Method of prevention and / or treatment of nairoviridae family infections

Abstract

The invention relates to a treatment of Nairoviridae family infections. Here the inventors identified putative membrane trafficking motifs in the CDs of CCHFV GPs and addressed how they can impact assembly / envelopment and production of infectious viral particles. They found that several of the identified CCHFV GP CD motifs could modulate GP transport through the various segments of the intracellular trafficking network and hence envelopment and secretion of infectious particles. In addition, they identified PACS-2 as a crucial host factor that contributes to CCHFV GPs trafficking and that is required for assembly and release of viral particles. These results demonstrate that Gn and Gc's CT domains interact with the host factor PACS2 to regulate CCHFV, viral assembly / incorporation, and budding. Thus, the present invention relates to an PACS-2 inhibitor for use in the prevention and / or the treatment of Nairoviridae family infections in a subject in need thereof.

Description

[0001] METHOD OF PREVENTION AND / OR TREATMENT OF NAIROVIRIDAE FAMILY

[0002] INFECTIONS

[0003] FIELD OF THE INVENTION

[0004] The present invention is in the field of medicine, in particular Nairoviridae family infections by targeting the cellular adaptator PACS-2.

[0005] BACKGROUND OF THE INVENTION

[0006] The Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-born zoonotic virus, responsible for severe hemorrhagic fever outbreaks in humans, with a case fatality rate of 10- 40%, while being asymptomatic in non-human hosts (Bente D.A et al., 2013, Antiviral Res). CCHFV is an emerging pathogen and it is endemic in Asia, the Middle East, and Africa (Messina J.P et al., 2015, Sci Data), which corresponds to the geographic distribution of its vector and / or reservoir, i.e., mainly Hyalomma and Ixodes ticks. Then, CCHFV has a broad tropism and can infect a variety of tissues or species, implying that it may use multiple receptors or entry factors or, alternatively, a receptor that could be broadly expressed. Currently, there is no really effective antiviral treatment or vaccine for treating patients infected with CCHFV and finding a cure for this disease is a priority for OMS. Some studies suggest that Ribavirin could be a good treatment but its efficacy is controversial. Therefore, the treatment of subjects infected with CCHFV consists mainly on supportive symptomatic treatment. CCHFV is an enveloped virus that belongs to the Nairoviridae family of the Bunyavirales order. The viral genome consists of three single-stranded RNA segments of negative or ambi sense polarity. The three genomic RNA segments are the large segment (L), which encodes the polymerase, the medium segment (M), which encodes a complex glycoprotein precursor (GPC), and the small segment (S), which encodes NP and a non-structural protein (NSs). It is associated with virus- encoded nucleoproteins (NP) and an RNA-dependent RNA polymerase enclosed within an host-derived lipid bilayer at the surface of which two surface glycoproteins (GPs), Gn and Gc, are inserted. The two surface GPs are produced by cleavage from GPC that also give rise to several nonstructural proteins (Altamura L.A et al., 2007, J Virol & Sanchez A. J et al., 2002, J Virol). Its well-ordered processing as well as its membrane associating determinants, featuring a leader N-terminal signal peptide (SP), two internal SPs and several trans-membrane domains (TMD), allows to generate two intermediate GP precursors, preGn (140 kDa) and preGc (85 kDa), NSm, a double-membrane-spanning non- structural protein, but also a mucin-like protein (MLD) containing a large number of predicted O-glycosylation sites and three secreted proteins of poorly-known functions: GP38, GP85, and GP160 (Altamura L.A et al., 2007, J Virol). Inserted on the viral envelope, the Gn and Gc GPs are responsible for the attachment of viral particles to the surface of host cells and their subsequent penetration into the cytosol (Hawman D.W et al., 2023, Nature Reviews Microbiology). Protein traffic through the secretory pathway requires tight regulations and highly synchronized interactions of several cellular factors (Cole N.B et al., 1995, CurrO pin Cell Biol). The secretory pathways is subdivided into two membrane populations: the endoplasmic reticulum (ER) / Golgi system, which is needed for oligomerization, folding, and co-posttranslational modifications of proteins that shuttle along the secretory pathways (Schafer W et al., 1995, EMBOJ & Schekman R et al., 1996, Science), and the trans-Golgi network (TGN) / endosomal system, which is important for sorting, export, and recovery of various soluble and membrane associated secretory proteins. Several types of trafficking motifs are typically contained in the cytoplasmic tails (CT) or cytoplasmic domain (CD) of viral surface glycoproteins which may also be the case for the Bunyaviruses (Strandin T et al., 2013, Virology), and regulate various stages of GPs, from their biogenesis to their ultimate intracellular localization. Studies showed that some Golgi resident transmembrane proteins used AP-1 mediated retrograde transport from endosomes to trans-Golgi network (TGN) through the binding of the cellular adaptor PACS- l / PACS-2 to their acidic cluster but PACS-l / PACS-2 were never described for Nairoviridae family and they could be an interesting therapeutic target to develop new therapies for subjects infected with CCHFV.

[0007] SUMMARY OF THE INVENTION

[0008] The present invention relates to :

[0009] A PACS-2 inhibitor for use in the prevention and / or in the treatment of Nairoviridae family infections in a subject in need thereof.

[0010] A method for use in the prevention and / or in the treatment of Nairoviridae family infections in a subject in need thereof comprising administering a therapeutically effective amount of an PACS-2 inhibitor. A pharmaceutical composition for use in the prevention and / or in the treatment of Nairoviridae family infections comprising a therapeutically effective amount of an PACS-2 inhibitor alone or in combination with a PACS-1 inhibitor.

[0011] The present invention is defined by the claims. The following detailed description, figures and examples do not fall under the scope of the present invention and are present for understanding and illustration purposes only.

[0012] DETAILED DESCRIPTION OF THE INVENTION

[0013] The Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-borne bunyavirus that causes high mortality in humans with a wide geographic range. It is an enveloped virus with a tri-segmented negative RNA genome that harbors two surface glycoproteins (GP), Gn and Gc. The CCHFV M segment encodes a glycoprotein precursor complex (GPC) whose maturation takes place in the ER and is followed by transport of PreGn and PreGc unprocessed GPs to the Golgi complex. Intracellular trafficking motifs of viral GPs are typically contained in their cytoplasmic domains (CD), which regulates various stages of GPCs biogenesis and localization. Here, the inventors aimed at understanding how CCHFV GPs exploits cellular trafficking networks with cellular host components during the stages of virus assembly, envelopment and / or egress, which has yet not been studied. They identified putative membrane trafficking motifs in the CDs of CCHFV GPs and addressed how they can impact assembly / envelopment and production of infectious viral particles. The inventors introduced several mutations in the CDs of CCHFV Gn and Gc GPs as well as a large deletion of the cytoplasmic tail of Gc (ACT mutant) and characterized CCHFV GP CD mutants using infection assays combined with biochemical assays and confocal microscopy analyses of virus producer cells. They found that several of the identified CCHFV GP CD motifs could modulate GP transport through the various segments of the intracellular trafficking network and hence envelopment and secretion of infectious particles. In addition, they identified PACS-2 as a crucial host factor that contributes to CCHFV GPs trafficking and that is required for assembly and release of viral particles. These results demonstrate that Gn and Ge's CT domains interact with the host factor PACS2 to regulate CCHFV, viral assembly / incorporation, and budding.

[0014] A first object of the invention relates to a PACS-2 inhibitor for use in the prevention and / or in the treatment of Nairoviridae family infections in a subject in need thereof. As used herein, the term “patient” or “subject” or “individual” refers to a subject to be treated by the compound disclosed herein. In particular, the patient suffers from Nairoviridae family infections. In one embodiment, the patient is a mammal. Non-limiting examples of mammals include rodents (e.g., mice and rats), primates (e.g., lemurs, bushbabies, monkeys, apes and humans), rabbits, dogs, horses, cats, livestock (such as pigs, bovines, donkeys, mules, bison, goats, camels, and sheep), and deer. In one embodiment, the mammal is a human. The subject may as well be afflicted by the disease as he may be healthy.

[0015] By “healthy”, it is herein intended to mean that the subject is not afflicted by the disease, whether or not he is afflicted by another disease.

[0016] In one embodiment, the Nairoviridae family infection is a Norwavirus, Ocetevirus, Orthonairovirus, Sabavirus, Shaspivirus, Striwavirus or Xinspivirus infection. In one embodiment, the Nairoviridae family infection is a Orthonairovirus genus infection. In one embodiment, the Orthonairovirus infection is a CCHFV or Hazara infection.

[0017] In one embodiment, the Orthonairovirus infection is a CCHFV infection.

[0018] As used herein, the term “viral infection” refers to a Nairoviridae family infection induced by a viral agent. “Virus” or “Viral agent” refers to an infectious agent requiring a host, often a cell, whose constituents and metabolism allow the viral replication. Virus change form during their cycle with an extracellular stage and an intracellular stage.

[0019] As used herein, the term “Nairoviridae family infection” or “Nairovirus family infection” refers to an infection induced by a virus from Nairoviridae family. Nairoviridae are a family of viruses belonging to the order Bunyavirales. Nairoviridae is transmitted by ticks and comprises seven genera including Orthonairovirus genus. Some virus from this family induce serious and lethal human diseases such as Crimean-Congo hemorrhagic fever.

[0020] As used herein, the term “Orthonairovirus genus infection” refers to a Nairoviridae family infection induced by a virus from Orthonairovirus genus. Virus belonging to the Nairovirus family, Orthonairovirus genus comprises viruses with a single-stranded RNA and a spherical virion. The majority comes from ticks and some virus from this genus induce serious and lethal human diseases such as Crimean-Congo hemorrhagic fever.

[0021] As used herein, the term “Crimean-Congo hemorrhagic fever virus infection” or “CCHFV infection” or “Crimean-Congo hemorrhagic fever” or “CCHF” refers to a Nairoviridae family infection, in particular Crimean-Congo hemorrhagic fever, induced by a CCHFV. CCHFV is an enveloped virus that belongs to the Nairoviridae family and the Orthonairovirus genus. The viral genome consists of three single-stranded RNA segments (L, M, and S) of negative or ambisense polarity. The RNA segments exclusively replicate in the cytosol and encode up to five non-structural proteins and four structural proteins, which are the RNA-dependent RNA polymerase L, the nucleoprotein NP, and two envelope glycoproteins (GP) Gc and Gn. The NP protein binds to genomic RNA to form, together with the viral polymerase, the pseudo-helical ribonucleoproteins (RNPs) inside the virions. Inserted on the viral envelope, the Gn and Gc GPs are responsible for the attachment of viral particles to the surface of host cells and their subsequent penetration into the cytosol (Hawman D.W et al., 2023, Nature Reviews Microbiology). CCHFV has a broad tropism and can infect a variety of tissues or species, implying that that it may use multiple receptors or entry factors or, alternatively, a receptor that could be broadly expressed.

[0022] Phosphofurin Acidic Cluster Sorting protein 2 (PACS-2) is well known in the state of the art. PACS-2 is a multifunctional sorting protein at MAMs, plays a critical role in mitochondria, ER and lysosome homeostasis (Li C et al., 2020, Pharmacol Res). Human PACS- 2, which is located near the telomere at 14q32.33, also contains 24 exons and at least 11 alternatively spliced variants. PACS-2 helps transport certain molecules and proteins. PACS-2 mediates the localization of cargo proteins to the Endoplasmic Reticulum, from early endosomes to the Trans-Golgi Network or plasma membrane, and also promotes Mitochondria- associated membrane integrity (Thomas G et al., 2017, J Cell Sci). The Entrez reference number of human gene coding for PACs-2 is 23241 and the Uniprot reference number of PACS-2 human protein is Q86VP3.

[0023] As used herein, the term “PACS-2 inhibitor” refers to any compound natural or not which is capable of reducing or blocking the activity or expression of PACS-2. It comprises directly or indirectly inhibitors. The term encompasses any inhibitor that is currently known in the art or that will be identified in the future and includes any chemical entity that, upon administration to a patient, results in inhibition or down-regulation of a biological activity associated with activation of PACS-2. The term also encompasses any inhibitor of expression. PACS-2 inhibitors are well known in the state of the art. In the context of the present invention, “PACS-2 inhibitor” is an inhibitor which neutralizes, blocks, inhibits, abrogates, reduces or interferes with the biological activity of PACS-2. In particular it refers to an inhibitor which reduces the cell infection by Nairoviridae family virus. In one embodiment, the PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the PACS-2 inhibitor inhibits the GP expression and / or the GP secretion.

