Compositions and methods for the potentiation of cellular responses to matrix stiffness

Abstract

Disclosed herein are mechanoenhancers and compositions and methods for modulating expression of a mechanoenhancer. Modulation of the mechanoenhancer may result in apoptosis, mechanotransduction, proliferation, migration, or growth, or a combination thereof. The compositions and methods may be used to treat disease such as cancer or fibrosis.

Description

COMPOSITIONS AND METHODS FOR THE POTENTIATION OF CELLULAR RESPONSES TO MATRIX STIFFNESS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 602,887, filed November 27, 2023, the entire contents of which are hereby incorporated by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under grants UM1HG009428, UM1HG012053, and RMI HG011123 awarded by the National Institutes of Health (NIH) and Federal Grant No. EFMA-1830957 awarded by the National Science Foundation (NSF). The government has certain rights in the invention. FIELD

[0003] This disclosure relates to compositions and methods for modulating expression of genes affected by matrix stiffness and mechanical cues from the cellular microenvironment. INTRODUCTION

[0004] Epigenetic control of cellular transcription and phenotype is influenced by changes in the cellular microenvironment, yet how mechanical cues from these microenvironments precisely influence epigenetic state to regulate transcription remains largely unmapped. SUMMARY

[0005] In an aspect, the disclosure relates to a composition comprising a modulator of a gene or a regulatory element thereof or a chromosome region selected from those listed in TABLE 14. In some embodiments, the gene is selected from CCN2, CYR61, MYH9, RFLNB, RANGAP1, RASGRP1, NF2, and BMF. In some embodiments, the composition modulates apoptosis, mechanotransduction, proliferation, migration, growth, fibrosis, atherosclerosis, ECM secretion, senescence, or a combination thereof, in a cell. In some embodiments, the modulator comprises a polypeptide, or a polynucleotide, or a small molecule, or siRNA, or shRNA, or a combination thereof. In some embodiments, the modulator comprises siRNA, or shRNA, or an antibody, or a combination thereof. In some embodiments, the modulator is an inhibitor of the gene. In some embodiments, themodulator is an activator of the gene. In some embodiments, the modulator comprises a DNA targeting composition, the DNA targeting composition comprising: (a) a Cas9 protein and at least one guide RNA (gRNA) that targets the Cas9 protein to the gene or a regulatory element thereof; or (b) a fusion protein, wherein the fusion protein comprises two heterologous polypeptide domains, wherein the first polypeptide domain comprises a zinc finger protein or a TALE or a Cas12 protein or a Cas13 protein or a Cas9 protein, and wherein the second polypeptide domain has an activity selected from transcription repression activity, transcription activation activity, nuclease activity, base editing activity, prime editing activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methylase activity, and demethylase activity, wherein when the first polypeptide domain comprises a Cas9 protein the DNA targeting composition further comprises at least one guide RNA (gRNA) that targets the Cas9 protein to the gene or a regulatory element thereof.

[0006] In a further aspect, the disclosure relates to a DNA targeting composition comprising: a Cas9 protein or a fusion protein, wherein the fusion protein comprises two heterologous polypeptide domains, wherein the first polypeptide domain comprises a zinc finger protein or a TALE or a Cas12 protein or a Cas13 protein or a Cas9 protein, and wherein the second polypeptide domain has an activity selected from transcription repression activity, transcription activation activity, nuclease activity, base editing activity, prime editing activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methylase activity, and demethylase activity; and at least one guide RNA (gRNA) that targets the Cas9 protein to a target gene or a regulatory element thereof when the DNA targeting composition comprises a Cas9 protein, wherein the target gene is selected from those listed in TABLE 14. In some embodiments, the gene is selected from CCN2, CYR61, MYH9, RFLNB, RANGAP1, RASGRP1, NF2, and BMF. In some embodiments, the gRNA targets or is encoded by a polynucleotide comprising a sequence selected from SEQ ID NOs: 57-441, or comprises a sequence selected from SEQ ID NOs: 442-826. In some embodiments, the Cas protein comprises a Streptococcus pyogenes Cas9 protein, or a Staphylococcus aureus Cas9 protein, or any fragment thereof. In some embodiments, the Cas9 protein comprises the amino acid sequence of one of SEQ ID NOs: 26-29, or any fragment thereof, and / or wherein the Cas9 protein is encoded by a polynucleotide comprising a sequence selected from SEQ ID NOs: 30-39, and / or wherein the Cas9 protein comprises an amino acid sequence having at least 90% or greater identity to a sequence selected from SEQ ID NOs: 26-29, or any fragment thereof, and / or wherein the Cas9 protein is encoded by a polynucleotide comprising a sequence having at least 90% or greater identity to a sequence selected from SEQ ID NOs: 30-39, or any fragment thereof,and / or wherein the Cas9 protein comprises an amino acid sequence having one, two, three, four, five or more changes selected from amino acid substitutions, insertions, or deletions, relative to a sequence selected from SEQ ID NOs: 26-29, or any fragment thereof, and / or wherein the Cas9 protein is encoded by a polynucleotide comprising a sequence having one, two, three, four, five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to a sequence selected from SEQ ID NOs: 30-39, or any fragment thereof. In some embodiments, the fusion protein comprises more than one second polypeptide domain. In some embodiments, the second polypeptide domain has transcription repression activity. In some embodiments, the second polypeptide domain comprises KRAB or FokI. In some embodiments, KRAB comprises the amino acid sequence of SEQ ID NO: 45, or any fragment thereof, and / or wherein KRAB is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 46, and / or wherein KRAB comprises an amino acid sequence having at least 90% or greater identity to SEQ ID NO: 45, or any fragment thereof, and / or wherein KRAB is encoded by a polynucleotide comprising a sequence having at least 90% or greater identity to SEQ ID NO: 46, or any fragment thereof, and / or wherein KRAB comprises an amino acid sequence having one, two, three, four, five or more changes selected from amino acid substitutions, insertions, or deletions, relative to SEQ ID NO: 45, or any fragment thereof, and / or wherein KRAB is encoded by a polynucleotide comprising a sequence having one, two, three, four, five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to SEQ ID NO: 46, or any fragment thereof. In some embodiments, the fusion protein comprises the amino acid sequence of SEQ ID NO: 47 or 49, or any fragment thereof, and / or wherein the fusion protein is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 48 or 50, and / or wherein the fusion protein comprises an amino acid sequence having at least 90% or greater identity to SEQ ID NO: 47 or 49, or any fragment thereof, and / or wherein the fusion protein is encoded by a polynucleotide comprising a sequence having at least 90% or greater identity to SEQ ID NO: 48 or 50, or any fragment thereof, and / or wherein the fusion protein comprises an amino acid sequence having one, two, three, four, five or more changes selected from amino acid substitutions, insertions, or deletions, relative to SEQ ID NO: 47 or 49, or any fragment thereof, and / or wherein the fusion protein is encoded by a polynucleotide having one, two, three, four, five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to SEQ ID NO: 48 or 50.

[0007] Another aspect of the disclosure provides an isolated polynucleotide sequence encoding a composition as detailed herein.

[0008] Another aspect of the disclosure provides a vector comprising an isolated polynucleotide sequence as detailed herein. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is selected from AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, and an engineered AAV vector.

[0009] Another aspect of the disclosure provides a cell comprising a composition as detailed herein, or N isolated polynucleotide sequence as detailed herein, or a vector as detailed herein, or a combination thereof. In some embodiments, the cell is a tumor cell, fibroblast, stellate cell, or endothelial cell.

[0010] Another aspect of the disclosure provides a pharmaceutical composition including a composition as detailed herein, or an isolated polynucleotide sequence as detailed herein, or a vector as detailed herein, or a combination thereof. In some embodiments, the composition further includes at least one cancer therapy.

[0011] Another aspect of the disclosure provides a method of modulating the expression of a mechanoenhancer. The method may include administering to a cell or a subject a composition as detailed herein, or an isolated polynucleotide sequence as detailed herein, or a vector as detailed herein, or a cell as detailed herein, or a pharmaceutical composition as detailed herein, or a combination thereof. In some embodiments, modulating the expression of a mechanoenhancer results in modulation of apoptosis, mechanotransduction, proliferation, migration, or growth, or a combination thereof, in the cell or subject.

[0012] Another aspect of the disclosure provides a method of treating a disease in a subject. The method may include administering to the subject a composition as detailed herein, or an isolated polynucleotide sequence as detailed herein, or avector as detailed herein, or a cell as detailed herein, or a pharmaceutical composition as detailed herein, or a combination thereof. In some embodiments, the disease comprises cancer. In some embodiments, the method further includes administering at least one cancer therapy. In some embodiments, the disease comprises fibrosis, regeneration, aging, or atheroschlerosis.

[0013] The disclosure provides for other aspects and embodiments that will be apparent in light of the following detailed description and accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIGS.1A-1K show that short-term culture on physiologically soft materials results in broad changes in gene expression and chromatin structure. FIG.1A is a diagram showing an experimental design that was used to assess how physiologically-soft mechanical microenvironments affect the cellular epigenetic state, primary human neonatal foreskin fibroblasts (HFF cells) and A549 cells were cultured on soft (Elastic modulus, E=1kPa) or stiff (E= 50kPa) fibronectin-coated polyacrylamide hydrogels for 20 hours. FIG. 1B is a graph showing RNA-seq results and reveals differentially expressed genes (FDR < 0.05, abs(Log2[Fold-Change])>0.5) in HFF cells. FIG.1C is a graph showing RNA-seq results and reveals differentially expressed genes (FDR < 0.05, abs(Log2[Fold- Change])>0.5) in A459 cells. FIG.1D is a diagram showing overlapping differentially expressed genes from FIGS.1B-C. FIG.1E is a graph showing ATAC-seq results and reveals differentially accessible chromatin regions (FDR < 0.01, abs(Log2 Fold-Change)>1) in HFF cells cultured on soft 1 kPa or stiff 50 kPa hydrogels. FIG.1F is a graph showing ATAC-seq results and reveals differentially accessible chromatin regions (FDR < 0.01, abs(Log2 Fold-Change)>1) in A549 cells cultured on soft 1 kPa or stiff 50 kPa hydrogels. FIG.1G is a graph showing overlap in accessibility between the two cell types from FIGS. 1E-F. FIG.1H is a graph showing de novo analysis results from significantly enriched transcription factor motifs in differentially accessible regions on either 1 kPa or 50 kPa substrates in HFF cells. FIG.1I is a graph showing de novo analysis results from significantly enriched transcription factor motifs in differentially accessible regions on either 1 kPa or 50 kPa substrates in A549 cells. FIG.1J is graphs showing ATAC-seq tracks showing representative regions with significantly higher accessibility (highlighted in grey) on soft 1 kPa hydrogels (e.g., near IGFBP1, ARHGEF2, RASL12). FIG.1K is graphs showing ATAC-seq tracks showing representative regions with significantly higher accessibility (highlighted in grey) on stiff 50 kPa hydrogels (e.g., near TLN2, GKN1, RAD18). The top two rows of FIGS.1J-K highlight peaks shared between both cell types, while the subsequent rows show cell type-specific peaks.

[0015] FIGS.2A-2B show a correlation of biological replicates for ATAC-seq data. FIG. 2A is a chart showing correlation of ATAC-seq tag counts from biological replicates for soft (1 kPa) and stiff (50 kPa) conditions for A549 and HFF cells. Each point corresponds to a peak call from the merged peak set. FIG.2B is a heatmap showing a distance between samples from FIG.2A after rlog transformation.

[0016] FIGS.3A-3B show annotation of HFF ATAC-seq peaks regionality on soft and stiff hydrogels. FIG.3A is a Venn diagram showing the total peaks. FIG.3B is chartsshowing an overview and annotations of differentially-accessible chromatin regions across HFF cells cultured on either 1 kPa and 50 kPa hydrogels from the top 5000 most significantly changing peaks over UTR / TTS, promoter-TSS, exon, intergenic, intronic, or non-coding RNA annotations.

[0017] FIG.4 is a graph showing changes in chromatin accessibility following 10 µM Y- 27632 ROCKi treatment for 1 hour prior to harvest. HFF cells were cultured for 20 hours on 50 kPa polyacrylamide hydrogels, with DMSO or 10 µM Y-27632 added for the last hour of culture. ATAC-seq was then performed and each open chromatin region is represented as an individual point.

[0018] FIGS.5A-5P show that CRISPRi screening reveals a MYH9 intron 3 mechanoenhancer that regulates MYH9 expression and cell contractility. FIG.5A is a graph showing expression of MYH9 on soft 1 kPa hydrogels, 50 kPa hydrogels, and TCP from RNA-seq (N=2 reps / group). FIG.5B is a schematic of CRISPRi screening procedure for finding genomic regulators of MYH9 protein expression. FIG.5C is a graph showing individual gRNA enrichment in Low / High MYH9 expression bins following the MYH9 locus screen averaged across two replicates. FIG.5D is a graph showing CRISPRi screening results across the MYH9 locus as shown by MYH9 Repression Phenotype Scores (t-score) and average effect size (z-score) as calculated across each DHS in the screen. Blue points indicate DHS was differentially-accessible in ATAC-seq data between soft / stiff hydrogel conditions across both screen replicates. FIG.5E is a graph showing ATAC-seq signal across the MYH9 intron 3 enhancer region, with the yellow highlight denoting the force- sensitive pRE#1 subregion. FIG.5F is a graph showing normalized ENCODE H3K37ac signal around differentially-accessible pRE#1 peak from MYH9 intron 3 region compared for 9 available ENCODE tier 1 cell lines. FIG.5G is a graph showing relative MYH9 RNA expression 10d following lentiviral transduction with dCas9KRABalong with either a non- targeting gRNA, MYH9 intron 3 enhancer-targeting gRNA, or an MYH9 promoter-targeting gRNA. CTL group represents no transduction. FIG.5H is representative images of F-actin and vinculin focal adhesion immunostaining. FIG.5I is a graph showing corresponding quantifications of a focal adhesion morphologic parameter (cell area) in HFF cells transduced with either a non-targeting or a MYH9 intron 3 enhancer-targeting gRNA (N=39- 45 FA / group, ** = p <0.01, **** = p<0.0001 by Studenťs t-test). Red line indicates group means. FIG.5J is a graph showing corresponding quantifications of a focal adhesion morphologic parameter (number of FA per cell) in HFF cells transduced with either a non- targeting or a MYH9 intron 3 enhancer-targeting gRNA (N=39-45 FA / group, ** = p <0.01, **** = p<0.0001 by Studenťs t-test). Red line indicates group means. FIG.5K is a graphshowing corresponding quantifications of a focal adhesion morphologic parameter (average FA area) in HFF cells transduced with either a non-targeting or a MYH9 intron 3 enhancer- targeting gRNA (N=39-45 FA / group, ** = p <0.01, **** = p<0.0001 by Studenťs t-test). Red line indicates group means. FIG.5L is a schematic of Cas9 nuclease saturation indel screening procedure performed in HFF cells across the MYH9 int3 enhancer region. FIG. 5M is a plot showing the results of this Cas9 screening, with the ratio of gRNA enrichment in low MYH9 expression bins as compared to high MYH9 expression bins across the MYH9 intron 3 enhancer as well as across non-targeting gRNAs and ENCODE safe-targeting gRNAs. Dots shown are averages across all three replicates. FIG.5N is a graph showing gRNA positioning of hit gRNAs relative to the positions of the core SRF CaRG motif (gRNA#24). FIG.5O is a graph showing gRNA positioning of hit gRNAs relative to the positions of the core SRF HLTF motif (gRNA#43). FIG.5P is a graph showing relative MYH9 expression during singleton validation of the top three gRNA hits from the screen, six days post-transduction (N=3 reps / group).

[0019] FIGS.6A-6D show changes in chromatin looping in HFF cells cultured on soft or stiff hydrogels. FIG.6A is a schematic showing how chromatin loops were determined to be unique or shared between soft and stiff surfaces. Light grey shading indicates anchor(s) of chromatin loops that intersect on both surfaces. FIG.6B is a graph showing the number of chromatin loops measured via HiCAR on each surface that are unique to that surface (‘unique’), overlap with one anchor of a chromatin loop on the other surface (‘either’), or with both anchors overlapping both anchors of a chromatin loop on the other surface (‘both’). The percentages noted in the plots indicate the proportion of all chromatin loops for that surface. FIG.6C is a schematic showing an analysis comparing differentially accessible ATAC-seq peaks with chromatin loops on each surface. Dark grey and medium grey shading indicate ATAC peaks more accessible on soft or stiff surfaces, respectively, and correspond to shading in FIG.6D. FIG.6D is a graph showing the number of significantly differentially accessible ATAC-seq peaks that overlap with a chromatin loop anchor on either surface. The color indicates whether the ATAC-seq peak was more accessible in HFF cells cultured on soft or stiff hydrogel.

[0020] FIG.7 is a mirror plot of the average gRNA enrichment in low / high MYH9 expressing cells from the MYH9 screen across the genomic location, where gRNA points plotted upwards are (+) stranded, and gRNA points plotted downward are (-) stranded. The plot shows that CRISPR interference leads to strand bias in screening positive strand protospacer gRNA.

[0021] FIG.8 is a graph showing a singleton validation for CRISPRi MYH9 locus screen intron 3 hits. Singleton validations of MYH9 repression found across the three hit pRE from the MYH9 screen at Day 9 timepoints (N=3 reps / group).

[0022] FIG.9 is a graph showing MYH9 protein levels in HFFs 10d after CRISPRi perturbation of promoter and intronic mechanoenhancer. HFFs were transduced with dCas9-KRAB and either a non-targeting gRNA, a MYH9-intron 3 pRE#1 gRNA, or a MYH9 prom gRNA. Cells were fixed, immunostained for MYH9, and then subjected to flow cytometry. 42,602 cells were counted for the non-targerting gRNA, 187,733 cells for the MYH9 intron 3 pRE#1 gRNA (~28% of mean non-targeting expression), and 109,402 cells for the MYH9 promoter gRNA (~18% of mean non-targeting expression, though with a biphasic population).

[0023] FIGS.10A-10D show representative morphometric and focal adhesion images of HFF cells following MYH9-intron 3 enhancer repression or MYH9 promoter repression with CRISPRi. FIG.10A is representative morphometric and focal adhesion images of HFF cells. FIG.10B is representative images of outlines of cell area and vinculin immunostaining for HFF cells following 9 days post-transduction of dCas9-KRAB constructs and a non-targeting gRNA. FIG.10C is representative images of outlines of cell area and vinculin immunostaining for HFF cells following 9 days post-transduction of dCas9-KRAB constructs and a MYH9-intron 3 enhancer targeting gRNA. FIG.10D is representative images of outlines of cell area and vinculin immunostaining for HFF cells following 9 days post- transduction of dCas9-KRAB constructs and a MYH9 promoter targeting gRNA.

[0024] FIGS.11A-11E show that BMF intron #4 mechanoenhancer has increased activity with reduced contractility and is a mediator of anoikis. FIG.11A is a graph showing BMF RNA expression from RNA-seq across different stiffness conditions in HFF cells (N=2 reps per stiffness condition). FIG.11B is a graph showing ENCODE Tier1 H3K27ac signal and ATAC-seq data between HFF cells cultured on soft and stiff PA hydrogels with regions of differential chromatin accessibility highlighted, with grey highlights indicating regions of differential-accessibility across stiffness contexts. FIG.11C is a graph showing luciferase enhancer reporter readouts from three of the BMF regions with and without 24 hr of 10 μM Y-27632 treatment, showing relative firefly luciferase activity controlled by these enhancers normalized to a control co-transfected renilla luciferase reporter. Box and whisker plots show median, plus indicates the group mean, and bars indicate the top / bottom 10% expression range (N=4 reps / group). FIG.11D is a graph showing relative RNA expression (N=3) of HFF cells either untreated, or transduced with various gRNAs, following 0.5 µM LatrunculinA for 24 hours. FIG.11E is a graph showing normalized Caspase-3 / 7 activity(N=4 reps / group) of HFF cells either untreated, or transduced with various gRNAs, following 0.5 µM LatrunculinA for 24 hours. All data presented as mean + / − SEM and are representative of at least two independent experiments, **** indicates p<0.0001, * indicates p <0.05 by Studen’s t-test. Caspase 3-7 activity and luciferase assay stats are shown compared to the DMSO control group, while RNA expression comparisons are shown by overlay bars. “nt gRNA” abbreviates “non-targeting” gRNA.

[0025] FIGS.12A-12H show that functional migration and growth screening paired with single cell CRISPRi screening identifies mechanosensitive regulatory elements driving functional behaviors and their target genes. FIG.12A is a schematic of the experimental setup for the paired migration and cellular growth screens in HFF cells, transduced with a CRISPRi library containing 21,498 gRNAs targeting the top 1,000 differentially accessible ATAC-seq peaks on stiff substrates. FIG.12B is a graph showing Z-scores for the migration phenotype. FIG.12C is a graph showing Z-scores for the growth phenotype. FIGS.12B- 12C show promoter positive controls, the top five pREs with the highest Z-scores for each phenotype, and three representative pREs ranked among the highest Z-scores for the other phenotype. Each dot represents a gRNA targeting a given pRE. Dashed line indicates a Z- score threshold of two. FIG.12D is a Venn diagram showing a comparison of the hit pREs regulating both phenotypes or only one. FIG.12E is a diagram showing a workflow overview of the single cell CRISPRi screen. A gRNA library targeting pREs identified from migration and growth screens was delivered to CRISPRi HFF cells, and single cell transcriptomes were profiled eight days later. FIG.12F is a volcano plot showing the change in target gene expression (lnFC) versus significance (-log10(FDR)) for each gRNA-gene connection. Significant gRNA-gene connections are colored as follows: pRE (‘NT’, medium grey), previously identified enhancers (‘Enhancer’, light grey), promoter regions (‘Promoter’, dark grey), and non-targeting controls (‘NT’, black), with an FDR < 0.01. Non-significant (‘NS’) gRNA-gene connections are shown in light grey. FIG.12G is a graph showing the average effect on target gene expression for MYH9 promoter-targeting positive control gRNAs, intron 3 enhancer-targeting positive control gRNA (medium grey), and the top ten pREs affecting migration (light grey) and growth (dark grey). Points represent individual gRNA-gene linkages, with all regions showing significant target gene reduction (FDR < 0.01). FIG.12H is a graph showing Z-scores of hit gRNA for each pRE from functional screening plotted versus the average effect on target gene expression from the same pRE in the single cell screening. Points represent the top 10 pREs by Z-score from functional screening, along with the greatest absolute fold-change of pRE-gene linkages from single cell RNA-seq screen.

[0026] FIGS.13A-13G show that a pRE near FZD2 displays mechanosensitive enhancer activity in HFF and A549 cells. FIG.13A is a track showing that both HFFs and A549 cells have shared differential accessibility of a pRE near the FZD2 promoter. FIG.13B is a graph showing RNA-seq data from HFFs that shows increasing FZD2 expression between 1 kPa / 50 kPa / and TCP mechanical environments. FIG.13C is a graph showing luciferase enhancer reporters showing that both the FZD2 pRE and the MYH9 intron 3 pRE have exogenous enhancer activity in HFFs one day post transfection, with the FZD2 pRE having higher levels of transcriptional activation. * indicates p < 0.05 by Welch’s t-test (uneven variance between groups). FIG.13D is a graph showing FZD2 RNA expression evaluated eight days post-transduction of dCas9-KRAB constructs and either a non-targeting gRNA, two FZD2 pRE gRNA (g3 / g4), or a FZD2 promoter targeting gRNA. **** indicated p<0.0001 by one-way ANOVA with multiple comparisons. FIG.13E is a graph showing the FZD2 pRE luciferase enhancer reporters in HFF showing a dose-dependent decrease in enhancer activity following blebbistatin treatment. *** indicates p<0.001 and **** indicates p < 0.0001 by one-way ANOVA with multiple comparisons. FIG.13F is a graph showing the FZD2 pRE luciferase enhancer showed decreases in activity following blebbistatin (40 μM), Y-27632 (10 μM), and an increase in treatment following nocodazole (10 μM) and CN03 treatment (1 μg / mL) all at one day post dosing. FIG.13G is a graph showing the FZD2 pRE luciferase enhancer reporters show exogenous luciferase activity in A549s, with significant reductions following blebbistatin treatment (40 μM). **** indicates p < 0.0001 by unpaired t- test.

[0027] FIG.14 is a graph showing a screen effect size (Z-score) for each pRE across both migration screens and growth screens. Non-targeting gRNA and positive control gRNA of genes changing migration are shown in red and blue respectively. Points shown are average Z-score across all gRNA in each region / target.

[0028] FIGS.15A-15B show a comparison of growth and migration phenotype scores. FIG.15A is a scatterplot comparing the phenotype scores between growth and migration phenotypes of all perturbed pREs. pREs significant in both screens, only the growth screen, only the migration screen, are colored in light grey, dark grey, and medium grey, respectively. The phenotype scores between the screens were not correlated for pREs regulating only migration (R2 = 0.0098, p-value = 0.46), both phenotypes (R2 = 0.082, p- value = 0.56), and only regulating growth (R2 = 0.049, p-value = 0.12). FIG.15B is a graph showing violin plots of a comparison of the phenotype scores between regions significant in only the growth, only the migration, or in both screens, colored in dark grey, medium grey, and light grey, respectively (Migration phenotype: One-way ANOVA, p-value = 3.1e-06;Tukey’s post-hoc tests: both vs migration, adj. p-value = 0.485; both vs growth, adj. p-value = 0.002; migration vs growth, adj. p-value = 0.00001; Growth phenotype: One-way ANOVA, p-value = 0.264). For box plots within violin plots, boxes show the quartiles with a line at the median. Lines extend to 1.5 times the interquartile range, and dots show outliers. Sample sizes for each group are as follows: both, N=7; growth, N=50; migration, N=58. For clarity, significance indicated in plot only for comparison with adj. p-value < 0.05. ** indicates p < 0.01 and *** indicates p < 0.001.

[0029] FIG.16 is a heatmap showing significant screen pREs that regulate migration and / or proliferation (columns) by ENCODE biosamples (rows) with coloring of very dark grey or white indicating the screen region overlaps or does not overlap an accessible chromatin region in that biosample, respectively, with data clustered by rows and by columns. “Lineage-specific”, “Prevalent”, and “Ubiquitous” regions indicated by light grey, dark- medium grey, and medium grey, respectively. The biosample corresponding to the same cell type queried in the screens (‘HFF’) is denoted in bold red text. The heatmap shows overlap of mechanosensitive regulatory elements and accessible chromatin regions in ENCODE biosamples.

[0030] FIGS.17A-17N show that epigenetic repression of validated mechanoenhancers inhibits cellular mechano-responses across cell lines and fibrotic disease contexts. FIG.17A is a graph showing the distribution of effect size difference between pRE-connected genes and permuted samples, comparing the ‘HAS1 High’ diseased fibroblast subpopulation to all other cell types (‘All’) within IPF lung tissue from single cell RNA-seq datasets. One-tailed p- value for permuted samples comparing the mean effect size is shown in the plot. Dashed line indicates the observed effect size difference for pRE-connected genes versus all other genes. FIG.17B is a diagram and images showing lung fibroblasts that were isolated from four healthy and four IPF patients. The baseline response of healthy donor cells treated with PDGFα was compared to either healthy cells activated in vitro with TGFβ or IPF cells treated with PDGFα. Representative images show differences in αSMA staining under these conditions. FIG.17C is a chart showing ATAC-seq and pRE-gene linkages in HFF cells showing SKP2 regulation by pRE#32. FIG.17D is a graph showing singleton validations of dCas9KRAB-induced mechanoenhancer SKP2 repression in HFFs. FIG.17E is a graph showing singleton validations of dCas9KRAB-induced mechanoenhancer SKP2 repression in A549 cells. FIG.17F is a graph showing singleton validations of dCas9KRAB-induced mechanoenhancer SKP2 repression in patient-derived lung fibroblasts. FIG.17G is a chart showing ATAC-seq and pRE-gene linkages in HFF showing regulation of CTGF and LINC1013 by pRE#740. FIG.17H is a graph showing singleton validations of dCas9KRAB-induced CTGF mechanoenhancer repression in HFFs. FIG.17I is a graph showing singleton validations of dCas9KRAB-induced CTGF mechanoenhancer repression in A549 cells. FIG.17J is a graph showing singleton validations of dCas9KRAB-induced CTGF mechanoenhancer repression in patient-derived lung fibroblasts. FIG.17K is a chart showing ATAC-seq and pRE-gene linkages in HFFs and A549 cells showing regulation of MYH9 by pRE#264. FIG.17L is a graph showing singleton validations of dCas9KRAB- induced MYH9 mechanoenhancer repression across HFFs. FIG.17M is a graph showing singleton validations of dCas9KRAB-induced MYH9 mechanoenhancer repression across A549 cells. FIG.17N is a graph showing singleton validations of dCas9KRAB-induced MYH9 mechanoenhancer repression across patient-derived lung fibroblasts. Each dot represents a biological replicate for HFF and A549 cells, and one donor for patient-derived lung fibroblasts.

