or more bits.

[0008] Additionally disclosed herein is a method for controlling activity in a cell, the method comprising: presenting a binary genetic counter in the cell, the binary genetic counter comprising one or more bits, at least one of the one or more bits encoded by a genomic sequence comprising: a central controller sequence; a first flanking sequence comprising a first set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a second flanking sequence comprising a second set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the central controller sequence is flippable to express one of the first or second flanking arms, and progressing through one or more clock cycles using the binary genetic counter to modify activity of the cell. In various embodiments, progressing through one or more clock cycles of the binary genetic counter results in terminating expression of one or more exogenous elements of a cassette introduced into the cell. In various embodiments, terminating expression of one or more exogenous elements comprises de-editing the cassette, or a portion thereof, previously introduced into the cell. In various embodiments, progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the first flanking sequence, thereby controlling recombination of a sequence of the second flanking sequence. In various embodiments, progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the second flanking sequence, thereby controlling recombination of a sequence of the first flanking sequence. In various embodiments, expression of the recombined sequence of the first or second flanking sequence is operably linked to a modification of activity of a cell. In various embodiments, wherein progressing through one or more clock cycles further uses a second bit of the one ormore bits encoded by a second genomic sequence comprising: a second central controller sequence; a third flanking arm comprising a third flanking sequence comprising a third set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a fourth flanking sequence comprising a fourth flanking sequence comprising a fourth set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the second central controller sequence is flippable to express one of the third flanking sequence or fourth flanking sequence. In various embodiments, progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the third flanking sequence, thereby controlling recombination of a sequence of the fourth flanking sequence. In various embodiments, progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the fourth flanking sequence, thereby controlling recombination of a sequence of the third flanking sequence. In various embodiments, progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the first flanking sequence or the second flanking sequence, thereby controlling an orientation of the second central controller sequence. In various embodiments, progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the first flanking sequence or the second flanking sequence, thereby controlling for recombination of a sequence of the second central controller sequence. In various embodiments, a recombinase of the third flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence. In various embodiments, a recombinase of the fourth flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence. In various embodiments, the opposingly-oriented recombinase sequence of the first or second flanking sequence encodes for a recombinase. In various embodiments, the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site. In various embodiments, the RNA comprises a sequence that is at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site. In various embodiments, the opposingly-oriented recombinase sequence of the secondflanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site. In various embodiments, the RNA comprises a sequence that is at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site. In various embodiments, the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a first RNA that guides a first recombinase to a first corresponding recombinase recognition site, and wherein the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a second RNA that guides a second recombinase to a second corresponding recombinase recognition site. In various embodiments, the first recombinase and the second recombinase are a same type of recombinase. In various embodiments, the same type of recombinase is a cpC31 recombinase. In various embodiments, the first recombinase and the second recombinase are different types of recombinases. In various embodiments, the binary genetic counter comprises 2 bits, 3 bits, 4 bits, 5 bits, 6 bits, 7 bits, 8 bits, 9 bits, 10 bits, 11 bits, 12 bits, 13 bits, 14 bits, 15 bits, 16 bits, 17 bits, 18 bits, 19 bits, 20 bits, 21 bits, 22 bits, 23 bits, 24 bits, 25 bits, 26 bits, 27 bits, 28 bits, 29 bits, 30 bits, 31 bits, 32 bits, 33 bits, 34 bits, 35 bits, 36 bits, 37 bits, 38 bits, 39 bits, 40 bits, 41 bits, 42 bits, 43 bits, 44 bits, 45 bits, 46 bits, 47 bits, 48 bits, 49 bits, or 50 bits. In various embodiments, each of the one or more bits comprises a left and right arm and a central controller wherein for each bit, the left arm controls the right arm and the right arm controls the left arm. In various embodiments, for each of the one or more bits, at least one of the left arm or the right arm controls a controller of a different bit of the one or more bits. In various embodiments, except for a first bit of the one or more bits, the central controller for every other bit is dependent on another one of the one or more bits. In various embodiments, upon the binary genetic counter reaching a programmed state, the activity of the cell is modified.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings.

[0010] Figure (FIG.) 1 depicts a flow diagram for implementing a binary genetic counter, in accordance with an embodiment.

[0011] FIG. 2A is an exemplary diagram showing 3 bits as well as the architecture of each bit (e.g., Bit 1), in accordance with an embodiment.

[0012] FIG. 2B shows a schematic of the architecture of a bit showing different annotations in comparison to FIG. 2A, in accordance with an embodiment.

[0013] FIG. 2C is an exemplary diagram showing the functioning of a 2-bit binary genetic counter.

[0014] FIG. 2D is an exemplary diagram showing the functioning of a 3-bit binary genetic counter.

[0015] FIGs. 3A-3F shows the operation of a central controller, in accordance with an embodiment.

[0016] FIGs. 4A-4K shows the operation of the right arm, in accordance with an embodiment.

[0017] FIGs. 5A-5G shows the operation of the left arm, in accordance with an embodiment.

[0018] FIGs. 6A-6C depict operation of processes across three bits, in accordance with an embodiment.

[0019] FIG. 7 is an illustration of a portion of the genetic binary counter for purposes of illustrating notations that bridge the gap between the notation used herein and notations that are traditionally used.

[0020] FIGs. 8A-8C show generic elements of the binary counter, in accordance with an embodiment.

[0021] FIG. 8D shows exemplary genetic elements of the binary counter using unique reversible recombinases.

[0022] FIGs. 9A-9D show operation of a binary counter across multiple states using unique reversible recombinases.

[0023] FIG. 10 shows exemplary genetic elements of the binary counter using an RNA implementation.

[0024] FIGs. 11 A-l ID show operation of a binary counter across multiple states using an RNA implementation.

[0025] FIGs. 12A-12C show different states of a binary genetic counter using the unique reversible recombinase embodiment.

[0026] FIG. 12D further shows the detailed annotation of state 0 and its constituent elements using the unique reversible recombinase embodiment.

[0027] FIGs. 13A-13D show different states of a binary genetic counter using the RNA implementation.

[0028] FIG. 13E further shows the detailed annotation of state 0 and its constituent elements using the RNA implementation.

[0029] FIG. 14 shows an example of a full self de-editing cassette.

[0030] FIGs. 15 and 16 depicts an exemplary de-editing cassette inside of the genome.DETAILED DESCRIPTIONOverview

[0031] Terms used in the claims and specification are defined as set forth below unless otherwise specified. It must be noted that, as used in the specification, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0032] Current methodologies for propagating inserted genes can result in negative / uncontrolled consequences such as extinction of species. Disclosed herein is a methodology using a finite-state machine for controlling propagation of an inserted genetic element and a subsequent controlled self-excision of the inserted genetic element.

[0033] Self de-editing can be broken down into parts and these parts can be assembled with other genetic technologies like gene drives. In it’s most basic form, a self de-editing cassette comprises a logical processor, self-excision machinery controlled by the logical processor, and excision recognition domains that flank the rest of the cassette: < [processor] [excision machinery]:*. With a simple cassette like this, a host gene can be disrupted (deactivated) until a trigger event induces the excision of the cassette, yielding the functional gene again. Self de-editing becomes more powerful when a payload is included in the cassette: < [processor] [excision machinery] [payload] >, giving the device an additional function that is either controlled by the processor, or is constitutively active until the device is excised. Finally, self de-editing is further empowered when the device is additionally coupled with a homing endonuclease gene, like cas9, giving it gene drive capabilities, for example: < [processor] [excision machinery] [pay load] [gene drive] >. When the device is inherited heterozygously, the organism not only inherits the genetic state of the logical processor in one allele, but also induces homozygosity by cutting and repairing the sister allele, generating two copies of the self de-editing cassette and insuring every one of the organism’s offspring will inherit the cassette, as well as its gene drive, further propagating its effects. Additionally, multiplecassettes may be employed serially and / or in parallel, whether in a population, across a genome, or even in a single chromosome. It should also be noted that while the term “self deediting” limits the scope of that particular implementation, the invention also extends scope to devices that instead of de-editing, simply change state, where an organism could go from wildtype (natural) to edited and back: wt — > A — > wt, it could also iterate over different states based on the logical processor: wt — > A — > B — > C — > wt, or any other patterns of transition:wt.

[0034] Disclosed herein are two implementations of a binary cassette. The first is implemented in unique reversible recombinases, where each recombinase is encoded in the cassette and two additional unique reversible recombinases are required for each additional bit. The second is implemented using RNAs and their cognate recombinases where only the individual RNAs are encoded in the binary cassette and an additional cassette hosts the constitutively expressed recombinase(s). Note, both cassettes go through a setup phase where in the first step, all of the bits, other than bit 1, reset their right arms. As disclosed herein, each implementation involves a biological counter that proceeds over clock cycles, the lengths of which are determined according to the underlying biological process (e.g., a clock cycle may be based in part on the time for completion of a site-specific recombination event catalyzed by one or more recombinases). When the binary counter is completed, the terminal activity, such as a self-excision of a gene, can be performed.

[0035] Reference is made to FIG. 1 which depicts a flow diagram for implementing a binary genetic counter, in accordance with an embodiment.

[0036] Step 110 involves presenting a binary genetic counter in a cell, the binary genetic counter comprising a central controller sequence, a first flanking sequence comprising a first set of opposingly-oriented recombinases and / or recombinase recognition sites; and a second flanking sequence comprising a second set of opposingly-oriented recombinases and / or recombinase recognition sites, wherein the central controller sequence is flippable to express one of the first or second flanking arms.

[0037] Step 120 involves progressing through one or more clock cycles using the binary genetic counter. As shown in FIG. 1, step 120 involves each of steps 130, 140, 150, and 160. Step 130 involves initializing the binary genetic counter. In various embodiments, initializing the binary genetic counter involves removing a repressor (e.g., a signal-inducible repressor) from the central controller sequence. Thus, the central controller sequence, such asa promoter, can drive expression of the first flanking sequence or the second flanking sequence (depending on the orientation of the central controller sequence).