[0024] In one embodiment, the PACS-2 inhibitor according to the invention is 1) an inhibitor of PACS-2 activity and / or 2) an inhibitor of PACS-2 expression.

[0025] In one embodiment, the inhibitor of PACS-2 activity according to the invention is a small molecule, an anti -PACS-2 neutralizing antibody, an aptamer, a polypeptide.

[0026] In one embodiment, the inhibitor of PACS-2 expression according to the invention is a siRNA, a nuclease, a ribozyme and / or an antisense oligonucleotide.

[0027] By "biological activity" of PACS-2 is meant, in the context of the present invention, inhibiting the assembly, the envelopment and / or the release of the Nairoviridae family virus as well as inhibiting the GP expression and / or the GP secretion. Tests for determining the capacity of a compound to be an inhibitor according to the invention are well known to the person skilled in the art. In a particular embodiment, the ability of the inhibitor to inhibits the biological activity of PACS-2 is well known to the person skilled in the art. The ability to inhibit the assembly, the envelopment and / or the release of the Nairoviridae family virus may be determined by assaying cell infectivity with Flow Cytometry (FACS) using a MACSQuant (Miltenyi Biotec) VYB apparatus (see Figures 1, 3 & 6) or with RTqPCR (see Figure 7), by assaying virus production with confocal microscopy (see Figures 2, 4 & 8) and by assaying glycoprotein production with western blot (see Figures 1, 3, 5 & 6).

[0028] As used herein, the term “assembly of the virus” refers to a dynamic process driven by genetically programmed sequential morphogenetic reactions involving protein-protein associations and interactions between the viral genome and capsid proteins. As used herein, the term “envelopment of the virus” refers to a process where the virus acquires an additional membrane envelope. As used herein, the term “release of the virus” refers to the phenomenon by which virus particles leave infected host cells.

[0029] The methods for assessing the assembly, the envelopment and / or the release of a virus are well known to the person skilled in the art (Encyclopedia of Virology, Fourth Edition, 2021; Navaratnarajah C.K et al., 2008, Encyclopedia of virology, Selzer L et al., 2015, Cold Spring Harb Per sped Med).

[0030] Inhibitor of the PACS-2 activity

[0031] In one embodiment, the PACS-2 inhibitor according to the invention is an inhibitor of PACS-2 activity. As used herein, the term “inhibitor of the PACS-2 activity” refers to a natural or synthetic compound that has a biological effect to inhibit the activity of PACS-2. In some embodiments, said inhibitor of PACS-2 activity is a small organic molecule, an antibody, an aptamer and / or a polypeptide. Inhibitors of PACS-2 activity are well known in the state of the art. Small organic molecule

[0032] In one embodiment, the compound according to the invention is a low molecular weight compound, e.g. a small organic molecule. In one embodiment, the small organic molecule as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the compound inhibits the GP expression and / or the GP secretion.

[0033] As used herein, the term “small organic molecule” refers to a molecule (natural or not) of a size preferably smaller than 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and more preferably up to 1000 Da.

[0034] The small organic molecules as inhibitors of PACS-2 are well known in the state of the art.

[0035] Methods for selecting an appropriate small organic molecule are well known in the art. In particular, the methods for selecting small molecules specifically inhibiting PACS-2 are known in the prior art.

[0036] • Antibody

[0037] In one embodiment, the compound according to the invention is an anti-PACS-2 neutralizing antibody that can block directly or indirectly the PACS-2 activity. In particular, the antibody selected is a neutralizing antibody. For this invention, neutralizing antibodies of PAC- 2 are selected for their capacity to inhibit the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the PACS-2 antibody inhibits the GP expression and / or the GP secretion. As used herein, "antibody" includes both naturally occurring and non-naturally occurring antibodies. Specifically, "antibody" includes polyclonal and monoclonal antibodies, and monovalent and divalent fragments thereof. Furthermore, "antibody" includes chimeric antibodies, wholly synthetic antibodies, single chain antibodies, and fragments thereof. The antibody may be a human or nonhuman antibody. A nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in man. Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The Fc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitopebinding ability in isolation. Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDRS). The CDRs, and in particular the CDRS regions, and more particularly the heavy chain CDRS, are largely responsible for antibody specificity. It is now well-established in the art that the non CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and / or Fc / pFc' regions to produce a functional antibody. The antibodies as inhibitors of PACS-2 are well known in the state of the art and commonly sold in the trade. Antibodies are prepared according to conventional methodology. Monoclonal antibodies may generated using method of Kholer and Milstein (Nature, 256:495, 1975). Antibodies directed against PACS-2 can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against PACS-2 can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-PACS-2 single chain antibodies. Compounds useful in practicing the present invention also include anti-PACS-2 antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and / or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to PACS-2.

[0038] In another embodiment, the antibody according to the invention is a humanized antibody. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody will also optionally comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397). Humanized anti-PACS-2 antibodies and antibody fragments there from can also be prepared according to known techniques. In one embodiment of the humanized forms of the antibodies, some, most or all of the amino acids outside the CDR regions have been replaced with amino acids from human immunoglobulin molecules but where some, most or all amino acids within one or more CDR regions are unchanged. However, using certain methods of humanization, the affinity and / or specificity of binding of the antibody may be increased using methods of "directed evolution", as described by Wu et al., / . Mol. Biol. 294: 151, 1999, the contents of which are incorporated herein by reference. In vitro methods also exist for producing human antibodies. These include phage display technology (U.S. Pat. Nos. 5,565,332 and 5,573,905) and in vitro stimulation of human B cells (U.S. Pat. Nos. 5,229,275 and 5,567,610). The contents of these patents are incorporated herein by reference. Moreover, one of ordinary skill in the art will be familiar with other methods for antibody humanization. In another embodiment, the antibody according to the invention is a single domain antibody. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”. PACS-2 being an intracellular target, VHH are particularly suitable for inhibiting it. Thus, methods for selecting an appropriate antibody are well known in the art. In particular, the methods for selecting an antibody specifically inhibiting PACS-2 are known in the prior art. For this invention, a neutralizing single domain antibody of PACS-2 is selected.

[0039] • Aptamer

[0040] In one embodiment, the compound according to the invention is a neutralizing aptamer. In one embodiment, the aptamer as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the compound inhibits GP expression and / or the GP secretion.

[0041] Aptamers representing an alternative to antibodies in term of molecular recognition are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.

[0042] The aptamers as inhibitors of PACS-2 are well known in the state of the art. Methods for selecting an aptamer specifically inhibiting PACS-2 are known in the state of the art. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C et al., 1990, Science. The random sequence library is obtainable by combinatorial chemical synthesis of DNA and each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D et al., 1999, Clin Chem. For this invention, neutralizing aptamers of PACS-2 are selected.

[0043] • Polypeptide

[0044] In one embodiment, the compound according to the invention is a polypeptide. In one embodiment, the polypeptide as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the compound inhibits the GP expression and / or the GP secretion.

[0045] A polypeptide is a chain of amino acids linked by peptide bonds. In particular, a polypeptide comprises an amino acid chain containing from 10 to 100 amino acids.

[0046] The polypeptides as inhibitors of PACS-2 are well known in the state of the art. Methods for selecting an polypeptide specifically inhibiting PACS-2 are known in the prior art. The polypeptides of the invention may be produced by any suitable means. The expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the polypeptide of the invention. The polypeptide may be produced by recombinant means, by expression from an encoding nucleic acid molecule with Systems for cloning and expression of a polypeptide well known. When expressed in recombinant form, the polypeptide is preferably generated by expression from an encoding nucleic acid in an appropriate host cell. Suitable host cells include but are not limited to bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include but are not limited to HeLa cells or baby hamster kidney cells. A common, preferred bacterial host is E coli.

[0047] In one embodiment, the polypeptides may be modified in order to improve their therapeutic efficacy, decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity may be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution.

[0048] A strategy for improving drug viability is the utilization of water-soluble polymers that may modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers and modify the rate of clearance from the body. Water-soluble polymers may contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain.

[0049] Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications. Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug / linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory half-life of the conjugate.

[0050] Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration. Linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes.

[0051] Inhibitor of PACS-2 gene expression

[0052] In one embodiment, the PACS-2 inhibitor according to the invention is an inhibitor of PACS-2 gene expression. As used herein the term “inhibitor of the PACS-2 gene expression” refers to a natural or synthetic compound that has a biological effect to inhibit the expression of gene. In some embodiments, said inhibitor of gene expression is a siRNA, a nuclease, a ribozyme or an antisense oligonucleotide.

[0053] Inhibitors of gene expression according to the invention are commonly sold and they are well known in the state of the art and include those described in :

[0054] Simmen T et al., 2005, EMBO J

[0055] Li C et al., 2020, Pharmacol Res

[0056] Atkins K.M et al., 2014, Cell Rep

[0057] • Small inhibitory RNA

[0058] In one embodiment, inhibitor of PACS-2 expression according to the invention is an Small inhibitory RNAs (siRNAs). In one embodiment, the small inhibitory RNA as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the small inhibitory RNA as PACS-2 inhibitor inhibits the GP expression and / or the GP secretion. Small inhibitory RNA (usually of 20-24 bp) interacting with an mRNAto decrease or inhibit a gene expression. siRNAs as PACS-2 inhibitors are well known in the state of the art (Crump C.M et al., 2003, J Virol Mani C et al., 2020, Oncogene Simmen T et al., 2005, EMBO J Li C et al., 2020, Pharmacol Res & Atkins K.M et al., 2014, Cell Rep). Moreover, shRNA as inhibitor according to the invention are known in the state of the art (Jenkins PM et al., 2009, J Neurosci). In the present invention, the PACS-2 downregulation is induced by the specific shRNAs TRCN000135103, CACCAAGGAGAAGAACAAGAA (SEQ ID No: 22) and

[0059] GACCAGGCAACAGAACTTCAA (SEQ ID NO: 23). PACS-2 gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that PACS-2 gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01 / 36646, WO 99 / 32619, and WO 01 / 68836). In particular, the methods for selecting small inhibitory RNA as inhibitor according to the invention are known in the prior art.

[0060] • Nuclease

[0061] In one embodiment, the inhibitor of PACS-2 expression according to the invention is a Nuclease. In one embodiment, the nuclease as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the nuclease as PACS-2 inhibitor inhibits the GP expression and / or the GP secretion. Nuclease or Endonuclease are synthetic nucleases consisting of a DNAbinding site, a linker, and a cleavage module derived from a restriction endonuclease which are used for gene targeting efforts. The synthetic nucleases according to the invention exhibit increased preference and specificity to bipartite or tripartite DNA target sites comprising DNA binding (i.e. TALEN or CRISPR recognition site(s)) and restriction endonuclease target site while cleaving at off-target sites comprising only the restriction endonuclease target site is prevented. The guide RNA (gRNA) sequences direct the nuclease (i.e. Cas9 protein) to induce a site-specific double strand break (DSB) in the genomic DNA in the target sequence. Restriction endonucleases (also called restriction enzymes) as referred to herein in accordance with the present invention are capable of recognizing and cleaving a DNA molecule at a specific DNA cleavage site between predefined nucleotides. In contrast, some endonucleases such as for example Fokl comprise a cleavage domain that cleaves the DNA unspecifically at a certain position regardless of the nucleotides present at this position. Therefore, preferably the specific DNA cleavage site and the DNA recognition site of the restriction endonuclease are identical. Moreover, also preferably the cleavage domain of the chimeric nuclease is derived from a restriction endonuclease with reduced DNA binding and / or reduced catalytic activity when compared to the wildtype restriction endonuclease. According to the knowledge that restriction endonucleases, particularly type II restriction endonucleases, bind as a homodimer to DNA regularly, the chimeric nucleases as referred to herein may be related to homodimerization of two restriction endonuclease subunits. Preferably, the restriction endonuclease from which the cleavage module of the chimeric nuclease is derived is a type IIP restriction endonuclease. The preferably palindromic DNA recognition sites of these restriction endonucleases consist of at least four or up to eight contiguous nucleotides. Preferably, the type IIP restriction endonucleases cleave the DNA within the recognition site which occurs rather frequently in the genome, or immediately adjacent thereto, and have no or a reduced star activity. Nucleases as PACS-2 inhibitors according to the invention are well known in the state of the art and they are commonly sold (sc-430777 by Santa Cruz, sc-403026 by Santa Cruz).