[0031] FIGS.18A-18E show distribution of coverage, MOI, pREs per gene, genes connected to each pRE, and significant gRNAs per pRE. FIG.18A is a histogram of number of gRNAs observed in a given cell (MOI; mean = 1.90, median = 1). FIG.18B is a histogram of cells in which a given gRNA was observed (coverage; mean = 195, median = 159). FIG. 18C is a graph showing distribution of the number of genes that significantly change in expression upon perturbation of each pRE (FDR < 0.01, mean = 1.03, median = 1). FIG. 18D is a graph showing distribution of the number of pREs that when perturbed led to a significant change in expression of a given gene (FDR < 0.01, mean = 3.11, median = 2). For FIGS.18A-D, mean and median MOI indicated by vertical dark grey and light grey lines, respectively. FIG.18E is a graph showing the number of pREs with 1, 2, or 3 or more (‘3+’) significant gRNAs (N_1 = 21, N_2 = 11, N_‘3+’ = 33).

[0032] FIGS.19A-19C show pREs with many gene connections. FIG.19A is a browser track showing chr1:28648521−28649567. pRE-gene connections are shown below the ‘TSS peaks’ with dashed and solid lines indicating the gene is located to the left or right of the pRE, respectively. FIG.19B is a graph showing pRE-gene connections for pREs linked to 11 genes. Each point represents an individual gRNA-gene pair, and the coloring corresponds to the connected gene. FIG.19C is a graph showing odds ratios for enrichment of transcription factor motifs in differentially expressed genes upon perturbation of chr1:28648521−28649567 (adj. p-value < 0.1).

[0033] FIGS.20A-20E show a comparison of perturbation effects by gRNA type. FIG. 20A is a graph showing percent of total gRNA-gene differential expression tests with FDR < 0.01 for non-targeting (‘NT’), pRE-targeting (‘Targeting’), TSS-targeting positive controls (‘TSS’), and enhancer-targeting positive control (‘Enhancer’) gRNAs, colored by black, lightgrey, dark grey, and medium grey, respectively. Percent noted above each bar. FIG.20B is a graph showing a comparison of effect size for significant gRNA-gene connections between gRNA types. There was no significant difference in effect size for CCN1 expression for TSS vs Targeting (t-test, p-value = 0.3623). FIG.20C is a graph showing a comparison of effect size for significant gRNA-gene connections between gRNA types. There was a significant difference in effect size for FZD2 expression for Enhancer vs NT (adj. p-value = 0.0453). There was no significant difference for TSS vs NT (adj. P = 0.0972) and TSS vs Enhancer (adj. p-value = 0.6556). FIG.20D is a graph showing a comparison of effect size for significant gRNA-gene connections between gRNA types. There was a significant difference effect in effect size for MYH9 mRNA expression for TSS vs Enhancer (adj. p-value = 0.0017), TSS vs NT (adj. p-value = 0.0015), and TSS vs Targeting (adj. p-value = 0.0053). There was no significant difference for Targeting vs Enhancer (adj. p-value = 0.9582), NT vs Enhancer (adj. p-value = 0.1366), and Targeting vs NT (adj. p-value = 0.3121). FIG.20E is a graph showing a comparison of effect size for significant gRNA-gene connections between gRNA types. There was a significant difference in effect size for RANGAP1 mRNA expression for Targeting vs NT (adj. p-value = 1.18e-05), TSS vs NT (adj. p-value = 1.00e- 07), and TSS vs Targeting (adj. p-value = 1.86e-05). For FIGS.20C-E, adjusted p-value from Tukey’s post-hoc test is noted following each comparison.

[0034] FIGS.21A-21D show a characterization of interaction distance and basal expression levels for DHS-gene connections. FIG.21A is a volcano plot of single cell screen results comparing the change in mRNA expression (avg_logFC) versus the significance (-log10(FDR)) for significant gRNA-gene connections (FDR < 0.01) and colored by basal level of mRNA expression in HFF cells. Note, mRNA expression values were log10-transformed prior to visualization. FIG.21B is a volcano plot of single cell screen results comparing the change in mRNA expression (avg_logFC) versus the significance (- log10(FDR)) for significant gRNA-gene connections (FDR < 0.01) and colored by the absolute distance between each pRE and gene. Note, the absolute distance was log-10 transformed prior to visualization. FIG.21C is a graph showing the total count of gRNA- gene connections grouped by absolute distance between pRE and target gene (<5 kb, 5 kb- 20 kb, 20 kb-100 kb, 100 kb-500 kb, >500 kb). FIG.21D is a graph showing a comparison of avg_logFC of gene expression for gRNA-gene connections between groups in FIG.21C. Boxes show the quartiles with a line at the median. Lines extend to 1.5 times the interquartile range, and dots show outliers. All comparisons versus ‘<5 kb’ are significant (adj. p-value < 0.05). Sample sizes for each group: <5 kb = 32, 5 kb-20 kb = 103, 20 kb-100 kb = 76, 100 kb-500 kb = 133, >500 kb = 103.

[0035] FIGS.22A-22D show overlap of pREs identified in bulk and scRNA-seq screens with genomic annotations. FIG.22A is a graph showing the number of ENCODE SCREEN cCREs that overlap significant pREs in the bulk phenotype screens. FIG.22B is a graph showing the number of chromHMM annotated genomic regions that overlap significant pREs in the bulk phenotype screens. X-axis labels are abbreviated as follows: TssA = Active TSS, TssAFlnk = Flanking TSS, TxFlnk = Strong flanking transcription, Tx = Strong transcription, TxWk = Weak transcription, EnhG = Genic enhancer, Enh = Enhancer, ZNF / Rpts = ZNF genes and repeats, Het = Heterochromatin, TssBiv = Bivalent / poised TSS, BivFlnk = Flanking bivalent TSS / enhancer, EnhBiv = Bivalent enhancer, ReprPC = Repressed polycomb, ReprPCWk = Weak repressed polycomb, Quies = Quiescent / low. FIG.22C is a graph showing the number of ENCODE SCREEN cCREs that overlap significant pREs in the scRNA-seq screen. FIG.22D is a graph showing the number of chromHMM annotated genomic regions that overlap significant pREs in the scRNA-seq screen. X-axis labels are abbreviated as follows: TssA = Active TSS, TssAFlnk = Flanking TSS, TxFlnk = Strong flanking transcription, Tx = Strong transcription, TxWk = Weak transcription, EnhG = Genic enhancer, Enh = Enhancer, ZNF / Rpts = ZNF genes and repeats, BivFlnk = Flanking bivalent TSS / enhancer, ReprPC = Repressed polycomb, ReprPCWk = Weak repressed polycomb, Quies = Quiescent / low.

[0036] FIGS.23A-23F show a comparison between functional characterization DHS- gene connections and other prediction methods. FIG.23A is a histogram of the number of genes located between the pRE and connected gene in the scRNA-seq screen. Dark grey line indicates mean, light grey line indicates median. FIG.23B is a box plot showing the number of genes located between the pRE and connected gene in the scRNA-seq screen for each chromosome. Boxes show the quartiles with a line at the median. Lines extend to 1.5 times the interquartile range, and dots show outliers. Sample sizes for chromosomes in order of x-axis from left to right: chr1, N=33; chr10, N=2; chr11, N=5; chr12, N=6; chr15, N=9; chr16, N=31; chr17, N=7; chr18, N=3; chr19, N=15; chr2, N=18; chr20, N=2; chr21, N=1; chr22, N=9; chr3, N=12; chr4, N=8; chr5, N=10; chr6, N=12; chr7, N=7; chr8, N=4; chr9, N=7; chrX, N=1. FIG.23C is a graph showing a comparison of scRNA-seq links between pRE-gene pairs with chromatin loop observed in microC (+Loop) versus pRE-gene pairs without a chromatin loop (-Loop). The change in gene expression for pRE-gene pairs with FDR < 0.01 (N_+loop = 144, N_-loop = 885; gene expression: t-test, p-value = 1.195e- 07; pRE-gene distance: t-test, p-value < 2.2E-16). FIG.23D is a graph showing a comparison of scRNA-seq links between pRE-gene pairs with chromatin loop observed in microC (+Loop) versus pRE-gene pairs without a chromatin loop (-Loop). The change in the distance between the pRE and linked gene for pRE-gene pairs with FDR < 0.01 (N_+loop =144, N_-loop = 885; gene expression: t-test, p-value = 1.195e-07; pRE-gene distance: t-test, p-value < 2.2E-16). FIG.23E is a graph showing a comparison of scRNA-seq links between pRE-gene pairs with chromatin loop observed in microC (+Loop) versus pRE-gene pairs without a chromatin loop (-Loop). The change in gene expression for pRE-gene pairs with FDR < 0.05 (N_+loop = 217, N_-loop = 2029; gene expression: t-test, p-value = 1.391e-12; pRE-gene distance: t-test, p-value < 2.2e-16). FIG.23F is a graph showing a comparison of scRNA-seq links between pRE-gene pairs with chromatin loop observed in microC (+Loop) versus pRE-gene pairs without a chromatin loop (-Loop). The change in the distance between the pRE and linked gene for pRE-gene pairs with FDR < 0.05 (N_+loop = 217, N_- loop = 2029; gene expression: t-test, p-value = 1.391e-12; pRE-gene distance: t-test, p- value < 2.2e-16). For FIG.23D and FIG.23F, the distance was log10-transformed prior to statistical test and for visualization. For FIGS.23C-F, for box plots within each violin plot, boxes show the quartiles with a line at the median. Lines extend to 1.5 times the interquartile range, and dots show outliers.

[0037] FIGS.24A-24D show close-range pRE-gene validation examples. FIG.24A is a browser track of the region containing the gene CCN1 and the linked pRE with epigenomic and genomic annotations in HFF cells and across ENCODE3 biosamples. FIG.24B is a graph showing CCN1 mRNA expression measured via RT-qPCR following individual delivery of gRNAs targeting the connected pRE in CRISPRi HFF cells (N=6 for NT, N=3 for all other gRNAs; ‘NT’ indicates non-targeting; ‘ns’ indicates not significant, adj. p-value >= 0.05; ** denotes adj. p-value < 0.01). Error bars indicate + / - 1 SEM, horizontal line indicates mean. FIG.24C is a browser track of the region containing the gene NF2 and the linked pRE with epigenomic and genomic annotations in HFF cells and across ENCODE3 biosamples. FIG.24D is a graph showing NF2 mRNA expression measured via RT-qPCR following individual delivery of gRNAs targeting the connected pRE in CRISPRi HFF cells (N=6 for NT, N=3 for all other gRNAs; ‘NT’ indicates non-targeting; ‘ns’ indicates not significant, adj. p-value >= 0.05; * denotes adj. p-value < 0.05). Error bars indicate + / - 1 SEM, horizontal line indicates mean.

[0038] FIGS.25A-25D show long-range pRE-gene validation examples. FIG.25A is a browser track of the region containing the lncRNA LINC02948, the gene DUSP4, and the linked pRE with epigenomic and genomic annotations in HFF cells and across ENCODE3 biosamples. FIG.25B is a graph showing DUSP4 mRNA expression measured via RT- qPCR following individual delivery of gRNAs targeting the connected pRE in FIG.25A in CRISPRi HFF cells (N=6 for NT, N=3 for all other gRNAs; ‘NT’ indicates non-targeting; ‘ns’ indicates not significant, adj. p-value >= 0.05; ** denotes adj. p-value < 0.01). Error barsindicate + / - 1 SEM, horizontal line indicates mean. FIG.25C is a browser track of the region containing the gene RFLNB and the linked pRE with epigenomic and genomic annotations in HFF cells and across ENCODE3 biosamples. FIG.25D is a graph showing RFLNB mRNA expression measured via RT-qPCR following individual delivery of gRNAs targeting the connected pRE in FIG.25C in CRISPRi HFF cells (N=6 for NT, N=3 for all other gRNAs; ‘NT’ indicates non-targeting; ‘ns’ indicates not significant, adj. p-value >= 0.05; * denotes adj. p-value < 0.05). Error bars indicate + / - 1 SEM, horizontal line indicates mean.

[0039] FIGS.26A-26C show intronic pRE regulates two genes and contains functional SLE variants. FIG.26A is a browser track of the region containing the genes, FAM98B and RASGRP1, and the linked pRE with epigenomic and genomic annotations in HFF cells and across ENCODE3 biosamples. Single nucleotide polymorphisms from the GWAS Catalog and SLE variants shown. Grey shading indicates promoter of FAM98B, pRE identified in scRNA-seq screen, and promoter of RASGRP1, from left to right, respectively. FIG.26B is a graph showing FAM98B mRNA expression measured via RT-qPCR following individual delivery of gRNAs targeting the connected pRE in FIG.23A in CRISPRi HFF cells (N=6 for NT, N=3 for all other gRNAs; ‘NT’ indicates non-targeting; ‘ns’ indicates not significant, adj. p-value >= 0.05; * denotes adj. p-value < 0.05). Error bars indicate + / - 1 SEM, horizontal line indicates mean. FIG.26C is a graph showing RASGRP1 mRNA expression measured via RT-qPCR following individual delivery of gRNAs targeting the connected pRE in FIG. 23B in CRISPRi HFF cells (N=6 for NT, N=3 for all other gRNAs; ‘NT’ indicates non- targeting; ‘ns’ indicates not significant, adj. p-value >= 0.05; **** denotes adj. p-value < 0.0001). Error bars indicate + / - 1 SEM, horizontal line indicates mean.

[0040] FIGS.27A-27E show characterization of RANGAP1 enhancer element. FIG. 27A is a browser track showing gene connections for pRE proximal to RANGAP1 and ZC3H7B. Light grey shading indicates region containing pRE and green shading highlights promoters of differentially expressed genes. ChIA-PET loops for RAD21, SCREEN cCREs, and H3K4me1, H3K4me3, H3K27ac, and ATAC-seq peaks, are also shown. Significant pRE-gene connections are drawn from the pRE (light grey shaded region) to the promoters of RANGAP1 and ZC3H7B with individual gRNA validations denoted by ‘g7’, ‘g19’, and ‘g23’. FIG.27B is a graph showing RANGAP1 mRNA expression measured via RT-qPCR for individual gRNA validations (non-targeting (‘NT’), N=6; N=3 for all other gRNAs). FIG.27C is a graph showing ZC3H7B mRNA expression measured via RT-qPCR for individual gRNA validations (non-targeting (‘NT’), N=6; N=3 for all other gRNAs). FIG.27D is a graph showing CPM values for RANGAP1 mRNA expression from bulk RNA-sequencing of HFF cells cultured on 1 kPa (N=2), 10 kPa (N=2), or TCP (N=2) surfaces. Individual pointsrepresent biological replicates. FIG.27E is a graph showing CPM values for chromatin accessibility from ATAC-seq of HFF cells and cultured on 1 kPa, 12 kPa, 50 kPa, and 50 kPa + 10 μM Y-27632 (N=2-3). Error bars represent mean + / - 1 SEM. **** indicates p-value < 0.0001, *** indicates p-value < 0.001, ** indicates p-value < 0.01, * indicates p-value < 0.05.

[0041] FIGS.28A-28D show characterization of SKP2 enhancer element. FIG.28A is a browser track showing gene connections for SKP2 intronic pRE. Light grey shading indicates region containing pRE and green shading highlights SKP2 promoter. ChIA-PET loops for RAD21, SCREEN cCREs, and H3K4me1, H3K4me3, H3K27ac, and ATAC-seq peaks, are also shown. Significant pRE-gene connections are drawn from the pRE (light grey shaded region) to the SKP2 promoter with individual gRNA validations denoted by ‘g2’, ‘g7’, and ‘g26’. FIG.28B is a graph showing CPM values for chromatin accessibility of SKP2 enhancer in HFF cells cultured on 10 kPa (N=3), 12 kPa (N=3), or 50 kPa (N=2), surfaces or cultured on 50 kPa surface and treated with Y27 (N=3). FIG.28C is a graph showing CPM values for SKP2 mRNA expression from bulk RNA-sequencing of HFF cells cultured on 1 kPa (N=2), 10 kPa (N=2), or TCP (N=2) surfaces. FIG.28D is a graph showing SKP2 mRNA expression measured via RT-qPCR for individual gRNA validations (non-targeting (‘NT’), N=6; N=3 for all other gRNAs). Individual points represent biological replicates. Error bars represent mean + / - 1 SEM. **** indicates p-value < 0.0001, *** indicates p-value < 0.001, ** indicates p-value < 0.01, * indicates p-value < 0.05.

[0042] FIG.29 is a graph showing changes in gene expression for confirmed pRE-gene connections that are well correlated between single cell screen and individual gRNA validations. Change in gene expression was measured via single cell RNA-sequencing versus change in mRNA expression was measured via RT-qPCR for pRE-gene connections that were confirmed with individual gRNA validations. The y-coordinate of each point is the most significant avg_logFC value for a given pRE-gene connection. Spearman correlation R2 value and related significance are denoted in the upper left corner. Blue diagonal line represents the linear best-fit model.

[0043] FIGS.30A-30B show that gene set and transcription factor enrichment reveals shared networks regulated by mechanoresponsive regulatory elements. FIG.30A is a graph showing pathway analysis using the union set of genes connected to at least one pRE link multiple mechanosensitive pathways. Proportion of overlap between pRE-connected genes and gene set shown on x-axis. Coloring indicates the database for each gene set. All pathways shown significant at adj. p-value < 0.05. FIG.30B is a graph showing transcription factor enrichment using the union set of genes connected to at least one pRE and the ‘ChIP-X Consensus TF’ gene set. -log10(adj. p-value) shown on x-axis. Dashed line indicates adj. p-value = 0.05. All sets shown significant at adj. p-value < 0.1.

[0044] FIGS.31A-31D show gRNA library plasmid pool verification by NGS sequencing. FIG.31A is a histogram showing the log2 total reads from NGS sequencing for the MYH9 locus pRE library and the number of gRNA from the library that fall in each bin. FIG.31B is a histogram showing the log2 total reads from NGS sequencing for the MYH9 int3 pRE library and the number of gRNA from the library that fall in each bin. FIG.31C is a histogram showing the log2 total reads from NGS sequencing for the functional / migration growth screen pRE library and the number of gRNA from the library that fall in each bin. FIG.31D is a histogram showing the log2 total reads from NGS sequencing for the sc-RNA-seq pRE validation library and the number of gRNA from the library that fall in each bin. All plasmid pools showed full representation of every gRNA from the oligo pool. DETAILED DESCRIPTION

[0045] Described herein are compositions and methods for modulating the expression of genes affected by matrix stiffness and mechanical cues from the cellular microenvironment. As detailed herein, genome-wide epigenome profiling, epigenome editing, and phenotypic and single-cell RNA-seq CRISPR screening were used to identify a new class of genomic enhancers that responds to the mechanical microenvironment. These genomic enhancers may be referred to as “mechanoenhancers” and may be active on soft or stiff extracellular matrix contexts and regulate transcription to influence critical cell functions such as apoptosis, mechanotransduction, proliferation, and migration. For example, epigenetic editing of mechanoenhancers detailed herein on rigid materials were found to tune gene expression to levels observed on softer materials, thereby reprogramming the cellular response to the mechanical microenvironment. Modulation of expression of the mechanoenhancers may enable the precise alteration of mechanically-driven disease states, such as cancer and fibrosis, and may be used as targets in disease treatment. 1. Definitions

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein areincorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

[0047] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and,” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of,” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0048] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0049] The term “about” or “approximately” as used herein as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In certain aspects, the term “about” refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). Alternatively, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2- fold, of a value.

[0050] “Adeno-associated virus” or “AAV” as used interchangeably herein refers to a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very mild immune response.

[0051] “Allogeneic” refers to any material derived from another subject of the same species. Allogeneic cells are genetically distinct and immunologically incompatible yetbelong to the same species. Typically, “allogeneic” is used to define cells, such as stem cells, that are transplanted from a donor to a recipient of the same species.

[0052] “Amino acid” as used herein refers to naturally occurring and non-natural synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code. Amino acids can be referred to herein by either their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Amino acids include the side chain and polypeptide backbone portions.

[0053] “Autologous" refers to any material derived from a subject and re-introduced to the same subject.

[0054] “Binding region” as used herein refers to the region within a target region that is recognized and bound by the CRISPR / Cas-based gene editing system.

[0055] The terms “cancer”, “cancer cell”, “tumor”, and “tumor cell” are used interchangeably herein and refer generally to a group of diseases characterized by uncontrolled, abnormal growth of cells (e.g., a neoplasia). In some forms of cancer, the cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body (“metastatic cancer”). “Cancer” refers to all types of cancer or neoplasm or malignant tumors found in animals, including carcinoma, adenoma, melanoma, sarcoma, lymphoma, leukemia, blastoma, glioma, astrocytoma, mesothelioma, or a germ cell tumor. Cancer may include cancer of, for example, the colon, rectum, stomach, bladder, cervix, uterus, skin, epithelium, muscle, kidney, liver, lymph, bone, blood, ovary, prostate, lung, brain, head and neck, and / or breast. Cancer may include medullablastoma, non-small cell lung cancer, and / or mesothelioma. In embodiments detailed herein, the cancer includes leukemia. The term “leukemia” refers to broadly progressive, malignant diseases of the hematopoietic organs / systems and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia diseases include, for example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophilic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, undifferentiated cell leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocyticleukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myelocytic leukemia, myeloid leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, plasmacytic leukemia, and promyelocytic leukemia. In some embodiments, the leukemia is chronic myeloid leukemia (CML). In some embodiments, the leukemia is acute myeloid leukemia (AML).

[0056] “Clustered Regularly Interspaced Short Palindromic Repeats” and “CRISPRs”, as used interchangeably herein, refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea.

[0057] “Coding sequence” or “encoding nucleic acid” as used herein means the nucleic acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The regulatory elements may include, for example, a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal. The coding sequence may be codon optimized.

[0058] “Complement” or “complementary” as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T / U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules. “Complementarity” refers to a property shared between two nucleic acid sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.

[0059] The terms “control,” “reference level,” and “reference” are used herein interchangeably. The reference level may be a predetermined value or range, which is employed as a benchmark against which to assess the measured result. “Control group” as used herein refers to a group of control subjects. The predetermined level may be a cutoff value from a control group. The predetermined level may be an average from a control group. Cutoff values (or predetermined cutoff values) may be determined by Adaptive Index Model (AIM) methodology. Cutoff values (or predetermined cutoff values) may be determined by a receiver operating curve (ROC) analysis from biological samples of the patient group. ROC analysis, as generally known in the biological arts, is a determination ofthe ability of a test to discriminate one condition from another, e.g., to determine the performance of each marker in identifying a patient having CRC. A description of ROC analysis is provided in P.J. Heagerty et al. (Biometrics 2000, 56, 337-44), the disclosure of which is hereby incorporated by reference in its entirety. Alternatively, cutoff values may be determined by a quartile analysis of biological samples of a patient group. For example, a cutoff value may be determined by selecting a value that corresponds to any value in the 25th-75th percentile range, preferably a value that corresponds to the 25th percentile, the 50th percentile or the 75th percentile, and more preferably the 75th percentile. Such statistical analyses may be performed using any method known in the art and can be implemented through any number of commercially available software packages (e.g., from Analyse-it Software Ltd., Leeds, UK; StataCorp LP, College Station, TX; SAS Institute Inc., Cary, NC.). The healthy or normal levels or ranges for a target or for a protein activity may be defined in accordance with standard practice. A control may be a subject or cell without a composition as detailed herein. A control may be a subject, or a sample therefrom, whose disease state is known. The subject, or sample therefrom, may be healthy, diseased, diseased prior to treatment, diseased during treatment, or diseased after treatment, or a combination thereof.

[0060] “Correcting”, “gene editing,” and “restoring” as used herein refers to changing a mutant gene that encodes a dysfunctional protein or truncated protein or no protein at all, such that a full-length functional or partially full-length functional protein expression is obtained. Correcting or restoring a mutant gene may include replacing the region of the gene that has the mutation or replacing the entire mutant gene with a copy of the gene that does not have the mutation with a repair mechanism such as homology-directed repair (HDR). Correcting or restoring a mutant gene may also include repairing a frameshift mutation that causes a premature stop codon, an aberrant splice acceptor site or an aberrant splice donor site, by generating a double stranded break in the gene that is then repaired using non-homologous end joining (NHEJ). NHEJ may add or delete at least one base pair during repair which may restore the proper reading frame and eliminate the premature stop codon. Correcting or restoring a mutant gene may also include disrupting an aberrant splice acceptor site or splice donor sequence. Correcting or restoring a mutant gene may also include deleting a non-essential gene segment by the simultaneous action of two nucleases on the same DNA strand in order to restore the proper reading frame by removing the DNA between the two nuclease target sites and repairing the DNA break by NHEJ.

[0061] “Donor DNA”, “donor template,” and “repair template” as used interchangeably herein refers to a double-stranded DNA fragment or molecule that includes at least a portion of the gene of interest. The donor DNA may encode a full-functional protein or a partially functional protein.

[0062] “Enhancer” as used herein refers to non-coding DNA sequences containing multiple activator and repressor binding sites. Enhancers range from 200 bp to 1 kb in length and may be either proximal, 5’ upstream to the promoter or within the first intron of the regulated gene, or distal, in introns of neighboring genes or intergenic regions far away from the locus. Through DNA looping, active enhancers contact the promoter dependently of the core DNA binding motif promoter specificity. 4 to 5 enhancers may interact with a promoter. Similarly, enhancers may regulate more than one gene without linkage restriction and may “skip” neighboring genes to regulate more distant ones. Transcriptional regulation may involve elements located in a chromosome different to one where the promoter resides. Proximal enhancers or promoters of neighboring genes may serve as platforms to recruit more distal elements.

[0063] “Frameshift” or “frameshift mutation” as used interchangeably herein refers to a type of gene mutation wherein the addition or deletion of one or more nucleotides causes a shift in the reading frame of the codons in the mRNA. The shift in reading frame may lead to the alteration in the amino acid sequence at protein translation, such as a missense mutation or a premature stop codon.

[0064] “Functional” and “full-functional” as used herein describes protein that has biological activity. A “functional gene” refers to a gene transcribed to mRNA, which is translated to a functional protein.

[0065] “Fusion protein” as used herein refers to a chimeric protein created through the joining of two or more genes that originally coded for separate proteins. The translation of the fusion gene results in a single polypeptide with functional properties derived from each of the original proteins.

[0066] “Genetic construct" as used herein refers to the DNA or RNA molecules that comprise a polynucleotide that encodes a protein. The coding sequence includes initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered. As used herein, the term “expressible form” refers to gene constructs that contain the necessary regulatory elements operable linked to acoding sequence that encodes a protein such that when present in the cell of the individual, the coding sequence will be expressed. The regulatory elements may include, for example, a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal.

[0067] “Genome editing” or “gene editing” as used herein refers to changing the DNA sequence of a gene. Genome editing may include correcting or restoring a mutant gene or adding additional mutations. Genome editing may include knocking out a gene, such as a mutant gene or a normal gene. Genome editing may be used to treat disease or, for example, enhance muscle repair, by changing the gene of interest. In some embodiments, the compositions and methods detailed herein are for use in somatic cells and not germ line cells.

[0068] The term “heterologous” as used herein refers to nucleic acid comprising two or more subsequences that are not found in the same relationship to each other in nature. For instance, a nucleic acid that is recombinantly produced typically has two or more sequences from unrelated genes synthetically arranged to make a new functional nucleic acid, for example, a promoter from one source and a coding region from another source. The two nucleic acids are thus heterologous to each other in this context. When added to a cell, the recombinant nucleic acids would also be heterologous to the endogenous genes of the cell. Thus, in a chromosome, a heterologous nucleic acid would include a non-native (non- naturally occurring) nucleic acid that has integrated into the chromosome, or a non-native (non-naturally occurring) extrachromosomal nucleic acid. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (for example, a “fusion protein,” where the two subsequences are encoded by a single nucleic acid sequence).