[0038] Step 140 involves flipping the orientation of the central controller sequence one or more times. In various embodiments, the orientation of the central controller sequence is flipped, thereby constituting a single clock cycle. The orientation of the central controller can be flipped as the result of expression of a recombinase (e.g., expression of the recombinase is under operable control by the central controller). Step 150 involves controlling the recombination of the second flanking sequence through expression of the first flanking sequence or vice versa. For example, the central controller sequence may drive expression of the first flanking sequence, which expresses a recombinase with a corresponding recombinase recognition sequence located at or near the second flanking sequence. Thus, by expressing the recombinase, the recombinase then exhibits activity upon the second flanking sequence at the recombinase recognition sequence, thereby controlling recombination of the second flanking sequence.

[0039] Step 160 involves propagating a signal to one or more subsequent bits of the binary genetic counter. For example, the steps 130, 140, and 150 may control a first bit, which then propagates a signal to a second bit. The second bit can further include a separate central controller sequence, a third flanking sequence comprising a third set of opposingly-oriented recombinases and / or recombinase recognition sites; and a fourth flanking sequence comprising a fourth set of opposingly-oriented recombinases and / or recombinase recognition sites, wherein the separate central controller sequence is flippable to express one of the third or fourth flanking arms.

[0040] Step 160 involves modifying the activity of the cell. Generally, step 160 occurs when the binary genetic counter reaches a termination point. For example, the binary genetic counter can be designed to enable modification of the activity of the cell after a defined number of cell cycles, day / night cycles, generations, or other biologically accessible event. In various embodiments, step 160 involves terminating expression of a gene (e.g., via selfexcision). In various embodiments, step 160 involves turning on the expression of a gene or another aspect of the cell’s genome.Genetic Finite-State Machine

[0041] As used herein, “controller” refers to a genetic element that receives an input and in response activates another element in the system, such as but not limited to a DNA promoter, functional RNA, or protein kinase. As used herein, a “biologically programmed input” is abiologic event that is detected and responded to due to its intentional genetic design, whether co-opted from existing biology or designed from scratch, including but not limited to a kinase cascade programmed to respond to a detected extracellular event, a cellular division sensed by a designed division detection system, and allelic differences detected by a designed mismatch detection system.

[0042] Disclosed herein is an implementation of a finite-state machine whose elements are, at a minimum, self-sufficient and self-contained e.g., in a single chromosome. This device has multiple possible states, but exists in one state at a time. These states can be used to implement many logical processes including but not limited to a timer, a counter, a memory array, and a calculator.

[0043] To illustrate, the following is a description of an embodiment of how a binary-type counter might be implemented that can be characterized as a series of self-referencing latches. In one embodiment, the device consists of programmable genetic elements that allow for the site-specific recombination of an array of bits, each themselves comprising paired arms and a controller.

[0044] In various embodiments, the binary counter comprises 2 bits, 3 bits, 4 bits, 5 bits, 6 bits, 7 bits, 8 bits, 9 bits, 10 bits, 11 bits, 12 bits, 13 bits, 14 bits, 15 bits, 16 bits, 17 bits, 18 bits, 19 bits, 20 bits, 21 bits, 22 bits, 23 bits, 24 bits, 25 bits, 26 bits, 27 bits, 28 bits, 29 bits, 30 bits, 31 bits, 32 bits, 33 bits, 34 bits, 35 bits, 36 bits, 37 bits, 38 bits, 39 bits, 40 bits, 41 bits, 42 bits, 43 bits, 44 bits, 45 bits, 46 bits, 47 bits, 48 bits, 49 bits, or 50 bits.

[0045] Each bit undergoes 4 stages per cycle, signaled by the flipping of the central controller resulting in the various genetic elements being expressed that propagate the information sequentially along the computational cascade. This process sets and resets the paired arms so that each subsequent bit is prepared to receive the signal from the previous bit and correctly pass it onto the next.

[0046] Each bit comprises a central controller and a left and right arm. Each arm comprises a left and right element. The central controller drives expression of the closer element in the arm it points toward. When the controller activates one arm, the activated element inverts both elements in the other arm as a pair preparing the closer element in that arm for subsequent activation.

[0047] FIG. 2A is an exemplary diagram showing 3 bits as well as the architecture of each bit (e.g., Bit 0), in accordance with an embodiment. The binary cassette comprises a left and right arm and central controller. The central controller comprises a standard promoter flankedby opposingly oriented recombinase recognition sites. These sites are programmed such that when they are recombined they yield new recombination recognition sites that are accessible to the original recombinases’ anti -recombinase. The controller alternates between upstream and downstream, activating clock and anti-clock elements and the left and right arm, respectively if the first bit, and just the arms alone, if any other, as only the first bit has clock and anti-clock elements flanking its controller. The clock and anti-clock elements pacemake the first controller, driving processing of the arm elements which interpret the others’ signals and affect them back. The clock and anti-clock comprise a recombinase-anti-recombinase pair that targets the central controller. As used herein, the term “anti-recombinase” refers to any element that undoes the work 1 : 1 of another, distinctly programmed recombinase.

[0048] In one embodiment, the left arm comprises a recombinase-anti-recombinase pair that targets the right arm as well as the subsequent bit. The right arm is also a recombinase-anti- recombinase pair that targets the left arm’s recombination recognition sites. In every case, at least one arm has the role of affecting its subsequent bit’s controller in addition to affecting its partner arm (left affecting right or right affecting left). Between every element there may or may not be any number of insulating nucleotides. The collective sum of these actions exhibits robust base 2 binary step down behavior.

[0049] FIG. 2B shows a schematic of the architecture of a bit showing different annotations in comparison to FIG. 2A, in accordance with an embodiment. FIG. 2B illustrates the first bit of the binary cassette with notation focusing on the “WiFi” like nature of the comprising elements in that the expression of molecular elements “broadcasts” the signal throughout the entire accessible compartment (e.g., the cytoplasm) with signal decay respect to time and distance. The left arm, central controller, and right arm (surrounded by parentheses) are directly invertible via their cognate recombinases binding to their flanking recombinase recognition sites. Red broadcast symbols indicate that signal is being expressed and blue receive signals indicate that the site is properly oriented and ready for recombination by its respective recombinase or anti-recombinase. When recombinase recognition sites are inverted, they switch off the blue receive signal (now faded blue), and switch on the blue anti-receive signal - and vice versa, repeating. To the left and right of the central controller are the clock and anti-clock recombinases. These are expressed once per clock cycle and pacemake the device, allowing it to tick rhythmically in the absence of a control system, or tick in time with the control system when present. The left arm comprises two opposinglyoriented recombinases, as does the right arm. Only the recombinase in-line with the promoter is expressed at any given timestep.

[0050] Activation of this element by the controller then inverts the first arm preparing the second element in the first arm for subsequent activation. This process repeats, resetting the bit and simultaneously inverting the controller of the subsequent bit (FIG. 2C). FIG. 2C depicts a binary genetic counter to keep track of cellular events in its base genetic form. The first row is the initial bit. This bit is slightly altered from the succeeding bits in that it contains two additional recombinases and respective recombinase recognition sites. The following bits, each one row following “ / / ” designate the expandable memory base. The inverse guide is represented by a dot above the guide for simplicity. Superscripts-right represent the recombinase each arm is sensitive to, and subscripts-left represent the recombinase each inverse arm would be sensitive to upon inversion. This bank is expandable to the degree in which unique recombinases are available.

[0051] Coupling this with generative artificial intelligence models, this bank is restricted only by spatial constraints maintaining genomic integrity within the volume of the cell.

[0052] Another embodiment of the system could be implemented in kinases in the cytosol. In such an embodiment and others, the notion of “left” and “right” arms would become arbitrary, as well as the notion of “closeness” since the elements would instead be diffusing through the cytosol. In this case left and right might become A and B or another notation.

[0053] In the aforementioned embodiment where the binary counter is constructed in the chromosome from sequence-programmable recombinases, the initial bit is set up using 3 guide in verse- guide pairs, with each subsequent bit requiring 2 additional and distinct guide inverse-guide pairs. A pair where the guide targets the recombinase to a target site, flipping the target sequence, and the inverse guide targets the recombinase to the inverse target site on the flipped sequence, flipping back the target sequence, restoring the original. The central promoter of the first bit is flanked by the first guide inverse-guide pair ( x, x ) which target and flip the promoter back and forth respectively. Each arm then comprises a guide inverseguide pair in reverse orientation within itself, (1, 1*) and (2, 2*), whose target sites each lie on the opposite arm, in either the original sequence or the flipped sequence. Thus, the arms flip each other back and forth in alternation. The central promoter of the first bit is repressed by a signal-inducible repressor, such as a division-detecting repressor system. Upon relief of repression, the central promoter drives expression of guide x and guide 2. Guide x inverts the central promoter and guide 2 inverts the (1, 1*) arm. Upon relief of repression event 2, thecentral promoter drives expression of guide x and guide 1. Guide x returns the central promoter to its default orientation, and guide 1 inverts the (2, 2*) arm, revealing guide 2* for expression on the next relief of repression event. Guide 1 also flips the central promoter of the second bit, propagating the signal. Upon relief of repression event 3, the central promoter drives expression of guide x as well as expression of the newly revealed guide 2*. Guide x flips the central promoter into its alternate orientation, and guide 2* flips the (1, 1*) arm into the (1*, 1) position, revealing guide 1 for expression on the next relief of repression event. Upon relief of repression event 4, the x guide returns the central promoter to its default position and guide 1 flips the (2*, 2) arm back to its default (2, 2*) position as well as unflipping the central promoter of the second bit. At this point the first bit has been returned to its starting position and is ready to begin the process anew. Two full cycles have been recorded by the first bit (1 : flip, unflip, 2: flip, unflip), and these have been translated along to the second bit affecting a flip and unflip of the second bit (a full cycle). Continuing this pattern by extending the bit array allows the third bit to complete a cycle every 4 cycles of the first, and the fourth bit to complete a cycle every 8 cycles of the first. This binary processor has a memory bank capable of storing signal events in bits. Flipping the final bit into an active position can then yield an actuating event, such as signaling to the excision machinery of a self de-editing mechanism, or influencing some other cellular event.