[0062] • Ribozyme

[0063] In one embodiment, the inhibitor of PACS-2 expression according to the invention is a Ribozyme. In one embodiment, the ribozyme as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the ribozyme as PACS-2 inhibitor inhibits the GP expression and / or the GP secretion. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of PACS-2 mRNA sequences are thereby useful within the scope of the present invention. Ribozymes as PACS-2 inhibitors according to the invention are well known in the state of the art. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays. Methods for selecting ribozymes specifically inhibiting PACS-2 gene expression are known in the prior art. Antisense oligonucleotide

[0064] In one embodiment, the inhibitor of PACS-2 expression according to the invention is an Antisense oligonucleotide. In one embodiment, the antisense oligonucleotide as PACS-2 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the antisense nucleotide as PACS-2 inhibitor inhibits the GP expression and / or the GP secretion. Antisense oligonucleotides, including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of PACS- 2 mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of PACS-2, and thus activity, in a cell. The antisense oligonucleotides as PACS-2 inhibitors according to the invention are well known in the state of the art. Antisense oligonucleotides can be synthesized, e.g., by conventional phosphodiester techniques. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732). In particular, the methods for selecting antisense oligonucleotides specifically inhibiting PACS-2 gene expression are known in the prior art. The inhibitor of PACS-2gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoter. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and / or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

[0065] • Inhibitor of PACS-2 gene expression can be associated with a vector

[0066] The PACS-2 inhibitor according to the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the inhibitor of the gene expression to the cells and preferably cells expressing PACS-2. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the inhibitor of the gene expression. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles are provided in Kriegler, 1990 and in Murry, 1991. Preferred viruses for certain applications are the adeno-viruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno- associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC / CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation.

[0067] In one embodiment, the inhibitor of PACS-2 gene expression according to the invention is associated with a vector.

[0068] In one embodiment, the inhibitor of PACS-2 gene expression according to the invention is associated with a viral vector, adeno-viral vector or a plasmid vector. In one embodiment, the inhibitor of PACS-2 gene expression according to the invention is associated with a lentiviral vector. In one embodiment, the inhibitor of PACS-2 gene expression is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter can also be, e.g., a viral promoter, such as CMV promoter or any synthetic promoters.

[0069] Therapeutic applications

[0070] Another object of the invention relates to a method for preventing and / or treating Nairoviridae family infections in a subject in need thereof comprising administering a therapeutically effective amount of the PACS-2 inhibitor according to the invention.

[0071] As used herein, the term “curative treatment” or “therapeutic treatment” is focused on treating existing diseases, conditions, or health problems after they have already developed. The goal of curative treatment is to alleviate symptoms, eliminate the cause of the problem, and restore the patient to a healthier state. Curative treatment is reactive, as it addresses health issues that have already manifested and are causing problems for the patient. The term is thus distinguishable from the term “preventive treatment”. Curative treatment is administered after a health issue has developed, targets existing diseases or conditions and aims to provide relief and cure. Curative treatment addresses the symptoms and root causes of a specific health problem. Thus, the goal of curative treatment is to restore the patient's health and eliminate the disease or condition. As used herein, the term “preventive treatment” or “prophylactic treatment” aims to prevent the development of diseases, conditions, or health problems before they occur. The goal of preventive treatment is to reduce the risk factors associated with a particular health issue and promote overall well-being. Preventive treatment is proactive, as it focuses on minimizing the likelihood of health problems arising in the first place. Preventive treatment is administered before any health problems arise and focuses on reducing the risk of developing diseases or conditions. Preventive treatment emphasizes lifestyle changes and interventions to minimize risk factors. Thus, the goal of preventive treatment is to maintain good health and avoid the onset of diseases. In particular, the method of the present invention is particularly suitable for reducing the cell infection by Nairoviridae family virus. In particular, the method of the present invention is particularly suitable for inhibiting the cell entry steps of Nairoviridae family virus and / or the GP expression and / or the GP production and / or the production of infectious viral particles.

[0072] In one embodiment, PACS-2 inhibitor is used in the treatment of Nairoviridae family infections in the early stage of the infection. As used herein, the term “early stage of the infection” refers to a period of few hours post-infection. In particular, the term refers to a period less than 24 hours post-infection. In particular, the term refers to a period between 6 hours and 24 hours post-infection.

[0073] As used herein, the term “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. A therapeutically effective amount is also one in which any toxic or detrimental effects are outweighed by the therapeutically beneficial effects. The efficient dosages and dosage regimens depend on the disease or condition to be treated and may be determined by the persons skilled in the art. A physician having ordinary skill in the art may readily determine and prescribe the effective amount required. For example, the physician could start doses at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subj ect to be treated. A medicine typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 7 mg / kg of body weight per day. By "dosage regimen” or “therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]). The therapeutically effective amount, the time of administration, route of administration, and the duration of the treatment may vary according to factors well known in the medical art such as the disease state, age, sex, and weight of the individual, and the ability of the compound of the invention to elicit a desired response in the individual.

[0074] Pharmaceutical composition

[0075] Another object of the invention relates to a pharmaceutical composition for use in the prevention and / or in the treatment of Nairoviridae family infections comprising a therapeutically effective amount of the PACS-2 inhibitor according to the invention.

[0076] The composition of the present invention may e.g. be formulated for any mode of administration suitable for the treatment of Nairoviridae family infections. In particular, CCHFV infection. The form of the composition, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the subject, etc. Then, the uses are adjusted to provide the optimum desired response (e.g., a therapeutic response). The pharmaceutical compositions may contain vehicles which are pharmaceutically acceptable for a formulation capable of preventing and / or treating Nairoviridae family infections. As used herein, the term “pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administrated to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluents, encapsulating material or formulation auxiliary of any type. The carrier(s) must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. “Carriers” or “vehicles” include any such material known in the art and may be any liquid, gel, solvent, liquid diluent, solubilizer, or like, which is non-toxic and which does not interect with any components of the composition in a deleterious manner. Examples of nutritionally acceptable carriers include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, polyethylene glycols, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, petroethral fatty acid esters, hydroxymethyl-cellulose, polyvinylpyrrolidone, and the like.

[0077] Kit of parts

[0078] Another object of the invention relates to a kit of part comprising an PACS-2 inhibitor and at least one further therapeutic agent as a combined preparation for simultaneous, separate or sequential use in the prevention and / or the treatment of Nairoviridae infections. As used herein, the term “therapeutic agent” or “active agent” or “active substance” or “active principle” or “active ingredient” relates to a chemical substance inducing an effect such as a therapeutic or a preventive effect. It may be a bioactive chemical compound from a drug or the drug itself. Active agent can be a single molecule or a mixture of several substances. As used herein, the term “simultaneous use” denotes the use of a PACS-2 inhibitor and at least one active agent occurring at the same time. As used herein, the term “separate use” denotes the use of a PACS-2 inhibitor and at least one active agent not occurring at the same time. As used herein, the term “sequential use” denotes the use of a PACS-2 inhibitor and at least one active agent occurring by following an order. In one embodiment, active agents may be added to the pharmaceutical composition or used in combination with the compound of the invention in the case of the treatment of Nairoviridae infections.

[0079] In one embodiment, the PACS-2 inhibitor according to the invention is used in combination with a PACS-1 inhibitor. In one embodiment, the method according to the invention comprises administering of an effective amount of the PACS-2 inhibitor according to the invention in combination with an effective amount of a PACS-1 inhibitor.

[0080] In one embodiment, the pharmaceutical composition according to the invention comprises a therapeutically effective amount of the PACS-2 inhibitor according to the invention in combination with a therapeutically effective amount of a PACS-1 inhibitor.

[0081] Phosphofurin Acidic Cluster Sorting protein 1 (PACS-1) is well known in the state of the art. PACS-1 is a protein with a role in the localization of trans-Golgi network membrane proteins. Human PACS1 is located at 1 lql3. l-ql3.2 and contains 24 exons and at least 12 alternatively spliced variants. PACS1 protein is found in a complex network of membranes known as the trans-Golgi network, which sorts proteins and other molecules and sends them to their intended destinations inside or outside the cell. Within the trans-Golgi network, this protein helps transport certain molecules and proteins. Thus, PACS-1 mediates the sorting of client proteins from late endosomes to the Trans-Golgi Network and from early endosomes to the plasma membrane (Thomas G et al., 2017, J Cell Set). The PACS1 protein is most active during development before birth (Lusk L et al., 2020, Gene Reviews Schuurs-Hoeij makers J.H.M et al., 2016, Am J Med Genet A Schuurs-Hoeij makers J.H.M et al., 2012, Am J Med Genet & Stern D et al., 2017, Clin Genet). The Entrez reference number of the human gene coding for PACS-1 is 55690 and the Uniprot reference number of PACS-1 human protein is Q6VY07. Many studies demonstrated that PACS-1 is involved in viral infections such as HIV- 1 infection (Liu H et al., 2020, Virology).

[0082] As used herein, the term “PACS-1 inhibitor” refers to any compound natural or not which is capable of reducing or blocking the activity or expression of PACS-1. It comprises directly or indirectly inhibitors. The term encompasses any inhibitor that is currently known in the art or that will be identified in the future and includes any chemical entity that, upon administration to a patient, results in inhibition or down-regulation of a biological activity associated with activation of PACS-1. The term also encompasses any inhibitor of expression.

[0083] PACS-1 inhibitors are well known in the state of the art and include those described in :

[0084] Crump C.M et al., 2003, J Virol

[0085] Mani C et al., 2020, Oncogene

[0086] Jenkins PM et al., 2009, J Neurosci In the context of the present invention, “PACS-1 inhibitor” is an inhibitor which neutralizes, blocks, inhibits, abrogates, reduces or interferes with the biological activity of PACS-2. In particular it refers to an inhibitor which reduces the cell infection by Nairoviridae family virus. In one embodiment, the PACS-1 inhibitor inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus. In one embodiment, the PACS-1 inhibitor inhibits the GP expression and / or the GP secretion.

[0087] In one embodiment, the PACS-1 inhibitor according to the invention is

[0088] 3) an inhibitor of PACS-1 activity and / or

[0089] 4) an inhibitor of PACS-1 expression.

[0090] In one embodiment, the inhibitor of PACS-1 activity according to the invention is a small molecule, an anti -PACS-1 neutralizing antibody, an aptamer, a polypeptide as described above.

[0091] In one embodiment, the inhibitor of PACS-1 expression according to the invention is a siRNA, a nuclease, a ribozyme and / or an antisense oligonucleotide as described above. In the present invention, the PACS-1 downregulation is induced by the specific shRNA AGATCTGTTCAGTCGCTC (SEQ ID NO: 14).

[0092] By "biological activity" of PACS-1 is meant, in the context of the present invention, inhibiting the assembly, the envelopment and / or the release of the Nairoviridae family virus as well as inhibiting the GP expression and / or the GP secretion. Tests for determining the capacity of a compound to be an inhibitor according to the invention are well known to the person skilled in the art. In a particular embodiment, the ability of the inhibitor to inhibits the biological activity of PACS-1 is well known to the person skilled in the art. The ability to inhibit the assembly, the envelopment and / or the release of the Nairoviridae family virus may be determined by assaying cell infectivity with Flow Cytometry (FACS) using a MACSQuant (Miltenyi Biotec) VYB apparatus (see Figures 1, 3 & 6) or with RTqPCR (see Figure 7), by assaying virus production with confocal microscopy (see Figures 2, 4 & 8) and by assaying glycoprotein production with western blot (see Figures 1, 3, 5 & 6).