[0069] “Homology-directed repair” or “HDR” as used interchangeably herein refers to a mechanism in cells to repair double strand DNA lesions when a homologous piece of DNA is present in the nucleus, mostly in G2 and S phase of the cell cycle. HDR uses a donor DNA template to guide repair and may be used to create specific sequence changes to the genome, including the targeted addition of whole genes. If a donor template is provided along with the CRISPR / Cas9-based gene editing system, then the cellular machinery will repair the break by homologous recombination, which is enhanced several orders of magnitude in the presence of DNA cleavage. When the homologous DNA piece is absent, non-homologous end joining may take place instead.

[0070] “Identical” or “identity” as a percentage as used herein in the context of two or more polynucleotide or polypeptide sequences means that the sequences have a specifiedpercentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

[0071] “Mutant gene” or “mutated gene” as used interchangeably herein refers to a gene that has undergone a detectable mutation. A mutant gene has undergone a change, such as the loss, gain, or exchange of genetic material, which affects the normal transmission and expression of the gene. A “disrupted gene” as used herein refers to a mutant gene that has a mutation that causes a premature stop codon. The disrupted gene product is truncated relative to a full-length undisrupted gene product.

[0072] “Non-homologous end joining (NHEJ) pathway” as used herein refers to a pathway that repairs double-strand breaks in DNA by directly ligating the break ends without the need for a homologous template. The template-independent re-ligation of DNA ends by NHEJ is a stochastic, error-prone repair process that introduces random micro-insertions and micro-deletions (indels) at the DNA breakpoint. This method may be used to intentionally disrupt, delete, or alter the reading frame of targeted gene sequences. NHEJ typically uses short homologous DNA sequences called microhomologies to guide repair. These microhomologies are often present in single-stranded overhangs on the end of double-strand breaks. When the overhangs are perfectly compatible, NHEJ usually repairs the break accurately, yet imprecise repair leading to loss of nucleotides may also occur, but is much more common when the overhangs are not compatible. “Nuclease mediated NHEJ” as used herein refers to NHEJ that is initiated after a nuclease cuts double stranded DNA.

[0073] “Normal gene” as used herein refers to a gene that has not undergone a change, such as a loss, gain, or exchange of genetic material. The normal gene undergoes normal gene transmission and gene expression. For example, a normal gene may be a wild-type gene.

[0074] “Nucleic acid” or “oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a polynucleotide also encompasses the complementary strand of a depicted single strand. Many variants of a polynucleotide may be used for the same purpose as a given polynucleotide. Thus, a polynucleotide also encompasses substantially identical polynucleotides and complements thereof. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, a polynucleotide also encompasses a probe that hybridizes under stringent hybridization conditions. Polynucleotides may be single stranded or double stranded or may contain portions of both double stranded and single stranded sequence. The polynucleotide can be nucleic acid, natural or synthetic, DNA, genomic DNA, cDNA, RNA, mRNA, or a hybrid, where the polynucleotide can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including, for example, uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. Polynucleotides can be obtained by chemical synthesis methods or by recombinant methods.

[0075] “Open reading frame” refers to a stretch of codons that begins with a start codon and ends at a stop codon. In eukaryotic genes with multiple exons, introns are removed, and exons are then joined together after transcription to yield the final mRNA for protein translation. An open reading frame may be a continuous stretch of codons. In some embodiments, the open reading frame only applies to spliced mRNAs, not genomic DNA, for expression of a protein.

[0076] “Operably linked” as used herein means that expression of a gene is under the control of a promoter with which it is spatially connected. A promoter may be positioned 5' (upstream) or 3' (downstream) of a gene under its control. The distance between the promoter and a gene may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance may be accommodated without loss of promoter function. Nucleic acid or amino acid sequences are “operably linked” (or “operatively linked”) when placed into a functional relationship with one another. For instance, a promoter or enhancer is operably linked to a coding sequence if it regulates, or contributes to the modulation of, the transcription of the coding sequence. Operably linked DNA sequences are typically contiguous, and operably linked amino acid sequences are typically contiguous and in the same reading frame. However, since enhancers generally function when separated from the promoter by up to several kilobases or more and intronic sequences may be of variablelengths, some polynucleotide elements may be operably linked but not contiguous. Similarly, certain amino acid sequences that are non-contiguous in a primary polypeptide sequence may nonetheless be operably linked due to, for example folding of a polypeptide chain. With respect to fusion polypeptides, the terms “operatively linked” and “operably linked” can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked.

[0077] “Partially-functional” as used herein describes a protein that is encoded by a mutant gene and has less biological activity than a functional protein but more than a non- functional protein.

[0078] A “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The terms “polypeptide”, “protein,” and “peptide” are used interchangeably herein. “Primary structure” refers to the amino acid sequence of a particular peptide. “Secondary structure” refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains, for example, enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tail domains. “Domains” are portions of a polypeptide that form a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Exemplary domains include domains with enzymatic activity or ligand binding activity. Typical domains are made up of sections of lesser organization such as stretches of beta-sheet and alpha- helices. “Tertiary structure” refers to the complete three-dimensional structure of a polypeptide monomer. “Quaternary structure” refers to the three-dimensional structure formed by the noncovalent association of independent tertiary units. A “motif” is a portion of a polypeptide sequence and includes at least two amino acids. A motif may be 2 to 20, 2 to 15, or 2 to 10 amino acids in length. In some embodiments, a motif includes 3, 4, 5, 6, or 7 sequential amino acids. A domain may be comprised of a series of the same type of motif.

[0079] “Premature stop codon” or “out-of-frame stop codon” as used interchangeably herein refers to nonsense mutation in a sequence of DNA, which results in a stop codon at location not normally found in the wild-type gene. A premature stop codon may cause a protein to be truncated or shorter compared to the full-length version of the protein.

[0080] “Promoter” as used herein means a synthetic or naturally derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to furtherenhance expression and / or to alter the spatial expression and / or temporal expression of same. A promoter may also comprise distal enhancer or repressor elements, which may be located as much as several thousand base pairs from the start site of transcription. A promoter may be derived from sources including viral, bacterial, fungal, plants, insects, and animals. A promoter may regulate the expression of a gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter, human U6 (hU6) promoter, and CMV IE promoter. Promoters that target muscle-specific stem cells may include the CK8 promoter, the Spc5-12 promoter, and the MHCK7 promoter.

[0081] The term “recombinant” when used with reference to, for example, a cell, nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein, or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (naturally occurring) form of the cell or express a second copy of a native gene that is otherwise normally or abnormally expressed, under expressed, or not expressed at all.

[0082] “Sample” or “test sample” as used herein can mean any sample in which the presence and / or level of a target is to be detected or determined or any sample comprising a DNA targeting or gene editing system or component thereof as detailed herein. Samples may include liquids, solutions, emulsions, or suspensions. Samples may include a medical sample. Samples may include any biological fluid or tissue, such as blood, whole blood, fractions of blood such as plasma and serum, muscle, interstitial fluid, sweat, saliva, urine, tears, synovial fluid, bone marrow, cerebrospinal fluid, nasal secretions, sputum, amniotic fluid, bronchoalveolar lavage fluid, gastric lavage, emesis, fecal matter, lung tissue, peripheral blood mononuclear cells, total white blood cells, lymph node cells, spleen cells, tonsil cells, cancer cells, tumor cells, bile, digestive fluid, skin, or combinations thereof. In some embodiments, the sample comprises an aliquot. In other embodiments, the sample comprises a biological fluid. Samples can be obtained by any means known in the art. The sample can be used directly as obtained from a patient or can be pre-treated, such as by filtration, distillation, extraction, concentration, centrifugation, inactivation of interferingcomponents, addition of reagents, and the like, to modify the character of the sample in some manner as discussed herein or otherwise as is known in the art.

[0083] “Subject” and “patient” as used herein interchangeably refers to any vertebrate, including, but not limited to, a mammal that wants or is in need of the herein described compositions or methods. The subject may be a human or a non-human. The subject may be a vertebrate. The subject may be a mammal. The mammal may be a primate or a non- primate. The mammal can be a non-primate such as, for example, cow, pig, camel, llama, hedgehog, anteater, platypus, elephant, alpaca, horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, and mouse. The mammal can be a primate such as a human. The mammal can be a non-human primate such as, for example, monkey, cynomolgous monkey, rhesus monkey, chimpanzee, gorilla, orangutan, and gibbon. The subject may be of any age or stage of development, such as, for example, an adult, an adolescent, a child, such as age 0-2, 2-4, 2-6, or 6-12 years, or an infant, such as age 0-1 years. The subject may be male. The subject may be female. In some embodiments, the subject has a specific genetic marker. The subject may be undergoing other forms of treatment.

[0084] “Substantially identical” can mean that a first and second amino acid or polynucleotide sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% over a region of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids or nucleotides, respectively.

[0085] “Target gene” as used herein refers to any nucleotide sequence encoding a known or putative gene product. The target gene may be a mutated gene involved in a genetic disease. The target gene may encode a known or putative gene product that is intended to be corrected or for which its expression is intended to be modulated. In certain embodiments, the target gene is or encodes a mechanoenhancer as detailed herein.

[0086] “Target region” as used herein refers to the region of the target gene to which the CRISPR / Cas9-based gene editing or targeting system is designed to bind.

[0087] “Transgene” as used herein refers to a gene or genetic material containing a gene sequence that has been isolated from one organism and is introduced into a different organism. This non-native segment of DNA may retain the ability to produce RNA or protein in the transgenic organism, or it may alter the normal function of the transgenic organism's genetic code. The introduction of a transgene has the potential to change the phenotype of an organism.

[0088] “Transcriptional regulatory elements” or “regulatory elements” refers to a genetic element which can control the expression of nucleic acid sequences, such as activate, enhancer, or decrease expression, or alter the spatial and / or temporal expression of a nucleic acid sequence. Examples of regulatory elements include, for example, promoters, enhancers, splicing signals, polyadenylation signals, and termination signals. A regulatory element can be “endogenous,” “exogenous,” or “heterologous” with respect to the gene to which it is operably linked. An “endogenous” regulatory element is one which is naturally linked with a given gene in the genome. An “exogenous” or “heterologous” regulatory element is one which is not normally linked with a given gene but is placed in operable linkage with a gene by genetic manipulation.

[0089] “Treatment” or “treating” or “therapy” when referring to protection of a subject from a disease, means suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. Treatment may result in a reduction in the incidence, frequency, severity, and / or duration of symptoms of the disease. Preventing the disease involves administering a composition of the present invention to a subject prior to onset of the disease. Suppressing the disease involves administering a composition of the present invention to a subject after induction of the disease but before its clinical appearance. Repressing or ameliorating the disease involves administering a composition of the present invention to a subject after clinical appearance of the disease.

[0090] As used herein, the term “gene therapy” refers to a method of treating a patient wherein polypeptides or nucleic acid sequences are transferred into cells of a patient such that activity and / or the expression of a particular gene is modulated. In certain embodiments, the expression of the gene is suppressed. In certain embodiments, the expression of the gene is enhanced. In certain embodiments, the temporal or spatial pattern of the expression of the gene is modulated.

[0091] “Variant” used herein with respect to a polynucleotide means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a referenced nucleic acid or the complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, complement thereof, or a sequence substantially identical thereto. A variant can be a polynucleotide sequence that is substantially identical over the full length of the full polynucleotide sequence or a fragmentthereof. The polynucleotide sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or less than 100% identical over the full length of the polynucleotide sequence or a fragment thereof.

[0092] “Variant” with respect to a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity. Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity. Representative examples of “biological activity” include the ability to be bound by a specific antibody or polypeptide or to promote an immune response. Variant can mean a functional fragment thereof. Variant can also mean multiple copies of a polypeptide. The multiple copies can be in tandem or separated by a linker. A conservative substitution of an amino acid, for example, replacing an amino acid with a different amino acid of similar properties (for example, hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes may be identified, in part, by considering the hydropathic index of amino acids, as understood in the art (Kyte et al., J. Mol. Biol.1982, 157, 105-132). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes may be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of ±2 are substituted. The hydrophilicity of amino acids may also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide. Substitutions may be performed with amino acids having hydrophilicity values within ±2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties. A variant can be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or fragment thereof. The amino acid sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or less than 100% identical over the full length of the amino acid sequence or a fragment thereof.

[0093] “Vector” as used herein means a nucleic acid sequence containing an origin of replication. A vector may be capable of directing the delivery or transfer of a polynucleotidesequence to target cells, where it can be replicated or expressed. A vector may contain an origin of replication, one or more regulatory elements, and / or one or more coding sequences. A vector may be a viral vector, bacteriophage, bacterial artificial chromosome, plasmid, cosmid, or yeast artificial chromosome. A vector may be a DNA or RNA vector. A vector may be a self-replicating extrachromosomal vector. Viral vectors include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, retrovirus vector, or lentivirus vector. A vector may be an adeno-associated virus (AAV) vector. The vector may encode a Cas9 protein and at least one gRNA molecule.

[0094] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. 2. Mechanoenhancers

[0095] Provided herein are mechanoenhancers. Mechanoenhancers are genes whose expression may be affected by matrix stiffness and / or mechanical cues from the cellular microenvironment. These mechanical cues from the cellular microenvironment may include the physical forces and stresses that cells experience from their surrounding environment, such as the extracellular matrix (ECM). Mechanical cues may include, for example, matrix stiffness (for example, a soft extracellular matrix, or a stiff extracellular matrix), tension, compression, stretching, shear stress, hydrostatic pressure, topography of the ECM, or a combination thereof. Matrix stiffness may include the rigidity or flexibility of the extracellular matrix, which can significantly impact cell behavior. Tensile stress may include pulling forces exerted on a cell from its surroundings. Compressive stress may include pushing forces exerted on a cell. Shear stress may include forces acting parallel to a cell surface, like fluid flow. Hydrostatic pressure may include uniform pressure exerted on a cell from all directions. Topography may include the surface features or texture of the ECM.

[0096] The mechanical cues may influence various cellular behaviors including, for example, proliferation, differentiation, migration, and adhesion, by acting as signals that cellscan sense and respond to through a process called. Mechanotransduction pathways may refer to the cascade(s) of intracellular signaling events that are triggered when a cell experiences mechanical force, leading to changes in gene expression and cell behavior. Cellular behaviors influenced by mechanical cues, as listed above, may affect embryonic development, tissue homeostasis, wound healing, and cancer or other disease progression. A mechanoenhancer may modulate apoptosis, mechanotransduction, proliferation, migration, growth, fibrosis, atherosclerosis, ECM secretion, or senescence, or a combination thereof.

[0097] Mechanoenhancers may include a gene selected from those listed in TABLE 14 or a gene product thereof. In some embodiments, the mechanoenhancer is selected from CCN2 (also known as CTGF), CYR61, MYH9, RFLNB, RANGAP1, RASGRP1, NF2, and BMF or a gene product thereof.

[0098] The mechanoenhancer may be modified. Modifying or modulating may include increasing or decreasing, for example. In some embodiments, a mechanoenhancer is increased. In some embodiments, a mechanoenhancer is decreased. Provided herein are inhibitors of a mechanoenhancer. Provided herein are activators of a mechanoenhancer. Modulating the expression of a mechanoenhancer may result in modulation of apoptosis, mechanotransduction, proliferation, migration, growth, fibrosis, atherosclerosis, ECM secretion, or senescence, or a combination thereof, in a cell or subject. Expression or activity of a cellular marker may be increased by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2- fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Expression or activity of a cellular marker may be increased by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Expression or activity of a cellular marker may be increased by about 5-95%, 10- 90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control. In some embodiments, the compositions and methods comprise an agent that decreases expression or activity of a cellular marker in a cell or subject. Expression of a marker may be determined done by any suitable means in the art, including, for example, ELISA, immunohistochemistry, flow cytometry, FACS, DNA or RNA sequencing, and hybridization of reporters or probes to RNA transcripts.