[0054] FIG. 2D is an exemplary diagram showing the functioning of a 3-bit binary genetic counter. This figure illustrates the algorithmic nature of the device as well as the previously described base 2 binary step down behavior. At time step 1, the bits are in their default configuration. There is an initial setup phase where all bits express their default state and this transforms the system to a state that is insensitive to background noise and only sensitive to signals from the first bit’s controller. A signal driving expression from the central promoter then induces expression of the clock recombinase as well as the right arm of the first bit. The clock recombinase inverts the controller and the right arm inverts the left arm. Once a second signal is received, the controller drives expression of the anti-clock recombinase and expression of the left arm. The anti-clock recombinase inverts the controller back to its original orientation and the left arm inverts the right arm so that the second recombinase of the right arm which was previously anti-parallel to the controller is now oriented parallel with the controller. At the next signal, the controller drives expression of the clock recombinase and the newly unveiled second element of the right arm. The clock recombinase again inverts the controller and the second element of the right arm inverts the left arm back to its originalorientation, exposing a new element on the left arm that had not been exposed when the controller was last driving expression of the left arm. At the next time step, the anti-clock reverts the controller and the left arm expresses its newly unveiled recombinase, inverting the right arm, and inverting the controller of the subsequent bit. This process repeats identically until the anti-recombinase of the left arm is expressed, flipping the controller of the second bit back to its original position, completing a cycle.

[0055] The binary counter can be implemented in various means, two embodiments are presented in the following that characterize the device as embodiment implemented with recombinases where the states are stored inheritably in the genome. In other embodiments, this device could store states in other ways, for example, in one embodiment, states could be stored in post-translational modifications and propagated by kinases. To illustrate an inheritable embodiment, we provide first the general case, and then two embodiments representing two different mechanisms for encoding the binary counter in the genome.

[0056] In various embodiments, a binary genetic counter includes one or more bits. In various embodiments, each bit comprises a left and right arm and a controller where the left arm controls the right arm and the right arm controls the left arm. In various embodiments, each bit comprises a left and right arm and a controller, and at least one arm controls the controller of a subsequent bit. In various embodiments, each bit's controller is dependent on a previous bit except for the zeroth bit which is dependent on an external biological event or is allowed to tick freely. In various embodiments, the bits are composable given sufficient orthogonal recombinases and / or sufficient orthogonal recombinase-guiding RNAs. In various embodiments, the counter is infinitely scalable limited only by resource and combinatorial constraints. In various embodiments, upon reaching some programmed state of the counter, some secondary function is activated. In various embodiments, upon reaching some programmed state of the counter, some activity of the cell is modified.The General Inherited Case

[0057] Provided herein are illustrations that bridge the gap between the notation used herein and that traditionally used in the literature. Two opposingly oriented split triangles flank the sequences to be recombined. These triangles represent the recombinase recognition sites. One triangle is filled and the other is unfilled to illustrate that they have or have not been recombined. The product is an inversion of the region flanked by the recombinase recognition sites where the recombinase recognition sites were split by the recombinase and swapped.

[0058] Pairs of recombinases and anti-recombinases are used, where anti-recombinases are any molecule capable of undoing another recombinase’ s action. In bit 0, the central controller comprises a promoter flanked by recombinase recognition sites. These are further flanked by a recombinase and anti-recombinase pair, clock (recombinase c) and anti-clock (FIG. 3 A). Clock is expressed and immediately binds to (FIG. 3B) and inverts (FIG. 3C) the central controller, after which the recombinase dissociates and diffuses away (FIG. 3D). Now that the controller is inverted, expression of anti-clock is driven and the central controller is reverted to its original position. This process repeats indefinitely (FIG. 3E) unless a mechanism is employed to interrupt the cycle, such as a repressor or suite of repressors. In addition to the central controller there are two arms that flank it. The left arm and the right arm. The right arm (FIG. 3F) comprises two opposingly oriented recombinases which is illustrated in FIG. 3F by the annotated methionines (M, ATG) and stop codons (*, TAA (or another stop codon)). This ensures that only the gene immediately downstream of the controller gets expressed. When an arm is driven by the controller, its recombinase gets expressed and acts on, at least, the opposite arm (Rec 2). The arm is thus also acted upon by the other (Rec 1). Depending on the implementation, the DNA being recombined may be a very long sequence. This does not pose a constraint as DNA is inherently flexible and naturally folds on itself. For very large distances, a shuttle protein or other molecular machine may be used to facilitate co-localization of recombinase recognition sites. For the present embodiment such a mechanism need not be invoked as the process unfolds spontaneously over the short distances of these designs (FIGs. 4A and 4B). Once the recombinase recognition sites are co-localized, the recombinase binds both elements (FIGs. 4C and 4D). The recombinase then cuts the DNA (FIG. 4E) and facilitates crossing-over (FIGs. 4F and 4G) and ligation (FIG. 4H), yielding an inverted sequence (FIG. 41). The recombinase then dissociates (FIG. 41) and the DNA unfolds (FIG. 4K). The left arm undergoes identical chemistry to its sister arm, expressing a recombinase that affects the sister arm, and being affected by the recombinase expressed from the sister arm, equallying yielding an inverted arm (FIGs. 5A-5G). This process can be seen in FIGs. 6A-6C in a time-independent manner, visualizing all processes that can occur across a bit. In real life, these processes are sequential, as is described extensively elsewhere in this document.Unique Reversible Recombinases

[0059] One embodiment is constructed from recombinases mined from the sequences available in nature or from AT generated recombinases. That is, each of the following recombinases are different polypeptide chains that recognize distinct recombinase recognition sites. In nature, reversible recombinases are generally made reversible in viruses by expression of a recombinase directionality factor that has evolved to partner with its specific recombinase. For example, Bxbl recombinase and its directionality factor, gp47. Bxbl targetsCCGCGGGCCGGCTTGTCGACGACGGGGGTCTCCGTCGTCAGGATCATCCGGTCCA (SEQ ID NO: 31) attB and CTGGGTTTGTACCGTACACCACTGAGACCGCGGTGGTTGACCAGACAAACCAC (SEQ ID NO: 32) attP and recombines them to:CCGCGGGCCGGCTTGTCGACGACGGGGGTCTCAGTGGTGTACGGTACAAACCCAG (SEQ ID NO: 33) attL and TGGACCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCAC (SEQ ID NO: 34) attR as illustrated in FIG. 7. Note, the recombination reactions, by nature of inversion, yield not the reverse sequences, but the reverse complements.

[0060] The product attL attR attachment sites are no longer recognized by Bxbl, but when gp47 is expressed and partners with Bxbl, Bxbl:gp47 can then recognize the attL attR sequences and invert them back to the original attB attP substrate sequences. These recombinase directionality factors can be mined from nature along with their recombinases, or anti-recombinases can be generated with Al, which are simply any molecule which recognizes the product sequence and catalyzes its recombination to reproduce the substrate sequence. That is to say, recombinase directionality factors are not inherently necessary. They can be substituted for any controllable molecule that scarlessly reverts the original recombination. In one embodiment, the recombinase directionality factors can be fused to therecombinase to ensure efficient recombination and help avoid erroneous molecular partnerships.

[0061] FIGs. 8A-8C show generic elements of the binary counter. In various embodiments, the binary counter can be implemented with unique reversible recombinases as illustrated in FIG. 8D and FIGs. 9A-9D. The central controller starts out pointing to the right and driving the expression of the clock recombinase (FIG. 9A, State 0) (here, cpC31) and the right arm (Bxbl). The clock recombinase inverts the controller and the right arm inverts the left arm, leading to expression of Al 18 and the anti-clock recombinase (FIG. 9B, State 1). Al 18 inverts the right arm and the subsequent bit’s controller and the anti-clock reverts the controller. This leads to expression of the clock recombinase and Bxbl-gp47 (FIG. 9C, State 2), reverting the left arm. This leads to expression of the anti-clock recombinase and Al 18- gp44 (FIG. 9D, State 3), which reverts the right arm and reverts the controller of the subsequent bit (not shown).RNA Implementation

[0062] The binary counter can also be implemented, and more robustly, in sequence- programmable recombinases. Currently, a well-characterized sequence-programmable recombinase is IS621. This recombinase, belonging to the “Insertion Sequence” family of recombinases, employs RNAs to direct it to recombination sites, of which the “target” and “donor” loops can be reprogrammed to direct the recombinase to recombine any two sequences (although this process is so enormously benefited by directing the recombinase to recombine across two cytosine thymine (CT) cores, that its programmability is effectively limited to this constraint). The terms “target” and “donor” are arbitrary and can be thought of as interchangeable with previously discussed recombinase recognition sites. Generally, the RNA implementation involves the use of any RNA sequence that directs a recombinase to recombine any two targets. In some embodiments, the RNA sequence used in the RNA implementation is a bridge RNA.

[0063] In various embodiments, a RNA comprises a sequence that is at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site. As used herein a RNA is complementary to a sequence that islocated near a corresponding recombinase recognition site if the RNA is capable of guiding a recombinase to act upon the recombinase recognition site. In various embodiments, a RNA is complementary to a sequence located with 200 bases, within 150 bases, within 100 bases, within 90 bases, within 80 bases, within 70 bases, within 60 bases, within 50 bases, within 40 bases, within 30 bases, within 20 bases, within 10 bases, or within 5 bases of a recombinase recognition site.