[0093] The invention will be further illustrated by the following figures and examples. However, the examples and figures should not be interpreted in any way as limiting the scope of the present invention. FIGURES

[0094] Figure 1 : Infectivity and viral incorporation of CCHFV Gc cytoplasmic tail mutants. (A) Infectivity titers of intracellular and extracellular CCHFV tc-VLPs bearing mutant Gc proteins. At 72h post-transfection, clarified supernatants and cell-associated tc-VLPs were used to infect Huh7.5 cells pre-transfected with L and N expression vectors, and titers were determined by FACS analysis at 24h post-infection. (B) tc-VLP producer cells were lysed 72h post-transfection and cell lysate were analyzed by Western blot. Relative quantification of intracellular expression of Gc from Gc mutant proteins compared to WT proteins. Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT. (C) Relative quantification of intracellular expression of NP from Gc mutant proteins compared to WT proteins. Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT. (D) Relative quantification of intracellular expression of Gn from Gc mutant proteins compared to WT proteins. Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT. (E) tc-VLP containing supernatants were pelleted by ultracentrifugation through 20% sucrose cushions, resuspended in Opti-MEM medium and analyzed by Western blot. Relative quantification of extracellular secretion of Gc is expressed as fold change compared to WT. (F) Relative quantification of extracellular secretion of NP is expressed as fold change compared to WT. (G) Relative quantification of extracellular secretion of Gn is expressed as fold change compared to WT. Statistical significance was determined using parametric student-t test compared with WT GPs. The values are displayed as means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

[0095] Figure 2 : Intracellular localization of CCHFV Gc cytoplasmic tail determinants. Confocal microscopy analysis of Huh7.5 cells producing tc- VLPs encoding a GFP marker that were generated with WT GPs vs. Gc cytoplasmic tail mutants (Yl, Y2, LL, AC, ERR, CT). (A) Golgi localization of CCHFV Gc glycoprotein. At 48h post-transfection, cells were fixed, permeabilized with Triton X- 100, and stained for GFP, Golgi (anti-GM130), Gc (11E7), and nuclei (Hoechst). (B) Early endosome localization of CCHFV Gc glycoprotein. As described in (A), cells were fixed and stained for GFP, Rab5 (anti-Rab5), Gc (11E7), and nuclei (Hoechst). (C) Late endosome localization of CCHFV Gc glycoprotein. As described in (A), cells were fixed and stained for GFP, Rab7 (anti-Rab7), Gc (11E7), and nuclei (Hoechst). Pearson’s coefficients were calculated using FIJI (JACoP) on at least 15 cells from 3 separated experiments and expressed as means ± SEM. Statistical significance was determined using nonparametric two-tailed Mann-Whitney test. Each dot in the graphs corresponds to the value of an individual cell.

[0096] Figure 3 : Infectivity and viral incorporation of CCHFV Gn cytoplasmic tail mutants. (A) Infectivity titers of intracellular and extracellular CCHFV tc-VLPs bearing mutant Gn proteins. At 72h post-transfection, clarified supernatants and cell-associated tc-VLPs were used to infect Huh7.5 cells pre-transfected with L and N expression vectors, and titers were determined by FACS analysis at 24h post-infection. (B) tc-VLP producer cells were lysed 72h post-transfection and cell lysate were analyzed by Western blot. Relative quantification of intracellular expression of Gc from Gn mutant proteins compared to WT proteins. Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT. (C) Relative quantification of intracellular expression of NP from Gn mutant proteins compared to WT proteins. Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT. (D) Relative quantification of intracellular expression of Gn from Gn mutant proteins compared to WT proteins. Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT. (E) tc-VLP containing supernatants were pelleted by ultracentrifugation through 20% sucrose cushions, resuspended in Opti-MEM medium and analyzed by Western blot. Relative quantification of extracellular secretion of Gc is expressed as fold change compared to WT. (F) Relative quantification of extracellular secretion of NP is expressed as fold change compared to WT. (G) Relative quantification of extracellular secretion of Gn is expressed as fold change compared to WT. Statistical significance was determined using parametric student-t test compared with WT GPs. The values are displayed as means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

[0097] Figure 4 : Intracellular localization of CCHFV Gn cytoplasmic tail determinants. Confocal microscopy analysis of Huh7.5 cells producing tc- VLPs encoding a GFP marker that were generated with WT GPs vs. Gn cytoplasmic tail mutants (Yl, Y2, LL, AC). (A) Golgi localization of CCHFV Gc glycoprotein. At 48h post-transfection, cells were fixed, permeabilized with Triton X- 100, and stained for GFP, Golgi (anti-GM130), Gc (11E7), and nuclei (Hoechst). (B) Early endosome localization of CCHFV Gc glycoprotein. As described in (A), cells were fixed and stained for GFP, Rab5 (anti-Rab5), Gc (11E7), and nuclei (Hoechst). (C) Late endosome localization of CCHFV Gc glycoprotein. As described in (A), cells were fixed and stained for GFP, Rab7 (anti-Rab7), Gc (11E7), and nuclei (Hoechst). Pearson’s coefficients were calculated using FIJI (JACoP) on at least 15 cells from 3 separated experiments and expressed as means ± SEM. Statistical significance was determined using nonparametric two-tailed Mann-Whitney test. Each dot in the graphs corresponds to the value of an individual cell.

[0098] Figure 5 : Knockdown of PACS-1 does not impact CCHFV GPs localization and infectivity. Downregulation of PACS-1 was achieved in Huh7.5 cells via a lentiviral vector expressing a PACS- 1 shRNA. The cells were then used to produce CCHFV tc-VLPs harboring WT glycoproteins or no glycoproteins (No-GPs). (A) Relative quantification of PACS-1 expression in down-regulated cells. Results are expressed as fold change compared to PACS-1 expression levels in cells transduced with a control shRNA. (B) Infectivity titers of CCHFV tc- VLPs produced in the presence vs. in the absence of PACS-1 shRNA. At 72h post-transfection, clarified supernatants and cell-associated tc-VLPs were used to infect Huh7.5 cells pretransfected with L and N expression vectors, and titers were determined by FACS analysis at 24h post-infection. (C) Levels of intracellular and extracellular CCHFV viral RNA in PACS-1 KD or control cell lines. The cell lines were infected with authentic CCHFV at an MOI of 0.01. Supernatants (extracellular) and cells (intracellular) were harvested 24h post-infection and viral RNA titers in the supernatants and cells were determined using RTqPCR assay. (D-F) tc-VLP producer cells down-regulated for PACS-1 expression or control cells were lysed 72h posttransfection and cell lysate were analyzed by Western blot. Relative quantification of intracellular expression of Gc (D), NP (E) or Gn (F). Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT expression in control cells. (G-I) Cell supernatants containing tc- VLPs produced in PACS-1 down-regulated or control cells were pelleted by ultracentrifugation through 20% sucrose cushions, resuspended in Opti- MEM medium and analyzed by Western blot. Relative quantification of extracellular secretion of Gc (G), NP (H) or Gn (I). Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT expression in control cells.

[0099] Figure 6 : PACS2 knockdown impacts CCHFV GPs assembly and infectivity. (A) Downregulation of PACS-2 was achieved in Huh7.5 cells via a lentiviral vector expressing PACS-2 shRNAs (shl03 or sh433) or shControl. The cells were then used to produce CCHFV tc-VLPs harboring WT glycoproteins or no glycoproteins (No-GPs). (A) Relative quantification of PACS-2 expression in down-regulated cells. Results are expressed as fold change compared to PACS-2 expression levels in cells transduced with a control shRNA. (B-C) Infectivity titers of CCHFV tc-VLPs produced in the presence vs. in the absence of PACS-2 shRNA. At 72h post-transfection, clarified supernatants (B) or cell-associated tc-VLPs (C) were used to infect Huh7.5 cells pre-transfected with L and NP expression vectors, and titers were determined by FACS analysis at 24h post-infection. (D-F) tc-VLP producer cells down-regulated for PACS-2 expression or control cells were lysed 72h post-transfection and cell lysate were analyzed by Western blot. Relative quantification of intracellular expression of Gc (D), NP (E) or Gn (F). Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT expression in control cells. (G-I) Cell supernatants containing tc- VLPs produced in PACS-2 down-regulated or control cells were pelleted by ultracentrifugation through 20% sucrose cushions, resuspended in Opti- MEM medium and analyzed by Western blot. Relative quantification of extracellular secretion of Gc (G), NP (H) or Gn (I). Protein band intensities from Western blot membranes were quantified and normalized relative to actin and expressed as fold change compared to WT expression in control cells.

[0100] Figure 7 : Infectivity analysis in PACS-2 downregulated cells with WT CCHFV virus. Downregulation of PACS-2 was achieved in Huh7.5 cells via a lentiviral vector expressing PACS- 2 shRNAs (shl03 or sh433) or shControl. The cells were then used to infect with authentic CCHFV or mock (no infection). (A) Relative quantification of PACS-2 expression in down-regulated cells. Results are expressed as fold change compared to PACS-2 expression levels in cells transduced with a control shRNA. (B-C) Levels of intracellular and extracellular CCHFV viral RNAin PACS-2 KD or control cell lines. The cell lines were infected with authentic CCHFV at an MOI of 0.01. Supernatants (B) and cells (C) were harvested 24h post-infection and viral RNA titers in the supernatants and cells were determined using RTqPCR assay.

[0101] Figure 8 : PACS-1 down-regulation in tc-VLPs producing cells does not influence Gc intracellular localization. Confocal microscopy analysis of Huh7.5 cells down-regulated for PACS- 1 expression and producing tc-VLPs encoding a GFP marker that were generated with WT GPs vs. Gn AC mutant. Forty-eight hours post-transfection, cells were fixed, permeabilized with Triton X- 100, and stained for GFP, Golgi (anti-GM130), Gc (11E7), and nuclei (Hoechst). Pearson’s correlation coefficients between Gc and GM130 were calculated using FIJI (JACoP) and expressed as means ± SEM.

[0102] Figure 9 : CCHFV GPs trafficking in PACS-2 knockdown cells. Downregulation of PACS-2 was achieved in Huh7.5 cells via a lentiviral vector expressing PACS-2 shRNAs (Shl03, Sh433) or control shRNA (ShControl). The cells were then used to produce CCHFV tc-VLPs. (A) Golgi localization of CCHFV Gc glycoprotein. Confocal microscopy analysis of 1

[0103] Huh7.5 cells producing tc-VLPs encoding a GFP marker that were generated with WT GPC. At 48h post-transfection, cells were fixed, permeabilized with Triton X-100, and stained for GFP (grey channel), Golgi (anti-GM130, green channel), Gc (11E7, red channel), and nuclei (Hoechst, blue channel). (B) Gc colocalization with NP. Confocal microscopy analysis of Huh7.5 cells producing tc-VLPs encoding a GFP marker that were generated with WT GPC. At 48h post-transfection, cells were fixed, permeabilized with Triton X-100, and stained for GFP (grey channel), Gc (11E7, green channel), NP (2B11, red channel), and nuclei (Hoechst, blue channel). Scale bars represent 10 pm. Magnification of the squared areas is shown at the right side of each condition, scale bars from squared area represent 2pm. Pearson’s coefficients were calculated using FIJI (JACoP) and expressed as means ± SEM. Statistical significance was determined using non-parametric two-tailed Mann-Whitney test. The values are displayed as means ± SEM. Each dot in the graphs corresponds to the value of an individual cell.

[0104] Figure 10 : Working model of CCHFV GP retrograde intracellular trafficking. The molecular characterization of Gn and Gc CT motifs suggest that after translation, either GP follows the secretion pathway, via an unidentified mechanism, to reach the plasma membrane (PM). From the PM, Gc is re-endocytosed via its first tyrosine domain (Yl), which probably involves a clathrin-mediated endocytosis via AP-2 complexes. After endocytosis, Gn and Gc traffic via the endosomal retrograde pathway and are transferred from the late endosomes to the Golgi through the usage of their second tyrosine motif (Gn Y2 and Gc Y2 respectively). From there, Gn and Gc progress along the Golgi stacks to reach the unidentified assembly site, probably via COPI binding to Gc ERR motif and Gn AC motif via the PACS-2 protein adaptor. Interestingly, our results suggest that NP trafficking and / or assembly into particles is also dependent on PACS-2 protein.

[0105] EXAMPLES

[0106] Material & Methods

[0107] Cell culture and reagents.

[0108] Huh-7.5 hepato-carcinoma and HEK 293T kidney cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) complemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. All the cells were grown in a 37°C and 5% CO2 incubator.

[0109] Plasmids and constructs.