[0099] The mechanoenhancer may be modulated by targeting the mechanoenhancer gene or a regulatory element thereof. Regulatory elements include, for example, promoters and enhancers. Regulatory elements may be within 1000 base pairs of the transcriptionstart site. Regulatory elements may be within 600 base pairs of the transcription start site. The agent, or the composition or the method comprising the agent, may modify the expression of a mechanoenhancer gene. For example, the agent, or the composition or the method comprising the agent, may reduce, inhibit, decrease, activate, increase, or enhance the expression or activity of a mechanoenhancer gene or its gene protein product. The agent, or the composition or the method comprising the agent, may directly or indirectly modulate the activity of the mechanoenhancer gene’s protein product. For example, the mechanoenhancer modulator may increase or decrease the binding or enzymatic activity of the mechanoenhancer gene’s protein product, or inhibit the binding of the mechanoenhancer gene’s protein product to another molecule or ligand, or increase the binding of the mechanoenhancer gene’s protein product to another molecule or ligand, or increase or decrease the degradation of the mechanoenhancer gene’s protein product, or a combination thereof. [000100] In some embodiments, the mechanoenhancer is increased, activated, and / or enhanced. The expression or activity of a mechanoenhancer gene or gene protein product may be increased, activated, and / or enhanced. The level of polynucleotide encoding the mechanoenhancer gene or gene product may be increased, activated, and / or enhanced. The level of transcription of a polynucleotide encoding the mechanoenhancer gene or gene product may be increased, activated, and / or enhanced. The level of translation of a mRNA encoding the mechanoenhancer gene product may be increased, activated, and / or enhanced. The expression of protein encoded by the mechanoenhancer gene or the open reading frame thereof may be increased, activated, and / or enhanced. The level or amount of protein expressed from the mechanoenhancer gene may be increased, activated, and / or enhanced. The level or amount of protein expressed from the open reading frame of the mechanoenhancer gene may be increased, activated, and / or enhanced. [000101] In some embodiments, the mechanoenhancer is decreased, reduced, deactivated, and / or inhibited. The expression or activity of a mechanoenhancer gene or gene protein product may be decreased, reduced, deactivated, and / or inhibited. The level of polynucleotide encoding the mechanoenhancer gene or gene product may be decreased, reduced, deactivated, and / or inhibited. The level of transcription of a polynucleotide encoding the mechanoenhancer gene or gene product may be decreased, reduced, deactivated, and / or inhibited. The level of translation of a mRNA encoding the mechanoenhancer gene product may be decreased, reduced, deactivated, and / or inhibited. The expression of protein encoded by the mechanoenhancer gene or the open reading frame thereof may be decreased, reduced, deactivated, and / or inhibited. The level oramount of protein expressed from the mechanoenhancer gene may be decreased, reduced, deactivated, and / or inhibited. The level or amount of protein expressed from the open reading frame of the mechanoenhancer gene may be decreased, reduced, deactivated, and / or inhibited. [000102] Mechanoenhancers may be modulated by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5- fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Mechanoenhancers may be modulated by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Mechanoenhancers may be modulated by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5- fold to 10-fold, relative to a control. Mechanoenhancers may be reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Mechanoenhancers may be reduced by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Mechanoenhancers may be reduced by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control. Mechanoenhancers may be increased by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Mechanoenhancers may be increased by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. Mechanoenhancers may be increased by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control. [000103] In some embodiments, the modulator of the mechanoenhancer is administered concurrently with a cancer therapy, or subsequent to a cancer therapy, or prior to a cancer therapy, or as a cancer therapy. 3. DNA Targeting Systems [000104] In some embodiments, the mechanoenhancer may be modified with or by a DNA targeting composition or at least one component thereof. A “DNA Targeting System” as used herein is a system capable of specifically targeting a particular region of DNA and modulating gene expression by binding to that region. Non-limiting examples of thesesystems are CRISPR-Cas-based systems, zinc finger (ZF)-based systems, and / or transcription activator-like effector (TALE)-based systems. The DNA Targeting System may be a nuclease system that acts through mutating or editing the target region (such as by insertion, deletion or substitution) or it may be a system that delivers a functional second polypeptide domain, such as an activator or repressor, to the target region. [000105] Each of these systems comprises a DNA-binding portion or domain, such as a guide RNA, a ZF, or a TALE, that specifically recognizes and binds to a particular target region of a target DNA. The DNA-binding portion (for example, Cas protein, ZF, or TALE) can be linked to a second protein domain, such as a polypeptide with transcription activation activity, transcription repression activity, transcription release factor activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, demethylase activity, acetylation activity, or deacetylation activity, to form a fusion protein. Exemplary second polypeptide domains are detailed further below (see “Cas Fusion Protein”). For example, the DNA-binding portion can be linked to an activator and thus guide the activator to a specific target region of the target DNA. Similarly, the DNA-binding portion can be linked to a repressor and thus guide the repressor to a specific target region of the target DNA. [000106] In some embodiments, the DNA targeting composition comprises a meganuclease. A meganuclease is an endodeoxyribonuclease characterized by a large recognition site, such as double-stranded DNA sequences of 12 to 40 base pairs. The recognition site may occur only once in any given genome. A meganuclease may be a homing endonuclease selected from an intron endonuclease or an intein endonuclease. Meganucleases may include, for example, the LAGLIDADG family of homing endonucleases. [000107] In some embodiments, the DNA-binding portion comprises a Cas protein, such as a Cas9 protein. Some CRISPR-Cas-based systems can operate to activate or repress expression using the Cas protein alone, not linked to an activator or repressor. For example, a nuclease-null Cas9 can act as a repressor on its own, or a nuclease-active Cas9 can act as an activator when paired with an inactive (dead) guide RNA. In addition, RNA or DNA that hybridizes to a particular target region of the target DNA can be directly linked (covalently or non-covalently) to an activator or repressor. Some CRISPR-Cas-based systems can operate to activate or repress expression using the Cas protein linked to a second protein domain, such as, for example, an activator or repressor.i) DNA Binding Protein [000108] The DNA Targeting System may include a DNA binding protein. The DNA binding protein may comprise, for example, a zinc finger protein or a transcription activator- like effector (TALE). The zinc finger protein or TALE may target a gene selected fromTGIF2LX, TGIF1, TGIF2, FOS, HNF4A, KLF8, NFKBIZ, CARF, EBF3, HMX3, LHX4, LMX1A, PLAG1, PLAGL1, POU2F3, SOX14, TFAP2D, and WT1, or a regulatory element thereof. (1) Zinc Finger Protein [000109] A zinc finger protein is a protein that includes one or more zinc finger domains. Zinc finger domains are relatively small protein motifs that contain multiple finger-like protrusions that make tandem contacts with their target molecule such as a DNA target molecule. A zinc finger domain may bind one or more zinc ions or other metal ion such as iron, or in some cases a zinc finger domain forms salt bridges to stabilize the finger-like folds. The zinc binding portion of a zinc finger protein may include one or more cysteine residues and / or one or more histidine residues to coordinate the zinc or other metal ion. A zinc finger protein recognizes and binds to a particular DNA sequence via the zinc finger domain. In some embodiments, a zinc finger protein is fused to or includes a nuclease domain and may be referred to as a zinc finger nuclease (ZFN). The nuclease domain may include, for example, the endonuclease FokI. ZFNs may recognize target sites that consist of two zinc-finger binding sites that flank a 5- to 7-base pair (bp) spacer sequence recognized by the endonuclease FokI cleavage domain. (2) Transcription Activator-like Effector (TALE) [000110] A TALE is another type of protein that recognizes and binds to a particular DNA sequence. The DNA-binding domain of a TALE includes an array of tandem 33-35 amino acid repeats, also known as RVD modules. Each RVD module specifically recognizes a single base pair of DNA. RVD modules may be arranged in any order to assemble an array that recognizes a defined DNA sequence. The binding specificity of a TALE DNA-binding domain is determined by the RVD array followed by a single truncated repeat of, for example, 20 amino acids. A TALE DNA-binding domain may have an array of 12 to 27 RVD modules, each RVD module recognizing a single base pair of DNA. Specific RVDs have been identified that recognize each of the four possible DNA nucleotides (A, T, C, and G). Because the TALE DNA-binding domains are modular, repeats that recognize the four different DNA nucleotides may be linked together to recognize any particular DNA sequence.These targeted DNA-binding domains may then be combined with catalytic domains to create functional enzymes, including artificial transcription factors and / or nucleases. In some embodiments, a TALE is fused to or includes a nuclease domain and may be referred to as a TALE nuclease (TALEN). The nuclease domain may include, for example, the endonuclease FokI. TALENs may recognize target sites that consist of two TALE DNA- binding sites that flank a 12-bp to 20-bp spacer sequence recognized by the FokI cleavage domain. (3) DNA Binding Fusion Protein [000111] Additionally or alternatively, a zinc finger protein or TALE can be fused to a polypeptide domain and referred to as a DNA binding fusion protein or fusion protein. The fusion protein may act as a synthetic transcription factor. The fusion protein comprises two heterologous polypeptide domains, including a first polypeptide domain comprising the zinc finger protein or the TALE or a Cas9 protein as further detailed below, and a second polypeptide domain having an activity selected from transcription activation activity, transcription repression activity, nuclease activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methylase activity, and demethylase activity. A zinc finger protein or TALE can be fused to a polypeptide domain having epigenetic modifying activity to mediate targeted gene regulation. A fusion protein comprising a zinc finger protein or TALE, and a second polypeptide domain having transcription repression activity, may mediate targeted gene repression. A fusion protein comprising a zinc finger protein or TALE, and a second polypeptide domain having transcription activation activity, may mediate targeted gene activation. The second polypeptide domain is further detailed below (see “Cas Fusion Protein”). ii) CRISPR / Cas-based Gene Editing System [000112] Provided herein are CRISPR / Cas9-based gene editing systems. The CRISPR / Cas-based gene editing system may be used to modulate expression of a mechanoenhancer. The CRISPR / Cas-based gene editing system may include a Cas protein or a fusion protein, and at least one gRNA, and may also be referred to as a “CRISPR-Cas system.” [000113] “Clustered Regularly Interspaced Short Palindromic Repeats” and “CRISPRs”, as used interchangeably herein, refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea. The CRISPR system is a microbial nuclease system involved in defense againstinvading phages and plasmids that provides a form of acquired immunity. The CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes as well as non- coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage. Short segments of foreign DNA, called spacers, are incorporated into the genome between CRISPR repeats, and serve as a “memory” of past exposures. Cas proteins include, for example, Cas12a, Cas9, and Cascade proteins. Cas12a may also be referred to as “Cpf1.” Cas12a causes a staggered cut in double stranded DNA, while Cas9 produces a blunt cut. In some embodiments, the Cas protein comprises Cas12a. In some embodiments, the Cas protein comprises Cas9. Cas9 forms a complex with the 3’ end of the sgRNA (which may be referred interchangeably herein as “gRNA”), and the protein-RNA pair recognizes its genomic target by complementary base pairing between the 5’ end of the gRNA sequence and a predefined 20 bp DNA sequence, known as the protospacer. This complex is directed to homologous loci of pathogen DNA via regions encoded within the crRNA, i.e., the protospacers, and protospacer-adjacent motifs (PAMs) within the pathogen genome. The non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct Cas nucleases to the target site (protospacer). By simply exchanging the 20 bp recognition sequence of the expressed gRNA, the Cas9 nuclease can be directed to new genomic targets. CRISPR spacers are used to recognize and silence exogenous genetic elements in a manner analogous to RNAi in eukaryotic organisms. [000114] Three classes of CRISPR systems (Types I, II, and III effector systems) are known. The Type II effector system carries out targeted DNA double-strand break in four sequential steps, using a single effector enzyme, Cas9, to cleave dsDNA. Compared to the Type I and Type III effector systems, which require multiple distinct effectors acting as a complex, the Type II effector system may function in alternative contexts such as eukaryotic cells. The Type II effector system consists of a long pre‐crRNA, which is transcribed from the spacer‐containing CRISPR locus, the Cas9 protein, and a tracrRNA, which is involved in pre-crRNA processing. The tracrRNAs hybridize to the repeat regions separating the spacers of the pre‐crRNA, thus initiating dsRNA cleavage by endogenous RNase III. This cleavage is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9, forming a Cas9:crRNA- tracrRNA complex. Cas12a systems include crRNA for successful targeting, whereas Cas9 systems include both crRNA and tracrRNA. [000115] The Cas9:crRNA-tracrRNA complex unwinds the DNA duplex and searches for sequences matching the crRNA to cleave. Target recognition occurs upon detection ofcomplementarity between a “protospacer” sequence in the target DNA and the remaining spacer sequence in the crRNA. Cas9 mediates cleavage of target DNA if a correct protospacer-adjacent motif (PAM) is also present at the 3’ end of the protospacer. For protospacer targeting, the sequence must be immediately followed by the protospacer- adjacent motif (PAM), a short sequence recognized by the Cas9 nuclease that is required for DNA cleavage. Different Cas and Cas Type II systems have differing PAM requirements. For example, Cas12a may function with PAM sequences rich in thymine “T.” [000116] An engineered form of the Type II effector system of S. pyogenes was shown to function in human cells for genome engineering. In this system, the Cas9 protein was directed to genomic target sites by a synthetically reconstituted “guide RNA” (“gRNA”, also used interchangeably herein as a chimeric single guide RNA (“sgRNA”)), which is a crRNA- tracrRNA fusion that obviates the need for RNase III and crRNA processing in general. Provided herein are CRISPR / Cas9-based engineered systems for use in gene editing and treating genetic diseases. The CRISPR / Cas9-based engineered systems can be designed to target any gene, including genes involved in, for example, a genetic disease, aging, tissue regeneration, or wound healing. The CRISPR / Cas9-based gene editing system can include a Cas9 protein or a Cas9 fusion protein. b. Cas9 Protein [000117] Cas9 protein is an endonuclease that cleaves nucleic acid and is encoded by the CRISPR loci and is involved in the Type II CRISPR system. The Cas9 protein can be from any bacterial or archaea species, including, but not limited to, Streptococcus pyogenes, Staphylococcus aureus (S. aureus), Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida,Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp., or Verminephrobacter eiseniae. In certain embodiments, the Cas9 molecule is a Streptococcus pyogenes Cas9 molecule (also referred herein as “SpCas9”). SpCas9 may comprise an amino acid sequence of SEQ ID NO: 26. In certain embodiments, the Cas9 molecule is a Staphylococcus aureus Cas9 molecule (also referred herein as “SaCas9”). SaCas9 may comprise an amino acid sequence of SEQ ID NO: 27. [000118] A Cas9 molecule or a Cas9 fusion protein can interact with one or more gRNA molecule(s) and, in concert with the gRNA molecule(s), can localize to a site which comprises a target domain, and in certain embodiments, a PAM sequence. The Cas9 protein forms a complex with the 3’ end of a gRNA. The ability of a Cas9 molecule or a Cas9 fusion protein to recognize a PAM sequence can be determined, for example, by using a transformation assay as known in the art. [000119] The specificity of the CRISPR-based system may depend on two factors: the target sequence and the protospacer-adjacent motif (PAM). The target sequence is located on the 5’ end of the gRNA and is designed to bond with base pairs on the host DNA at the correct DNA sequence known as the protospacer. By simply exchanging the recognition sequence of the gRNA, the Cas9 protein can be directed to new genomic targets. The PAM sequence is located on the DNA to be altered and is recognized by a Cas9 protein. PAM recognition sequences of the Cas9 protein can be species specific. [000120] In certain embodiments, the ability of a Cas9 molecule or a Cas9 fusion protein to interact with and cleave a target nucleic acid is PAM sequence dependent. A PAM sequence is a sequence in the target nucleic acid. In certain embodiments, cleavage of the target nucleic acid occurs upstream from the PAM sequence. Cas9 molecules from different bacterial species can recognize different sequence motifs (for example, PAM sequences). A Cas9 molecule of S. pyogenes may recognize the PAM sequence of NRG (5’-NRG-3’, where R is any nucleotide residue, and in some embodiments, R is either A or G, SEQ ID NO: 1). In certain embodiments, a Cas9 molecule of S. pyogenes may naturally prefer and recognize the sequence motif NGG (SEQ ID NO: 2) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from that sequence. In some embodiments, a Cas9 molecule of S. pyogenes accepts other PAM sequences, such as NAG (SEQ ID NO: 3) in engineered systems (Hsu et al., Nature Biotechnology 2013 doi:10.1038 / nbt.2647). In certain embodiments, a Cas9 molecule of S. thermophilus recognizes the sequence motif NGGNG (SEQ ID NO: 4) and / or NNAGAAW (W = A or T)(SEQ ID NO: 5) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from these sequences. In certain embodiments, a Cas9 molecule of S. mutans recognizes the sequence motif NGG (SEQ ID NO: 2) and / or NAAR (R = A or G) (SEQ ID NO: 6) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp, upstream from this sequence. In certain embodiments, a Cas9 molecule of S. aureus recognizes the sequence motif NNGRR (R = A or G) (SEQ ID NO: 7) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from that sequence. In certain embodiments, a Cas9 molecule of S. aureus recognizes the sequence motif NNGRRN (R = A or G) (SEQ ID NO: 8) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from that sequence. In certain embodiments, a Cas9 molecule of S. aureus recognizes the sequence motif NNGRRT (R = A or G) (SEQ ID NO: 9) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from that sequence. In certain embodiments, a Cas9 molecule of S. aureus recognizes the sequence motif NNGRRV (R = A or G; V = A or C or G) (SEQ ID NO: 10) and directs cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from that sequence. A Cas9 molecule derived from Neisseria meningitidis (NmCas9) normally has a native PAM of NNNNGATT (SEQ ID NO: 11), but may have activity across a variety of PAMs, including a highly degenerate NNNNGNNN PAM (SEQ ID NO: 12) (Esvelt et al. Nature Methods 2013 doi:10.1038 / nmeth.2681). In the aforementioned embodiments, N can be any nucleotide residue, for example, any of A, G, C, or T. Cas9 molecules can be engineered to alter the PAM specificity of the Cas9 molecule. [000121] In some embodiments, the Cas9 protein recognizes a PAM sequence NGG (SEQ ID NO: 2) or NGA (SEQ ID NO: 13) or NNNRRT (R = A or G) (SEQ ID NO: 14) or ATTCCT (SEQ ID NO: 15) or NGAN (SEQ ID NO: 16) or NGNG (SEQ ID NO: 17). In some embodiments, the Cas9 protein is a Cas9 protein of S. aureus and recognizes the sequence motif NNGRR (R = A or G) (SEQ ID NO: 7), NNGRRN (R = A or G) (SEQ ID NO: 8), NNGRRT (R = A or G) (SEQ ID NO: 9), or NNGRRV (R = A or G; V = A or C or G) (SEQ ID NO: 10). In the aforementioned embodiments, N can be any nucleotide residue, for example, any of A, G, C, or T. [000122] Additionally or alternatively, a nucleic acid encoding a Cas9 molecule or Cas9 polypeptide may comprise a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art, for example, SV40 NLS (Pro-Lys-Lys-Lys-Arg-Lys-Val; SEQ ID NO: 20).[000123] In some embodiments, the at least one Cas9 molecule is a mutant Cas9 molecule. The Cas9 protein can be mutated so that the nuclease activity is inactivated. An inactivated Cas9 protein (“iCas9”, also referred to as “dCas9”) with no endonuclease activity has been targeted to genes in bacteria, yeast, and human cells by gRNAs to silence gene expression through steric hindrance. Exemplary mutations with reference to the S. pyogenes Cas9 sequence to inactivate the nuclease activity include: D10A, E762A, H840A, N854A, N863A and / or D986A. A S. pyogenes Cas9 protein with the D10A mutation may comprise an amino acid sequence of SEQ ID NO: 28. A S. pyogenes Cas9 protein with D10A and H840A mutations may comprise an amino acid sequence of SEQ ID NO: 29. Exemplary mutations with reference to the S. aureus Cas9 sequence to inactivate the nuclease activity include D10A and N580A. In certain embodiments, the mutant S. aureus Cas9 molecule comprises a D10A mutation. The nucleotide sequence encoding this mutant S. aureus Cas9 is set forth in SEQ ID NO: 30. In certain embodiments, the mutant S. aureus Cas9 molecule comprises a N580A mutation. The nucleotide sequence encoding this mutant S. aureus Cas9 molecule is set forth in SEQ ID NO: 31. [000124] In some embodiments, the Cas9 protein is a VQR variant. The VQR variant of Cas9 is a mutant with a different PAM recognition, as detailed in Kleinstiver, et al. (Nature 2015, 523, 481–485, incorporated herein by reference). [000125] A polynucleotide encoding a Cas9 molecule can be a synthetic polynucleotide. For example, the synthetic polynucleotide can be chemically modified. The synthetic polynucleotide can be codon optimized, for example, at least one non-common codon or less-common codon has been replaced by a common codon. For example, the synthetic polynucleotide can direct the synthesis of an optimized messenger mRNA, for example, optimized for expression in a mammalian expression system, as described herein. An exemplary codon optimized nucleic acid sequence encoding a Cas9 molecule of S. pyogenes is set forth in SEQ ID NO: 32. Exemplary codon optimized nucleic acid sequences encoding a Cas9 molecule of S. aureus, and optionally containing nuclear localization sequences (NLSs), are set forth in SEQ ID NOs: 33-39. Another exemplary codon optimized nucleic acid sequence encoding a Cas9 molecule of S. aureus comprises the nucleotides 1293-4451 of SEQ ID NO: 40. c. Cas Fusion Protein [000126] Alternatively or additionally, the CRISPR / Cas-based gene editing system can include a fusion protein. The fusion protein can comprise two heterologous polypeptide domains. The first polypeptide domain comprises a Cas protein or a mutated Cas protein.The first polypeptide domain is fused to at least one second polypeptide domain. The second polypeptide domain has a different activity that what is endogenous to Cas protein. For example, the second polypeptide domain may have an activity such as transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, histone methylase activity, DNA methylase activity, histone demethylase activity, DNA demethylase activity, acetylation activity, and / or deacetylation activity. The activity of the second polypeptide domain may be direct or indirect. The second polypeptide domain may have this activity itself (direct), or it may recruit and / or interact with a polypeptide domain that has this activity (indirect). In some embodiments, the second polypeptide domain has transcription activation activity. In some embodiments, the second polypeptide domain has transcription repression activity. In some embodiments, the second polypeptide domain comprises a synthetic transcription factor. The second polypeptide domain may be at the C- terminal end of the first polypeptide domain, or at the N-terminal end of the first polypeptide domain, or a combination thereof. The fusion protein may include one second polypeptide domain. In some embodiments, the fusion protein comprises more than one second polypeptide domain. The fusion protein may include two of the second polypeptide domains. For example, the fusion protein may include a second polypeptide domain at the N-terminal end of the first polypeptide domain as well as a second polypeptide domain at the C-terminal end of the first polypeptide domain. In other embodiments, the fusion protein may include a single first polypeptide domain and more than one (for example, two or three) second polypeptide domains in tandem. [000127] The linkage from the first polypeptide domain to the second polypeptide domain can be through reversible or irreversible covalent linkage or through a non-covalent linkage, as long as the linker does not interfere with the function of the second polypeptide domain. For example, a Cas polypeptide can be linked to a second polypeptide domain as part of a fusion protein. As another example, they can be linked through reversible non-covalent interactions such as avidin (or streptavidin)-biotin interaction, histidine-divalent metal ion interaction (such as, Ni, Co, Cu, Fe), interactions between multimerization (such as, dimerization) domains, or glutathione S-transferase (GST)-glutathione interaction. As yet another example, they can be linked covalently but reversibly with linkers such as dibromomaleimide (DBM) or amino-thiol conjugation. [000128] In some embodiments, the fusion protein includes at least one linker. A linker may be included anywhere in the polypeptide sequence of the fusion protein, for example, between the first and second polypeptide domains. A linker may be of any length anddesign to promote or restrict the mobility of components in the fusion protein. A linker may comprise any amino acid sequence of about 2 to about 100, about 5 to about 80, about 10 to about 60, or about 20 to about 50 amino acids. A linker may comprise an amino acid sequence of at least about 2, 3, 4, 5, 10, 15, 20, 25, or 30 amino acids. A linker may comprise an amino acid sequence of less than about 100, 90, 80, 70, 60, 50, or 40 amino acids. A linker may include sequential or tandem repeats of an amino acid sequence that is 2 to 20 amino acids in length. Linkers may include, for example, a GS linker (Gly-Gly-Gly-Gly-Ser)n, wherein n is an integer between 0 and 10 (SEQ ID NO: 21). In a GS linker, n canbe adjusted to optimize the linker length and achieve appropriate separation of the functional domains. Other examples of linkers may include, for example, Gly-Gly-Gly-Gly-Gly (SEQ ID NO: 22), Gly-Gly-Ala-Gly-Gly (SEQ ID NO: 23), Gly / Ser rich linkers such as Gly-Gly-Gly-Gly- Ser-Ser-Ser (SEQ ID NO: 24), or Gly / Ala rich linkers such as Gly-Gly-Gly-Gly-Ala-Ala-Ala (SEQ ID NO: 25). [000129] In some embodiments, the Cas protein and / or the Cas fusion protein and / or gRNAs detailed herein may be used in compositions and methods for modulating expression of gene. Modulating may include, for example, increasing or enhancing expression of the gene, or reducing or inhibiting expression of the gene. The expression of the gene may be modulated by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7- fold, 8-fold, 9-fold, or 10-fold, relative to a control. The expression of the gene may be modulated by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7- fold, 8-fold, 9-fold, or 10-fold, relative to a control. The expression of the gene may be modulated by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control. The expression of the gene may be reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5- fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. The expression of the gene may be reduced by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. The expression of the gene may be reduced by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5- fold to 10-fold, relative to a control. The expression of the gene may be increased by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. The expression of the gene may be increased by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control. The expression of the gene may be increased by about 5-95%, 10- 90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control. i) Transcription Activation Activity [000130] The second polypeptide domain can have transcription activation activity, for example, a transactivation domain. For example, gene expression of endogenous mammalian genes, such as human genes, can be achieved by targeting a fusion protein of a first polypeptide domain, such as dCas9, and a transactivation domain to mammalian promoters via combinations of gRNAs. The transactivation domain can include a VP16 protein, multiple VP16 proteins, such as a VP48 domain or VP64 domain, p65 domain of NF kappa B transcription activator activity, TET1, VPR, VPH, Rta, and / or p300. For example, the fusion protein may comprise dCas9-p300. In some embodiments, p300 comprises a polypeptide having the amino acid sequence of SEQ ID NO: 41 or SEQ ID NO: 42. In other embodiments, the fusion protein comprises dCas9-VP64. In other embodiments, the fusion protein comprises VP64-dCas9-VP64. VP64-dCas9-VP64 may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 43, encoded by the polynucleotide of SEQ ID NO: 44. VPH may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 53, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 54. VPR may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 55, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 56. ii) Transcription Repression Activity [000131] The second polypeptide domain can have