[0064] The sequence-programmable recombinase paradigm relieves the need to mine new unique reversible recombinases from nature or generate them with Al. Thus, described herein is how the binary counter would be implemented in RNAs as they will likely be the ideal system in the future. These designs are illustrated for bit 0 in FIGs. 10 and 11 A-l ID. The bit comprises a left and right arm flanking a central controller. For bit 0, the central controller is also flanked, internal to the arms, by clock and anti-clock RNAs and target and donor. Since any sequence can be defined for sequence-programmable recombinases, illustrated here are these sites with 30 base pair randomized spacer sequences, but these sequences could be any length, sequence or position as long as the sequence produced is a scarless inversion of the element intended to be inverted. The clock elements flanking the central controller express RNAs that direct the sequence-programmable recombinase to invert the controller. This results in the expression of the anti-clock RNA, reproducing the initial controller state. anti-RNAs are simply RNAs that target the recombinase to the sequence produced by the initial recombination, as this sequence is distinct and can be targeted differentially. Otherwise, all mechanics of the counter behave the same as the unique reversible recombinase implementation, where each arm controls the opposite arm and one of the arms propagates the signal to the subsequent bit’s controller. FIGs. 11 A-l ID illustrates this in detail for the Oth bit.

[0065] In various embodiments, binary genetic counters may employ employ aspects of both embodiments (e.g., both unique reversible recombinases and RNA) to simultaneously meet various engineering demands.ADDITIONAL EMBODIMENTS

[0066] Disclosed herein are methods involving a programmable particle system for targeted ecological interactions and genetic mechanisms for the safer deployment of engineered organisms. While these technologies serve immediate goals, they also lay the groundwork formore complex endeavors. The goal here is to employ these innovations in a synergistic manner for the advancement of human civilization and the health of the biosphere.

[0067] As a preliminary matter, the disclosure herein is done so in an exemplary fashion in particular embodiments of the disclosure and shall not be considered as necessarily required or limiting to other aspects / embodiments in any way. Each numerical value presented herein, for example, in a table, a chart, or a graph, is contemplated to represent a minimum value or a maximum value in a range for a corresponding parameter. The numerical value provides express support for claiming the range, which may lie above or below the numerical value, in accordance with the teachings herein. Each numerical value presented herein is not to be considered limiting in any regard.

[0068] The terms and expressions employed herein are used as terms and expressions of description and not of limitation, and there is no intention, in the use of such terms and expressions, of excluding any equivalents of the features shown and described or portions thereof. In addition, having described certain embodiments of the invention, it will be apparent to those of ordinary skill in the art that other embodiments incorporating the concepts disclosed herein may be used without departing from the spirit and scope of the invention. The features and functions of the various embodiments may be arranged in various combinations and permutations, and all are considered to be within the scope of the disclosed invention. Accordingly, the described embodiments are to be considered in all respects as only illustrative and not restrictive.

[0069] Furthermore, the configurations, materials, and dimensions described herein are intended as illustrative and in no way limiting. Similarly, although physical explanations have been provided for explanatory purposes, there is no intent to be bound by any particular theory or mechanism, or to limit the claims in accordance therewith.

[0070] This patent describes a suite of synthetic biology tools for precise ecosystem editing, including:

[0071] Particle Factory Cells: Engineered to produce specialized particles ('cages' or ’shells’) for enzymatic interaction or molecular encapsulation. These particles can be decorated with Functional Domains.

[0072] Functional Domains: Surface modifications on particles for targeted payload delivery or multiorganism co-targeting.

[0073] Self De-editing Organisms: Engineered lifeforms programmed to revert to their wildtype form after a set number of cellular events.

[0074] Self-replicating Cassettes: Genetic modules that self-replicate and transfer themselves and their payloads to adjacent organisms, unless stopped by a boundary event.

[0075] Event Counting Devices: Simple and advanced counters for monitoring and tracking cellular and chromosomal events.

[0076] Timer: A metabolic timer that allows for time delays to be implemented in genetic systems.

[0077] Disclosed herein are a set of biosphere engineering technologies, merging ecological engineering and synthetic biology to address critical challenges in ecosystem health. By utilizing deep ecosystem sequencing to create metagenomic maps, key ecological niches and nutrient cycles are identified. This enables the fine-tuning of ecosystems for diverse objectives, such as enhanced crop yields, biodiversity conservation, and carbon sequestration. Current agricultural practices and the deteriorating health of fisheries underscore the urgency for these technologies, particularly in the context of climate change. Described herein is a suite of solutions for ecosystem engineering, designed for either independent or coordinated deployment in natural settings. These tools facilitate precise molecular control, serving as the foundation for advanced biosphere management and planetary ecosystem engineering.Independent Deployment

[0078] Factory Cells: Cultivated in bioreactors, isolated as lyophilized powder, and applicable to various environments.

[0079] Self De-editing Organisms: Capable of interacting with biotic and abiotic elements in ecosystems.

[0080] Self-replicating Cassettes: Designed for iterative cellular editing through selfreplication.Coordinated Deployment

[0081] When combined, these technologies offer enhanced control and minimized ecological risk. For instance, self de-editing organisms can synthesize and secrete programmed particles, eliminating the need for external particle synthesis. The inclusion of self-replicating cassettes within self de-editing organisms allows for controlled propagation effects. This coordinated approach is further refined by ecosystem gap analysis, enabling targeted interventions in synthetic ecosystems or established biospheres.Particle system

[0082] In one embodiment, the particle system is a protein-based particle where the core is composed of self-assembling proteins. These proteins can either be derived from nature or designed synthetically. They either form a closed shell, or an open cage, upon assembly. These particles are hollow. In closed shell form, they encapsulate a sample of the cytosol of the factory cell or cell-free environment, allowing the user to simultaneously engage in metabolic engineering of the cell or cell-free environment to produce chemical products desired to be packaged within the particle. In open cage form, these proteins can be modified, via flexible, unstructured protein linkers, fused to the N-terminus, C-terminus, or a region within the protein, based on design demands and optimizations, to decorate the inside of the cage with a series of enzymes, thus assembling a nanoscale bioreactor, processing a defined, or multiple defined, biosynthetic pathways. As these are open cages, inputs to the biosynthetic pathways flow into the particle, and are processed by the enzymatic pathway, and outputs flow out from the particle. In one embodiment, these particles might be lysed and collected and concentrated in an industrial facility. In another embodiment, these particles might be secreted directly from the factory cell directly into the environment they are intended to affect. To functionalize the surface, the assembling proteins are modified to fuse a spytag, or similar peptide-based spontaneous covalent bond- forming interaction, via an unstructured peptide linker, to the N-terminus, C-terminus, or a region within the protein, based on design demands and optimizations. This fusion construct is encoded in and expressed from a plasmid, RNA, or chromosomal integration. Additionally, a second construct is simultaneously encoded in and expressed from a plasmid, RNA, or chromosomal integration. This second construct encodes a spycatcher, or similar peptide-based spontaneous covalent bond-forming interaction partner, which when it comes into contact with its cognate spytag or spytag analog, undergoes a spontaneous click reaction, joining the two peptides covalently. Fused to the spycatcher or spycatcher analog, via an unstructured peptide linker, to the N-terminus, C-terminus, or a region within the protein, based on design demands and optimizations, is an actuator protein domain of interest. This domain performs some function. Some possible functions these domains might perform might include:• Regulatory activity: o Activating or inhibiting a cellular signaling pathway o Activating or inhibiting an enzymeBinding activity: o Binding to the surface of a target1■ Acting as a delivery mechanism■ Attaching a biosynthetic pathway to a target:• Facilitating ecological communication• Producing chemotactic signaling molecules to attract or repel organisms of interest• Producing feedstock from environmental molecules o Crosslinking molecular targets, forming a molecular matrix o Crosslinking organismal targets, forming an organismal matrix o Stabilizing transient ecological interactions o Aggregating and sinking algae to:■ Inject carbon into a carbon-depleted ecosystem■ Sequester atmospheric carbon

[0083] Additionally, these actuator domains can be mixed, since, as the cores assemble spontaneously, and the spycatcher- / spycatcher analog-fusions (decorations) decorate the surface of the assembled cores randomly, expressing multiple different decorations would yield a core particle stoichiometrically decorated according to the relative expression levels of the decorations.

[0084] A molecular model utilizing available protein data bank structures, RFdiffusion (Watson, et. al.), ProteinMPNN (Dauparas, et. al.), and AlphaFold (Jumper, et. al.) has been generated for two different use cases. The first use case decorates the particle with CotBl Si02-binding biomineralization domains (Abdelhamid, et. al.) to facilitate the programmed aggregation of algae. And the second use case decorates the particle with two different stoichiometrically balanced (1 :1) binders targeting a plant root hair protein and a protein involved in targeting bacteria to plants. These binders are fused to spycatcher in the this molecular model to generate what is termed "picotethers". These picotethers are the decorations that attach to the surface of the core, where the core is termed "Hyperionl".