[0110] The constructs encoding wild-type CCHFV strain lb Ar 10200 L polymerase (pCAGGS- V5-L WT), CCHFV nucleoprotein NP (pCAGGS-NP), CCHFV specific eGFP- expressing minigenome (pT7RiboSM2_vL_eGFP) or CCHFV specific mcherry-expressing minigenome (pT7RiboSM2_vL_mcherry), T7 RNA polymerase (pCAGGS-T7), CCHFV M-segment polyprotein (pCAGGS-GP / wt-M), and an empty vector without viral genes (pCAGGS) were described previously (Bergeron E et al., 2010, J Virol Devignot S et al., 2015, J Virol Freitas N et al., 2020, PLoS Pathog). Several CCHFV M segment cDNA mutants were generated using standard molecular cloning techniques and confirmed by DNA sequencing. Standard PCR and oligonucleotide-specific mutagenesis reactions were carried out with Phusion enzyme (NEBio- labs). Cytoplasmic tail mutations in Gc and Gn are derived from M segments. By site-directed mutagenesis, Gc tyrosine motif mutant one Y1 (SEQ ID NO:1 YRHL / SEQ ID NO: 2 ARHL) was created by changing the tyrosine to alanine. Gc tyrosine motif mutant two Y2 (SEQ ID NO: 3 YRRI / SEQ ID NO: 4 ARRI) was generated by changing tyrosine to alanine. Gc dileucine motif (LL / AA) mutant was generated by mutagenesis. Acidic motif mutations were created (SEQ ID NO: 5 DDEE / SEQ ID NO: 6 NNQQ). AERR in Gc cytoplasmic tail of M segment was generated (SEQ ID NO: 7 KTHIG). The entire abolishment of the Gc cytoplasmic tail mutant was created ACT. Similarly, by using site-directed mutagenesis, Gn tyrosine motif mutant one Y1 (SEQ ID NO: 8 YREL / SEQ ID NO: 9 AREL) was created by changing the tyrosine to alanine. Gn tyrosine motif mutant two Y2 (SEQ ID NO: 10 YLNL / SEQ ID NO: 11 ALNL) was generated by changing tyrosine to alanine. Gn dileucine motif (LL / AA) mutant was generated by mutagenesis. Acidic motif mutations in Gn were created (SEQ ID NO: 12 EKVEETE / SEQ ID NO: 13 QKVQQTQ). Details of oligonucleotides used for the constructs are available upon request.

[0111] Production and titration of full-length CCHFV particles.

[0112] Huh-7.5 cells were infected using CCHFV isolate IbArl0200 (obtained from Pasteur Institute) at MOI 0.01 and the production was harvested 48h and 72h post infection. Infectious titer was determined by anti NP immunostaining on VeroE6 cells. 24h post infection, cells were lysed with TriReagent (Molecular Research Center, Inc. Cat. No.:TR118 ) and RNAs were extracted according to manufacturer’s protocol and level of viral RNA was determined by RT- qPCR.

[0113] Knockdown ofPACS-1 and PACS-2.

[0114] Expression of specific shRNAs AGATCTGTTCAGTCGCTC (SEQ ID NO: 14) through a lentiviral vector induced the PACS-1 downregulation in producer cells (Bouard D et al., 2007, Traffic). Five PACS-2 shRNAs were ordered from SIGMA-ALDRICH, ref sequence NM_015197. Out of five only three were used TRCN000135103 (shlO3) (target sequence: CACCAAGGAGAAGAACAAGAA (SEQ ID NO: 22)), TRCN0000137443 (sh433) (target sequence: GACCAGGCAACAGAACTTCAA (SEQ ID NO: 23)). To package shRNA- expressing lentiviral vectors, huh7.5 cells were seeded in 10-cm plates and were transfected with 8 pg of the FG12 GFP / shRNA construct or pLKO PACS2 construct, 8 pg of the HIV packaging construct pCMV 8 pg and 2.7 pg of the VSV-G glycoprotein. The vector particles were collected by 0.45 pm filters and aliquots were kept at -80°C for further use. The infectious titers were determined on 293T cells by FACS analysis. To downregulate PACS-1 and PACS-2 in Huh7.5 cells, the shRNA lentiviral vectors were used at a multiplicity of infection of 10. For PACS-1, 3 days after transduction huh7.5 cells were seeded in 10-cm plates and transfected with WT-tecVLPs after 24h to perform biochemical assay either in control or knockdown cells. Similarly for PACS-2, 7 days after transduction, cells were used for further transfections to generate WT tecVLPs in Knockdown or control cells to perform biochemical assay. In parallel, a lentiviral vector without shRNA was used as a control. The knockdown of endogenous PACS- 1 and PACS-2 was validated by immunoblotting.

[0115] Production of tc-VLPs.

[0116] Huh7.5 cells were seeded in 10cm dishes and transfected with 3.6 pg of pCAGGS-V5- L WT, 1.2 pg of pCAGGS-NP, 1.2 pg of pT7riboSM2-vS-GFP, 3 pg of pCAGGS-GP, 3 pg of pCAGGS-T7 by using GeneJammer transfection reagent (Agilent), as previously described (Devignot S et al., 2015, J Virol Freitas N et al., 2020, PLoS Pathog). pCAGGS plasmid was additionally transfected to keep the DNA amount uniform. The transfection media was replaced after 6h post-transfection. Cells supernatants were harvested 72h post-transfection and filtered through a 0.45 pm filters using the syringe and concentrated through ultracentrifugation through a 20% sucrose cushion (SW41 rotor at 28,000 rpm, 2h, 4°C).

[0117] Intracellular and extracellular infectivity.

[0118] Infectivity was analyzed by pre-transfected L and NP plasmid on Huh7.5 cells. Briefly, in 24-well plates, Huh7.5 cells were seeded and pre-transfected with 0.1 pg pCAGGS-V5-L- WT and 0.2pg pCAGGS-NP before infection, as previously described (Devignot S et al., 2015, J Virol Freitas N et al., 2020, PLoS Pathog). After three repeated freeze-thaw cycles, intracellular tc-VLP particles were released. After 24h post-infection, the infectivity was analyzed by flow cytometry (FACS) using a MACSQuant (Miltenyi Biotec) VYB apparatus. Data were then analyzed using the FlowJo software. Titers were calculated according to the formula (number of seeded Huh7.5 cells x % of GFP-positive cells) x 1000 / pl of inoculum and expressed as infectious units per ml of supernatant (extracellular infectivity) or cell lysate (intracellular infectivity). Antibodies.

[0119] Anti-PreGc (clone 11E7) and anti-NP (clone 9D5) mouse monoclonal antibodies targeting CCHFV were received from the Joel M. Dalrymple — Clarence J. Peters USAMRIID Antibody Collection through BEI Resources, NIAID, NIH. Ali Mirazimi (Karolinska Institute, Sweden) has kindly given an anti-Gn rabbit polyclonal antibody. Monoclonal mouse anti-P- actin AC-74 (Sigma), anti-HA (3F10, Sigma), anti-PACS-1 (A12659, ABclonal), anti-PACS-2 (ab222316, Abeam) were used at 1 / 1000 for Western blotting. Anti-GM130 (ab52649, Abeam), anti-Rab5 (C8B1, Cell Signaling) and anti-Rab7 (D95F2, Cell Signaling) were used at 1 / 200 for immunofluorescence. All the antibodies were used according to the manufacturer’s guidelines.

[0120] RNA extraction and RT-QPCR analysis.

[0121] Viral RNAs were extracted either from infected cell (intracellular) or from the supernatant (extracellular) using TRI Reagent according to the manu- facturer’s instructions (Molecular Research Center). RNAs were reverse transcribed using random oligonucleotide primers with iScript (Bio-Rad). The following specific primers against S segment were used: for CCHFV RNA quantification, forward primer 5’ - TGTTGCCTCCACCAGAGCA (SEQ ID NO: 15) and reverse primer 5’-TTCCAAATGGCCAGTGCC (SEQ ID NO: 16) (Peyrefitte C.N et al., 2010, J Gen Virol). Quantitative PCR (qPCR) was performed using FastStart Universal SYBR Green Master (Roche) on a StepOne Real-Time PCR System (Applied Biosystems). As an internal control of extraction, in vitro-transcribed exogenous RNAs from the linearized Triplescript plasmid pTRI-Xef (Invitrogen) were added to the samples prior to RNA extraction and quantified with specific primers (50-CGACGTTGTCACCGGGCACG (SEQ ID NO: 17) and 50-ACCAGGCATGGTGGTTACCTTTGC (SEQ ID NO: 18)). All values of intracellular CCHFV RNAs were normalized to glyceraldehyde 3 -phosphate dehydrogenase (GAPDH) gene transcription. For GAPDH mRNA quantification, we used the forward 5’-AGGTGAAGGTCGGAGTCAACG (SEQ ID NO: 19) and reverse 5’- TGGAAGATGGTGATGGGATTTC (SEQ ID NO: 20) primers.

[0122] Western blot analysis.

[0123] Huh7.5 transfected cells were washed with cold PBS and detached with versene. Cells were lysed in cell lysate buffer (20 mM Tris pH 7.5, 1% Triton, SDS 0.05%, sodium Deoxy cholate Acid 0.5% and 150 mM NaCl) containing protease inhibitors (Roche). Cell lysates were precipitated by centrifugation at 13,000 rpm for 30 min at 4 deg C. Pellets from ultracentrifuged supernatants were resuspended in PBS lx buffer in 1 / 100 of the initial volumes. To detect the expression of Gn, samples were denatured at 95 deg C for 5 min in reducing loading buffer (5X Blue Loading Buffer, 200 mM Tris HC1 pH6.8, 10% SDS, 500 mM P- mercaptoethanol and 50% glycerol) and electrophoresed on 10% SDS-polyacrylamide gels. Alternatively, for detection of Gc, samples were processed in a non-reducing loading buffer (5X Blue Loading Buffer, 200 mM Tris HC1 pH6.8, 20% SDS, and 50% glycerol) and electrophoresed on 10% polyacrylamide gels. Proteins were transferred to a nitrocellulose membrane by electro blotting (Bio-Rad) for Ih at 100V. The membrane was incubated in TBST (20 mM Tris HC1, pH 7.5, 150 mMNaCl and Tween 0.05%)-milk 5% for 1 hour. Nitrocellulose membranes were incubated with primary antibodies for the detection of CCHFV proteins. Mouse monoclonal 9D5 anti-NP 1 : 1000), (mouse monoclonal 11E7 anti-Gc 1 :500 and rabbit polyclonal anti-Gn 1:5000 in TBST-milk 5% overnight at 4 deg C. After 3 washes using TBST, then membranes were incubated with immunoflurophore labelled secondary antibodies (LiCor Biosciences) at 1 : 10000 dilution in TBST for Ih at room temperature, followed by imaging with Odyssey infrared imaging CLx system (LiCor Biosciences). Quantification of proteins was performed with Odyssey imaging CLx system software.

[0124] Immunofluorescence analysis.

[0125] The procedure was described previously (Boson B et al., 2022, mB >). Briefly, Huh7.5 cells were seeded in 6-well plates on coverslips and transfected with the plasmids described above. The transfection media was replaced after 6h post-transfection and infected with WT tc- VLPs after 24h post-transfection. Forty-eight hours post-transfection, the cells were fixed with 4% paraformaldehyde (PF A) for 15 min at room temperature. Next, unless otherwise specified, the cells were permeabilized with 0.1% Triton X-100 for 7 min. Cells were washed 3 times with PBS and incubated for 1 h at room temperature with primary antibodies diluted in PBS / 1% BSA. After 3 washes with PBS / 1% BSA, cells were further incubated with Alexa Fluorconjugated secondary antibodies (Alexa Fluor 568 and Alexa Fluor 647; Thermo Fisher) in PBS / 1% BSA. After 3 washes with PBS, nuclei were stained with Hoechst 33342 (Molecular Probes), and the coverslips were mounted with Mowiol 40-88 (Sigma- Aldrich). The slides were examined using a confocal microscope LSM-800 (Zeiss). Pearson’s correlation coefficients were calculated using FIJI (JACoP) and were calculated on n cells from 3 separate experiments and expressed as mean ± SEM.

[0126] Immunoprecipitation assays.