transcription repression activity. Non- limiting examples of repressors include Kruppel associated box activity such as a KRAB domain or KRAB, MECP2, EED, ERF repressor domain (ERD), Mad mSIN3 interaction domain (SID) or Mad-SID repressor domain, SID4X repressor domain, Mxil repressor domain, SUV39H1, SUV39H2, G9A, ESET / SETBD1, Cir4, Su(var)3-9, Pr-SET7 / 8, SUV4- 20H1, PR-set7, Suv4-20, Set9, EZH2, RIZ1, JMJD2A / JHDM3A, JMJD2B, JMJ2D2C / GASC1, JMJD2D, Rph1, JARID1A / RBP2, JARID1B / PLU-1, JARID1C / SMCX, JARID1D / SMCY, Lid, Jhn2, Jmj2, HDAC1, HDAC2, HDAC3, HDAC8, Rpd3, Hos1, Cir6, HDAC4, HDAC5, HDAC7, HDAC9, Hda1, Cir3, SIRT1, SIRT2, Sir2, Hst1, Hst2, Hst3, Hst4, HDAC11, DNMT1, DNMT3a / 3b, DNMT3A-3L, MET1, DRM3, ZMET2, CMT1, CMT2, Laminin A, Laminin B, CTCF, and / or a domain having TATA box binding protein activity, or a combination thereof. In some embodiments, the second polypeptide domain has a KRAB domain activity, ERF repressor domain activity, Mxil repressor domain activity, SID4Xrepressor domain activity, Mad-SID repressor domain activity, DNMT3A or DNMT3L or fusion thereof activity, LSD1 histone demethylase activity, or TATA box binding protein activity. In some embodiments, the polypeptide domain comprises KRAB. KRAB may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 45, encoded by polynucleotide comprising the sequence of SEQ ID NO: 46. For example, the fusion protein may be S. pyogenes dCas9-KRAB (protein sequence comprising SEQ ID NO: 47; polynucleotide sequence comprising SEQ ID NO: 48). The fusion protein may be S. aureus dCas9-KRAB (protein sequence comprising SEQ ID NO: 49; polynucleotide sequence comprising SEQ ID NO: 50). iii) Transcription Release Factor Activity [000132] The second polypeptide domain can have transcription release factor activity. The second polypeptide domain can have eukaryotic release factor 1 (ERF1) activity or eukaryotic release factor 3 (ERF3) activity. iv) Histone Modification Activity [000133] The second polypeptide domain can have histone modification activity. The second polypeptide domain can have histone deacetylase, histone acetyltransferase, histone demethylase, or histone methyltransferase activity. The histone acetyltransferase may be p300 or CREB-binding protein (CBP) protein, or fragments thereof. For example, the fusion protein may be dCas9-p300. In some embodiments, p300 comprises a polypeptide of SEQ ID NO: 41 or SEQ ID NO: 42. v) Nuclease Activity [000134] The second polypeptide domain can have nuclease activity that is different from the nuclease activity of the Cas9 protein. A nuclease, or a protein having nuclease activity, is an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acids. Nucleases are usually further divided into endonucleases and exonucleases, although some of the enzymes may fall in both categories. Well known nucleases include deoxyribonuclease and ribonuclease. In some embodiments, the second polypeptide domain includes a meganuclease, as detailed above. In some embodiments, the polypeptide domain having nuclease activity comprises FokI. vi) Nucleic Acid Association Activity [000135] The second polypeptide domain can have nucleic acid association activity or nucleic acid binding protein-DNA-binding domain (DBD). A DBD is an independently foldedprotein domain that contains at least one motif that recognizes double- or single-stranded DNA. A DBD can recognize a specific DNA sequence (a recognition sequence) or have a general affinity to DNA. A nucleic acid association region may be selected from helix-turn- helix region, leucine zipper region, winged helix region, winged helix-turn-helix region, helix- loop-helix region, immunoglobulin fold, B3 domain, Zinc finger, HMG-box, Wor3 domain, and TAL effector DNA-binding domain. vii) Base Editing Activity [000136] The second polypeptide domain may have base editing activity. Base editing enables the direct, irreversible conversion of a specific DNA base into another base at a targeted genomic locus without requiring double-stranded DNA breaks (DSB). A base editing domain has sequence requirements for activity. In a 20 nucleotide protospacer, the target base may be within 4-8 nucleotides from the PAM-distal end. An exemplary splice acceptor is an “AG” immediately before the exon, and an exemplary splice donor is a “GT” immediately following the exon. Cas9 molecules from different species may use different PAMs, and thereby provide some flexibility in selecting the base to edit. Disruption of canonical splice sites can lead to exon skipping or activation of cryptic splice sites. Both adenine and cytosine base editors may be capable of disrupting an “AG” splice acceptor, converting it to either a “GG” or “AA”, respectively. In some embodiments, the base-editing domain includes an adenine base editor (ABE). Adenine base editors may include, for example, ecTadA, including wild-type and mutants thereof. The adenine base editor may be as described in Gaudelli et al. (Nature 2017, 551, 464–471), Koblan et al. (Nature Biotech. 2018, 36, 843–846), Richter et al. (Nature Biotech.2020, 38, 883–891), and Gaudelli et al. (Nature Biotech.2020, 38, 892–900), each of which is incorporated herein by reference. The ABE may comprise a polypeptide selected from SEQ ID NOs: 57-64 and / or be encoded by a polynucleotide comprising a sequence selected from SEQ ID NOs: 65-72, respectively. In some embodiments, the base-editing domain includes a cytidine deaminase domain. A cytidine deaminase domain can convert the DNA base cytosine to uracil. In some embodiments, the cytidine deaminase domain can include an apolipoprotein B mRNA- editing enzyme, catalytic polypeptide-like (APOBEC) family deaminase. In some embodiments, the cytidine deaminase domain can include an APOBEC 1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or a combination thereof. Base editing domains are detailed in, for example, WO 2020 / 210776 and WO 2022 / 081612, each of which is incorporated herein by reference.viii) Methylase Activity [000137] The second polypeptide domain can have methylase activity, which involves transferring a methyl group to DNA, RNA, protein, small molecule, cytosine, or adenine. In some embodiments, the second polypeptide domain includes a DNA methyltransferase. ix) Demethylase Activity [000138] The second polypeptide domain can have demethylase activity. The second polypeptide domain can include an enzyme that removes methyl (CH3-) groups from nucleic acids, proteins (in particular histones), and other molecules. Alternatively, the second polypeptide can convert the methyl group to hydroxymethylcytosine in a mechanism for demethylating DNA. The second polypeptide can catalyze this reaction. For example, the second polypeptide that catalyzes this reaction can be Tet1, also known as Tet1CD (Ten- eleven translocation methylcytosine dioxygenase 1; amino acid sequence comprising SEQ ID NO: 51; polynucleotide sequence comprising SEQ ID NO: 52). In some embodiments, the second polypeptide domain has histone demethylase activity. In some embodiments, the second polypeptide domain has DNA demethylase activity. d. Guide RNA (gRNA) [000139] The CRISPR / Cas-based gene editing system includes at least one gRNA molecule. For example, the CRISPR / Cas-based gene editing system may include two gRNA molecules. The at least one gRNA molecule can bind and recognize a target region. The gRNA is the part of the CRISPR-Cas system that provides DNA targeting specificity to the CRISPR / Cas-based gene editing system. The gRNA is a fusion of two noncoding RNAs: a crRNA and a tracrRNA. gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in the Type II Effector system. This duplex, which may include, for example, a 42- nucleotide crRNA and a 75-nucleotide tracrRNA, acts as a guide for the Cas9 to bind, and in some cases, cleave the target nucleic acid. The gRNA may target any desired DNA sequence by exchanging the sequence encoding a 20 bp protospacer which confers targeting specificity through complementary base pairing with the desired DNA target. The “target region” or “target sequence” or “protospacer” refers to the region of the target gene to which the CRISPR / Cas9-based gene editing system targets and binds. The portion of the gRNA that targets the target sequence in the genome may be referred to as the “targeting sequence” or “targeting portion” or “targeting domain.” “Protospacer” or “gRNA spacer” may refer to the region of the target gene to which the CRISPR / Cas9-based gene editing system targets and binds; “protospacer” or “gRNA spacer” may also refer to the portion of the gRNAthat is complementary to the targeted sequence in the genome. The gRNA may include a gRNA scaffold. A gRNA scaffold facilitates Cas9 binding to the gRNA and may facilitate endonuclease activity. The gRNA scaffold is a polynucleotide sequence that follows the portion of the gRNA corresponding to sequence that the gRNA targets. Together, the gRNA targeting portion and gRNA scaffold form one polynucleotide. The constant region of the gRNA may include the sequence of SEQ ID NO: 19 (RNA), which is encoded by a sequence comprising SEQ ID NO: 18 (DNA). The CRISPR / Cas9-based gene editing system may include at least one gRNA, wherein the gRNAs target different DNA sequences. The target DNA sequences may be overlapping. The gRNA may comprise at its 5’ end the targeting domain that is sufficiently complementary to the target region to be able to hybridize to, for example, about 10 to about 20 nucleotides of the target region of the target gene, when it is followed by an appropriate Protospacer Adjacent Motif (PAM). The target region or protospacer is followed by a PAM sequence at the 3’ end of the protospacer in the genome. Different Type II systems have differing PAM requirements, as detailed above. [000140] The targeting domain of the gRNA does not need to be perfectly complementary to the target region of the target DNA. In some embodiments, the targeting domain of the gRNA is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% complementary to (or has 1, 2 or 3 mismatches compared to) the target region over a length of, such as, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. For example, the DNA-targeting domain of the gRNA may be at least 80% complementary over at least 18 nucleotides of the target region. The target region may be on either strand of the target DNA. [000141] The gRNA may target the Cas9 protein or fusion protein to a gene or a regulatory element thereof. The gRNA may target the Cas protein or fusion protein to a non-open chromatin region, an open chromatin region, a transcribed region of the target gene, a region upstream of a transcription start site of the target gene, a regulatory element of the target gene, an intron of the target gene, or an exon of the target gene, or a combination thereof. In some embodiments, the gRNA targets the Cas9 protein or fusion protein to a promoter of a gene. In some embodiments, the target region is located between about 1 to about 1000 base pairs upstream of a transcription start site of a target gene. In some embodiments, the DNA targeting composition comprises two or more gRNAs, each gRNA binding to a different target region. [000142] The gRNA may target a region of a gene encoding a mechanoenhancer. The gRNA may target a region of a gene selected from those listed in TABLE 14, or a combination thereof, or a regulatory element thereof. In some embodiments, the gRNA targets a gene and is used in combination with a Cas9 fusion protein wherein the secondpolypeptide domain has transcription repression activity, to inhibit or reduce or decrease expression of the gene to increase T cells. The gRNA may comprise a polynucleotide selected from at least one of SEQ ID NOs: 442-826, or a complement thereof, or a variant thereof, or a truncation thereof. The gRNA may be encoded by a polynucleotide sequence comprising at least one of SEQ ID NOs: 57-441, or a complement thereof, or a variant thereof, or a truncation thereof. The gRNA may bind and target a polynucleotide sequence comprising at least one of SEQ ID NOs: 57-441, or a complement thereof, or a variant thereof, or a truncation thereof. A truncation may be 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides shorter than the sequence of SEQ ID NOs: 57-826. The gRNA may be used, for example, in a CRISPR / Cas-based gene editing system with dCas9, such as a fusion protein comprising dCas9 with KRAB. Exemplary mechanoenahncer genes and gRNA sequences and chromosome regions (putative regulatory regiongs) for targeting the mechanoenhancers include those shown in TABLE 14.TABL Ge ne LIN C02 613 RMDN 2- AS1 PPI P5K 2 PPI P5K 2 GIN 1 CO L3A 1 PM S1 CO L5A 2 ORMD L1 FA M9 8B RASGRP1 52RA SGRP 1 TLE 4 OSBP FA M11 1B ST X3 SN U13 SN U13 SN U13 SN U13 SN U13 TC F20 CSDC 2 SN U13 POLDI P3 IGF BP3 IGFBP3 46145845 53IGF BP3 IGF BP3 IGF BP3 IGF BP3 IGF BP3 IGF BP3 IGF BP3 PTPRM PTPRM PTPRM PTPRM PTPRM RASGRP 1 SPRED1 54FA M9 8B RASGRP 1 FA M9 8B RASGRP 1 FA M9 8B RASGRP 1 RASGRP 1 FA M9 8B RASGRP 1 TEAD 3 ANKS1A 55KC TD2 0 TEAD 3 FKBP5 UHRF1 BP1 SCUB E3 BRPF3 TEAD 3 TEAD 3 UHRF1 BP1 LHF PL5 TAF 11 TEAD 3 ANKS1 A SCD5 A A 82745915 56SC D5 HELQ TG M2 TG M2 TG M2 TG M2 TG M2 RANGAP1 ZC3 H7 B RANGAP1 ZC3 H7 B RANGAP1 ZC3 H7 B RANGAP1 ZC3 H7B 57ZC3 H7 B MR TFA RANGAP1 INS YN 2B INS YN 2B INS YN 2B INS YN 2B INS YN 2B INS YN 2B INS YN 2B INS YN 2B INS YN 2B SPDL1 G 169971676 58SH 2D4 A SH 2D4 A SH 2D4 A SH 2D4 A SH 2D4 A SH 2D4 A INT S10 SH 2D4 A SH 2D4 A TSEN 15 NIB AN 1 NMNA T2 TSEN15 59TS EN 15 TSEN 15 TSEN 15 TSEN 15 SK P2 SK P2 SK P2 SK P2 SK P2 SK P2 SK P2 SK P2 SK P2 SK P2 PU S7 HOXA11 60HO XA1 0- AS HOXA1 1 HIB ADH JAZ F1 MLST8 ZN F26 3 ZSCA N32 DNAS E1 IL3 2 TEDC 2 ZN F17 4 FLYWC H1 PAQR4 61TB C1 D24 KCTD5 TRAF7 NA A60 TIG D7 ADCY 9 E4F 1 ZN F21 3- AS1 ZN F21 3 ZN F20 5 CLUA P1 SLX 4 PGP ZN F20 0 ELOB U 3172694 62ER VK1 3-1 ZN F21 3- AS1 SLX 4 TEDC 2 E4F 1 PKMY T1 MM P25 - AS1 CCNF ZN F21 3- AS1 AMDH D2 ZN F20 5 KCTD5 THOC6 63ZN F20 0 PAQR 4 ZN F17 4 ADCY 9 PDPK1 ZN F26 3 DNAS E1 PGP LIN C01 133 RBMS 3 TGFB R2 RBMS 3 RBMS 3-AS3 64GR AM D2 B GRAM D2 B GRAM D2 B GRAM D2 B ALDH 7A1 GRAM D2 B GRAM D2 B ALDH 7A1 GRAM D2 B TLE 4 TLE4 0 A 79015240 65CC N1 DDAH 1 SYDE 2 C1o rf52 BC L10 OD F2L CC N1 CC N1 DDAH 1 ZNHIT 6 CC N1 DDAH 1 C1o rf52 SYDE 2 CC N1 CCN1 A 85581149 66CC N1 ZNHIT 6 DDAH 1 BC L10 CC N1 DDAH 1 ZNHIT 6 SYDE 2 CO L24 A1 CC N1 ADAR B1 ADAR B1 ADAR B1 ADARB1 67CH D6 IFI6 SESN 2 SRSF4 PP P1 R8 DNAJC 8 TAF 12 SRSF4 EP B41 SESN 2 IFI6 TRNA U1 AP RC C1 PP P1 R8 SRSF4 C 28649567 68SR SF4 DNAJC 8 EY A3 YTHD F2 LHF PL2 MY H9 MY H9 NR 6A1 TB C1 D2 B HM G20 A STA RD 5 GO LP H3 CO L6A 6 FEZ 2 FEZ2 U 36569188 69FEZ 2 NDUFAF7 STRN FEZ 2 HEAT R5 B FEZ 2 TT C28 BASP1 BASP1 BASP1 BASP1 BASP1 BASP1 BASP1 BASP1 BASP1 BASP1 17239174 70CC N1 LPA R3 PDI A6 RR M2 RR M2 AP H1 B CFAP9 7 CASP3 ANAP C4 ZCCH C4 ZCCH C4 HERC 4 SL C25 A16 SIK E1 NGF C 115496130 71NR G1 NR G1 NR G1 NR G1 NR G1 MGST1 C12 orf6 0 EP S8 MGP STRAP CC N2 CC N2 LIN C01 013 CC N2 CC N2 CC N2 CCN2 C 132085545 72CC N2 CC N2 CC N1 DDAH 1 DDAH 1 DDAH 1 DUSP4 NPHP 1 SOWAHC SH 3RF 3 SH 3RF 3 CCDC 138 MA LL SH 3RF3 73RA NB P2 SOWAHC MG LL TPRA 1 MG LL CHCH D6 MG LL MG LL MG LL RUVBL 1 ABTB1 MC M2 MG LL GATA2 GATA2 -AS1 74AB TB1 MG LL MG LL FLI 1 ET S1 PSTPI P2 C18 orf2 5 SEMA 3A KCNK 6 ACTN4 SIP A1L 3 ZN F52 7 ZN F56 9 DP F1 SARS2 75NF KBI B ZN F87 5 ZN F57 0 FBXO 27 YIF 1B FA M9 8C HNRNPL ZFP 30 RG P1 GA LT RUSC 2 TMEM 8B LIN C02 447 AFAP1 G G 7857935 76RFL NB VP S53 TLC D3 A RFL NB VP S53 RFL NB VP S53 C17 orf9 7 SCAR F1 RFL NB RFL NB RFL NB RFL NB RFL NB ABR GEMIN4 77RFL NB HPD TO R3 A LIN C00 632 ZKSCAN 8 PRDX 6 PRDX 6 PRDX 6 PRDX 6 PRDX 6 PRDX 6 TNFSF 4 GAS5 G 172956066 78PR DX 6 BMF BMF BMF GGGCCAGCATACCCCATATTGTAAGAGGGGAAACTGAGGCCAGGAAAGGCAAGCATAGTTATTGCAAGCGTAGTTATTCCCAGCCAG 79CTGGTATCTGCAACTCTCCCC (targeted chromosome region, SEQ ID NO: 867) 80[000143] As described above, the gRNA molecule comprises a targeting domain (also referred to as targeted or targeting sequence), which is a polynucleotide sequence complementary to the target DNA sequence. The gRNA may comprise a “G” at the 5’ end of the targeting domain or complementary polynucleotide sequence. The CRISPR / Cas9-based gene editing system may use gRNAs of varying sequences and lengths. The targeting domain of a gRNA molecule may comprise at least a 10 base pair, at least a 11 base pair, at least a 12 base pair, at least a 13 base pair, at least a 14 base pair, at least a 15 base pair, at least a 16 base pair, at least a 17 base pair, at least a 18 base pair, at least a 19 base pair, at least a 20 base pair, at least a 21 base pair, at least a 22 base pair, at least a 23 base pair, at least a 24 base pair, at least a 25 base pair, at least a 30 base pair, or at least a 35 base pair complementary polynucleotide sequence of the target DNA sequence followed by a PAM sequence. In certain embodiments, the targeting domain of a gRNA molecule has 19-25 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 20 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 21 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 22 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 23 nucleotides in length. [000144] The number of gRNA molecules that may be included in the CRISPR / Cas9-based gene editing system can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least 45 different gRNAs, or at least 50 different gRNAs. The number of gRNA molecules that may be included in the CRISPR / Cas9-based gene editing system can be less than 50 different gRNAs, less than 45 different gRNAs, less than 40 different gRNAs, less than 35 different gRNAs, less than 30 different gRNAs, less than 25 different gRNAs, less than 20 different gRNAs, less than 19 different gRNAs, less than 18 different gRNAs, less than 17 different gRNAs, less than 16 different gRNAs, less than 15 different gRNAs, less than 14 different gRNAs, less than 13 different gRNAs, less than 12 different gRNAs, less than 11 different gRNAs, less than 10 different gRNAs, less than 9 different gRNAs, less than 8 different gRNAs, less than 7 different gRNAs, less than 6 differentgRNAs, less than 5 different gRNAs, less than 4 different gRNAs, less than 3 different gRNAs, or less than 2 different gRNAs. The number of gRNAs that may be included in the CRISPR / Cas9-based gene editing system can be between at least 1 gRNA to at least 50 different gRNAs, at least 1 gRNA to at least 45 different gRNAs, at least 1 gRNA to at least 40 different gRNAs, at least 1 gRNA to at least 35 different gRNAs, at least 1 gRNA to at least 30 different gRNAs, at least 1 gRNA to at least 25 different gRNAs, at least 1 gRNA to at least 20 different gRNAs, at least 1 gRNA to at least 16 different gRNAs, at least 1 gRNA to at least 12 different gRNAs, at least 1 gRNA to at least 8 different gRNAs, at least 1 gRNA to at least 4 different gRNAs, at least 4 gRNAs to at least 50 different gRNAs, at least 4 different gRNAs to at least 45 different gRNAs, at least 4 different gRNAs to at least 40 different gRNAs, at least 4 different gRNAs to at least 35 different gRNAs, at least 4 different gRNAs to at least 30 different gRNAs, at least 4 different gRNAs to at least 25 different gRNAs, at least 4 different gRNAs to at least 20 different gRNAs, at least 4 different gRNAs to at least 16 different gRNAs, at least 4 different gRNAs to at least 12 different gRNAs, at least 4 different gRNAs to at least 8 different gRNAs, at least 8 different gRNAs to at least 50 different gRNAs, at least 8 different gRNAs to at least 45 different gRNAs, at least 8 different gRNAs to at least 40 different gRNAs, at least 8 different gRNAs to at least 35 different gRNAs, 8 different gRNAs to at least 30 different gRNAs, at least 8 different gRNAs to at least 25 different gRNAs, 8 different gRNAs to at least 20 different gRNAs, at least 8 different gRNAs to at least 16 different gRNAs, or 8 different gRNAs to at least 12 different gRNAs. e. Repair Pathways [000145] The CRISPR / Cas9-based gene editing system may be used to introduce site-specific double strand breaks at targeted genomic loci, such as a gene encoding a mechanoenhancer. Site-specific double-strand breaks are created when the CRISPR / Cas9-based gene editing system binds to a target DNA sequences, thereby permitting cleavage of the target DNA. This DNA cleavage may stimulate the natural DNA-repair machinery, leading to one of two possible repair pathways: homology-directed repair (HDR) or the non-homologous end joining (NHEJ) pathway. i) Homology-Directed Repair (HDR) [000146] Restoration of protein expression from a gene may involve homology-directed repair (HDR). A donor template may be administered to a cell. A donor sequence comprises apolynucleotide sequence to be inserted into a genome. The donor template may include a nucleotide sequence encoding a full-functional protein or a partially functional protein. In such embodiments, the donor template may include fully functional gene construct for restoring a mutant gene, or a fragment of the gene that after homology-directed repair, leads to restoration of the mutant gene. In other embodiments, the donor template may include a nucleotide sequence encoding a mutated version of an inhibitory regulatory element of a gene. Mutations may include, for example, nucleotide substitutions, insertions, deletions, or a combination thereof. In such embodiments, introduced mutation(s) into the inhibitory regulatory element of the gene may reduce the transcription of or binding to the inhibitory regulatory element. ii) Non-Homologous End Joining (NHEJ) [000147] Restoration of protein expression from gene may be through template-free NHEJ- mediated DNA repair. In certain embodiments, NHEJ is a nuclease mediated NHEJ, which in certain embodiments, refers to NHEJ that is initiated a Cas9 molecule that cuts double stranded DNA. The method comprises administering a presently disclosed CRISPR / Cas9-based gene editing system or a composition comprising thereof to a subject for gene editing. [000148] Nuclease mediated NHEJ may correct a mutated target gene and offer several potential advantages over the HDR pathway. For example, NHEJ does not require a donor template, which may cause nonspecific insertional mutagenesis. In contrast to HDR, NHEJ operates efficiently in all stages of the cell cycle and therefore may be effectively exploited in both cycling and post-mitotic cells, such as muscle fibers. This provides a robust, permanent gene restoration alternative to oligonucleotide-based exon skipping or pharmacologic forced read-through of stop codons and could theoretically require as few as one drug treatment. 4. Genetic Constructs [000149] The CRISPR / Cas9-based gene editing system may be encoded by or comprised within one or more genetic constructs. The CRISPR / Cas9-based gene editing system may comprise one or more genetic constructs. The genetic construct, such as a plasmid or expression vector, may comprise a nucleic acid that encodes the CRISPR / Cas9-based gene editing system and / or at least one of the gRNAs. In certain embodiments, a genetic construct encodes one gRNA molecule, i.e., a first gRNA molecule, and optionally a Cas9 molecule or fusion protein. In some embodiments, a genetic construct encodes two gRNA molecules, i.e., a first gRNA molecule and a second gRNA molecule, and optionally a Cas9 molecule or fusionprotein. In some embodiments, a first genetic construct encodes one gRNA molecule, i.e., a first gRNA molecule, and optionally a Cas9 molecule or fusion protein, and a second genetic construct encodes one gRNA molecule, i.e., a second gRNA molecule, and optionally a Cas9 molecule or fusion protein. In some embodiments, a first genetic construct encodes one gRNA molecule and one donor sequence, and a second genetic construct encodes a Cas9 molecule or fusion protein. In some embodiments, a first genetic construct encodes one gRNA molecule and a Cas9 molecule or fusion protein, and a second genetic construct encodes one donor sequence. [000150] Genetic constructs may include polynucleotides such as vectors and plasmids. The genetic construct may be a linear minichromosome including centromere, telomeres, or plasmids or cosmids. The vector may be an expression vectors or system to produce protein by routine techniques and readily available starting materials including Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989), which is incorporated fully by reference. The construct may be recombinant. The genetic construct may be part of a genome of a recombinant viral vector, including recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus associated virus. The genetic construct may comprise regulatory elements for gene expression of the coding sequences of the nucleic acid. The regulatory elements may be a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal. [000151] The genetic construct may comprise heterologous nucleic acid encoding the CRISPR / Cas-based gene editing system and may further comprise an initiation codon, which may be upstream of the CRISPR / Cas-based gene editing system coding sequence, and a stop codon, which may be downstream of the CRISPR / Cas-based gene editing system coding sequence. The genetic construct may include more than one stop codon, which may be downstream of the CRISPR / Cas-based gene editing system coding sequence. In some embodiments, the genetic construct includes 1, 2, 3, 4, or 5 stop codons. In some embodiments, the genetic construct includes 1, 2, 3, 4, or 5 stop codons downstream of the sequence encoding the donor sequence. A stop codon may be in-frame with a coding sequence in the CRISPR / Cas-based gene editing system. For example, one or more stop codons may be in-frame with the donor sequence. The genetic construct may include one or more stop codons that are out of frame of a coding sequence in the CRISPR / Cas-based gene editing system. For example, one stop codon may be in-frame with the donor sequence, and two other stop codons may be included that are in the other two possible reading frames. Agenetic construct may include a stop codon for all three potential reading frames. The initiation and termination codon may be in frame with the CRISPR / Cas-based gene editing system coding sequence. [000152] The vector may also comprise a promoter that is operably linked to the CRISPR / Cas- based gene editing system coding sequence. In some embodiments, the promoter is operably linked to a polynucleotide encoding a mechaoenhancer or a DNA targeting composition as detailed herein. The promoter may be a constitutive promoter, an inducible promoter, a repressible promoter, or a regulatable promoter. The promoter may be a ubiquitous promoter. The promoter may be a tissue-specific promoter. The tissue specific promoter may be a muscle specific promoter. The tissue specific promoter may be a skin specific promoter. The CRISPR / Cas-based gene editing system may be under the light-inducible or chemically inducible control to enable the dynamic control of gene / genome editing in space and time. The promoter operably linked to the CRISPR / Cas-based gene editing system coding sequence may be a promoter from simian virus 40 (SV40), a mouse mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter, Epstein Barr virus (EBV) promoter, or a Rous sarcoma virus (RSV) promoter. The promoter may also be a promoter from a human gene such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metalothionein. Examples of a tissue specific promoter, such as a muscle or skin specific promoter, natural or synthetic, are described in U.S. Patent Application Publication No. US20040175727, the contents of which are incorporated herein in its entirety. The promoter may be a CK8 promoter, a Spc512 promoter, a MHCK7 promoter, for example. [000153] The genetic construct may also comprise a polyadenylation signal, which may be downstream of the CRISPR / Cas-based gene editing system. The polyadenylation signal may be a SV40 polyadenylation signal, LTR polyadenylation signal, bovine growth hormone (bGH) polyadenylation signal, human growth hormone (hGH) polyadenylation signal, or human β- globin polyadenylation signal. The SV40 polyadenylation signal may be a polyadenylation signal from a pCEP4 vector (Invitrogen, San Diego, CA).[000154] Coding sequences in the genetic construct may be optimized for stability and high levels of expression. In some instances, codons are selected to reduce secondary structure formation of the RNA such as that formed due to intramolecular bonding. [000155] The genetic construct may also comprise an enhancer upstream of the CRISPR / Cas-based gene editing system or gRNAs. The enhancer may be necessary for DNA expression. The enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such as one from CMV, HA, RSV, or EBV. Polynucleotide function enhancers are described in U.S. Patent Nos.5,593,972, 5,962,428, and WO94 / 016737, the contents of each are fully incorporated by reference. The genetic construct may also comprise a mammalian origin of replication in order to maintain the vector extrachromosomally and produce multiple copies of the vector in a cell. The genetic construct may also comprise a regulatory sequence, which may be well suited for gene expression in a mammalian or human cell into which the vector is administered. The genetic construct may also comprise a reporter gene, such as green fluorescent protein (“GFP”) and / or a selectable marker, such as hygromycin (“Hygro”). [000156] The genetic construct may be useful for transfecting cells with nucleic acid encoding the CRISPR / Cas-based gene editing system, which the transformed host cell is cultured and maintained under conditions wherein expression of the CRISPR / Cas-based gene editing system takes place. The genetic construct may be transformed or transduced into a cell. The genetic construct may be formulated into any suitable type of delivery vehicle including, for example, a viral vector, lentiviral expression, mRNA electroporation, and lipid-mediated transfection for delivery into a cell. The genetic construct may be part of the genetic material in attenuated live microorganisms or recombinant microbial vectors which live in cells. The genetic construct may be present in the cell as a functioning extrachromosomal molecule. [000157] Further provided herein is a cell transformed or transduced with a system or component thereof as detailed herein. Suitable cell types are detailed herein. In some embodiments, the cell is a stem cell. The stem cell may be a human stem cell. In some embodiments, the cell is an embryonic stem cell. The stem cell may be a human pluripotent stem cell (iPSCs). Further provided are stem cell-derived neurons, such as neurons derived from iPSCs transformed or transduced with a DNA targeting system or component thereof as detailed herein.a. Viral Vectors [000158] A genetic construct may be a viral vector. Further provided herein is a viral delivery system. Viral delivery systems may include, for example, lentivirus, retrovirus, adenovirus, mRNA electroporation, or nanoparticles. In some embodiments, the vector is a lentiviral vector. Lentiviruses are a subclass of Retroviruses. Lentiviruses resemble γ-retroviruses (γ-RV) in their ability to stably integrate into the target cell genome, resulting in persistent expression of the gene of interest. Species of lentivirus include, for example, human immunodeficiency virus 1 (HIV-1), human immunodeficiency virus 2 (HIV-2), simian immunodeficiency virus (SIV), bovine immunodeficiency virus (BIV), and feline immunodeficiency virus (FIV). In some embodiments, the vector is a modified lentiviral vector. In some embodiments, the vector is an engineered lentiviral vector. Lentiviruses may include, for example, pseudo-type lentivirus, integrase- deficient lentivirus, and virus-like particles. In some embodiments, the viral vector is an adeno- associated virus (AAV) vector. The AAV vector is a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. [000159] Viral vectors may be used to deliver CRISPR / Cas9-based gene editing systems using various construct configurations. For example, AAV vectors may deliver Cas9 or fusion protein and gRNA expression cassettes on separate vectors or on the same vector. Alternatively, if the small Cas9 proteins or fusion proteins, derived from species such as Staphylococcus aureus or Neisseria meningitidis, are used then both the Cas9 and up to two gRNA expression cassettes may be combined in a single AAV vector. In some embodiments, the AAV vector has a 4.7 kb packaging limit. [000160] In some embodiments, the AAV vector is a modified AAV vector. In some embodiments, the AAV vector is an engineered AAV vector. The AAV vector may include an engineered AAV capsid. The AAV vector may be an engineered AAV vector for a specific cell type. For example, the AAV vector may be an engineered AAV vector for T cells. The modified AAV vector may have enhanced cell type tropism. The modified AAV vector may have enhanced cardiac and / or skeletal muscle tissue tropism. The modified AAV vector may be capable of delivering and expressing the transcription factor coding sequence or the CRISPR / Cas9-based gene editing system in the cell of a mammal. For example, the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. Human Gene Therapy 2012, 23, 635–646, incorporated herein by reference). The modified AAV vector may be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. Themodified AAV vector may be based on AAV2 pseudotype with alternative muscle-tropic AAV capsids, such as AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, and AAV / SASTG vectors that efficiently transduce skeletal muscle or cardiac muscle by systemic and local delivery (Seto et al. Current Gene Therapy 2012, 12, 139-151, incorporated herein by reference). The modified AAV vector may be AAV2i8G9 (Shen et al. J. Biol. Chem.2013, 288, 28814-28823, incorporated herein by reference). 