[0085] To produce these particles the chosen core protein is codon optimized for the expression system utilized, either for the chosen organism if in a cell, e.g. Bacillus subtilis, or, in a cell-free system, the system should be tRNA optimized to the average amino acid relative abundance of the protein set. In cell-based systems the gene constructs can either be integrated into the genome or expressed transiently from plasmids. We have designed an early prototype to show the efficacy of the binding capabilities of our particles. This prototype does utilize self-assembling protein core proteins, but this particle is different inthat these proteins self-assemble around the core of the Bacillus subtilis spore during sporulation. Thus, these particles are not fit for deployment as they are filled with the genetic material of the factory cell. They are also much larger than the claimed shell / cage design and therefore are decorated with many orders of magnitude more decoration molecules than the shell / cage design. But they serve the purpose of exploring actuator efficacy, as, aside from the previously described differences, the decoration mechanism and decorations themselves are identical to the final design. The plasmids to build this early prototype are as follows. pEB4 contains integration homology arms for the amyE locus of the Bacillus subtilis genome. These arms flank a PcotY / Z promoter which is expressed during sporulation driving expression of the core protein (in the spore-based prototype, CotZ) fused, via a flexible linker, to a spytag motif. This is succeeded by a terminator and spectinomycin resistance gene to select for successful genomic integrations. pEB6 contains integration homology arms for the sacA locus of the Bacillus subtilis genome. These arms flank a Pveg promoter which is expressed constitutively driving the expression of spycatcher fused, via a flexible linker, to a CotBl Si02-specific biomineralization motif. This is succeeded by a terminator and chloramphenicol resistance gene to select for successful genomic integrations

[0086] These plasmids were generated by the purchasing of a synthetic DNA construct from Twist Biosciences containing CotZ-spytag and spycatcher-CotB 1 , and these pieces were amplified out individually from the larger gene block using standard polymerase chain reaction (PCR) methods. They were then sub-cloned into pDRl l l and pSac-Cm backbones, respectively, using Bsalmediated golden gate assembly. pDRl l l, pSac-Cm, and Bsl68 were gifts from the Boston Open Science Laboratory (BOSLab) and all PCR reagents and golden gate assembly enzymes were sourced from New England Biolabs, Inc.

[0087] An embodiment of may be a factory cell or cell-free system that produces the designed particles. A prototype was generated using Bacillus subtilis as a cell factory. The factory was produced via the following method. First a strain of subtilis (Bs 168) was made competent using a standard competence inducing protocol (Harwood, et. al. ). Competent Bsl68 were transformed with pEB4 and pEB6 separately using a standard subtilis transformation protocol (Harwood, et. al. ), and these were selected on spectinomycin- (Spec) and chloramphenicol-supplemented (Cm) LuriaBertani (LB) agar plates, respectively. Successful transformants were restreaked on their respective selective plates and single colonies were selected. These colonies were grown in broth LB cultures, an aliquot of eachwas set aside for freezing, and their genomes were isolated using a genome isolation kit. The appropriate loci were PCR amplified and Sanger sequenced to confirm successful integrations. Following confirmation, Bsl68 + pEB4 was named EBS4 and Bsl68 + pEB6 was named EBS2. EBS4 was then made competent using the same competence protocol and was transformed with the extracted genomic DNA of EBS2 using the same transformation protocol. These transformants were selected on Cm-L B plates. Successful transformants were restreaked on Cm-L B plates and single colonies were selected. These were grown for freezing and genome extraction. Both loci were PCR amplified and the products were sent for Sanger sequencing, confirming successful integration of both genetic cassettes in this new strain. Upon confirmation, this strain was named EBS6. EBS6 is the factory strain capable of producing the core particle as well as the Si02-targeting decoration. The decorations attach to the particle during assembly inside of the factory cell and the mature particles can then be liberated from the factory cell via a standard lysis protocol (Harwood, et. al.).Self-replicating cassette

[0088] Disclosed herein is a genetic device that, in one embodiment, integrates into the genome of a starter cell at a predefined location. That results in propagation of this cassette from cell to cell in an amplifying fashion, concluding in the distribution of this cassette through a population. This may either be human cells, bacterial cells, plant cells, or a variety of other forms of light. In the context of the human, the replication ends at the extent of the somatic system. The device is described thus.

[0089] The genetic construct in question requires integration downstream of an endogenous promoter. This is because copying of the cassette for further propagation leads to a recursive impasse if the promoter is included within the cassette itself. The cassette begins and ends, that is, is flanked by homology arms. These target the cassette to its programmed destination. Immediately following the upstream-most homology arm is an optional payload. This unit is left behind when the program has concluded. This may be a point mutation to correct a genetic disorder, or a much larger construct that imbues the target cell with a new function. Following the payload are three single-guide RNAs. These guides are interspersed with RNA nuclease targeting sites. This allows, at the appropriate time, for the transcript to be cleaved into pieces, liberating these guide RNAs to partner with their cognate Cas9 molecules. Following the guides is the packaging system. This packaging system is any system that will allow for the containment of all necessary parts and delivery of those parts to the next cell, and the targeting of that package into the cell via an endocytotic or infectious mechanism.Following the packaging system are two adapter proteins. These bind to each homology arm, respectively, and form a protein-protein partnership with the internal face of the packaging proteins, guiding the entire construct into the package for delivery. This is followed by a Cas9-binding protein adapter that similarly targets the mature ribonucleoprotein Cas9 molecules to the internal face of the packaging system. These are then followed by a reverse transcriptase. The reverse transcriptase is expressed and transcribes the entirety of the transcript, transcribed by the endogenous promoter. That transcript reaches the length from the upstream homology arm to the downstream homology arm. This generates a DNA copy that is guided into the packaging system via the DNA-binding proteins. Following the reverse transcriptase is an RNA nuclease-inhibiting protein. This protein inhibits the RNA nuclease that then follows downstream. This is expressed in an initial state, preventing RNAse activity before a time delay has occurred. Following the RNA nuclease is the RNA nuclease array, which is a series of four short RNAs that target the RNA nuclease to the four RNA nuclease target sites, allowing for liberation of the guide RNAs at the appropriate time. This array is followed by a timer system that governs the activity of the RNA nuclease. This is composed of a preprotimer, a protimer, and a timer. In this case, the timer is a domain attached to the RNA nuclease inhibiting it. Upon cleavage of this timer, the RNA nuclease is activated. The preprotimer is an enzyme that utilizes a cellular metabolite and produces an orthogonal metabolite, foreign to the cell, at a specific rate. After this foreign metabolite reaches a specific threshold, it activates the protimer. The protimer cleaves the timer off of the inhibited protein, activating, here, the RNA nuclease. Downstream of the timer mechanism is the downstream-most homology arm. The logic of this system plays out according to the following steps. First, the system is integrated into the chromosome. Then, the endogenous promoter transcribes the length of the entire transcript. This is a polycistronic transcript, so each protein has its own ribosome binding domain. These get translated, producing all of the proteins in question at the same time. The reverse transcriptase transcribes the entire transcript back to the DNA. This gets packaged into the packaging system. A timer device allows for a delay before the RNA nuclease is activated and cleaves the full-length transcript into five pieces, six pieces, liberating the guide RNAs, which then partner with their cognate Cas9 molecules and are loaded into the packaging system and cleave the chromosome downstream of the payload and upstream of the second homology arm. These homology arms have a slight overlap that allows them to re-anneal and ligate, sealing the excision in ascarless manner. The packaged system is then secreted and continues to propagate through the population.Components

[0090] Endogenous Promoter: This ensures that the genetic device integrates downstream of an existing promoter within the host cell, effectively controlling the device's overall

[0091] expression.

[0092] Homology Arms: These precisely designed DNA sequences act as molecular "addresses," guiding the device to its pre-determined genomic location.

[0093] Payload: An optional yet powerful segment that carries genetic material, facilitating a variety of applications-from correcting genetic abnormalities to conferring new functionalities onto the target cells.

[0094] Guide RNAs: These molecular beacons direct the Cas9 enzyme to specific genomic locations, enabling precise genetic manipulation.

[0095] Packaging System: An ingenious mechanism responsible for containing and transporting the device components to subsequent cells.

[0096] Adapter Proteins: These proteins facilitate the interaction between the packaging system and the homology arms, ensuring accurate assembly.

[0097] Cas9-Binding Adapter: A specialized adapter that optimizes the interaction between Cas9 and the packaging system, enabling efficient processing.

[0098] Reverse Transcriptase: An enzyme that transcribes the entire RNA transcript back into its DNA form, facilitating its incorporation into the packaging system.

[0099] RNA Nuclease Inhibitor: A temporal gatekeeper protein that blocks RNA-cutting activity until a pre-defined time point is reached.

[0100] RNA Nuclease Array: A set of short RNA sequences that specifically direct the RNA nuclease to its designated cutting sites.

[0101] Timer System: A sophisticated control mechanism that dictates when the RNA nuclease is activated, offering programmable versatility.Operational Flow

[0102] Genome Integration: The device is first integrated into the host genome at a specific locus.

[0103] Transcription: The host's native promoter initiates the transcription process, generating an all-inclusive RNA transcript.

[0104] Translation: The RNA transcript undergoes translation, generating the required proteins.

[0105] DNA Repackaging: Reverse transcriptase reconverts the RNA transcript into DNA, which is subsequently packaged for delivery to the next host cell.

[0106] Temporal Control: A built-in timer system activates the RNA nuclease, initiating the cutting of the transcript into manageable pieces.

[0107] Genomic Editing: The liberated guide RNAs direct Cas9 to specific genomic locations, facilitating precise cutting.

[0108] Propagation: The device is repackaged and transferred to a new host cell, where the process repeats.

[0109] By incorporating advanced features like a programmable timer system and precise RNA nuclease controls, this genetic device offers unparalleled adaptability, opening new avenues for a multitude of applications.Self de-editing cassette

[0110] Disclosed herein i a technology that, in one embodiment, involves recognition of some trigger event which in turn results in the auto-excision of a genomically encoded excision recognition domain (ERD)-flanked cassette. This method utilizes a modular logical processor, exchangeable for any other logical processor, allowing for different events to trigger the excision machinery and different rules to govern the processing of the trigger events. In one embodiment, this logical processor might detect a signal received from another cell, immediately inducing excision. Another might detect a signal received from another cell, count these signals, cross reference them against the presence of a set of other possible signals, and once a given condition is satisfied, activate the excision machinery. Another might detect divisions of the chromosome, count these divisions, and once a threshold has been met, activate the excision machinery, thereby giving a cap to the number of daughter organisms that can arise from a particular genetic modification before every one of those cells simultaneously reverts to the wildtype ancestor. The payload that is included in this genetic cassette can exist decoupled from the logical processor and excision machinery so that it can exert its designed effect independently. That is, the payload is genetically orthogonal to the rest of the self de-editing cassette (Fig. 8). This pay load might involve production of pay loadeffectors that are secreted into the environment to suppress pathogens and provide plant growth promoting factors. It might secrete a carbohydrate matrix to add structural integrity to the soil. It may even secrete products outlined elsewhere in this patent such as co-targeting molecules to tether chosen organisms together, deliver particular small molecules, or regulate the cellular logic of a target organism in the environment. By excising itself from the genome, the host organism reverts to a natural form, providing a robust biosafety mechanism to prevent persistence of genetically engineered organisms in the environment. This patent claims the design and implementation of this cassette for and in any DNA-based form of life, be it bacterial, fungal, plant, animal, etc.