[0127] HEK 293T kidney cells were seeded in a 10cm dish. Cells were transfected with 3pg of pCAGGS-V5-L WT alone or with pcdna3.1 PACS1-HA 3 pg, using GeneJammer transfection reagent from (Agilent). pCCAGS plasmid was additionally transfected to keep the DNA amount uniform. The transfection media was replaced after 6h post- transfection. Cell lysates were harvested 72h post-transfection by RPIA buffer (0. l%tween20, 25mM Tris-HCl pH7.5, 300mM NaCl). Cell lysates were incubated overnight with Pierce HA magnetic beads. Samples were prepared according to the manufacturer instructions (catalog #8837).

[0128] Statistical analysis.

[0129] All the statistical analysis were performed using GraphPad Prism version 5.02 for Windows or Mac, GraphPad Software (San Diego, California, USA), for statistical comparisons, the Mann-Whitney or the student-t test were used. For statistical analysis, a p- value of 0.05 or less was considered significant. Data are presented as mean ± standard deviation, and results of the statistical analysis are shown as follows: ns, not significant (P > 0.05); *, P < 0.05; **, P < 0.01; and ***, P < 0.001.

[0130] Funding

[0131] This work was supported by the LabEx Ecofect (ANR-ll-LABX-0048) of the “Universite de Lyon”, within the program “Investissements d’ Avenir” (ANR-l l-IDEX-0007) operated by the French National Research Agency (ANR), the Fondation pour la Recherche Medicale (Grant number: EQU202203014673 awarded to F-LC), and the ANR (Grant number: ANR-22-ASTR-0031 awarded to F-LC). A.G. and N.F. were supported by fellowships of the ANRS / MIE. S.L. was supported by a fellowship of the FRM. M.R. was supported by a fellowship of the LabEx Ecofect.

[0132] Results

[0133] Gc cytoplasmic determinants are essential for the formation of infectious particles.

[0134] We identified several putative membrane trafficking motifs in the cytoplasmic tail (CT) of CCHFV Gc glycoprotein (Data not shown): two tyrosine-based motifs (Y 1 and Y2), an acidic cluster motif (AC), a dileucine motif (LL), and an ER retrieval motif (ERR). These potential determinants were mutated (Data not shown) in the context of GPC expression vectors, to raise mutant Gc proteins upon a CCHFV tc-VLP production and infection assay. To evaluate the role of these putative trafficking motifs on virion assembly, GP incorporation, and infectivity, we first generated a GC CT deletion mutant (Gc ACT) that was used to produce tc-VLPs by cotransfection of Huh7.5 cells with a CCHFV minigenome, CCHFV RNA polymerase (L) and nucleoprotein (NP) expression constructs together with constructs expressing either wild type (WT) GPC or ACT GPC (Data not shown). Whole-cell lysates of tc-VLP producer cells (defined as ‘Intracellular’ in all Figures) and the corresponding supernatants purified by ultracentrifugation through a sucrose cushion (defined as ‘Pellet’ in the Figures) were analyzed by SDS-PAGE and Western blot at 2 days post-transfection (Data not shown). NP intracellular expression and secretion in cell supernatants were not significantly different between WT and ACT tc-VLPs (Data not shown). In agreement with previous studies (Devignot S et al., 2015, J Virol Vincent M.J et al., 2003, Journal of Virology Zivcec M et al., 2016, Viruses & Freitas N et al., 2020, PLoS Palhog the expression of WT GPC raised mature Gn protein at 37kDa (Data not shown) and Gc protein as a preGc precursor of 85kDa that was converted to mature Gc (75kDa). In contrast with WT GPC, the ACT mutant GPC raised lower preGc and Gc bands due to the deletion of Gc cytoplasmic tail. Western blot analyses of pellets of tc-VLP producer cell supernatants indicated that while Gn and Gc were readily incorporated into particles for WT GPC, tc-VLPs generated with the ACT mutant displayed no or poor Gc and Gn levels, suggesting a defect in virion incorporation / secretion of either GP. In agreement with these results, the deletion of the CT of Gc resulted in a complete loss of both extracellular and intracellular infectivity (Fig.lA), hence underscoring the presence of critical determinants in Gc CT that allows envelopment and production of infectious viral particles. Next, we examined the ability of the mutants generated in the identified CT motifs (Data not shown) to support the formation and release of extracellular and intracellular infectious CCHFV tc-VLPs. We used tc-VLPs generated in the absence of M segment that does not generate infectious particles (No- GPs in Fig.1 A) to set up the thresholds of infectivity assessments. We found that while the Y 1 mutant allowed the formation and release of infectious tc-VLPs at levels identical to WT tc- VLPs, the other CT mutants yielded lower (AC mutant) or hardly detectable (Y2, LL, ERR mutants) infectivity for both intracellular and extracellular tc-VLPs. Collectively, these results indicated that several CT determinants play important roles in the envelopment and release of infectious tc-VLPs. Then, to further understand the functions of Gc CT motifs, we analyzed the effect of their mutation on Gn and Gc expression and processing, NP expression, and secretion of particle associated viral proteins (Fig.lB-lG). Expression of WT and mutant GPC raised similar levels of NP, Gc and Gn expression (Fig.1B-1D). Yet, in contrast to Y1 and AC mutant GPCs whose Gn and Gc GPs were only slightly less well incorporated into particles compared to WT GPC, the other Gc CT mutant constructs did not allow secretion of tc-VLPs displaying Gc or Gn GPs (Fig.lE-lG), which fully supported the results of infection assays (Fig. lA). Altogether, these results indicated that the motifs identified in Gc CT regulate an early stage of assembly prior to virion envelopment.

[0135] Gc CT determinants play a role in cellular trafficking of CCHFV Gc glycoprotein.

[0136] The processing and maturation steps of WT GPC are initiated in the ER and are followed by PreGn and PreGc transport through the secretion pathway and ultimately to the proposed site of CCHFV assembly and envelopment near the Golgi complex. Since tyrosine-based motifs, di-leucine motifs, acidic clusters and ER retrieval motifs are involved in protein retrograde trafficking from plasma membrane to endosomes, from endosomes to Golgi and from Golgi to ER, we assessed the role of Gc CT determinants on Gc intracellular trafficking and localization by immunofluorescence (IF) studies using cellular markers specific of the Golgi (GM130), early (Rab5) and late (Rab7) endosomes. We found that expression of WT GPC in Huh7.5 cells induced localization of Gc throughout the secretory pathway, without obvious accumulation in Golgi and late endosomes (Fig.2). In contrast to WT GPs, we found that the ACT mutant had impaired co-localization with GM130 (Fig.2A& data not shown) and Rab5 markers (Fig.2B & Data not shown), likely owing to the removal of intracellular trafficking motifs in Gc CT. Moreover, we found that ACT mutant displayed increased detection of Gc at the cell surface (Data not shown), suggesting that this mutant accumulated at the plasma membrane (PM). Altogether, these results underscored the role of CT motifs that allow Gc trafficking from the PM to intracellular organelles. We therefore sought to address the individual contribution of the putative trafficking motifs present in Gc CT to Gc intracellular traffic and localization, and to correlate this with assembly and release of viral particles. First, we investigated the levels of cell surface expression of the mutants by IF in nonpermeabilized cells. We found that compared to WT GPC and other mutant GPCs, the Gc Y1 mutant displayed higher levels of expression at the surface (Data not shown). This suggested that mutation of the Y1 motif could prevent Gc internalization, in agreement with higher cell-cell fusion levels induced by this mutant as compared to WT GPC and Y2 motif mutant (Data not shown). Second, when we addressed the above determinants in Gc CT (Data not shown), we found that the Gc AC mutant and, with statistical significance, the Y2 and ERR mutants exhibited reduced colocalization with GM130 marker, underscoring impaired trafficking to or within the Golgi (Fig.2A & Data not shown). Then, when we investigated Gc localization in early endosomes, we found that the Gc LL and ERR mutants exhibited a decreased co-localization with Rab5 marker, as compared to WT GPC, indicating that retrograde trafficking from early endosomes to Golgi may be impaired for these mutants (Fig.2B & Data not shown). Yet, in contrast with WT GPC, the Gc AC mutant showed slightly increased co-localization with Rab5 (Fig.2B & Data not shown). This observation suggested an impaired retrograde trafficking of the Gc AC mutant from the early endosomes to the Golgi apparatus. From early endosomal compartments, a subset of proteins can be targeted to late endosomes. We thus addressed the co-localization of Gc mutants with the late endosomal marker, Rab7. In contrast to Gc expressed from WT GPC, the Y2 mutant showed increased co-localization with Rab7 (Fig.2C & Data not shown), suggesting that the mutation of its tyrosine-based motif impairs its trafficking from the late endosomes to the upstream compartment, possibly to lysosomes or lysosomerelated organelles (Bonifacino J.S et al., 2003, Annu Rev Biochem). Altogether, these results indicated that the several determinants of the CT domain of Gc cooperate to allow intracellular trafficking of CCHFV Gc GP from the PM to the virion assembly site.

[0137] Mutations in Gn cytosolic determinants impact the formation of CCHFV infectious particles.

[0138] The CCHFV Gn glycoprotein consists of an amino-terminal ectodomain that is followed by two TMDs and a 94-residue long CD between these TMDs (Haferkamp S et al., 2005, J ViroT) (Data not shown). We identified several putative membrane trafficking motifs in the CD of CCHFV Gn glycoprotein (Data not shown): two tyrosine-based motifs (Y 1 and Y2), an acidic cluster motif (AC) and a di-leucine motif (LL). These potential determinants were mutated in the context of the GPC expression vector to raise mutant Gn proteins upon CCHFV tc-VLP production (Data not shown). We found that while the mutation of the Y1 motif allowed the formation and release of infectious tc-VLPs at levels identical to WT tc-VLPs, the other CD mutants (Y2, LL, and AC mutants) yielded strongly reduced or no infectivity for both intracellular and extracellular tc-VLPs (Fig.3A). These results indicated that these latter determinants play essential roles in envelopment and release of infectious virions. Then, to better understand the functions of Gn CD motifs, we analyzed the effect of their mutation on Gn and Gc expression and processing, NP expression and secretion of particle associated viral proteins (Fig.3B-3G). Expression of WT and mutant GPC raised similar levels of NP, except for the AC mutant that showed decrease in Gc and Gn expression (Fig.3B-3D). Yet, in sharp contrast to Y1 GPCs whose Gn and Gc GPs were only slightly less well incorporated into viral particles, as compared with WT GPs, the other Gn CD mutant constructs raised tc-VLPs that had no detectable Gn and / or Gc GPs (Fig.3E-3G), which fully supported the results of infection assays (Fig.3A). Altogether, these results indicated that motifs identified in Gn cytosolic domain regulate an early stage of assembly before virion envelopment. To further investigate the function of these Gn determinants in envelopment of viral particles, we analyzed tc-VLP- producer cells by confocal microscopy using specific antibodies against Gc and intracellular markers. Note that owing to lack of suitable Gn antibodies for IF assays, we could not perform the analysis of Gn intracellular localization. First, like for the Gc Y2 mutant (Fig.2), we found that the Gn Y2 mutant induced a defect in the distribution pattern of Gc in the Golgi (Fig.4A & Data not shown), suggesting that tyrosine domains of both Gn and Gc work in a similar way to promote CCHFV GP intracellular localization and reflecting that mutations in either Gn or Gc can impact traffic of the other protein (Bertolotti-Ciarlet A et al., 2005, J ViroT) as they likely form a heterodimer (Du S et al., 2023, Nat Commun ; Hover S et al., 2023, Nat Commun). Surprisingly, we also found that the Gn AC mutant induced a stronger Gc co-localization with GM130, indicating that the GP can reach the Golgi but displays impaired trafficking through the Golgi. Next, when we analyzed Gc co-localization with early endosomes (Rab5 marker), we found no significant differences in the distribution patterns for the different mutants (Fig.4B & Data not shown). Yet, we noticed that in contrast with WT GPC and Y1 Gn mutant, the other Gn CD mutants (Y2, LL, AC) exhibited increased Gc co-localization with the Rab7 late endosomal marker (Fig.4C & Data not shown). Altogether, these results indicated that mutations of Gn CD motifs that induce GP accumulation in late endosomes may block retrograde transport to the trans-Golgi and prevent GP incorporation on viral particles.

[0139] The PACS-1 sorting protein does not modulate viral incorporation and secretion of CCHFV glycoproteins.