5. Additional Therapies [000161] The compositions and methods detailed herein may further include at least one additional therapy, such as at least one cancer therapy or at least one antiviral therapy, or a combination thereof. As used herein, the term “standard of care treatment” or “additional therapy” or “additional treatment” are used interchangeably and refer to any other standard treatments / additional treatments that do not include the specific compositions detailed herein for modifying a mechanoenhancer as detailed herein. Additional therapies may comprise a small molecule, peptide, polypeptide, antibody, nucleotide, polynucleotide, lipid, or carbohydrate, or a combination thereof. Additional therapies may be synthesized and / or extracted and / or purified by any suitable means known in the art. Additional therapies may be commercially available. An effective amount of the additional therapy may be administered. a. Cancer Therapies [000162] The compositions and methods detailed herein may further include at least one cancer therapy. The term “standard of care treatment” or “additional therapy” or “additional treatment” are used interchangeably and refer to any other standard cancer treatments / additional cancer treatments that do not include the specific compositions detailed herein for modifying a mechanoenhancer. Additional cancer therapies may comprise a small molecule, peptide, polypeptide, antibody, nucleotide, polynucleotide, lipid, or carbohydrate, or a combination thereof. Additional cancer therapies may be synthesized and / or extracted and / or purified by any suitable means known in the art. Additional cancer therapies may be commercially available. Additional cancer therapies may include, for example, chemotherapy, immunotherapy, radiation therapy, hormone therapy, targeted drug therapy, cryoablation, antibody drug conjugates, and surgery, or a combination thereof. Hormone therapy, for example, may block hormone synthesis such as blocking estrogen synthesis. An effective amount of the additional cancer therapy may be administered.[000163] Chemotherapy may include, for example, an antimitotic agent, an alkylating agent, an antimetabolite, an antimicrotubule agent, a topoisomerase inhibitor, a cytotoxic agent, a cell cycle inhibitor, a growth factor inhibitor, a histone deacetylase (HDAC) inhibitor, and an inhibitor of a pathway that cross-talks with and activates ER transcriptional activity, or a combination thereof. [000164] Alkylating agents may include, for example, cisplatin (PLATINOL®), oxaliplatin (ELOXATIN®), chlorambucil (LEUKERAN®), procarbazine (MATULANE®; NATULAN®), or carmustine (BiCNU®), or a combination thereof. Antimetabolites may include, for example, methotrexate (also known as amethopterin), 5-fluorouracil, cytarabine (also known as cytosine arabinoside or ara-C; CYTOSAR®), or gemcitabine (GEMZAR®), or a combination thereof. Antimicrotubule agents may include, for example, vinblastine (VELBAN®; VELBE®), or paclitaxel (TAXOL®), or a combination thereof. Topoisomerase inhibitors may include, for example, etoposide (VEPESID®), or doxorubicin (ADRIAMYCIN®; MYOCET®), or a combination thereof. Cytotoxic agents may include, for example, bleomycin (BLENOXANE®). Growth factor inhibitors may include, for example, human epidermal growth factor receptor 2 (HER2) inhibitors. HER2 inhibitors include, for example, trastuzumab (HERCEPTIN®), deruxtecan, sacitizumab, and / or ado-trastuzumab emtansine (KADCYLA®). HDAC inhibitors may include, for example, vorinostat (ZOLINZA®), romidepsin (ISTODAX®), chidamide (also known as tucidinostat; EPIDAZA®; HIYASTA™), panobinostat (FARYDAK®), belinostat (also known as BELEODAQ® or PXD101), valproic acid (DEPAKOTE®; DEPAKENE®; STAVZOR®)), mocetinostat (also known as MGCD0103), abexinostat (also known as PCI- 24781), entinostat (also known as SNDX-275 or MS-275), pracinostat (also known as SB939), resminostat (also known as 4SC-201 or RAS2410), givinostat (also known as gavinostat or ITF2357), quisinostat (also known as JNJ-26481585), kevetrin, CUDC-101, AR-42, tefinostat (also known as CHR-2845), nanatinostat (also known as CHR-3996), domatinostat (also known as 4SC-202), ivaltinostat (also known as CG-200745), rocilinostat (also known as ACY-1215), or sulforaphane, or a combination thereof. Inhibitors of a pathway that cross-talks with and activates ER transcriptional activity may include, for example, a phosphoinositide 3-kinase (PI3K) inhibitor, a heat shock protein 90 (HSP90) inhibitor, or a mammalian target of rapamycin (mTOR) inhibitor. mTOR inhibitors include, for example, everolimus (AFINITOR®; VOTUBIA®; ZORTRESS®). In some embodiments, the HDAC inhibitor comprises vorinostat (ZOLINZA®) and / or romidepsin (ISTODAX®).[000165] Immunotherapies may include, for example, a checkpoint inhibitor, or denosumab (PROLIA®; XGEVA®), or a combination thereof. “Checkpoint inhibitor” or “immune checkpoint inhibitor” may also be referred to as an immune checkpoint blockade (ICB) therapy. Checkpoint inhibitors may comprise an antibody. Checkpoint inhibitors may include, for example, an antibody to programmed cell death protein 1 (PD1) (anti-PD1), or an antibody to cytotoxic T- lymphocyte-associated protein 4 (CTLA4) (anti-CTLA4), or an antibody to programmed death- ligand 1 (PDL1) (anti-PDL1), or DMXAA (sting agonist; also known as ASA404, vadimezan, or dimethylxanthone acetic acid) or a combination thereof. “Anti-PD1” refers to an antibody that binds PD1, “anti-CTLA4” refers to an antibody that binds CTLA4, and “anti-PDL1” refers to an antibody that binds PDL1. In some embodiments, the PD-1 antibody comprises pembrolizumab (KEYTRUDA®) or nivolumab (OPDIVOo®). In some embodiments, the CTLA-4 antibody comprises ipilimumab (YERVOY®). [000166] Antibody drug conjugates may include, for example, gemtuzumab ozogamicin (MYLOTARG™), brentuximab vedotin (ADCETRIS®), ado-trastuzumab emtansine (KADCYLA®), inotuzumab ozogamicin (BESPONSA®), polatuzumab vedotin (POLIVY®), enfortumab vedotin (PADCEV®), fam-trastuzumab deruxtecan (ENHERTU®), sacituzumab govitecan (TRODELVY®), loncastuximab tesirine (ZYNLONTA®), tisotumab vedotin (TIVDAK®), mirvetuximab soravtansinegynx (ELAHERE™), moxetumomab pasudotox (LUMOXITI™), belantamab mafodotin-blmf (BLENREP®), cetuximab saratolacan (AKALUX®), or disitamab vedotin (AIDIXI®), or a combination thereof. 6. Pharmaceutical Compositions [000167] Further provided herein are pharmaceutical compositions comprising the above- described genetic constructs or gene editing systems. In some embodiments, the pharmaceutical composition may comprise about 1 ng to about 10 mg of DNA encoding the CRISPR / Cas-based gene editing system. The systems or genetic constructs as detailed herein, or at least one component thereof, may be formulated into pharmaceutical compositions in accordance with standard techniques well known to those skilled in the pharmaceutical art. The pharmaceutical compositions can be formulated according to the mode of administration to be used. In cases where pharmaceutical compositions are injectable pharmaceutical compositions, they are sterile, pyrogen free, and particulate free. An isotonic formulation is preferably used. Generally, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol and lactose. In some cases, isotonic solutions such as phosphate bufferedsaline are preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstriction agent is added to the formulation. [000168] The composition may further comprise a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient may be functional molecules as vehicles, adjuvants, carriers, or diluents. The term “pharmaceutically acceptable carrier,” may be a non-toxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. Pharmaceutically acceptable carriers include, for example, diluents, lubricants, binders, disintegrants, colorants, flavors, sweeteners, antioxidants, preservatives, glidants, solvents, suspending agents, wetting agents, surfactants, emollients, propellants, humectants, powders, pH adjusting agents, and combinations thereof. The pharmaceutically acceptable excipient may be a transfection facilitating agent, which may include surface active agents, such as immune- stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents. The transfection facilitating agent may be a polyanion, polycation, including poly-L-glutamate (LGS), or lipid. The transfection facilitating agent may be poly-L-glutamate, and more preferably, the poly-L- glutamate may be present in the composition for gene editing in skeletal muscle or cardiac muscle at a concentration less than 6 mg / mL. 7. Administration [000169] The systems or genetic constructs as detailed herein, or at least one component thereof, may be administered or delivered to a cell. Methods of introducing a nucleic acid into a host cell are known in the art, and any known method can be used to introduce a nucleic acid (e.g., an expression construct) into a cell. Suitable methods include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, polycation or lipid:nucleic acid conjugates, lipofection, electroporation, nucleofection, immunoliposomes, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery, and the like. In some embodiments, the composition may be delivered by mRNA delivery and ribonucleoprotein (RNP) complex delivery. The system, genetic construct, or composition comprising the same, may be electroporated using BioRad Gene Pulser Xcell or AmaxaNucleofector IIb devices or other electroporation device. Several different buffers may be used, including BioRad electroporation solution, phosphate-buffered saline product #D8537 (PBS; Sigma, St. Louis, MO), Invitrogen OptiMEM I (OM), or Amaxa Nucleofector solution V (N.V.). Transfections may include a transfection reagent, such as Lipofectamine 2000. The modulators of mechanoenhancers detailed herein may be delivered or administered, for example, to a cell ex vivo or to a subject in vivo, by a method including viral delivery (such as, for example, lentivirus, retrovirus, or AAV vectors as detailed above), virus-like particles (VLPs), and integrase-defective lentivirus, non-viral integrating methods (such as, for example, transposons, integrases, and gene editing), and non-viral transient methods (such as, for example, mRNA, plasmids, and minicircles as detailed above). The modulators of mechanoenhancers detailed herein may be delivered by any delivery method suitable for ex vivo engineered cell therapy. The modulators of mechanoenhancers detailed herein may be delivered by any suitable delivery method, including, for example, lipid nanoparticles and micelles. In some embodiments, the modulator of a mechanoenhancer or a polynucleotide encoding the modulator is encapsulated within a lipid nanoparticle or polymeric carrier. [000170] The systems or genetic constructs as detailed herein, or at least one component thereof, or the pharmaceutical compositions comprising the same, may be administered to a subject. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration. The presently disclosed systems, or at least one component thereof, genetic constructs, or compositions comprising the same, may be administered to a subject by different routes including orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, intranasal, intravaginal, via inhalation, via buccal administration, intrapleurally, intravenous, intraarterial, intraperitoneal, subcutaneous, intradermally, epidermally, intramuscular, intranasal, intrathecal, intracranial, and intraarticular or combinations thereof. In certain embodiments, the system, genetic construct, or composition comprising the same, is administered to a subject intramuscularly, intravenously, or a combination thereof. The systems, genetic constructs, or compositions comprising the same may be delivered to a subject by several technologies including DNA injection (also referred to as DNA vaccination) with and without in vivo electroporation, liposome mediated, nanoparticle facilitated, recombinant vectors such as recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus associated virus. The composition may be injected into the brain or other component of the central nervous system. The composition may be injected into theskeletal muscle or cardiac muscle. For example, the composition may be injected into the tibialis anterior muscle or tail. For veterinary use, the systems, genetic constructs, or compositions comprising the same may be administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian may readily determine the dosing regimen and route of administration that is most appropriate for a particular animal. The systems, genetic constructs, or compositions comprising the same may be administered by traditional syringes, needleless injection devices, “microprojectile bombardment gone guns,” or other physical methods such as electroporation (“EP”), “hydrodynamic method”, or ultrasound. Alternatively, transient in vivo delivery of CRISPR / Cas-based systems by non-viral or non- integrating viral gene transfer, or by direct delivery of purified proteins and gRNAs containing cell-penetrating motifs may enable highly specific correction and / or restoration in situ with minimal or no risk of exogenous DNA integration. [000171] Upon delivery of the presently disclosed systems or genetic constructs as detailed herein, or at least one component thereof, or the pharmaceutical compositions comprising the same, and thereupon the vector into the cells of the subject, the transfected cells may express the gRNA molecule(s) and the Cas9 molecule or fusion protein. a. Cell Types [000172] Any of the delivery methods and / or routes of administration detailed herein can be utilized with a myriad of cell types. Further provided herein is a cell transformed or transduced with a system or component thereof as detailed herein. For example, provided herein is a cell comprising an isolated polynucleotide encoding the protein product from a gene as detailed herein. For example, provided herein is a cell comprising an isolated polynucleotide encoding a transcription factor or a CRISPR / Cas9 system as detailed herein. Suitable cell types are detailed herein. The cell may be isolated, as from a subject or tissue, or ex vivo, or in vivo. The cell may be autologous to the subject. The cell may be allogenic to the subject. In some embodiments, the cell is an immune cell. Immune cells may include, for example, lymphocytes such as T cells and B cells and natural killer (NK) cells. In some embodiments, the cell is a T cell. T cells may be divided into cytotoxic T cells and helper T cells, which are in turn categorized as TH1 or TH2 helper T cells. Immune cells may further include innate immune cells, adaptive immune cells, tumor-primed T cells, NKT cells, IFN-γ producing killer dendritic cells (IKDC), memory T cells (TCMs), and effector T cells (TEs). The cell may be a stem cell such as a human stem cell. In some embodiments, the cell is an embryonic stem cell or ahematopoietic stem cell. The stem cell may be a human induced pluripotent stem cell (iPSCs). In some embodiments, the cell is a T cell. In some embodiments, the cell is a CD8+ T cell. In some embodiments, the cell is a CD4+ T cell. The cell may be a tumor cell or a cancer cell. The cell may be a fibrotic cell, such as, for example, a fibroblast or stellate cell. The cell may be an endothelial cell. 8. Kits [000173] Provided herein is a kit, which may be used to modulate a mechanoenhancer as detailed herein. The kit comprises genetic constructs or a composition comprising the same, for modulating a mechanoenhancer, as described above, and instructions for using said composition. In some embodiments, the kit comprises at least one gRNA comprising a polynucleotide sequence of SEQ ID NO: 442-826, a complement thereof, a variant thereof, or fragment thereof, or gRNA targeting or encoded by a polynucleotide sequence of SEQ ID NO: 57-441, a complement thereof, a variant thereof, or fragment thereof. The kit may further include instructions for using the CRISPR / Cas-based gene editing system. [000174] Instructions included in kits may be affixed to packaging material or may be included as a package insert. While the instructions are typically written on printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term “instructions” may include the address of an internet site that provides the instructions. [000175] The genetic constructs or a composition comprising thereof for modulating a mechanoenhancer may include a modified AAV vector that includes a gRNA molecule(s) and a Cas9 protein or fusion protein, as described above, that specifically binds and cleaves a region of a mechanoenhancer gene. The CRISPR / Cas-based gene editing system, as described above, may be included in the kit to specifically bind and target a particular region, for example, a regulatory region of the gene.9. Methods a. Methods of Modulating the Expression of a Mechanoenhancer [000176] Provided herein are methods of modulating the expression of a mechanoenhancer. The methods may include administering to a cell or a subject a composition, an isolated polynucleotide, a vector, or a pharmaceutical composition as detailed herein. In some embodiments, modulating the expression of a mechanoenhancer results in modulation of apoptosis, mechanotransduction, proliferation, migration, or growth, or a combination thereof, in the cell or subject. The modulators of mechanoenhancers detailed herein may be delivered or administered, for example, to a cell in vitro or ex vivo or to a subject in vivo. The modulators of mechanoenhancers detailed herein may be delivered or administered to a cell for in vivo or ex vivo cell modification. In some embodiments, a modulator of a mechanoenhancer as detailed herein is administered to a cell isolated from a subject. The cell may be autologous. The cell may be allogenic. A cell modified by a modulator of a mechanoenhancer as detailed herein may be administered to a subject. b. Methods of Treating Disease [000177] Provided herein are methods of treating a disease. The methods may include administering to a cell or a subject a composition, an isolated polynucleotide, a vector, or a pharmaceutical composition as detailed herein. In some embodiments, modulating the expression of a mechanoenhancer results in modulation of apoptosis, mechanotransduction, proliferation, migration, or growth, or a combination thereof, in the cell or subject. The compositions and methods detailed herein may be used to treat any disease where mechanical regulation of the microenvironment affects disease progression. Diseases may include, for example, cancer (such as solid tumors), fibrosis (such as in, for example, the lung, liver, kidney, and / or muscle), atherosclerosis, and aging and / or senescence. In some embodiments, the disease includes pulmonary fibrosis such as idiopathic pulmonary fibrosis (IPF). In some embodiments, the disease comprises cancer. In some embodiments, method further includes administering at least one cancer therapy. In some embodiments, the disease comprises fibrosis regeneration, aging, and / or atheroschlerosis. In some embodiments, the disease comprises fibrosis. The modulators of mechanoenhancers detailed herein may be delivered or administered, for example, to a cell in vitro or ex vivo or to a subject in vivo. The modulators of mechanoenhancers detailed herein may be delivered or administered to a cell for in vivo or exvivo cell modification. In some embodiments, a modulator of a mechanoenhancer as detailed herein is administered to a cell isolated from a subject. The cell may be autologous. The cell may be allogenic. A cell modified by a modulator of a mechanoenhancer as detailed herein may be administered to a subject. 10. Examples [000178] The foregoing may be better understood by reference to the following examples, which are presented for purposes of illustration and are not intended to limit the scope of the invention. The present disclosure has multiple aspects and embodiments, illustrated by the appended non-limiting examples. Example 1 Materials and Methods [000179] Cell culture. Primary human neonatal fibroblasts (HFF cells) were acquired from ATCC®(CRL-2097™) and cultured in DMEM with 10% FBS, 1% AntiAnti (Antibiotic- Antimycotic), and 1% non-essential amino acids (NEAA; Sigma, St. Louis, MO) on tissue culture plastic (TCP). All work was performed within 30 doublings from the initial passage of the vial. [000180] RNA-Seq and Omni-ATAC-Seq [000181] Cell culture and soft hydrogel processing. Polyacrylamide hydrogel 35 and 150 mm PetriSoft®EasyCoat®dishes (Matrigen, Irvine, CA) with an Elastic Modulus of 1 kPa (“soft”) and 50 kPa (“stiff”) were used for all next generation sequencing (NGS) experiments. These dishes were incubated for 5 minutes with sterile PBS, rinsed two more times with sterile PBS, followed by addition of 10 µg / mL fibronectin (Sigma, St. Louis, MO) for 30 minutes at room temperature. Fibronectin was then removed, and dishes were rinsed twice with sterile PBS, followed by a 20- minute incubation with complete growth media while cells were passaged. Media was removed from the dishes and cell suspensions were added and allowed to attach overnight. [000182] Bulk RNA-Seq. 40k human foreskin fibroblast (HFF) cells were seeded on 50 kPa dishes and TCP dishes, while 70k HFF cells were seeded on 1 kPa dishes to achieve the same effective plating density due to slightly reduced HFF attachment rates (and spreading) on 1kPa hydrogels. Similarly, A549 cells were seeded on Matrigen®T75 flasks (1 kPa and 50 kPa) at slightly variable densities to account for reduced cell attachment on softer substrates (2 millioncells and 1.25 million cells, for 1 and 50 kPa flasks). 20 hours after seeding, cells were trypsinized, spun down at 300g for 5 minutes, and then RNA was isolated from the cells using the Total RNA Purification Kit (#17250; Norgen, Ontario, Canada) according to the manufacturer's protocol, and samples were run on an RNA TapeStation®(Agilent, Santa Clara, CA) to verify all samples had an RNA integrity number (RIN) score > 8. cDNA Libraries were built from the RNA inputs using the TruSeq®Stranded Library Prep Kit (Illumina, San Diego, CA; #RS-122-2101) according to manufacturer’s instructions. Quality control was performed by running the amplified libraries out on a High Sensitivity D1000 TapeStation®(Agilent, Santa Clara, CA) to confirm expected size, and Qubit®dsDNA HS assays were performed to determine a final concentration. Libraries were diluted to 10 nM and pooled together in equal volumes, followed by sequencing performed on an Illumina®HiSeq®2500 using a 50 bp PE RapidRun®kit. Resulting reads were subjected to adapter trimming using Trimmomatic v0.32 (Bolger et al., Bioinformatics.2014; 30, 2114–2120), aligned to GRCh38 with the STAR v2.4 aligner (Dobin et al., Bioinformatics.2013; 29, 15–21), and counts were retrieved using featureCounts (Liao et al., Bioinformatics.2014; 30, 923–930) from subread version 1.4.6p4 with Gencode v22 gene annotations used as reference. Differential expression analysis was performed using edgeR quasi-likelihood methodology (Robinson et al., Bioinformatics.2010.26, 139–140) and data was visualized using Degust (Powell D. R., Degust: interactive RNA-seq analysis. Drpowell / Degust) and Rstudio. Genes with significant differential expression were determined using a threshold of FDR < 0.05 and absolute value of Log2(FC) > 0.5. [000183] Omni ATAC-seq. Cells were seeded on Matrigen®dishes of varying stiffness (1, 12, 50 kPa elastic modulus) at slightly variable densities to account for reduced HFF attachment on softer substrates (70k, 45k, 40k HFF cells seeded per group, respectively) and allowed to culture for 20 hours overnight. A549s were seeded in a similar fashion with Matrigen®T75 flasks (1, 50 kPa elastic modulus) seeded with either 2 million and 1.25 million cells per flask, respectively and allowed to culture for 20 hours. For Y-27632 ROCKi experiments, the cells were seeded as normal, but 1 hour prior to harvest 10 µM Y-27632 ROCKi (StemCell Tech, Vancouver, Canada) in growth media was added to the cells. The Omni-ATAC-seq protocol was used to minimize mitochondrial reads from the preps (Corces et al., Omni-ATAC-seq: improved ATAC-seq protocol. Protocol exchange (2017)), however no trypsinization was used and instead on-plate disruption / removal of nuclei (using the digitonin present in the lysis buffer) was used to better preserve nuclear mechanical context and connectivity prior to transposition by the Tn5. Following the final PCR, libraries were cleaned with a 0.5x / 1.8x double-sided SPRIclean. Libraries were subjected to quality control by determining the number of cycles required to reach 25% of the peak threshold in the diagnostic PCR, as well as running the amplified libraries out on a High Sensitivity D1000 TapeStation®(Agilent, Santa Clara, CA) to confirm expected size, and Qubit®dsDNA HS assays were performed to determine a final concentration. Libraries were individually diluted to 6 nM and then pooled at equal volumes prior to sequencing on an Illumina®HiSeq 4000 using a single lane of 50 bp single end reads. FastQC®(Andrews et al., FastQC: a quality control tool for high throughput sequence data (2010)) was used to identify read quality, and adapter reads were trimmed using Trimmomatic v0.32 (Bolger et al., Bioinformatics.2014; 30, 2114–2120) followed by Bowtie (Langmead, Curr Protoc Bioinformatics.2010; Chapter 11: Unit 11.7) alignment (v1.0) of the reads to the reference genome using the settings: -v 2 –best –strata -m 1 with duplicate reads removed using Picard MarkDuplicates (v1.13) and ENCODE hg38 blacklist reads removed using bedtools2 v2.25 (Quinlan, Curr. Protoc. Bioinformatics.2014; 47, 11.12.1–34). Peak calling was performed using MACS2 with narrowPeak settings and a threshold of FDR < 0.001 (Zhang et al., Genome Biol.2008; 9, R137), and a master peak set was generated as the union set of all called peaks across every sample analyzed (224,906 unique regions total). Count matrices were made using featureCounts (Liao et al., Bioinformatics.2014.30, 923–930) and DEseq2 v1.36 was used for differential accessibility analysis (Love et al., Genome Biol.2014; 15, 550). Annotation of genomic regions was performed using ChIPSeeker (Yu et al., Bioinformatics. 2015; 31, 2382–2383), interactive visualization of processed data was done using Degust (Powell D. R., Degust: interactive RNA-seq analysis. Drpowell / Degust) and Rstudio along with ggplot2 and tidyverse plugins were used to generate data visualizations. Sequencing-depth normalized ATAC bigWig files were generated using deeptools bamCoverage v3.0.1 (Ramírez et al., Nucleic Acids Res.2014; 42, W187–91). All motif analysis was performed using the HOMER suite (Heinz et al., Mol. Cell.2010; 38, 576–589). [000184] HiCAR. HFF cells were seeded on Matrigen®T75 flasks (1 kPa and 50 kPa) at slightly variable densities to account for reduced cell attachment on softer substrates (2 million and 1.25 million). After 20 hours, HiCAR libraries were prepared as previously reported (Ho et al., Nature.2013; 497, 507–511). 200,000 crosslinked cells were used for each replicate. Nuclei were isolated using NPB buffer (5% BSA in PBS, 1 mM DTT, 0.2% IGEPAL, Protease Inhibitor) and incubated with assembled Tn5 transposase in 1X TB buffer (33 mM Tris-AC pH 7.8, 66 mM KCl-AC, 10 mM Mg-AC, 16% DMF) at 37°C on a rotator for 1 hour. Chromatin digestion was performed with MseI, followed by in situ ligation with T4 DNA ligase and DNApurification. Purified genomic DNA was further digested with NlaIII and circularized with T4 DNA ligase, followed by DNA purification and PCR amplification. After size selection, the libraries were sequenced using the Illumina NovaSeq™ X. [000185] The analysis pipeline to process the HiCAR libraries can be found at nf- co.re / hicar / 1.0.0 with the following parameters: --genome GrCh38, --profile singularity, --ensyme ‘MseI’, --restriction_sites ‘^TAA’, --resample_pairs, --qval_thresh 0.01. Briefly, quality reads were determined using FASTQC [bioinformatics.babraham.ac.uk / projects / fastqc / ] then adapters were trimmed using cutadapt (Vartiainen et al., Science.2007; 316, 1749–1752). Reads were aligned to the reference genome using bwa mem [bio-bwa.sourceforge.net / bwa.shtml#12]. Aligned reads were then processed using pairtools (Miralles et al., Cell.2003; 113, 329–342) and quality control was performed using pairsqc [github.com / 4dn-dcic / pairsqc]. MACS2 (Pelham Jr. and Wang, Proc. Natl. Acad. Sci.1997; 94, 13661–13665) was used to call peaks and MAPS (Bischoff et al., Proc. Natl. Acad. Sci.1994; 91, 2587–2591) was used to find genomic interaction loops. Differential analysis was performed using edgeR (Simeonov et al., Nature.2017; 549, 111–115) and files for visualization were generated using Cooler (Elosegui- Artola et al., Cell.2017; 171, 1397–1410.e14) and Juicer (Miroshnikova, Nava, and Wickström, J. Cell Sci.2017; 130, 2243–2250). To compare the chromatin loops between ECM stiffness conditions, bedtools pairtopair with the -type parameter set to both, either, or neither were used (Le et al., Nat. Cell Biol.2016; 18, 864–875). To compare the chromatin loops with the differentially accessible ATAC-seq peaks, bedtools pairtobed were used (Le et al., Nat. Cell Biol.2016; 18, 864–875). [000186] MYH9 Locus Screening [000187] Library design and cloning. Using the ATAC-seq data, every open chromatin region that was within 440 kb of the MYH9 transcription start site (TSS) was used as input to generate an oligo pool. For each ATAC-seq peak, any gRNA that had a GuideScan specificity score of > 0.2 was included, which has previously been shown to increase the quality of non-coding screens (Tycko et al., Nat. Commun.2019; 10, 4063). This resulted in 114 peaks represented in the library, with an average of ~41 gRNA / peak. Also, 500 non-targeting gRNA were included as negative controls (Horlbeck et al., Elife.2016; 5: e19760). This combined gRNA library of 5,192 gRNA was synthesized as an oligo pool by Twist Biosciences (South San Francisco, CA) with common overhangs for cloning into our lentiviral backbone.