[0111] Self de-editing cassette.

[0112] Self-replicating cassette. This cassette can be introduced into a single cell and from that cell propagate to edit adjacent cells, leaving behind a payload in its wake, until the perimeter of a population, in logical or geometric space, is encountered. This cassette is targeted to be integrated downstream of an endogenous promoter, via introduction by CRISPR or natural homologous recombination. This cassette [in brackets] carries all of the machinery for making a copy of itself and carry itself forward to the next cell. The cassette then cuts itself out, leaving behind a payload in a scarless manner.

[0113] A signal is received as input by an interchangeable logical processor. This processor performs logical operations internally and, once the programmed conditions have been satisfied, the logical processor activates the accompanying excision machinery. This excision machinery then targets the flanking excision recognition domains and excises the entire cassette from the genome, leaving a scarless, or near-scarless daughter genetic product. The payload behaves independently of the greater self de-editing cassette it is housed within.7-point processor

[0114] Here, we claim a logical processor that, in one embodiment, has the capacity to keep track of seven (7) sequential events. This design includes the use of eight (8) distinct recombinases that each act on a different sequence of DNA. The logical sequence of the recombinases does not matter, but outlined is a possible implementation for clarity. This counter involves a promoter at the center of a cassette. The orientation of this promoter is controlled by an invertible recombinase (here, the <1>C31 integrase and it's recombination directionality factor (RDF) ). Here, a repressor, of which any form suffices and exchange of this element can be a means of modularly altering the function of the logical processor, represses the central promoter. Upon relief of this repressor, the <1>C31 integrase isexpressed and targets <1>C31 recombinase sites flanking the promoter. This integrase inverts the orientation of the promoter so the promoter now drives expression in the opposite direction. This process takes time and during this delay the repressor reanneals to its binding site. Upon the second relief of the repressor, the promoter now drives expression of the <1>C31 integrase as well as its associated RDF. In addition, the promoter also drives expression of int3, another recombinase. <1>C31 integrase plus its RDF (int RDF) return the orientation of the promoter to its original position while simultaneously, int3 inverts the orientation of the A 118 recombinase via A 118-flanking int3 recombination sites. When repression of the promoter is relieved for a third time, the promoter is in the default position, drives again expression of <1>C31 integrase in the absence of the RDF (simply, int), but this time also drives expression of the now properly oriented A 118 recombinase. While int flips the promoter to its alternate orientation, A 118 works in concert to flip int5 into a functional orientation. When repression of the central promoter is relieved a fourth time, the promoter drives the expression of int RDF, int3, and, now, int5. Int RDF returns the promoter to its default position and the newly expressed int5 now flips int8 into an active orientation. Int3 is expressed but is inert as A 118 has already been flipped into an active orientation, and, as int5 has no associated RDF, plays no further role in the logical operation. When repression is relieved a fifth time, A 118 is expressed but similarly to int5, does not play a logical role. Int8 flips inti 2 into position and the promoter is returned to the alternate orientation again by int. This pattern continues for relief of repression event 6, where intl2 flips TP901, and relief of repression event 7, where TP901 activates expression of a downstream module - here, expression of the excision machinery outlined in the section "self de-editing cassette".Division detection DNA binder

[0115] Described herein is one embodiment of a simple system for detecting division events. This design does not rely on signals that were expressed at different points of division as these signals have delays (such as the cyclin dependent kinases) due to the kinetics of transcription and translation, and it was also necessary that this design be portable to different life forms. Repressors naturally bind to DNA and a host of repressors have evolved to be sensitive to innumerable inputs across life on Earth. But every repressor has, at minimum, two inputs. One being its evolved sensitivity, such as lactose for lacl, and the other being a byproduct of track clearing via the replication machinery. In both of these instances the genetic locus being repressed undergoes a burst of transcription activity. Here we envisionsimply a repressor that does not take a bivalent input, responding singularly to track clearing by the replication machinery.

[0116] This is a protein-based binder that binds to a given motif of DNA and remains bound at all times unless physically dislodged during chromosome separation by the replication machinery. This repressor would be designed using artificial intelligence so that the repressor domain would have a strong affinity for the motif in question. Many repressors could be generated and screened to identify a repressor with tight dissociation kinetics. A second DNA-binding protein would be generated against a DNA motif somewhere sufficiently distant from the region of DNA that has been chosen to be repressed. A DNA-binding protein would be selected that has similar dissociation kinetics to the repressor. This second DNA- binding protein would be the "dock". Next, two domains would be generated using an Al model that generates two partner binding proteins. Many of these partners would be generated and screened to identify a partner pair that has dissociation kinetics weaker than the dissociation kinetics of the repressor and dock for their respective DNA motifs. One half of the partner pair would be fused to the repressor and the other half would be copied and repeated in a linear fashion separated by flexible linkers, like beads on a string. This string would be fused to the dock. The number of repeats would be titrated empirically to identify a number of beads that produces aggregate dissociation kinetics toward the repressor-binder so that when the repressor is dislodged from the DNA by the replication machinery, it is captured by the dock-beads to provide a delay so the repressor does not immediately return to its target promoter.

[0117] This time delay can be titrated by extending the bead array. This delayed period of repression allows for a brief burst of transcription to occur immediately following dislodgement from replication. This acts as a detector for replication with one burst occurring every period of chromosomal replication. As the repressor has a much higher affinity for its target than the binder does for the beads, the repressor inevitably returns to its target. The input signal is thus replication fork propagation and the output is any defined transcriptional unit, either GFP or any other payload (here referred to as GOI (Gene of Interest)).To construct this one would:1. Use artificial intelligence to generate DNA-binding proteins. Instead of providing an amino acid sequence and receiving a protein-binding protein against that target, theuser would provide a DNA sequence and would receive a DNA-binding protein against that target. Many of these would be generated.2. These would then be screened by expressing them in a cell or cell-free system and purified using standard protein purification techniques. A His-tag technique should work fine for the screening process.3. The isolated proteins would then be screened likely using surface plasmon resonance, isothermal titration calorimetry, or atomic force microscopy.4. Similarly, protein-binding partner pairs would be generated and screened for affinity toward one another. This is the bead-binder pair.5. A plasmid would be generated containing both the repressor-binder and dock-bead under a constitutive promoter and this plasmid would be integrated into a bacterial chromosome.

[0118] As the repressor would be designed to bind to a particular sequence, that sequence could be anywhere in the genome as long as it is sufficiently spatially separated from the dock in order to maintain the delay effect the dock provides.Binary processor

[0119] To build upon the 7-point processor, described herein is a binary logical processor that, in one embodiment, can count any number of cellular events given that sufficient recombinases are available to expand the memory bank. A binary genetic processor has been previously postulated (Zhao, et. al.), but until now, the details of how one would actualize it have been elusive. Disclosed herein is a detailed logical processor that displays algorithmic behavior encoding a working binary processor in DNA. The details are thus. An initial bit is set up using 3 reversible recombinases, and each additional bit after requires a novel set of 2 reversible recombinases. The system is initialized by a bit comprising a central invertible promoter, a flanking recombinase and recombinase + RDF partner (x, x*), and then two flanking recombinase and recombinase + RDF partner pairs under invertible control by the cognate partner pair on the opposing flank [(1, 1 *), (2, 2*)]. The recombination directionality factor is represented by a dot above the recombinase for simplicity. Additionally, parentheses again serve to represent opposingly-oriented recombinase recognition sites, yielding inversions upon recombinase engagement. Superscripts-right represent the recombinase each cassette is sensitive to, and subscripts -left represent the recombinase each cassette would besensitive to upon inversion. The central promoter of bit 1 is repressed by a signal-inducible repressor, such as the division-detecting repressor system described above. Upon relief of repression, the central promoter drives expression of the x recombinase and recombinase 2. The x recombinase inverts the orientation of the central promoter and recombinase 2 inverts the (1, 1 *) recombinase cassette. On the second relief of repression event, the central promoter drives expression of the x* recombinase as well as expression of recombinase 1. The x* recombinase returns the central promoter to its default orientation, and recombinase 1 inverts the (2, 2*) recombinase cassette, orienting recombinase 2* into an active orientation. Recombinase 1 also flips the central promoter of the second bit.

[0120] Upon relief of repression event 3, the central promoter drives expression of the x recombinase as well as expression of the newly revealed recombinase 2*. The x recombinase flips the central promoter into its alternate orientation, and recombinase 2* flips the (1, 1 *) recombinase cassette into the (1 *, 1) position, revealing recombinase 1 for expression on the next relief of repression event. Upon this event, the x* recombinase returns the central promoter to its default position and recombinase 1 flips the (2*, 2) recombinase cassette back to its default (2, 2*) position as well as unflipping the central promoter of the second bit. At this point the entire cassette has been returned to its starting position and is ready to begin the process anew. Two full cycles have been recorded by the first bit (1 : flip, unflip, 2: flip, unflip), and these have been translated along to the second bit affecting a flip and unflip of the second bit (a full cycle). Continuing this pattern by extending the bit array allows the third bit to complete a cycle every 4 cycles of the first, and the fourth bit to complete a cycle every 8 cycles of the first. This binary processor has a memory bank capable of storing 2n signal events. Flipping the final bit into an active position can then yield an actuating event, such as signaling to the excision machinery of the self de-editing cassette, or influencing some other cellular event.