[0140] Our results indicate that the AC motif in Gn is important to promote CCHFV GP intracellular trafficking and / or incorporation on viral particles since its mutation induced accumulation in late endosomes and Golgi, and prevented GP assembly and release of infectious particles (Fig.3 & Fig.4). Since some Golgi resident transmembrane proteins have been shown to use AP-1 mediated retrograde transport from endosomes to trans-Golgi network (TGN) through binding of the cellular adaptor PACS-1 to their acidic cluster, we investigated whether PACS-1 down-regulation could induce endosomal accumulation of the CCHFV GPs. Thus, we downregulated PACS-1 through expression of a previously validated (Bouard D et al., 2007, Traffic) short hairpin RNAs (shRNAs) in producer cells (Fig.5A). As assessed by immunoblotting, we achieved a knockdown efficiency of PACS-1 of up to 65% in Huh7.5 cells (Fig.5A). We found that PACS-1 down-regulation induced a 25-30% reduction of Gc and Gn expression in tc-VLP producer cells (Fig.5D & Fig.5F) and a 55-75% reduction of Gc and Gn incorporation in tc-VLP particles, as assessed in the pelleted supernatant of producer cells (Fig.5G & Fig.51). Likewise, the intracellular and extracellular levels of NP were reduced by ca. 30-35% upon PACS-1 down-regulation (Fig.5E & Fig.5H). Yet, these mild effects did not influence the production of infectious viral particles, as shown for both tc-VLP (Fig.5B) and authentic CCHFV particles (Fig.5C) produced in PACS-1 downregulated Huh7.5 cells, in agreement with the lack of significant fluctuations in the colocalization of Gc with the Golgi marker (Fig.8). Hence, we concluded that PACS-1 is not a crucial host factor for the transportation of CCHFV glycoproteins to the assembly site.

[0141] The PACS-2 adaptor is a critical factor controlling virion incorporation and secretion of CCHFV glycoproteins. Given that mutant of Gn AC motif dramatically affected envelopment and infectivity of CCHFV particles, we next investigated the potential interaction between CCHFV GPs and the PACS-2 protein, which also binds acidic cluster motifs (Atkins K.M et al., 2008, J Biol Chem). We expressed in tc-VLP producer cells two distinct short hairpin RNAs, which readily induced PACS-2 knockdown to up to 85% (Fig.6A). Importantly, we found that PACS-2 downregulation strongly impacted the extracellular tc-VLP infectivity, since their titers were reduced by up to 10-fold as compared to tc-VLP produced in control cells (Fig.6B). Furthermore, we observed a reduction of intracellular infectivity of tc-VLPs produced in PACS-2 down-regulated cells (Fig.6C), which indicated that PACS-2 promotes production of infectious particles at the level of virion assembly. Next, when we investigated intracellular expression of CCHFV proteins, while no significant effect for NP protein could be detected (Fig.6E), we found that PACS-2 down-regulation could reduce Gn and Gc expression, as compared to cells expressing a control short hairpin RNA (Fig.6D & Fig.6F). Yet, when we analysed the pellets of ultracentrifuged supernatants of tec-VLP producer cells, we found that PACS-2 knockdown drastically reduced Gc (by ca. 90%) and Gn (by over 95%) secretion (Fig.6G & Fig.61). Furthermore, we found that PACS-2 downregulation also resulted in a notable reduction of the secretion of NP (Fig.6H). These results indicated that PACS-2 modulates trafficking of both GPs and NP.

[0142] The above observations underscored a critical host factor modulating CCHFV GPs intracellular trafficking and CCHFV assembly / envelopment and production of infectious particles. Thus, we sought to confirm this result with live CCHFV using PACS-2 knockdown or control cells (Fig.7A). Following infection with virus inoculate, samples from the infected cells and supernatants were collected at 24-hour following infection and analyzed by qPCR on viral RNAs. Notably, we found that the extracellular CCHFV RNAs harvested from PACS-2 down-regulated cells displayed significant decrease of CCHFV RNAs as compared to controls cells (Fig.7B) in agreement with reduction of intracellular viral RNAs (Fig.7C) as compared to control cells, which confirmed that PACS-2 is a crucial factor for production of infectious CCHFV particles. Altogether, these results indicated that CCHFV depends on the host component PACS-2 for the efficient secretion and viral incorporation of its glycoproteins, and hence, infectivity.

[0143] To confirm these results, we subsequently investigated Gc localization in PACS-2 down- regulated cells. We found that the knockdown of PACS-2 expression induced a slight but significant increased colocalization of Gc with the Golgi marker GM130 (Fig. 9A) but did not have any impact on colocalization of Gc with early or late endosomes. These results suggested that the loss of PACS-2 expression does not impact Gc trafficking from PM to Golgi, but impairs Gc trafficking through the Golgi. Interestingly, this result phenocopies the increased colocalization of Gc with GM130 that we observed for Gn AC mutant (Fig. 4A), albeit to a lesser extent. Furthermore, we found that Gc and NP colocalization was significantly increased in PACS-2 down-regulated cells (Fig. 9B), which reflected the accumulation of virion structural components when assembly was blocked.

[0144] Discussion

[0145] Due to its high pathogenicity that imposes handling in BSL4 laboratories, a scarce resource in the world, assembly and envelopment of CCHFV remains a poorly understood process. By comparison with other Bunyaviruses, it is admitted that CCHFV assembly occurs at or near Golgi membranes; yet, how viral proteins reach the assembly sites and which host cellular factors are involved remains open questions. One specific feature of the Gc GP of Nairoviruses is its unusually long cytoplasmic tail among Bunyaviruses, which potentially contains different domains that could control distinct trafficking pathways. Taking advantage of the tc-VLP assay (Devignot S et al., 2015, J Virol Zivcec M et al., 2016, Viruses & Freitas N et al., 2020, PLoS Pathog) we deleted or mutated several putative trafficking motifs in Gc and Gn cytoplasmic domains to get better insight into CCHFV envelope assembly. Surprisingly, the removal of most of the Gc CT increased the exposition of the GPs at the plasma membrane, as deduced by the increased formation of syncytia and GP staining in nonpermeabilized cells (Data not shown). Moreover, this mutant GP was unable to reach the Golgi and exhibited impaired Gn and Gc (but not NP) secretion as well as infectivity of tc-VLPs. Overall, these results confirmed that Gc CT contains important trafficking signals. Accordingly, a more subtle mutant, Gc Yl, that disrupts a tyrosine-based trafficking motif, also exhibited an overexposition of Gc at the plasma membrane, which suggested that traffic to and / or exposure to the plasma membrane is an important step for Gc properties and which implied that Gc must return to the Golgi to reach CCHFV assembly site. Although such a fold back seems counter-intuitive, this anterograde followed by retrograde trafficking is not unique as it is notably used by Golgi resident proteins such as Furin or TGN38 (Bonifacino J.S et al., 2QQ3, Annu Rev Biochem). One possibility is that it could be essential for both proper maturation of CCHFV GPs and encountering / recruitment of viral RNA. Indeed, as final maturation step of Gc involves the cleavage of PreGc by an uncharacterized SKI-1 / S1P protease (Vincent M.J et al., 2003, Journal of Virology), one cannot exclude that this cleavage event takes place in endosomal / lysosomal compartments since the involved proprotein convertases are active in a wide range of compartments (Cendron L et al., 2023, Adv Protein Chem Struct Biol). On the other hand, cytoplasmic ‘condensates’ that contain viral RNA and NP have been observed in CCHFV- infected cells and may represent replication sites (Andersson C et al., 2012, Virology). It is thus tempting to speculate that Gn / Gc complex would need to traffic outside the Golgi to interact with viral RNA through Gn zinc finger domains before reaching the assembly sites. The above properties of Ge’s CT led us to investigate the functions of all the trafficking motifs that were detected in both Gn and Gc cytosolic domains. Particularly, the last 5 amino acids of Gc (KTHIG), whose deletion abrogated production of infectious CCHFV tc-VLPs, would fit with a non-canonical di-lysine motif KxHxx as an ER retrieval (ERR) motif. Such a motif was first identified within an alternative viral envelope GP, the Spike protein of SARS-CoV-1 (Lontok E et al., 2004, J Virol). Curiously, while dibasic motifs are absent in Gc proteins from Orthobunyaviruses and Tospoviruses (Strandin T et al., 2013, Virology), they can be detected in Gc from Phleboviruses (KKxx) and Hantaviruses (KKxx or KxKxx), suggesting different GP trafficking requirements among Bunyaviruses. These dibasic motifs (KKxx or KxKxx), present in some type I transmembrane proteins, are recognized by the COPI coatomer to achieve their retrograde transport from TGN to ER (Ma W et al., 2013, EMBO J). The presence of such a motif in Ge’s CT therefore suggests that Gc needs to reach a dedicated place, probably the assembly sites, located between lower stacks of the Golgi and ER (Fig. 10), which may be analogous to the Spike protein of coronaviruses that needs to reach back the ER-Golgi Intermediate Compartment (ERGIC) to allow its incorporation into virions (Ujike M et al., 2015, Viruses). We also identified four putative tyrosine-based motifs, two located on Gn (YREL and YLNL, Gn Y1 and Y2 motifs, respectively) and two located on Gc (YRHL and YRRI, Gc Y1 and Y2 motifs, respectively). Tyrosine-based motifs YXX<I» ( stands for an amino acid with a bulky hydrophobic side chain and X for any amino acid) are known to be involved in protein recycling from the plasma membrane via clathrin-mediated endocytosis (Trowbridge I.S et al., 1993, Annu Rev Cell Biol) and in protein targeting to the lysosomes (Marks M.S et al., 1995, J Cell Biol), endosomal compartments (Jackson M.R et al., 1993, J Cell Biol) and TGN (Bos K et al., 1993, EMBO). YXX<I» motifs bind to the p subunit of adaptor protein complexes (APs) with the highest avidity for p2 of AP-2 complex (Bonifacino J.S et al., 2003, Annu Rev Biochem). Interestingly, our results identified distinct functional features for these different tyrosine-based motifs. As above discussed, mutation of Gc Y1 showed an increased GP exposition at the plasma membrane, hence suggesting that this motif acts as a classical endocytosis motif. Yet, Gn Y1 as well as Gc Y1 mutations resulted in only a mild defect, of up to two-fold of viral incorporation of either GP and had no impact on tc-VLP infectivity or on Gc localization at Golgi. This suggested that the bulk of envelope GPs was able to reach assembly sites, owing to alternative trafficking signals or to a weak endocytosis mechanism, and that either motif could be important for removing exceeding GP from the plasma membrane rather than to be a limiting factor for CCHFV envelopment. In contrast to the above, the two other tyrosine-based motifs located on either envelope GP, i.e., Gn Y2 and Gc Y2, showed to be crucial for virion assembly. Indeed, their individual mutation strongly impaired Gn and Gc secretion, virion envelopment and tc-VLP infectivity, which correlated with prevention of Gc colocalization at the Golgi, which, as a consequence, increased Gc colocalization with late endosomes. These results suggested that these mutant GPs have impaired traffic between endosomes and Golgi, and thus, that Gn and Gc Y2 YXX<I» domains represent crucial GP intracellular trafficking domains. Note that it was previously suggested that YXX<I» motifs could also act as late domains to recruit host cellular factors necessary to complete virion budding and to compensate the lack of matrix in Bunyaviruses (Strandin T et al., 2013, Virology) yet, one would expect that these mutants could be blocked within the assembly sites (Golgi) and would have altered NP secretion, which was not observed in our tc- VLP system. Additionally, we identified two functional dileucine motifs either in the cytosolic domain of Gn or in the cytoplasmic tail of Gc. Di-leucine based motifs are another class of sorting motifs that act in the TGN / endosomal system. They have been shown to be recognized by AP-1, AP-2 and AP-3 (Rapoport I et al., 1998, EMBO J) to mediate different sorting events, such as internalization from plasma membrane and sorting to endosomes (Rohn W.M et al., 2000, J Cell Sei). Curiously, the substitution for alanines of a di-leucine motif in Gc strongly impaired Uukuniemi virus (UUKV) VLPs budding, suggesting that this motif would act between assembly and secretion of UUKV VLPs (Overby A.K et al., 2007, J ViroT). In our study, we discovered that the disruption of the dileucine motif in the cytoplasmic tail of the Gn or Gc proteins resulted in a deficiency in the secretion and assembly of CCHFV tc-VLPs. Furthermore, our confocal microscopy analysis revealed an increased presence of the Gn LL mutants in the late endosome. Hence, the purported endocytosis motifs of CCHFV might be involved in endocytic recycling. Finally, we identified putative acidic cluster (AC) motifs, which are composed of a stretch of negatively charged amino acids, in both Gn and Gc cytosolic domains. While mutation of the acidic cluster of Gc GP did not seemingly alter its functions, the exchange of charged amino acids by neutral structural homologs in the acidic cluster of Gn GP (i.e., substitution of EKVEETEL (SEQ ID NO: 21) for QKVQQTQ) resulted in a complete loss of Gn / Gc secretion as well as of tc-VLP production and infectivity. Acidic cluster motifs are often found in transmembrane proprotein convertases, such as PC6B and PC7 that are localized to the TGN, and were first described in the cytosolic tail of furin (Voorhees P et al., 1995, EMBO J). Interestingly, several viral proteins also contain such motifs including GP of KSHV (Mansouri M et al., 2006, Blood), GP B of HCMV (Tugizov S et al., 1999, Journal of Virology), Nef of HIV-1 (Piguet V et al., 2000, Nat Cell Biol) or GP41 of RD114 (Bouard D et al., 2007, Traffic). These acidic cluster motifs are recognized by PACS (phosphofurin acidic cluster sorting proteins) -1 and -2 proteins, which connect cargos to different adaptor protein complexes: PACS-1 links cargos to AP-1 or AP-3 whereas PACS-2 links cargos to AP-2 or COPI. Importantly, acidic clusters often contain serine or threonine residues that can be phosphorylated by CK2 (casein kinase 2), which confers different subcellular distribution of the cargo proteins depending on its phosphorylated state. Owing to our results with mutations of AC motif in CCHFV Gn GP, we hypothesized that PACS-1 or PACS-2 could be involved in CCHFV life cycle through recognition of the Gn AC motif. Yet, even if we observed a very mild effect of the down-regulation of PACS-1 on the Gn and Gc secretion in the tc-VLP system, we did not observe any effect neither on tc-VLP nor on wt CCHFV infectivity production, hence suggesting that PACS-1 is not a crucial cellular host factor that is involved in CCHFV life cycle. Importantly, PACS-2 down-regulation severely impaired Gn / Gc secretion of tc-VLPs as well as CCHFV genome release by virus-infected cells, confirming that PACS-2 is an important proviral factor acting at the assembly / secretion level. That the silencing of PACS-2 also strongly impaired the formation of intracellular infectious tc-VLPs suggested that PACS-2 acts at assembly steps rather than secretion of CCHFV particle. Interestingly, we also observed a defect in NP secretion upon PACS-2 down-regulation. Little is known about the ligands of PACS-2, but due to its high homology with PACS-1 (nearly 80% sequence identity within the furin- binding-region (FBR) of PACS proteins) (Thomas G et al., 2017, J Cell Sci), one can imagine that PACS-2 could link several proteins at the same time, alike PACS-1 that was shown to bind within same complexes CLMPR, CK2 and GGA3 via different domains contained in the FBR region (Scott G.K et al., 2006, EMBO J). It is thus tempting to speculate that PACS-2 could bind Gn via its acidic cluster and NP via an unidentified domain. This tripartite association could then help the encountering of Gn with NP or, alternatively, could allow the co-trafficking of Gn and NP to the assembly site. The latter would explain why the mutation of the Gc AC affects only the secretion of Gn / Gc, while the absence of PACS-2 impairs the secretion of both Gn / Gc and NP.