[000188] This oligo pool was PCR amplified, and a hU6-driven lentiviral gRNA vector (pBDC119) was then digested with Esp3I, gel purified, and then ligated along with the amplified oligo pool by Gibson assembly. Following a 1x SPRI cleaning, the Gibson assembly was transformed into Endura™ competent cells (Lucigen, Middleton, WI) according to the manufacturer's protocol, and cultured overnight before maxi-prepping the gRNA-library plasmid. A PCR amplicon across the gRNA region of the resulting plasmid was sequenced to a depth of ~100k-1M read pairs on an Illumina®miSeq™in order to verify coverage across the entire gRNA library (FIGS.31A-31D). [000189] Lentiviral generation and functional titering of MYH9 locus library. gRNA library plasmid was co-transfected into ~18M HEK293T cells along with two lentiviral packaging plasmids using Lipofectamine™ 3000 (ThermoFisher, Waltham, MA). 20 hours post- transfection, the transfection media was removed, and fresh growth media was added. Media containing viral particles was removed one day later at 48 hours post-transfection and stored, replaced with fresh media and collected one day later before being stored at 4°C. Combined media containing viral particles was filtered through 0.45 μm low-protein binding filters, and then concentrated using Lenti-X™ Concentrator (Takara Bio, San Jose, CA) according to the manufacturer’s protocol. Functional titering to determine multiplicity of infection (MOI) was performed by transducing HFF cells across a 50x-10,000x dilution range of the viral stock, and then subjecting the cells to FACS-based cell sorting to identify what percent of the population was mCherry+ for each viral stock dilution. [000190] CRISPRi locus screen. A stable HFF line was created using a lentiviral dCas9- KRAB construct (pLV-hUbC-dCas9-KRAB-2A-Blast (pJB289)), followed by the gRNA library being transduced at an MOI of ~0.33 and Puro selection for four days at 1 µg / mL. Cells were maintained for an additional four days, prior to trypsinization and fixation at day 10 post- transduction. Following trypsinization with 0.25% Trypsin-EDTA for 5 minutes at 37°C, trypsin was neutralized with 1X volumes of complete growth media following by 300 g for 5 minutes centrifugation and aspiration of the supernatant, one rinse with 1X volume PBS followed by another centrifugation and aspiration leaving 200 µL of PBS above the pellet. The eBioScience™ ICC Fixation kit (ThermoFisher, Waltham, MA) was used to fix / permeabilize cells according to manufacturer’s instructions, with both reagents being equilibrated to room temperature (i.e., from about 20°C to about 22°C) prior to usage. Fixation was performed through the addition of 500 µL eBioSciences™ Fix / Perm Buffer (ThermoFisher, Waltham, MA) to the 200 µL PBS and pellet, and incubation at room temperature for 20 minutes. At the end ofthis incubation 1X Permeabilization Buffer (Perm Buffer) was added to 8 mL total volume, spun at 600 g for 5 minutes, followed by an additional perm buffer rinse. Following this step: HFF cells were counted, and ~2M cells were removed to be used for unsorted controls, and ~500k cells were set aside to be control samples for single channel compensation controls. Immunostaining of MYH9 was performed using a AlexaFluor™-488 conjugated Rabbit monoclonal anti-NMMIIA antibody (clone EPR8965; Abcam, Cambridge, United Kingdom; #ab204675) at a ratio of 0.5 µL antibody per 300k HFF cells per 100 µL of Perm Buffer which was determined to be the ideal staining ratio using an antibody titration series. HFF cells were incubated for 30 minutes at room temperature in the dark on a nutating rocker, a 600 g for 5 minutes spin, and two repeats of 3 mL 1X Perm Buffer rinse / spin cycles. Following the last spin down, cells were resuspended in FACS Buffer [1X PBS supplemented w / 1% BSA (Sigma, St. Louis, MO) and 0.5 mM EDTA (Sigma, St. Louis, MO)] at density of ~9M cells / mL and sorted. A SH800 Cell Sorter (Sony Biotechnologies, San Jose, CA) was used to separate out the top / bottom-expressing MYH9 fractions following immunostaining. Compensation panels were set up using single channel expressing cell populations including untreated cells, antibody-only cells, mCherry-only cells. The top 10% and lower 10% of the MYH9 population was sorted off and used for downstream gRNA-enrichment analysis and sequencing. [000191] gDNA recovery and library preparation. Cells were counted following sorting to verify enrichment, followed by DNA recovery / extraction from fixed cells using the PicoPure™ DNA extraction kit (ThermoFisher, Waltham, MA) according to manufacturer’s instructions. Recovery digests were performed for 20 hours at 65°C using up to 1.5M HFF cells per reaction volume. All gDNA was split between sample-indexed 100 µL Q5 PCR reactions (up to ~340 ng max input per 100 µL reaction) to amplify out the gRNA protospacer from HFF cells. These PCRs from gDNA were run as follows [98°C for 30s / 25x: 98°C for 10s, 60°C for 30s, 72°C for 15s / 72°C for 2 min] with primers in TABLE 1, followed by individual PCRs being pooled together and subjected to a double-sided 0.65X / 1X SPRI clean-up. Quality control was performed by running the amplified libraries out on a High Sensitivity D1000 TapeStation®(Agilent, Santa Clara, CA) to confirm expected size, and Qubit®dsDNA HS assays were performed to determine a final concentration. All libraries were pooled to an effective concentration of 4 nM and combined in equal volumes prior to sequencing on an Illumina®MiSeq™, using a v250 cycle reagent kit with Read1 being 21 cycles (protospacer) and index read 1 being 6 reads (sample barcoding).TABLE 1. PCR primers for gDNA recovery and library preparation. PCR Primer name Primer sequence number AATGATACGGCGACCACCGAGATCTACACAATTTCTTGGGTAGTTTGT T T T G[000192] MYH9 locus library analysis. Resulting FASTQ files were aligned to a custom reference sequence corresponding to the given gRNA library using bowtie2 and all downstream analyses were performed in R. All gRNA were verified to be represented in the baseline untreated library at day 8 post-transduction, and counts+1 for each gRNA were taken (to normalize for samples that dropped out in one condition) and normalized by sequencing depth for each library before downstream analysis (in counts per million reads sequenced, ‘CPM’). Due to the highly-apparent strand bias in the positive-strand when targeting the MYH9 gene body (see Supplementary Text 1 below), only the non-interfering gRNA from the negative strand were included (2,863 gRNA). A ratio was taken of the CPM for each gRNA of the low MYH9 expression group to high MYH9 expression group to identify whether the gRNA perturbation led to increases in enrichment in either expression bin. Next, for each screen replicate the Z-score was calculated for each gRNA relative to the control non-targeting gRNA population using similar methodologies as previously described in (Han et al. Nature, 2020; 580(7801): 136-141). First, each sample’s ratio was converted to a log2 fold-enrichment, and population statistics for the negative control non-targeting gRNAs (median, standard deviation, gRNA number) were calculated. For each individual gRNA, the median of the negative control fold-enrichment was subtracted from each individual gRNA’s log2 fold-enrichment value, and this value was further divided by the standard deviation of the negative control non-targeting gRNA population to get an individual Z-score relative to the negative control population. Raw Z-score values from bothreplicates were pooled to calculate pRE-wide effects. Phenotype scores (t-score based) were calculated as: ^^ ^^^^^^^^ ^^^^^^^^^^ℎ^^^^^^^^^^^^^^ ^^^^^^^^^^ = ^^ ^^^^^^ − ^^ ^^^^^^ ^൬^^^^^^^^ +^^^^^^^^^^^^^^^^^ = ^^^^^^^^^^^^^^ ∗ ^^^^^^^^^^^ − 1^ + ^^^^^^^^^^^^^^ ∗ (^^^^^^^^ − 1)[000193] Individual gRNA validations. For gRNA validations of all 5 hit pRE across the MYH9 locus (including the two promoter / exon1 regions). Oligos containing protospacer sequences were synthesized by IDT (Coralville, IA) and cloned into pLV_hU6-sgRNA_hUbC-GFP-P2A- PuroR (Addgene, Watertown, MA; plasmid #162335). Sanger sequencing was used to confirm the identity of the gRNA. Lentivirus was generated as previously described herein. dCas9- KRAB expressing HFF cells were seeded onto TCP and transduced on day 0. 24 hours post- transduction, lentivirus was removed and replaced with fresh growth media. Puromycin selection was applied as described for the bulk screen, and cells were harvested nine days post-transduction. mRNA was isolated using the Total RNA Purification Kit (#17250; Norgen, Ontario, Canada) according to the manufacturer's protocol. 100 ng mRNA was used as input for cDNA amplification using the Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit. For RT-qPCR, each reaction contained 1 µL cDNA, 7 µL H20, 1 µL TaqMan®probe for TBP, 1 µL TaqMan®probe for MYH9, and 10 µL Quantabio®PerfeCTa®FastMix®II. Delta delta Ct analysis was performed in Microsoft Excel. Graphpad Prism was utilized to conduct one-way ANOVA tests followed by Tukey’s HSD for post-hoc testing. Significance is reported in the figures as follows: *p-value < 0.05, **p-value < 0.01, ***p-value < 0.001. TaqMan®probe information provided in TABLE 2. A portion of the transduced cells for the MYH9-intron 3 pRE were propagated to day 15 and then subjected to MYH9 immunostaining and flow cytometry as described in the bulk screen section herein, with gain values held constant across all collections across samples. Populations were plotted to show shifts relative to transduction with the non- targeting gRNA. Noting high values of MYH9 promoter-targeting gRNA, a similar transduction was performed, and RNA expression was examined at day 6 post-transduction and markedly lower levels of MYH9 expression were seen, supporting the idea that MYH9 deficiencies in cytokinesis led to a dropout of transduced cells over longer timeframes (FIGS.10A-10D).TABLE 2. TaqMan®probes used for RT-qPCR. Supplier Probe Catalog Number[000194] Actin and vinculin labeling / immunostaining and focal adhesion imaging / analysis. HFF cells were seeded into 24 well-plates while being transduced with lentiviruses encoding an all-in-one construct that expressed dCas9-KRAB / hU6-gRNA (Addgene, Watertown, MA; plasmid #71236) with the gRNA being either a non-targeting control, an gRNA for the MYH9 intron 3 enhancer, and a gRNA for the MYH9 promoter. Viral media was removed 20 hours later, and replaced with complete growth media. Puromycin selection was started 2 days post- transduction, wherein 1.5 µg / mL Puromycin was added to the growth media for 3 days prior to removal of the antibiotic selection and continued passaging of the cells for expansion. Six dayspost transduction our transduced HFF cells were seeded at ~5k cells / well into µ-Slide 8 Well Glass Bottom (ibidi, Fitchburg, WI) chamber slides that were coated with 10 µg / mL fibronectin for 45 minutes at room temperature and rinsed 1x with PBS prior to seeding. Following an overnight culture, the media was removed on the chamber slide and 200 µL of 4% PFA was gently added to each well and cells were fixed at room temperature for 15 minutes, rinsed 2x with PBS, and then permeabilized with a permeabilizing solution [PBS supplemented with 0.5% TritonX-100, 10% w / v sucrose, 600 µM MgCl2] for 10 minutes at 4°C. Permeabilizing solution was then removed from cells, followed by 2x PBS rinses, and blocked with a labeling solution [1% bovine serum albumin (Sigma, St. Louis, MO) in PBS] for 30 minutes at room temperature. Fresh labeling solution was added that contained a 1:300 dilution of a Rabbit monoclonal anti- Vinculin antibody (clone EPR8185; Abcam, Cambridge, United Kingdom; #ab129002) and incubated in a nutating rocker in the dark overnight at 4°C. The next morning the primary antibody was removed, rinsed 2x with labeling solution, and then a secondary solution that contained a 1:200 dilution of AlexaFluor™-488 Goat anti-Rabbit secondary (ThermoFisher, Waltham, MA; #A-11008), a 1:100 dilution of AlexaFluor™-647-Phalloidin (ThermoFisher, Waltham, MA; #A22287) and a 1:5000 dilution of DAPI was added for 1 hour at room temperature on a nutating rocker in the dark. Following three PBS rinses, chamber-slide wells were mounted with Vectashield®Antifade Mounting Media (Vector Laboratories, Newark, CA; H- 1000-10). All focal adhesion and actin imaging was performed using a 20x / 0.8NA objective on a Zeiss Axio Observer 7 and a quad-bandpass filter. Focal adhesion morphometric characteristics were quantified using vinculin images input to an online web tool, the Focal Adhesion Analysis Server (FAAS; Berginski and Gomez, F1000Res.2013; 2: 68). For this analysis the minimum adhesion size was set to 0.21 µm2and the stdev_thresh was set to 5.5. Each value is reported as the average across an individual cell within the group, with N=39-45 cells / per group for either the control non-targeting gRNA or the MYH9 intron 3 targeting gRNA. [000195] MYH9 intron 3 saturation mutagenesis screening [000196] Library design and cloning. For the MYH9 intron 3 pRE saturation mutagenesis library, any gRNA that was within the hit pRE from the MYH9 locus library was included, which resulted in 64 gRNA across the library. Also, 25 non-targeting gRNA (Horlbeck et al., Elife. 2016; 5: e19760) and 11 safe-targeting gRNA (Yao et al., Nature methods.2024; 21(4) :723- 34.) were included as negative controls. This combined gRNA library of 100 gRNA was synthesized as an oligo pool by Twist Biosciences (South San Francisco, CA) with common overhangs for cloning into the lentiviral backbone. This oligo pool was PCR amplified, andpLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR (Addgene, Watertown, MA; plasmid #162335) was then digested with Esp3I, gel purified, and then ligated along with the amplified oligo pool by Gibson assembly. Following a 1x SPRI cleaning, the Gibson assembly was transformed into Endura™ competent cells (Lucigen, Middleton, WI) according to the manufacturer's protocol, and cultured overnight before maxi-prepping the gRNA-library plasmid. A PCR amplicon across the gRNA region of the resulting plasmid was sequenced to a depth of ~100k-1M read pairs on an Illumina®miSeq™ in order to verify coverage across the entire gRNA library (FIGS.31A- 31D). [000197] Lentiviral generation and functional tittering. gRNA library plasmid pool was co- transfected into ~7.8M HEK293T cells along with two lentiviral packaging plasmids using Lipofectamine™ 3000 (ThermoFisher, Waltham, MA). 20 hours post-transfection, the transfection media was removed, and fresh growth media was added. Media containing viral particles was removed one day later at 48 hours post-transfection and stored, replaced with fresh media, and collected one day later before being stored at 4°C. Combined media containing viral particles was filtered through 0.45 μm low-protein binding filters, and then concentrated using Lenti-X™ Concentrator (Takara Bio, San Jose, CA) according to the manufacturer’s protocol. Functional titering to determine MOI was performed by transducing HFF cells across a 0.75x-100x dilution range of the viral stock, and then subjecting the cells to FACS-based cell sorting to identify what percent of the population was mCherry+ for each viral stock dilution. [000198] MYH9 saturation mutagenesis screen. HFF cells were transduced with a lentiviral SpCas9 construct (FUGW-SpCas9-2A-HygroR (pVG54)), selected with 100 µg / mL hygromycin for 4 days with hygromycin in order to make a stable line. Following four passages the cells were frozen and used for subsequent screening experiments and validations. 600k HFF cells were transduced with lentivirus encoding the MYH9 intron 3 saturation pool. For screening, the same protocol was used as described above for the MYH9 CRISPRi locus screen, with 8 days of culture time prior to fixation, MYH9 immunostaining, FACS for the top / bottom 10% of cells, PicoPure™ gDNA recovery, and gRNA PCR and processing for enrichment across the low and high MYH9 expression bins. [000199] Individual gRNA validations. For gRNA validations of all 3 hit gRNA that had significantly altered MYH9 expression and a non-targeting control gRNA, oligos containing protospacer sequences were synthesized by IDT (Coralville, IA) and cloned into pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR (Addgene, Watertown, MA; plasmid #162335). Sanger sequencing was used to confirm the identity of the gRNA. Lentivirus was generated as previously described above. Cas9 expressing HFF cells were seeded onto TCP and transduced on day 0. 24 hours post-transduction, lentivirus was removed and replaced with fresh growth media, cells were grown for 8 days (with 4 days of 1.5 µg / mL puromycin selection). And for harvest cells were split with 500k cells for gDNA harvested following FACS (as detailed below) and RNA was harvested from 500k cells using a Total RNA Purification Kit (#17250; Norgen, Ontario, Canada). qPCR for MYH9 expression was performed as described above for the MYH9 locus screen. [000200] gRNA validation indel enrichment across MYH9 expression bins. Additionally, 500k cells were processed similarly to the screen that included cell fixation, MYH9 immunostaining, FACS for the top / bottom 10% of cells, PicoPure™ gDNA recovery. A MYH9 intron 3 PCR was performed with an amplicon size of 666 bp. All gDNA was split between sample-indexed 100 µL Q5 PCR reactions (up to ~340 ng max input per 100 µL reaction) to amplify out the gRNA protospacer from HFF cells. These PCRs from gDNA were run as follows [98°C for 30s / 25x: 98°C for 10s, 60°C for 30s, 72°C for 15s / 72°C for 2 min] with primers in TABLE 3, followed by individual PCRs being pooled together and subjected to a double-sided 0.65X / 1X SPRI clean- up. Quality control was performed by running the amplified libraries out on a High Sensitivity D1000 TapeStation®(Agilent, Santa Clara, CA) to confirm expected size, and Qubit®dsDNA HS assays were performed to determine a final concentration. All libraries were pooled to an effective concentration of 4 nM and combined in equal volumes prior to sequencing on an Illumina®MiSeq™, using a v250 cycle reagent kit with Read1 being 21 cycles (protospacer) and index read 1 being 6 reads (sample barcoding). FASTQ reads were run through Crispresso2 (Clement et al., Nat Biotechnol.2019; 37(3): 224-226) and indel enrichment in the low MYH9 bin was used to examine any overlapping TF motifs on common indel sites. TABLE 3. gRNA library for scRNA-seq screen. st gui chro target.site target.sit cutting.e cutting.s ra offtar offtarg D de mig gro ote A A ACGCCTCCC positive CRIM1 3635586 GAGCTGCC N _CTL_T Dolcetto _4 chr2 36355842 1 GAGT NA NA - NA NA A NA SS NA NA SetB NA GGCGAGC itiv A A A A A A A A A A A olc to etA olc to etA olc to etA A A A A A A- - gRNA_ TTGGGATT 1 putative 1.1 0.0 109__3 3771146 TGATGGGA 0.36355 2:0|3:1 0 _reg_el 94133 0 chr2 37711442 4 GCTC 39 1 + 111 9 30 ement 7 1 NA NA A A A A A A A A A A A A A A A A- gRNA_ CTCAGTTT 1 putative 0.3 0.0 138__1 18993373 1899337 CTAAGAGA 0.23173 2:1|3:1 3 _reg_el 13919 5 chr2 1 53 CTAT 36 6 + 187 8 15 ement 89 62 NA NA A A A A A A A A A A A A A A A A- gRNA_ AAGGGCAA 1 putative 0.0 0.6 164__4 chr1 6317525 AGGTGGTA 0.32188 2:0|3:1 6 _reg_el 79047 7 4 63175228 0 TCTC 38 5 - 177 4 47 ement 63 08 NA NA A A A A A A A A A A A A A A A A- gRNA_ CATAATGA 1 putative 3.6 1.0 187__3 7961096 CGAAAATA 2:0|3:1 8 _reg_el 47639 1 chr9 79610943 5 TGCT 54 025275 + 133 7 31 ement 08 46 NA NA A A A A A A A A A A A A A A A A- gRNA_ GAGCAGTT 2 putative 0.9 0.4 212__1 chr2 4166943 TATTCCTG 2:0|3:1 1 _reg_el 27497 1 2 41669411 3 GGTC 43 037989 - 111 2 11 ement 9 98 NA NA A A A A A A A A A A A A A A A A- GCTGAAGA putative 0.2 0.5 gRNA_ 4614549 ATTACCCA 0.42537 2:0|3:1 2 _reg_el 41700 22 7 chr7 46145469 1 CCTC 51 2 - 100 2 7 ement 1 73 NA NA A A A A A A A A A A A A A A A A0.1 - AGTTGCTT 2 putative 64 0.0 gRNA_ chr1 3853651 CTTCGTGC 0.49647 2 _reg_el 56935 221 35 38536494 6 CTAT 27 1 - 52:0|3:5 1 3 ement 8 5 NA NA A A A A A A A A A A A A A A A A0.5 gRNA_ GCAGTATA 2 putative 34 0.0 229__2 8274493 ATAAAGCT 0.20679 2:1|3:1 2 _reg_el 77577 0 chr4 82744911 3 GAGG 54 3 + 132 9 20 ement 3 55 NA NA A A A A A A A A A A A A A A A A- - gRNA_ GGAGCTG 2 putative 3.1 0.1 276__1 chr2 4129117 GAACAGTG 0.39042 2:0|3:1 7 _reg_el 20793 9 2 41291153 5 CCTAT 46 6 - 100 6 19 ement 12 3 NA NA A A A A A A A A A A A A A A A A- gRNA_ CAGGTGGC 2 putative 0.3 - 291__4 chr1 6579209 AATCCTGC 0.26047 2:0|3:1 9 _reg_el 73 0.2 5 4 65792068 0 TGTG 71 7 + 166 1 45 ement 79397 NA NA A A A A A A A A A A A A A A A A- gRNA_ TTGGCTTA 2 putative 3.4 2.3 296__3 1929917 TCAGCTCA 0.47023 2:0|3:1 9 _reg_el 35420 5 chr8 19299148 0 CTTC 25 2 - 133 6 35 ement 64 62 NA NA A A A A A A A A A A A A A A A A- GGATTTAG putative 0.4 0.8 gRNA_ 3615647 TTGCCAGA 0.44495 3 _reg_el 01957 32 10 chr5 36156456 8 TGTA 52 5 - 42:0|3:4 2 10 ement 88 82 NA NA A A A A A A A A A A A A A A A A- gRNA_ ACTTCACT 3 putative 2.0 2.9 325__6 10543947 1054394 GGGTGCC 0.21044 2:0|3:2 2 _reg_el 38900 7 chr7 2 94 CTCCT 30 3 + 211 5 67 ement 82 71 NA NA A A A A A A A A A A A A A A A A- gRNA_ CGGGTCG 3 putative - 0.5 339__4 chr1 CTCAGCTC 0.72234 3 _reg_el 0.4387 2 6 3172364 3172386 CACAT 61 2 + 42:0|3:4 9 42 ement 21 5 NA NA A A A A A A A A A A A A A A A A0.1 gRNA_ AGAAATAT 3 putative 03 0.8 379__1 2969429 AGTTCCAG 0.22620 2:0|3:2 7 _reg_el 71778 1 chr3 29694273 5 ACTT 60 3 - 233 9 11 ement 7 23 NA NA A A A A A A A A A A A A A A A A0.2 - TACCTTTC 3 putative 02 1.2 gRNA_ 12644704 1264470 ACCTAGTT 0.51350 8 _reg_el 15188 384 5 chr5 0 62 TCGT 53 7 + 42:0|3:4 4 5 ement 9 4 NA NA A A A A A A A A A A A A A A A A- gRNA_ GGCTATAG 4 putative 0.8 0.1 400__3 8477338 AAATTATG 0.21163 2:0|3:1 0 _reg_el 49508 0 chr9 84773367 9 GCAT 50 1 + 133 0 30 ement 12 22 NA NA A A A A A A A A A A A A A A A A- CAGGCCGT putative 1.2 0.7 gRNA_ 8558091 GCGCAGC 2:0|3:1 4 _reg_el 05257 41 44 chr1 85580894 6 GGGGT 30 033969 - 111 1 44 ement 24 16 NA NA A A A A A A A A A A A A A A A A- - gRNA_ GTGCATTG 4 putative 2.0 1.4 419__1 5495924 CTTTCATT 2:2|3:1 1 _reg_el 14492 7 chr4 54959219 1 CCAA 53 022633 - 142 9 17 ement 08 2 NA NA A A A A A A A A A A A A A A A A0.1 GCGACTCA 4 putative 19 1.6 gRNA_ 7183244 GAATGACA 0.42955 2 _reg_el 88096 420 3 chr2 71832425 7 GGAG 66 8 - 82:0|3:8 0 3 ement 9 93 NA NA A A A A A A A A A A A A A A A A A39 9 - RNA TAGACCTA 4 t tiv 02 05 A A A A A A A A A A A A A A A A A89 98 - RNA GGGCGATA 4 t tiv 16 13 A A A A A A A A A A A A A A A A A24 5 - TATAATTC 4 t tiv 14 A A A A A A A A A A A A A A A A A06 76 - - CATGAGTA t tiv 02 03 A A A A A A A A A A A A A A A A A64 25 - ACTTGAGA 5 t tiv 15 01 A A A A A A A A A A A A A A A A A- gRNA_ GGGGAAAT 5 putative 0.3 1.3 552__1 12966544 1296654 AATGACCG 0.33081 5 _reg_el 40904 6 chr3 2 64 AAGT 48 4 + 92:0|3:9 2 16 ement 41 41 NA NA A A A A A A A A A A A A A A A A- gRNA_ CCAAAGTA 5 putative 0.3 0.5 562__3 3656873 ATGTGGCA 0.21955 2:1|3:2 6 _reg_el 02669 2 chr2 36568709 1 AGGA 56 9 + 210 2 32 ement 77 86 NA NA A A A A A A A A A A A A A A A A- ACGGATTT 5 putative 3.2 0.5 gRNA_ 2037995 CTGTAGGA 0.44289 9 _reg_el 74716 596 2 chr6 20379930 2 TGAA 50 8 - 62:0|3:6 6 2 ement 01 69 NA NA A A A A A A A A A A A A A A A A1.2 gRNA_ AACCTGTA 6 putative 68 1.5 619__1 1723845 GTTAAGTG 0.35309 1 _reg_el 75270 3 chr5 17238428 0 TTAA 27 6 + 92:1|3:8 9 13 ement 8 61 NA NA A A A A A A A A A A A A A A A A- TGACCTTA putative 0.6 1.2 gRNA_ 8561339 GACAGCCC 0.70842 6 _reg_el 37564 62 7 chr1 85613372 4 TTTC 20 3 - 72:1|3:6 2 7 ement 96 89 NA NA A A A A A A A A A A A A A A A A- gRNA_ CTCTGGAA 6 putative 0.5 0.6 628__3 chr1 6367860 TTCATGAG 0.28313 2:2|3:1 2 _reg_el 02784 6 5 63678586 8 TTAC 28 9 - 175 8 36 ement 85 02 NA NA A A A A A A A A A A A A A A A A- gRNA_ AGAATACT 6 putative 0.8 1.0 656__2 2464329 CTCTGACT 0.35633 2:1|3:1 5 _reg_el 07485 4 chr4 24643271 3 TCTC 41 5 - 154 6 24 ement 51 77 NA NA A A A A A A A A A A A A A A A A- - ATGAGTAC putative 0.5 0.2 gRNA_ chr1 6792582 TTCTCTCC 0.40033 2:0|3:1 6 _reg_el 40399 68 9 0 67925805 7 ATAT 38 5 - 100 8 9 ement 83 6 NA NA A A A A A A A A A A A A A A A A- gRNA_ CTTTGTGT 6 putative 0.7 0.2 694__3 11549553 1154955 AGCCTCTG 0.32511 2:1|3:1 9 _reg_el 43163 6 chr1 6 58 AACC 52 3 + 176 4 36 ement 86 24 NA NA A A A A A A A A A A A A A A A A0.0 gRNA_ CTTAGAGC 7 putative 41 0.1 701__1 3263145 CTACTGCT 2:0|3:1 0 _reg_el 56189 3 chr8 32631437 9 GCTG 59 034447 + 100 1 13 ement 3 36 NA NA A A A A A A A A A A A A A A A A- - GATCTAGA 7 putative 1.7 1.0 gRNA_ 1051347 CGACTTGG 0.81666 2 _reg_el 98771 722 1 chr5 10513456 8 AGCT 46 7 - 12:0|3:1 2 1 ement 94 9 NA NA A A A A A A A A A A A A A A A A- GTTGAGTG 7 putative 1.4 1.0 gRNA_ 7463712 TTATACAC 0.34499 3 _reg_el 31794 735 4 chr3 74637107 9 ACAG 82 3 - 92:0|3:9 5 4 ement 25 38 NA NA A A A A A A A A A A A A A A A A1.0 gRNA_ GGAAGGCT 7 putative 96 0.9 740__2 13208494 1320849 GTTCTGCT 0.24504 2:0|3:1 4 _reg_el 62572 6 chr6 3 65 TGGT 49 1 - 166 0 26 ement 2 51 NA NA A A A A A A A A A A A A A A A A- - gRNA_ AGGTGCTC 7 putative 0.9 0.1 754__1 chr1 12029295 1202929 TCGCGAAT 5 _reg_el 31328 4 2 3 75 CAGC 54 090571 + 12:0|3:1 4 14 ement 08 4 NA NA A A A A A A A A A A A A A A A A0.0 - AAGAGCAG 7 putative 84 0.1 gRNA_ 2955693 ATTTCACT 0.58247 7 _reg_el 65747 774 5 chr8 29556913 5 CACC 55 8 + 82:0|3:8 4 5 ement 4 2 NA NA A A A A A A A A A A A A A A A A- gRNA_ GGAGCTGT 7 putative 1.0 1.4 784__4 10944778 1094478 ATCTTTTCA 0.62270 8 _reg_el 15299 6 chr2 2 04 TAT 51 6 + 92:0|3:9 4 46 ement 95 88 NA NA A A A A A A A A A A A A A A A A0.0 gRNA_ CACCAGGT 8 putative 87 1.2 816__1 chr1 2744451 CAGGGTTA 0.46845 1 _reg_el 24230 7 6 27444497 9 AACC 59 6 - 92:0|3:9 6 17 ement 6 24 NA NA A A A A A A A A A A A A A A A A- - TCCAGATA putative 0.4 0.3 gRNA_ chr1 12875975 1287597 AAAACGTC 0.61798 8 _reg_el 25948 82 9 1 4 76 TACT 48 7 + 42:0|3:4 2 9 ement 98 7 NA NA A A A A A A A A A A A A A A A A- gRNA_ AAATTATCT 8 putative 1.9 0.1 842__2 8472221 TAACCTCT 0.28903 2:0|3:2 4 _reg_el 21900 7 chr7 84722197 9 CTC 53 6 - 266 2 27 ement 91 63 NA NA A A A A A A A A A A A A A A A A- gRNA_ AGCAAATT 8 putative 0.4 0.6 868__2 3551681 ATGGTCCC 0.28240 2:0|3:1 6 _reg_el 47311 0 chr9 35516792 4 TGCC 43 1 + 100 8 20 ement 16 34 NA NA A A A A A A A A A A A A A A A A- AGCGATGG 8 putative 0.6 0.1 gRNA_ AGTCGTAC 0.94748 7 _reg_el 22582 875 1 chr4 7857260 7857282 TTTC 30 4 - 22:0|3:2 5 1 ement 75 47 NA NA A A A A A A A A A A A A A A A A- TCATCTTT 8 putative 1.3 0.9 gRNA_ chr1 CATGTGGC 0.60475 7 _reg_el 61398 878 32 5138594 5138616 GGCC 38 4 + 42:0|3:4 8 3 ement 61 82 NA NA A A A A A A A A A A A A A A A A A66 68 - - RNA ACTCATGA 8 t tiv 14 02 A A A A A A A A A A A A A A A A AgRNA_ AATTCGAG 9 putative 0.2 0.5 906__1 17983838 1798384 TCATAGAA 0.21152 2:0|3:1 0 _reg_el 04000 7 chr1 8 10 TGTT 41 5 - 144 6 17 ement 98 04 NA NA A A A A A A A A A A A A A A A A A53782 88 3 - - TAGTAAGG 9 t tiv 05 05 A A A A A A A A A A A A A A A A A51 08 - ACTAATGT 9 t tiv 05 05 A A A A A A A A A A A A A A A A A ACGCAGATC positive MYH9_ chr2 3638796 ACCGCGGT N _CTL_T gRNA_72_ 1 2 36387949 8 TCCT NA NA - NA NA A NA SS NA NA _1 NA CCGGGTG itiv RNA 72 A A A A A A A A A A A A A A A A A A A A A Anon_tar CTAAATATT negativ geting_ TGTAACTC N N e_contr _25 NA NA NA TCC NA NA A NA NA A 25 ol NA NA NA NA n n t r TGGGCTTA n tiv A A A A A A A A A A A A A A A A A A A A A Anon_tar GTTAGATA negativ geting_ ATACGAGC N N e_contr _46 NA NA NA ACTA NA NA A NA NA A 46 ol NA NA NA NA n n t r CAATTGAA n tiv A A A A A A A A A A A A A A A A A A A A A Anon_tar TTGAACTG negativ geting_ CGGGTGAA N N e_contr _67 NA NA NA CGTC NA NA A NA NA A 67 ol NA NA NA NA n n t r GTCGACAA n tiv A A A A A A A A A A A A A A A A A A A A A Anon_tar TAGATTGT negativ geting_ TGCACTAA N N e_contr _88 NA NA NA CGGA NA NA A NA NA A 88 ol NA NA NA NA n n t r TCTTTCCA n tiv A A A A A A A A A A A A olc to etA olc to etA olc to etA A A[000201] BMF / FZD2 Enhancer Characterization [000202] Luciferase Enhancer Reporter Assays. BMF / FZD2 / MYH9 regions with differential accessibility were identified, and primers were designed to amplify these regions from gDNA isolated from the HFF cell-lines. Briefly, 2x 25 µL reactions were run wherein 30 ng gDNA was input with 2x KAPA HiFi Hot Start MM and 0.75 µL of 10 µM PCR primers (TABLE 4) for eitherRegion #1 / 2 / 3 with an annealing temp of 63°C. Sequences were confirmed via Sanger sequencing. These enhancer fragments were then assembled into an improved STARR-seq enhancer luciferase reporter vector (Muerdter et al., Nat Methods.2018; 15(2): 141-149) via Gibson assembly and clones were sequences via Sanger sequencing to confirm the fragment addition. To perform the luciferase assay, 15k HFF cells and 10k A549 cells were seeded per well into a 24 well-plate one day prior to transfection, and the day of transfection fresh media was added immediately prior to lipofection, with either DMSO only or blebbistatin (2 μM, 10 μM, 40 μM), Y-27632 (10 μM), nocodazole (10 μM) were added. Lipofectamine™ LTX (2.25 μL per well for HFF, 2.5 μL per well for A549) was used to transfect luciferase reporter plasmids (300 ng for HFF, 500 ng for A549) at a mass ratio of 90% experimental firefly luciferase plasmid to 10% Renilla luciferase pRL-CMV control plasmid (Promega, Madison, WI) into cells. Cells were harvested 24 hours later, and the Dual-Glo®Luciferase Assay (Promega, Madison, WI) was performed according to manufacturer's instructions, with luciferase activity read on a GloMax®Discover instrument (0.3s integration time; Promega, Madison, WI). The average of four blank wells was then set as the background level and subtracted from all experimental values. Firefly luciferase values for each well were normalized to the Renilla luciferase values. Each experiment was further normalized to the performance of an empty luciferase reporter plasmid or FZD2 pRE reporter levels as baseline. TABLE 4. Sequences and primers for luciferase assay cloning. FWD REV G C G CT A CT TC C C A A C A A T T T G CCAGCTTAAGTTCCAGAAAACCACTCACTAATAACTA GAGAATCCCAAAGTGTCAGGAAGCAATCAGGGGCT CCCTGAACAAAGGATCCAGTCTGCTAGGCAGAGAA G T A G CA C C C G A T T C C A T G TC G C AC C G T A C G G A G C G T C G C A G C C G C GC C A C TGCCACAGAAGAGGCCTGGCAGACAGAGGGTGGGG AGATGGATGGCTTCCTCGTGTTTTGTAAACAAAGAT GAGTAAAAAGAGGAAACACACCCGGCTTAACAAAAT G G T CA A G C T T 1) G G T GC T C G C G A G A A CA AA G G A G G C C A C G G G AA G C A C A G T G T GAACCTGGAGGCAAGAAGGCCCACAAGCTGGGAGA CGGCAAGGCCTGGGTCACTTCCTGCAGTGAGGCAA CGTGACTACCAGGCAGAGGAGCCCAAATGTCTCCT C G TA T G A C C C T A A G G C A G C TG CA T A T G A G A TA T C A CT A A G A C T T G GT G C G T T AAGGTATGCACAACCAGATGCTTGCAGAGTGACTGG GTCAGCCCCAGCTTCAAAGAGGCTATATCAGTCTAT CCCCAAAACTGAAGTCCCTTGTAGATTTTTTCTTTCT C A A C G T TT T T C T A G A A G G G A C TC[000203] Latrunculin A Induction experiment culture. Oligos containing protospacer sequences were synthesized by IDT (Coralville, IA) and cloned into an all-in-one lentiviral vector expressing dCas9-KRAB-P2A-PuroR from an hUbC promoter and a gRNA from an hU6 promoter (Addgene, Watertown, MA; plasmid #71236). All gRNA were selected as (-) strand gRNA to minimize the strand-bias artifact (see Supplementary Text 1 below). Sanger sequencing was used to confirm the identity of the gRNA. Lentivirus was generated as described above for MYH9. HFF cells were transduced and seeded per well in a 24 well-plate on day 0, by adding 25 µL of 20x concentrated virus along with 5k cells and growth media. 