[0121] In some embodiments, one limitation of the system as described is its inability to keep track of the number of cellular events when they are not a power of 2. This comes from the need to hardwire the actuating machinery into the flipping of an individual bit in the binary processor, thus only allowing genes to be activated at 1, 2, 4, 8, 16, 32, 64, . . . , events and so on. Gaining higher resolution tracking of the number of cellular events could be valuable, especially since, as larger number events are recorded, the distance between base 2 states becomes exponentially larger. To keep track of the events in between base 2 events, a simple addition to the system can, in one embodiment, makes use of the split ribozymesystem by Gambill, et. al, and involves expressing a transcript of 20 nucleotides in length that induces the co-localization of two halves of a split ribozyme that is edited to splice a second transcript. Here this second transcript would be one half of a second split ribozyme. By using different messenger transcripts to convey the activation of a bit, this system can be used to hierarchically activate an exact count of any number, releasing logical processing from the restriction of actuation on base 2 events exclusively. To employ this, these 20 nucleotide transcripts would be placed under the expression of the central promoter. In bits after the first, these would be placed in the positions of x and x*. In the first bit, these would be added alongside expression of x and x*. The transcripts in each bit would thus correspond to bit states of 0 and 1 , respectively.EXAMPLES

[0001] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., percentages, etc.), but some experimental error and deviation should be allowed for.Example 1: Unique Reversible Recombinases

[0122] Implementation in unique reversible recombinases. This implementation exhibits a clock activity in the absence of an input signal controlling the central PvegA promoter of bit 0 (found at roughly position 6000, immediately upstream of cpC31 attP). Example 1 describes 2 bits because the literature describing known reversible recombinases is limited, although many hundreds to thousands, if not more, are likely waiting to be discovered in nature. With this two bit implementation, the cassette would tick through 8 unique states and repeat. Those 8 states are shown in FIGs. 12A-12C. Additionally, to provide evidence of the cassette’s algorithmic nature, state 0 is aligned with state 8 showing they are identical (see FIG. 12A and 12C). FIG. 12D further shows the detailed annotation of state 0 and its constituent elements. SEQ ID NOs: 1-11 show the sequence at each of states 0-10.Example 2; RNA Implementation

[0123] RNAs and their cognate recombinases are related to transposons and are encoded in sequences called “insertion sequences’" (ISs) in nature. These ISs are a single gene block that encode both the RNA and recombinase. The RNA is expressed and folds into a tertiary form that binds to its cognate recombinase.

[0124] The RNA encodes both a “target” and a “donor” loop which act as guides to define the specific sites in the DNA that should be recombined by the recombinase. Both the target and donor sequences have a conserved CT core in the well defined IS621 variant and others.

[0125] Depending on the orientation of the target and donor sequences, the CT cores are brought together in either a loop (target and donor point in the same direction) or an extruded (target and donor are opposed) topology. The CTs are traded and the strands are recombined. Loop junctions yield excisions or integrations and extrusion junctions yield genetic inversions. Our designs utilize an array of target-donor-opposing recombination sites that allow for in-place inversions to drive computation. With this three bit implementation, the cassette ticks through 16 unique states and repeats (FIGs. 13A-13D). To provide evidence of the cassette’s algorithmic nature, state 1 is aligned with state 17 showing they are identical. FIG. 13E further shows the detailed annotation of state 0 and its constituent elements. SEQ ID NOs: 12-30 show the sequence at each of states 0-18.Example 3: Self De-editing Cassette

[0126] Example 3 presents an example of the full self de-editing cassette (FIG. 14), constructed using the RNA implementation. FIGs. 15 and 16 depicts how the device would exist inside of the genome. This example details the processes in the context of disrupting the doublesex gene (Agdsx) of the African mosquito Anopheles gambiae immediately upstream of exon 5, a gene which regulates male and female development and in which exon 5 is necessary specifically for females. In this implementation, device is constructed from 1) a logical processor (the binary counter), 2) excision machinery comprising a recombinase, IS621, and an inverted RNA which targets the target and donor sites flanking the entire self de-editing cassette, and 3), an EGFP payload to represent any gene that could be delivered that would operate orthogonally to the rest of the cassette. For example, this could be the gene drive mechanism comprising a Cas9 and guide RNA driving propagation of the cassette through a gene pool.

[0127] Overall, the device is programmed to activate the excision machinery upon expression of RNA 5 (corresponding with State 9 shown in from FIG. 13B), which inverts the excision RNA, placing it inline with its promoter, leading to its expression. Upon excision, the genome is reverted scarlessly to its pre-edited state, returning a once again functional doublesex gene.

[0128] The specific sequences of the elements shown in FIG. 16 are shown below:left arm 0 (SEQ ID NO: 35)CCGTTAGATGCCTCGCTGTACTAATAGTTGAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTCGCGTACCTTGGGTTCTAACCTGTGGGAAAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGTTCTAATCATGGACCGGTTTTCCCGGTAATCCGTCGTTTCAAGGTTGGTTTCACTAGTGAAACCAACCTTTCAACCACGGATTACCGGGAAAACCGGTCCATGATTAGAACCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAATCTTGACGACAGGTTAGAACCCAAGGTACGCGACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTTATTAAACCTCTATCAGCCTATCGCGGTGA anti-clock (SEQ ID NO: 36)AGTGAAACCAGGCTGGCAAGTACGGATTACCGGGAAAACCGGTCCATGCTTACCACCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAAGCTCGTGAACAGGTTAGAACCCAAGCCGCTAAACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACT controller 0 (SEQ ID NO: 37)GGAACGCCCATTTAGCGGCTGGCGTCTTGAaattttgtcaaaataattttattgacaacgtcttattaacgttga tataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtATCCATTTCCCTCATTCACGAGCTTA CCAAClock (SEQ ID NO: 38)AGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTTTAGCGGCTTGGGTTCTAACCTGTACGCCAGCTTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGTGGTAAGCATGGACCGGTTTTCCCGGTAATCCGTTCTTACGAGCCTGGTTTCACT right arm 0 (SEQ ID NO: 39)CATACCGCGCGCGTACCTTTCCCGGCCATTAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTTGCCTCGCTTGGGTTCTAACCTGTAGTACAGCCTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGCGATAGGCATGGACCGGTTTTCCCGGTAATCCGTCTTTATCAGCGTGGTTTCACTAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTTGCCTCGCTTGGGTTCTAACCTGTCTATCAGCCTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGCGATAGGCATGGACCGGTTTTCCCGGTAATCCGTAGTTTACAGCGTGGTTTCACTTCGACAGATCGTCAAGATTAGAAAACGGTA left arm 1 (SEQ ID NO: 40)GTGAAACATACACGTTGCTCGGGTTCACCCAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTGCCGTGTCTTGGGTTCTAACCTGTAGTGAAGCCTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGCCATAGGCATGGACCGGTTTTCCCGGTAATCCGTCATTTGGAGACTGGTTTCACTAGTGAAACCAGTCTTCAAACTACGGATTACCGGGAAAACCGGTCCATGCCTATGGCCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAGGCTCCATGACAGGTTAGAACCCAAGACACGGCACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTTGTATCCGACCCCCGCAGCTTGCCAGCTCT controller 1 (SEQ ID NO: 41)CATACCGCGCGCGTACCTTTCCCGGCCATTacatttattgtacaacacgagcccatttttgtcaaataaaattt aaattatatcaacgttaataagacgttgtcaataaaattattttgacaaaattTCGACAGATCGTCAAGATTAGAAA ACGGTA right arm 1 (SEQ ID NO: 42)TGGATAGCCGTGTCTCCATGATACCCGAAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTCACGTTGCTTGGGTTCTAACCTGTCCCGCAGCTTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGTGGCAAGCATGGACCGGTTTTCCCGGTAATCCGTACTTCCGAGCATGGTTTCACTAGTGAAACCATGCTGCGAAGGACGGATTACCGGGAAAACCGGTCCATGCTTGCCACCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAAGCTCGGGTACAGGTTAGAACCCAAGCAACGTGACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTGCCGCAGCACAGTGAAGCCTATGGTTGAACGT left arm 2 (SEQ ID NO: 43)GTCCGATAACGAACTTCGACATGATAAAGTAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTACTGTAACTTGGGTTCTAACCTGTCGATGAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGCTCATATCATGGACCGGTTTTCCCGGTAATCCGTCTTTACGAGTTTGGTTTCACTAGTGAAACCAAACTCATAACGACGGATTACCGGGAAAACCGGTCCATGATATGAGCCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAATCTCGTAGACAGGTTAGAACCCAAGTTACAGTACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTGATCGAACGCTTCAGATGTGACCATATACT controller 2 (SEQ ID NO: 44)TGGATAGCCGTGTCTTCACTGTGCTGCGGCacatttattgtacaacacgagcccatttttgtcaaataaaattt aaattatatcaacgttaataagacgttgtcaataaaattattttgacaaaattTCGGGTATCATGGAGCCTATGGTTG AACGT right arm 2 (SEQ ID NO: 45)TTCCCAAACTGTAACTCGTAGTTGGTGAGGAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTTAACGAACTTGGGTTCTAACCTGTGCTTCAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGGTCACATCATGGACCGGTTTTCCCGGTAATCCGTGTTTCGAAGTTTGGTTTCACTAGTGAAACCAAACTGAAAAGCACGGATTACCGGGAAAACCGGTCCATGATGTGACCCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAATCTTCGACACAGGTTAGAACCCAAGTTCGTTAACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTTTGACGGAACGATGAGATATGAGGTAAGC

Claims

CLAIMS1. A binary genetic counter comprising one or more bits, at least one of the one or more bits encoded by a genomic sequence comprising: a central controller sequence; a first flanking arm comprising a first flanking sequence comprising a first set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a second flanking arm comprising a second flanking sequence comprising a second set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the central controller sequence is flippable to express one of the first or second flanking arms.