[0146] REFERENCES Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

[0147] Altamura. L.A et al., 2007, J Virol, DOI : 10.1128 / JVI.02730-06

[0148] Andersson C et al., 2012, Virology, DOI : 10.1016 / j.virol.2012.01.032

[0149] Atkins K.M et al., 2008, J Biol Chem DOI : 10.1074 / jbc.M707572200

[0150] Atkins K.M et al., 2014, Cell Rep, DOI : 10.1016 / j.celrep.2014.07.049

[0151] Bente. D.A et al., 2013, Antiviral Res, DOI : 10.1016 / j. antiviral.2013.07.006

[0152] Bergeron E et al., 2010, J Virol, DOI : 10.1128 / JVI.01859-09

[0153] Bertolotti-Ciarlet A et al., 2005, J Virol, DOI : 10.1128 / JVI.79.10.6152-6161.2005

[0154] Bonifacino J.S et al., 2003, Annu Rev Biochem, DOI : 10.1146 / annurev.biochem.72.121801.161800

[0155] Bos K et al., 1993, EMBO, DOI : 10.1002 / j.1460-2075.1993 ,tb05870.x

[0156] Boson. B et al., 2022, mBio, DOI : 10.1128 / mbio.02923-21

[0157] Bouard D et al., 2007, Traffic, DOI : 10.1111 / j.l600-0854.2007.00581.x

[0158] Cendron L et al., 2023, Adv Protein Chem Struct Biol, DOI : 10.1016 / bs.apcsb.2022.10.001

[0159] Cole N.B et al., 1995, CurrO pin Cell Biol, DOI : 10.1016 / 0955-0674(95)80045-x

[0160] Crump C.M et al., 2003, J Virol, DOI : 10.1128 / jvi.77.20.11105-11113.2003

[0161] Devignot. S et al., 2015, J Virol, DOI : 10.1128 / JVI.03691-14

[0162] Du S et al., 2023, Nat Commun, DOI: 10.1038 / s41467-023-41804-7

[0163] Freitas N et al., 2020, PLoS Pathog, DOI : 10.1371 / journal.ppat.1008850

[0164] Haferkamp S et al., 2005, J Virol, DOI : 10.1186 / 1743-422X-2-42

[0165] Hawman D.W et al., 2023, Nature Reviews Microbiology, DOI : 10.1038 / s41579-023-00871-9

[0166] Hover. S et al., 2023, Nat Commun, DOI: 10.1038 / s41467-023-41205-w

[0167] Jackson M.R et al., 1993, J Cell Biol, DOI : 10.1083 / jcb.121.2.317.

[0168] Jenkins P.M et al., 2009, JNeurosci, DOI : 10.1523 / JNEUROSCI.1590-09.2009

[0169] Li C et al., 2020, Pharmacol Res, DOI : 10.1016 / j. phrs.2020.105080

[0170] Liu H et al., 2020, Virology, DOI : 10.1016 / j .virol.2019.10.004

[0171] Lontok. E et al., 2004, J Virol, DOI : 10.1128 / JVI.78.11.5913-5922.2004

[0172] Lusk L et al., 2020, GeneReviews, PMID: 32672908

[0173] Ma W et al., 2013, EMBO J, DOI : 10.1038 / emboj.2013.41

[0174] Mani C et al., 2020, Oncogene, DOI : 10.1038 / s41388-020-1167-x

[0175] Mansouri M et al., 2006, Blood, DOI : 10.1182 / blood-2005-l l-4404

[0176] Marks. M.S et al., 1995, J Cell Biol, DOI : 10.1083 / jcb.131.2.351 Messina J.P et al., 2015, Sci Data, DOI : 10.1038 / sdata.2015.16

[0177] Overby A.K et al., 2007, J Virol, DOI : 10.1128 / JVI.00767-07

[0178] Peyrefitte C.N et al., 2010, J Gen Virol, DOI : 10.1099 / vir.0.015701-0

[0179] Piguet V et al., 2000, Nat Cell Biol, DOI : 10.1038 / 35004038

[0180] Rapoport. I et al., 1998, EMBO J, DOI : 10.1093 / emboj / 17.8.2148

[0181] Rohn W.M et al., 2000, J Cell Sci, DOI : 10.1242 / jcs.113.12.2093

[0182] Sanchez A. J et al., 2002, J Virol, DOI : 10.1128 / jvi.76.14.7263-7275.2002

[0183] Schafer W et al., 1995, EMBOJ, DOI : 10.1002 / j.1460-2075.1995.tb07240.x

[0184] Schekman R et al., 1996, Science, DOI : 10.1126 / science.271.5255.1526

[0185] Schuurs-Hoeij makers. J.H.M et al., 2012, Am J Med Genet, DOI : 10.1016 / j .ajhg.2012.10.013

[0186] Schuurs-Hoeij makers J.H.M et al., 2016, Am J Med Genet A, DOI : 10.1002 / ajmg.a.37476

[0187] Scott G.K et al., 2006, EMBO J, DOI : 10.1038 / sj.emboj.7601336

[0188] Simmen T et al., 2995, EMBO J, DOI : 10.1038 / sj.emboj.7600559

[0189] Stern D et al., 2017, Clin Genet, DOI : 10.1111 / cge.12956

[0190] Strandin. T et al., 2013, Virology, DOI : 10.1016 / j.virol.2013.01.001

[0191] Thomas G et al., 2017, J Cell Sci, DOI : 10.1242 / jcs.199463

[0192] Trowbridge I.S et al., 1993, Annu Rev Cell Biol, DOI : 10.1146 / annurev.cb.09.110193.001021

[0193] Tugizov S et al., 1999, Journal of Virology, DOI : 10.1128 / JVI.73.10.8677-8688.1999

[0194] Ujike M et al., 2015, Viruses, DOI : 10.3390 / v7041700

[0195] Vincent. M.J et al., 2003, Journal of Virology, p. 8640-9

[0196] Voorhees P et al., 1995, EMBO J, DOI : 10.1002 / j.1460-2075.1995.tb00179.x.

[0197] Zivcec M et al., 2016, Viruses, DOI : 10.3390 / v8040106

Claims

CLAIMS :

1. A PACS-2 inhibitor for use in the prevention and / or in the treatment of Nairoviridae family infections in a subject in need thereof.

2. The PACS-2 inhibitor for use according to claim 1 wherein the inhibitor :- inhibits the assembly, the envelopment and / or the release of the Nairoviridae family virus and / or- inhibits the glycoproteins (GP) expression and / or the GP secretion.

3. The PACS-2 inhibitor for use according to claims 1 or 2 wherein the Nairoviridae family infection is selected from the list consisting of Norwavirus, Ocetevirus, Orthonairovirus, Sabavirus, Shaspivirus, Striwavirus or Xinspivirus genus infection.

4. The PACS-2 inhibitor for use according to claim 3 wherein the Orthonairovirus genus infection is a CCHFV infection.

5. The PACS-2 inhibitor for use according to any one claims 1 to 4 wherein the inhibitor is :- an inhibitor of PACS-2 activity and / or- an inhibitor of PACS-2 expression.

6. The PACS-2 inhibitor for use according to claim 5 wherein the inhibitor of PACS-2 activity is a small molecule, an anti-PACS-2 neutralizing antibody, a neutralizing aptamer, a polypeptide.

7. The PACS-2 inhibitor for use according to claims 6 wherein the anti- PACS-2 neutralizing antibody is a single domain antibody.

8. The PACS-2 inhibitor for use according to claim 5 wherein the inhibitor of PACS-2 expression is a siRNA, a nuclease, a ribozyme and / or an antisense oligonucleotide.

9. The PACS-2 inhibitor for use according to claim 8 wherein the inhibitor of PACS-2 expression is associated with vector.

10. The PACS-2 inhibitor for use according to claims 1 to 9 wherein the inhibitor of PACS- 2 is used in the treatment of Nairoviridae family infections in the early stage of the infection.

11. A method for preventing and / or treating Nairoviridae family infections in a subject in need thereof comprising administering a therapeutically effective amount of the PACS- 2 inhibitor according to claims 1 to 10.

12. A pharmaceutical composition for use in the prevention and / or in the treatment of Nairoviridae family infections comprising a therapeutically effective amount of the PACS-2 inhibitor according to claims 1 to 10.

13. The PACS 2 inhibitor for use according to claims 1 to 10 wherein the PACS-2 inhibitor is used in combination with a PACS-1 inhibitor.

14. The method according to claim 11 wherein the PACS-2 inhibitor is used in combination with an effective amount of a PACS-1 inhibitor.

15. The pharmaceutical composition according to claim 12 wherein the PACS-2 inhibitor is used in combination with a therapeutically effective amount of a PACS-1 inhibitor.

Images