2. The binary genetic counter of claim 1 , wherein expression of the first flanking sequence controls recombination of a sequence of the second flanking sequence.

3. The binary genetic counter of claim 1, wherein expression of the second flanking sequence controls recombination of a sequence of the first flanking sequence.

4. The binary genetic counter of claim 2 or 3, wherein expression of the recombined sequence of the first or second flanking sequence is operably linked to a modification of activity of a cell.

5. The binary genetic counter of claim 4, wherein the modification of activity of a cell comprises a termination of expression of one or more exogenous elements introduced through a cassette in the cell.

6. The binary genetic counter of any one of claims 1-5, further comprising a second bit of the one or more bits encoded by a second genomic sequence comprising: a second central controller sequence; a third flanking arm comprising a third flanking sequence comprising a third set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a fourth flanking sequence comprising a fourth flanking sequence comprising a fourth set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the second central controller sequence is flippable to express one of the third flanking sequence or fourth flanking sequence.

7. The binary genetic counter of claim 6, wherein expression of the third flanking sequence controls recombination of a sequence of the fourth flanking sequence.

8. The binary genetic counter of claim 6, wherein expression of the fourth flanking sequence controls recombination of a sequence of the third flanking sequence.

9. The binary genetic counter of any one of claims 6-8, wherein expression of the first flanking sequence or expression of the second flanking sequence controls an orientation of the second central controller sequence.

10. The binary genetic counter of any one of claims 6-8, wherein expression of the first flanking sequence or expression of the second flanking sequence controls for recombination of a sequence of the second central controller sequence.

11. The binary genetic counter of any one of claims 6-10, wherein a recombinase of the third flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence.

12. The binary genetic counter of any one of claims 6-10, wherein a recombinase of the fourth flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence.

13. The binary genetic counter of any one of claims 1-12, wherein the opposingly-oriented recombinase sequence of the first or second flanking sequence encodes for a recombinase.

14. The binary genetic counter of any one of claims 1-12, wherein the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site.

15. The binary genetic counter of claim 14, wherein the RNA comprises a sequence that is at least 90% complementary, at least 91 % complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site.

16. The binary genetic counter of any one of claims 1-12, wherein the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site.

17. The binary genetic counter of claim 16, wherein the RNA comprises a sequence that is at least 90% complementary, at least 91 % complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site.

18. The binary genetic counter of any one of claims 1-17, wherein the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a first RNA that guides a first recombinase to a first corresponding recombinase recognition site, and wherein the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a second RNA that guides a second recombinase to a second corresponding recombinase recognition site.

19. The binary genetic counter of claim 18, wherein the first recombinase and the second recombinase are a same type of recombinase.

20. The binary genetic counter of claim 19, wherein the same type of recombinase is a cpC31 recombinase.

21. The binary genetic counter of claim 18, wherein the first recombinase and the second recombinase are different types of recombinases.

22. The binary genetic counter of any one of claims 1-21, wherein the binary genetic counter comprises 2 bits, 3 bits, 4 bits, 5 bits, 6 bits, 7 bits, 8 bits, 9 bits, 10 bits, 11 bits,12 bits, 13 bits, 14 bits, 15 bits, 16 bits, 17 bits, 18 bits, 19 bits, 20 bits, 21 bits, 22 bits,23 bits, 24 bits, 25 bits, 26 bits, 27 bits, 28 bits, 29 bits, 30 bits, 31 bits, 32 bits, 33 bits,34 bits, 35 bits, 36 bits, 37 bits, 38 bits, 39 bits, 40 bits, 41 bits, 42 bits, 43 bits, 44 bits,45 bits, 46 bits, 47 bits, 48 bits, 49 bits, or 50 bits.

23. The binary genetic counter of any one of claims 1 -22, where each of the one or more bits comprises a left and right arm and a central controller wherein for each bit, the left arm controls the right arm and the right arm controls the left arm.

24. The binary genetic counter of claim 23, where for each of the one or more bits, at least one of the left arm or the right arm controls a controller of a different bit of the one or more bits.

25. The binary genetic counter of claim 23 or 24, wherein except for a first bit of the one or more bits, the central controller for every other bit is dependent on another one of the one or more bits.

26. A method for controlling activity in a cell, the method comprising: presenting a binary genetic counter in the cell, the binary genetic counter comprising one or more bits, at least one of the one or more bits encoded by a genomic sequence comprising: a central controller sequence;a first flanking sequence comprising a first set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a second flanking sequence comprising a second set of opposingly-oriented recombinase sequence and / or recombinase recognition sites, wherein the central controller sequence is flippable to express one of the first or second flanking arms, and progressing through one or more clock cycles using the binary genetic counter to modify activity of the cell.

27. The method of claim 26, wherein progressing through one or more clock cycles of the binary genetic counter results in terminating expression of one or more exogenous elements of a cassette introduced into the cell.

28. The method of claim 27, wherein terminating expression of one or more exogenous elements comprises de-editing the cassette, or a portion thereof, previously introduced into the cell.

29. The method of any one of claims 26-28, wherein progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the first flanking sequence, thereby controlling recombination of a sequence of the second flanking sequence.

30. The method of any one of claims 26-28, wherein progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the second flanking sequence, thereby controlling recombination of a sequence of the first flanking sequence.

31. The method of claim 29 or 30, wherein expression of the recombined sequence of the first or second flanking sequence is operably linked to a modification of activity of a cell.

32. The method of any one of claims 26-31 , wherein progressing through one or more clock cycles further uses a second bit of the one or more bits encoded by a second genomic sequence comprising: a second central controller sequence; a third flanking arm comprising a third flanking sequence comprising a third set of opposingly-oriented recombinase sequence and / or recombinase recognition sites; and a fourth flanking sequence comprising a fourth flanking sequence comprising a fourth set of opposingly-oriented recombinase sequence and / or recombinase recognition sites,wherein the second central controller sequence is flippable to express one of the third flanking sequence or fourth flanking sequence.

33. The method of claim 32, wherein progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the third flanking sequence, thereby controlling recombination of a sequence of the fourth flanking sequence.

34. The method of claim 32, wherein progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the fourth flanking sequence, thereby controlling recombination of a sequence of the third flanking sequence.

35. The method of any one of claims 32-34, wherein progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the first flanking sequence or the second flanking sequence, thereby controlling an orientation of the second central controller sequence.

36. The method of any one of claims 32-34, wherein progressing through one or more clock cycles of the binary genetic counter to modify activity of the cell comprises expressing the first flanking sequence or the second flanking sequence, thereby controlling for recombination of a sequence of the second central controller sequence.

37. The method of any one of claims 32-36, wherein a recombinase of the third flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence.

38. The method of any one of claims 32-36, wherein a recombinase of the fourth flanking sequence is a different recombinase in comparison to a recombinase of the first flanking sequence or second flanking sequence.

39. The method of any one of claims 26-38, wherein the opposingly-oriented recombinase sequence of the first or second flanking sequence encodes for a recombinase.

40. The method of any one of claims 26-38, wherein the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site.

41. The method of claim 40, wherein the RNA comprises a sequence that is at least 90% complementary, at least 91 % complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97 % complementary, at least 98% complementary, at least 99%complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site.

42. The method of any one of claims 26-38, wherein the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a RNA that guides a recombinase to a corresponding recombinase recognition site.

43. The method of claim 42, wherein the RNA comprises a sequence that is at least 90% complementary, at least 91 % complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97 % complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to a sequence located at or near a corresponding recombinase recognition site.

44. The method of any one of claims 26-43, wherein the opposingly-oriented recombinase sequence of the first flanking sequence encodes for a first RNA that guides a first recombinase to a first corresponding recombinase recognition site, and wherein the opposingly-oriented recombinase sequence of the second flanking sequence encodes for a second RNA that guides a second recombinase to a second corresponding recombinase recognition site.

45. The method of claim 44, wherein the first recombinase and the second recombinase are a same type of recombinase.

46. The method of claim 45 , wherein the same type of recombinase is a cpC31 recombinase.

47. The method of claim 44, wherein the first recombinase and the second recombinase are different types of recombinases.

48. The method of any one of claims 22-47, wherein the binary genetic counter comprises2 bits, 3 bits, 4 bits, 5 bits, 6 bits, 7 bits, 8 bits, 9 bits, 10 bits, 11 bits, 12 bits, 13 bits,14 bits, 15 bits, 16 bits, 17 bits, 18 bits, 19 bits, 20 bits, 21 bits, 22 bits, 23 bits, 24 bits,25 bits, 26 bits, 27 bits, 28 bits, 29 bits, 30 bits, 31 bits, 32 bits, 33 bits, 34 bits, 35 bits,36 bits, 37 bits, 38 bits, 39 bits, 40 bits, 41 bits, 42 bits, 43 bits, 44 bits, 45 bits, 46 bits,47 bits, 48 bits, 49 bits, or 50 bits.

49. The method of any one of claims 26-48, where each of the one or more bits comprises a left and right arm and a central controller wherein for each bit, the left arm controls the right arm and the right arm controls the left arm.

50. The method of claim 49, where for each of the one or more bits, at least one of the left arm or the right arm controls a controller of a different bit of the one or more bits.

51. The method of claim 49 or 50, wherein except for a first bit of the one or more bits, the central controller for every other bit is dependent on another one of the one or more bits.

52. The method of any one of claims 26-51, where upon the binary genetic counter reaching a programmed state, the activity of the cell is modified.

Images