24 hours post-transduction, lentivirus was removed. Antibiotic selection was applied for four days and cells were grown for eight days post-transduction. At 9 days post-transduction cells were trypsinized, and were re-seeded at 5k HFF cells / well in a 24 well-plate for RNA experiments or 20k HFF cells / well in a 12WP for Caspase 3 / 7 experiments. To model detachment, on 11 days post-transduction the media was replaced with growth media containing either DMSO or 0.5 µM Latrunculin A. Cells were harvested for RNA or Caspase-Glo®3 / 7 analysis one day following the addition of Latrunculin A.[000204] RNA expression and Caspase 3 / 7-Activity assays. mRNA was isolated using the Total RNA Purification Kit (#17250; Norgen, Ontario, Canada) according to the manufacturer's protocol. 100 ng mRNA was used as input for cDNA amplification using the Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit. For RT-qPCR, each reaction contained 1 µL cDNA, 7 µL H20, 1 µL TaqMan®probe for TBP, 1 µL TaqMan®probe for BMF, and 10 µL Quantabio®PerfeCTa®FastMix®II. Delta delta Ct analysis was performed in Microsoft Excel. Graphpad Prism was utilized to conduct one-way ANOVA tests followed by Tukey’s HSD for post-hoc testing. Significance is reported in the figures as follows: *p-value < 0.05, **p-value < 0.01, ***p- value < 0.001. TaqMan®probe information provided in TABLE 2. For Caspase-3 / 7 activity assays, HFF cells were subjected to the Caspase-Glo®3 / 7 Assay (Promega, Madison, WI) and CellTiter-Glo®Assay (Promega, Madison, WI) according to manufacturer’s instructions with luciferase values read out on a GloMax®Discover instrument (0.3s integration time; Promega, Madison, WI). The average of two blank wells per assay was then set as the background level and subtracted from all experimental values. Caspase-Glo®3 / 7 values per group were further normalized to cell counts per group determined from the CellTiter-Glo®data. [000205] Bulk growth and migration functional CRISPRi screens [000206] Library design and cloning. The top 1000 regions from the ATAC-seq data that were increasingly-accessible on the stiff 50 kPa substrates as compared to the soft 1 kPa substrate were used as input to generate an oligo pool. For each peak, any gRNA that had a GuideScan specificity score of > 0.2 was included, which has previously been shown to increase the quality of non-coding screens (Tycko et al., Nat. Commun.2019; 10, 4063). This resulted in 969 peaks represented in the library, with an average of ~20 gRNA / peak. Also, 1,000 non-targeting gRNA (Horlbeck et al., Elife.2016; 5: e19760), and 249 promoter-targeting gRNA for 83 positive control genes that have previously been shown to be key modulators of transwell migration following RNAi screens (Seo et al., Nat Commun.2014; 5: 5217), with 3 gRNA per gene taken from the Dolcetto library were included (Sanson et al., Nat Commun.2018; 9(1): 5416). This combined gRNA library of 21,458 gRNA was synthesized as an oligo pool by Twist Biosciences (South San Francisco, CA) with common overhangs for cloning into the lentiviral backbone. This oligo pool was PCR amplified, pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR (Addgene, Watertown, MA; plasmid #162335) was digested with Esp3I and gel purified, and then the oligo pool and digested vector were ligated by Gibson assembly. Following a 1x SPRI cleaning, the Gibson assembly was transformed into Endura™ competent cells (Lucigen, Middleton, WI) according to the manufacturer's protocol, and cultured overnight before maxi-prepping thegRNA-library plasmid. A PCR amplicon across the gRNA region of the resulting plasmid was sequenced to a depth of ~100k-1M read pairs on an Illumina®miSeq™ in order to verify coverage across the entire gRNA library (FIGS.31A-31D). [000207] Lentiviral generation and functional tittering. Concentrated lentivirus was generated by the Duke Viral Vector Core from this plasmid pool. Functional titering to determine MOI was performed by transducing HFF cells across a 50x-10,000x dilution range of the viral stock, and then subjecting the cells to a qPCR-based titering protocol that has been previously described in detail (Gordon et al., Nat Protoc.2020; 15(8): 2387-2412). [000208] Migration / Growth pRE library screen. To perform screening, 600k HFF cells were transduced with the lentiviral library virus at 10.8 MOI to achieve a coverage of ~279 cells per gRNA. 20 hours after transduction the viral media was removed and replaced with fresh media and starting 48 hours after transduction HFF cells were selected with 1 µg / mL puromycin for 4 days. Puromycin selection media was then removed and HFF cells were grown out for two additional days until day 8. On day 8, ~11M cells were counted and split between migration and growth screens. Coverage of at least 279 cells / gRNA was maintained for each group throughout the entire experiment. [000209] Migration Screening: On day 8, the bottoms of 8 µm transwell inserts for 6WP were coated with 10 µg / mL fibronectin at room temp for 45 minutes and then rinsed 1x with PBS for 30 minutes before use. HFF cells were counted, placed into low serum conditions (0.2% FBS), and seeded at 240k cells per transwell insert across 18 inserts (~4.4M cells total). These inserts were placed into 10% serum and cells were allowed to migrate for 24 hours. Following this first day of migration, each side of the membrane was separately trypsinized and counted, where 27% of the initial cells were recovered as migratory cells (~1.2M cells) and non-migrated cells were recovered from the top of the insert. These migratory and non-migratory populations were re-seeded (separately by group) in the same way on new fibronectin-coated transwell inserts, with 4-5 inserts seeded at 240k cells / insert and allowed to migrate overnight. Following these two rounds of migration, the cells that either migrated twice or did not migrate twice (with a similar number of cells, 24%, being found to have migrated during this second round) were trypsinized and collected, and gDNA were isolated using DNeasy®kits (Qiagen, Hilden, Germany).[000210] Growth Screening: HFF cells were counted on day 8 post-transduction, and gDNA from 2M HFF cells were harvested as the “Day 0” reference population using a DNeasy®Blood and Tissue Kit (Qiagen, Hilden, Germany). Around 1M HFF cells were reseeded into 15 cm dishes for ongoing culture, and then serially-passaged as normal for 14 doublings (either 21 days post-“Day0” for replicate 1 or 22 days post-“Day0” for replicate 2) while maintaining at least 1M cells per dish during each passaging, prior to the final gDNA harvest using a DNeasy®Blood and Tissue Kit (Qiagen, Hilden, Germany). [000211] Library preparation and sequencing. All gDNA was split between sample-indexed 100 µL Q5 PCR reactions (up to ~340 ng max input per 100 µL reaction) to amplify out the gRNA protospacer from HFF cells. These PCRs from gDNA were run as follows [98°C for 30s / 25x: 98°C for 10s, 60°C for 30s, 72°C for 15s / 72°C for 2 min] with primers in TABLE 1, followed by individual PCRs being pooled together and subjected to a double-sided 0.65X / 1X SPRI clean-up. Quality control was performed by running the amplified libraries out on a High Sensitivity D1000 TapeStation®(Agilent, Santa Clara, CA) to confirm expected size, and Qubit®dsDNA HS assays were performed to determine a final concentration. All libraries were pooled to an effective concentration of 4 nM and combined in equal volumes prior to sequencing on an Illumina®MiSeq™, using a v250 cycle reagent kit with Read1 being 21 cycles (protospacer) and index read 1 being 6 reads (sample barcoding). [000212] Screen analysis. Resulting FASTQ files were aligned to a custom reference sequence corresponding to the given gRNA library using bowtie2 and all downstream analyses were performed in R. All gRNA were verified to be represented in the baseline untreated library at day 8 post-transduction, and counts+1 for each gRNA were taken (to normalize for samples that dropped out in one condition) and normalized by sequencing depth for each library before downstream analysis (in counts per million reads sequenced, ‘CPM’). For migration screens: A ratio was taken of the CPM for each gRNA of the 2x migrated group to the 2x non-migrated group to identify migratory or non-migratory enrichment. For growth screens: A ratio was taken of the CPM of the Day 0 population relative to the final Day 21 / 22 population for each replicate. Next, for each screen replicate the Z-score was calculated for each gRNA relative to the control non-targeting gRNA population using similar methodologies as previously described (Han et al. Nature, 2020; 580(7801): 136-141). First, each sample’s ratio was converted to a log2 fold- enrichment, and population statistics for the negative control non-targeting gRNAs (median, standard deviation, gRNA number) were calculated. For each individual gRNA, the median of the negative control fold-enrichment was subtracted from each individual gRNA’s log2 fold-enrichment value, and this value was further divided by the standard deviation of the negative control non-targeting gRNA population to get an individual Z-score relative to the negative control population. Raw Z-score values from both replicates were pooled to calculate pRE-level effects. An individual gRNA was called as a “hit” if the Z-score was above 2 or below -2. pRE- level stats were generated by performing a Fisher’s exact text relative to the non-targeting gRNA population, and a pRE-level was labeled significant for follow-up if the p-value was less than 0.1. To select pREs for validation in single cell RNA-seq, the pRE hits that had more than one gRNA as a “hit” and had at least 10 gRNA / DHS were further selected in order to enable higher-powered analysis of the downstream data. [000213] Comparison of phenotype scores between regions regulating growth, migration, or both phenotypes. Each significant region was labeled for the phenotype it regulated (one of growth, migration, or both). The phenotype (pZ) scores were compared between the three groups using a One-way ANOVA test followed by Tukey’s post-hoc tests using the aov and TukeyHSD functions in R. [000214] Chromatin accessibility of significant screen regions in IPF vs unaffected control tissue. ATAC-seq peak calls were obtained from GSE180242 (Hanmandlu et al., Am J Respir Cell Mol Biol.2022; 66(1): 53-63). The pREs that were significant in either bulk screen with the peak calls were intersected using bedtools intersect. Then, a Student’s t-test was performed comparing the fold change in chromatin accessibility for all overlapping peaks in IPF lung tissue vs unaffected control lung tissue using the t.test function in R. [000215] Analysis of chromatin accessibility across ENCODE biosamples. The union set of DNase peak calls across 95 ENCODE biosamples were obtained using the ‘Table Browser’ utility on the UCSC Genome Browser (downloaded February 2023; ‘wgEncodeRegDnaseClustered’). The union DNase peak calls were intersected with all regions included in the bulk screen library using bedtools intersect. Next, each region significant in at least one of two screens was labeled as ‘1’ or ‘0’ if the region did or did not overlap an accessible region in at least one biosample, respectively. The region X biosample visualization was generated using the pheatmap package in R with the following parameters: scale = “none”, cluster_cols = TRUE, cluster_rows = TRUE. To extract the clusters, the cutree_col function specifying h=8 was used. Then, the phenotype scores between each cluster were compared by performing one-way ANOVA tests followed by Tukey’s post-hoc tests using the aov and TukeyHSD functions in R.[000216] To determine if significant screen regions were enriched or depleted from accessible regions in specific biosamples, Fisher’s exact tests were performed separately for each biosample comparing the number of significant and nonsignificant screen regions that overlapped or did not overlap an accessible region using the fisher.test function in R. [000217] Single cell RNA-seq screen [000218] gRNA library design and cloning. Following hit identification from the combined migration and growth screens (as described above), a library was designed that included the top 10 gRNA by pZ value across either screen for the 87 hit pRE (870 gRNA total). 100 non- targeting control gRNA with similar sequence composition to the targeting gRNAs were included in the library, and 25 gRNA targeting the promoters of contractile genes including MYH9, RANGAP1, and CRIM1 were included, as well as the top gRNA from the MYH9 intron 3 enhancer as positive controls. In total the library contained 1005 gRNA sequences, which were synthesized as an oligo pool by Twist Biosciences (South San Francisco, CA) with common overhangs for cloning into the lentiviral backbone. This oligo pool was PCR amplified, and a hU6-driven lentiviral gRNA CROP-seq vector (pLRB104) was then digested with Esp3I, gel purified, and then ligated along with the amplified oligo pool by Gibson assembly. Following a 1x SPRI cleaning, the Gibson assembly was transformed into Endura™ competent cells (Lucigen, Middleton, WI) according to the manufacturer's protocol, and cultured overnight before maxi-prepping the gRNA-library plasmid. A PCR amplicon across the gRNA region of the resulting plasmid was sequenced to a depth of ~100k-1M read pairs on an Illumina®miSeq™ in order to verify coverage across the entire gRNA library (FIGS.31A-31D). [000219] Lentiviral generation and functional tittering. gRNA library plasmid was co- transfected into ~18M HEK293T cells along with two lentiviral packaging plasmids using Lipofectamine™ 3000 (ThermoFisher, Waltham, MA). 20 hours post-transfection, the growth media was removed, and fresh growth media was added. Media containing viral particles was removed at 48 hours, replaced, and removed at 72 hours post-lipofection before being stored at 4°C. Combined media containing viral particles was filtered through 0.45 μm low-protein binding filters, and then concentrated using Lenti-X™ Concentrator (Takara Bio, San Jose, CA) according to the manufacturer’s protocol. Functional titering to determine MOI was performed by transducing HFF cells across a 50x-10,000x dilution range of the viral stock, and then subjecting the cells to a qPCR-based titering protocol that has been previously described in detail (Gordon et al., Nat Protoc.2020; 15(8): 2387-2412).[000220] Single cell CRISPRi screen. To perform screening, 775k HFF cells stably expressing dCas9-KRAB were transduced at 0.33 MOI with the CROP-seq lentivirus to maintain a coverage of at least 150 cells / gRNA. Following 20 hours, viral media was removed and replaced with regular growth media, and 48 hours post-transduction the cells selected with puromycin (1.5 µg / mL) for 4 days. Following puromycin selection, HFF cells were maintained until day 8, at which point cells were trypsinized and 150k cells were moved on to library prep. [000221] Single cell RNA-seq library preparation. Cells were washed 3x with PBS and then resuspended to a final concentration of 1000 cells / µL. Approximately 20,000 cells were loaded onto each channel of a 10X Genomics’ 3’ Gene Expression (GEX) v3.1 assay chip. Downstream processing was performed according to the manufacturer’s protocol. To recover the protospacer sequences (gRNA libraries), a tri-nested PCR was performed separately for each GEX library using 10% of the purified cDNA as input to reaction 1 as previously described (Gasperini et al., Cell.2019; 176(1-2): 377-390.e19). Briefly, 4 ng cDNA was input into a 50 µL reaction with KAPA HiFi and PCR primers prLRB470 and prLRB471 (TABLE 5). The reaction was amplified for 12 cycles and then purified using 25 µL of AMPure®XP DNA beads and eluted in 25 µL H20. 1 µL of the purified sample was input into reaction 2 using PCR primers prLRB472 and prLRB473 (TABLE 5). The reaction was amplified for 14 cycles and purified as described above. 1 µL of the purified sample was input into reaction 3 using PCR primers prLRB473 and prLRB289-302 (TABLE 5), amplifying each sample with a unique i7 sequencing index. The reaction was amplified for 7 cycles, purified using 25 µL of AMPure®XP DNA beads (Beckman Coulter, Brea, CA; #A63881), and eluted in 25 µL Buffer EB®(Qiagen, Hilden, Germany; #19086). Quality control of final libraries was performed prior to sequencing using the Agilent®2200 TapeStation®with High Sensitivity DNA 5000 reagents, Qubit®High Sensitivity dsDNA reagents, and KAPA Library Quantification Kit for Illumina®platforms. TABLE 5. Primers used for CROP-seq recovery from 10X cDNA. PCR n mb Prim r n m DNA Prim r S n T C3 prLRB473_R1-P5AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG (SEQ ID NO: 852)CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCCCCCCCC[000222] Sequencing. GEX libraries were pooled and sequenced on a NovaSeq™ 6000 S4 flow cell using the parameters: 28x10x10x90. gRNA libraries were pooled and sequenced on a NovaSeq™ 6000 S1 flow cell using the parameters: 28x10x10x90. [000223] Data processing. Cell Ranger: All data processing steps were performed using CellRanger®v6.0.1 and the human reference genome (‘refdata-gex-GRCh38-2020-A’) was downloaded from 10X Genomics’ software downloads webpage. Fastq files for each flow cell lane and sequencing run were generated from .bcl files using the CellRanger®mkfastq pipeline. The corresponding fastq files for each sample were then merged. The merged fastqs were then processed using the CellRanger®count pipeline with the number of expected cells specified (-- expect-cells = 15000). The gene expression libraries were then aggregated using the CellRanger®aggr pipeline. The gRNA libraries were aligned to a custom bowtie index containing all protospacer sequences included in the pooled gRNA library and the UMI counts corresponding to each gRNA-cell pair were obtained.[000224] Seurat: The gene expression and gRNA UMI count data was imported into Seurat v3.1. A gRNA was defined as ‘observed in a cell’ if the gRNA had at least 5 UMI counts and comprised at least 0.5% of the total gRNA UMI counts in that cell. Then, the total percent of mitochondrial reads per cell were calculated and filtered for quality cells as follows: cells[["percent.mt"]] <- PercentageFeatureSet(cells, pattern = "^MT-") cells <- subset(cells, subset = nCount_RNA > 10000 & percent.mt < 20) [000225] Differential expression analysis. Using the gRNA-cell assignments, differential expression testing was performed using the MAST framework (Finak et al., Genome Biol.2015; 16:278) within Seurat v3.1 (Stuart et al., Cell.2019; 177(7): 1888-1902.e21), comparing cells in which a given gRNA was observed versus all other cells with at least one gRNA observed excluding the given gRNA and testing all genes within + / - 1 Mb of the midpoint of the pRE in which the gRNA is located. Gene coordinates were obtained from the Ensembl Human Gene v104 reference file. P-values were then FDR-corrected on an individual gRNA-level for all tests. All genes within + / - 1 Mb of any targeting gRNA were used as input features for NT gRNA tests (N=1,313). Significant gRNA-gene and corresponding pRE-gene pairs are defined as FDR < 0.01. [000226] Calculation of interaction distance (ep_length). The distance between the gRNA and the paired gene was calculated as follows: 1) the gRNA midpoint (gRNA_mid) was defined as (gRNA_start + gRNA_end) / 2, the gene start coordinate (gene_start) was defined as the start coordinate for genes on the ‘+’ plus strand, and end coordinate for genes on the ‘-’ strand. ‘ep_length’ was calculated as gRNA_mid - gene_start. [000227] Effect size comparison between targeting and control gRNAs. For each gene with a TSS- or validated enhancer-targeting gRNA, the avg_logFC of expression for the respective gene between TSS-control, enhancer-control, pRE-targeting, and NT-control gRNAs (FDR < 0.01) were compared using a one-way ANOVA followed by Tukey’s HSD with Bonferroni correction (adj. p-value). Significant differences in the change in gene expression were defined as adj. p-value < 0.05. [000228] Interaction distance versus effect size. Using all significant pRE-targeting gRNA gene pairs, the avg_logFC and effect size (avg_logFC*(1-FDR)) were plotted versus the log10-transformed ep_length (log10(abs(ep_length+1))). Spearman correlation R2 values were calculated using the ‘stat_cor’ function from the ‘ggpubr’ R package. [000229] Nearest gene prediction analysis. For each potential pRE-gene pair, the number of genes “skipped” by the element were calculated to regulate the gene as follows. First, for the significant pRE-gene connections, the start and end coordinates were defined for a given element and the start and end coordinates, and strand were defined for the paired gene. Next, the number of genes detected in the gene expression dataset were counted for which the entire gene body was contained within the region between the element and the connected gene. This was repeated for all significant pRE-gene connections. [000230] Comparison to microC looping. Chromatin contact data were obtained and intersected all targeted pREs, TSS regions (+ / - 1kb) of every gene and all genes for which a differential expression test was performed, separately extended by + / - 500bp with anchor 1 and anchor 2, using bedtools window -w 500. Then, the number of pREs, TSSs, and genes with at least one chromatin contact, defined as at least one intersection with anchor 1 or anchor 2, was quantified. Next, for all regions that intersected a region in the anchor 1 set, the number of pRE-gene pairs for which the corresponding contact in the anchor 2 set overlapped either the same TSS / gene or a different TSS / gene was quantified. This was repeated for pREs intersecting the anchor 2 set with comparison of contacts for TSSs / genes in the anchor 1 set. TABLE 6. Publicly available datasets used in this study. Source Description Location / Accession ID downloads wen lab or / V3 / Gta m _ ta m _4D Nucleome HFF ATAC 4DNESMBA9T3L PMID: 32213324 HFF micro-C 4DNFI18Q799K[000231] Comparison to ENCODE candidate cis-regulatory elements (cCREs) and chromHMM annotations. cCRE annotations were obtained from all human tissues and chromHMM annotations in human foreskin fibroblast primary cells (TABLE 6). The cCREs and annotated regions were intersected with all regions included in the bulk screen and single cell screen libraries using bedtools intersect. To determine if significant screen regions were enriched or depleted from accessible regions in specific biosamples, we performed Fisher’s exact tests comparing the number of significant and nonsignificant screen regions that overlapped or did not overlap an annotation using the fisher.test function in R. [000232] Gene overrepresentation and transcription factor enrichment tests. The union set of all genes with at least one significant pRE link (FDR < 0.01, N=196) were queried using the ‘enrichr’ function from the ‘enrichR’ R package with default parameters and the following databases: ‘DisGeNET’, ‘ENCODE_and_ChEA_Consensus_TFs_from_ChIP-X’, ‘ClinVar_2019’, ‘MSigDB_Hallmark_2020’, and ‘OMIM_Disease’. Over-represented pathways were defined as adj. p-value < 0.05. [000233] Chromatin accessibility of significant screen regions in IPF vs unaffected control tissue. ATAC-seq peak calls were obtained from GSE180242 (Hanmandlu et al., Am J Respir Cell Mol Biol.2022; 66(1): 53-63). The pREs connected to at least one gene were intersected with the peak calls using bedtools intersect. Then, a student’s t-test comparing the fold change in chromatin accessibility for all overlapping peaks in IPF lung tissue vs unaffected control lung tissue was performed using the t.test function in R. [000234] Single cell screen versus individual gRNA validations. For the 10 pRE-gene connections with at least one significant individual gRNA validation, the Spearman correlation (R2) and p-value between the change in mRNA expression measured via RT-qPCR (DDCt) versus the gene expression change observed in the single cell screen (avg_logFC of the mostsignificant gRNA-gene connection per DHS) were calculated using the ‘stat_cor’ function from the ‘ggpubr’ R package. [000235] Differential expression of linked genes in primary lung tissue single cell RNA- sequencing data. Differential gene expression results were obtained from single cell profiling of healthy lung tissue and of lung tissue from individuals with IPF (GEO accession: GSE135893) (Habermann et al., Sci Adv.2020; 6(28): eaba1972). For each cell type and / or disease context, the effect size (avg_logFC*(1-pval_adj) between pRE-connected genes and other genes was compared using a permutation test framework. First, the difference in effect size for pRE- connected genes versus all other genes in the dataset was calculated. Then, the genes in each group were randomly permuted and the difference in the mean effect size was calculated. This was repeated 10,000 times and a one-tailed p-value was calculated as the number of times the permuted difference was greater than the observed difference divided by the number of permutations. [000236] Individual gRNA validations. Oligos containing protospacer sequences were synthesized by IDT (Coralville, IA) and cloned into pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR (Addgene, Watertown, MA; plasmid #162335). Sanger sequencing was used to confirm the identity of the gRNA. Lentivirus was generated as described above. dCas9-KRAB expressing HFF cells were seeded onto TCP and transduced on day 0. 24 hours post-transduction, lentivirus was removed. Antibiotic selection was applied, and cells were harvested eight days post-transduction. mRNA was isolated using the Total RNA Purification Kit (#17250; Norgen, Ontario, Canada) according to the manufacturer's protocol. 100 ng mRNA was used as input for cDNA amplification using the Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit. For RT-qPCR, each reaction contained 1 µL cDNA, 7 µL H20, 1 µL TaqMan®probe for TBP, 1 µL TaqMan®probe for gene of interest, and 10 µL Quantabio®PerfeCTa®FastMix®II. Delta delta Ct analysis was performed in Microsoft Excel. Graphpad Prism was utilized to conduct one-way ANOVA tests followed by Tukey’s HSD for post-hoc testing. Significance is reported in figures as follows: *p-value < 0.05, **p-value < 0.01, ***p-value < 0.001. TaqMan®probe information is provided in TABLE 2. [000237] Individual gRNA validations: A549. Oligos containing protospacer sequences were synthesized by IDT and cloned into pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR (Addgene, Watertown, MA; plasmid #162335). Sanger sequencing was used to confirm the identity of the gRNA. Lentivirus was generated as described above. dCas9-KRAB expressing A549 cellswere seeded onto TCP and transduced on day 0. 24 hours post-transduction, lentivirus was removed and replaced with fresh media. 2 days post-transduction, antibiotic selection was applied. 8 days post-transduction, cells were seeded on 24 well Matrigen®dishes of varying stiffness (1 kPa or 50 kPa elastic modulus) or TCP at slightly variable densities to account for reduced cell attachment on softer substrates (20,000 on 1 kPA and 12,500 on 50 kPa / TCP) and allowed to culture for 20 hours overnight. mRNA was isolated using the Total RNA Purification Kit (Norgen, Ontario, Canada; #17250) according to the manufacturer's protocol. 100 ng mRNA was used as input for cDNA amplification using the Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit. For RT-qPCR, each reaction contained 1 µL cDNA, 7 µL H20, 0.5 µL TaqMan®probe for TBP, 0.5 µL TaqMan®probe for gene of interest, and 10 µL Quantabio®PerfeCTa®FastMix®II. Delta delta Ct analysis was performed in Microsoft Excel. Graphpad Prism was utilized to conduct one-way ANOVA tests followed by Tukey’s HSD for post-hoc testing. Significance is reported in the drawings as follows: *p-value < 0.05, **p-value < 0.01, ***p-value < 0.001. TaqMan®probe information is provided in TABLE 2. [000238] Individual gRNA validations: HFFs. Oligos containing protospacer sequences were synthesized by IDT and cloned into pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR (Addgene, Watertown, MA; plasmid #162335). Sanger sequencing was used to confirm the identity of the gRNA. Lentivirus was generated as described above. dCas9-KRAB expressing HFF cells were seeded onto TCP and transduced on day 0. 24 hours post-transduction, lentivirus was removed and replaced with fresh media. 2 days post-transduction, antibiotic selection was applied. 8 days post-transduction, cells were seeded on 24 well Matrigen®dishes of varying stiffness (1 kPa or 50 kPa elastic modulus) or TCP at slightly variable densities to account for reduced cell attachment on softer substrates (30,000 on 1 kPA and 18,750 on 50 kPa / TCP) and allowed to culture for 20 hours overnight. mRNA was isolated using the Total RNA Purification Kit (Norgen, Ontario, Canada; #17250) according to the manufacturer's protocol. 100 ng mRNA was used as input for cDNA amplification using the Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit. For RT-qPCR, each reaction contained 1 µL cDNA, 7 µL H20, 0.5 µL TaqMan®probe for TBP, 0.5 µL TaqMan®probe for gene of interest, and 10 µL Quantabio®PerfeCTa®FastMix®II. Delta delta Ct analysis was performed in Microsoft Excel. Graphpad Prism was utilized to conduct one-way ANOVA tests followed by Tukey’s HSD for post-hoc testing. Significance is reported in the drawings as follows: *p-value < 0.05, **p-value < 0.01, ***p-value < 0.001. TaqMan®probe information is provided in TABLE 2. [000239] Patient Derived Lung Fibroblast Isolations and Validations[000240] Human lung tissue dissociation. Human lung dissociation was performed as described previously (Katsura et al., Cell Stem Cell.2020; 27(6): 890-904.e8). Briefly, approximately 2-3 grams of human lung tissue was washed with PBS containing 1% Antibiotic- Antimycotic followed by removal of pleura, small airway and visible vasculature. Remaining tissue was cut into small pieces followed by incubation with enzyme mixture (Collagenase type I: 1.68 mg / mL, Dispase: 5 U / ml, DNase: 10 U / ml) at 37°C for 1-1.5 hours with rotation. The cells were filtered through a 100 μm strainer and rinsed with DMEM containing 10% FBS. Cell suspension was spun down at 450 g for 10 min and the cell pellet was resuspended in red blood cell lysis buffer for 5 min, washed with DMEM containing 10% FBS and filtered through a 40 μm strainer. Total cells were centrifuged at 450 g for 5 min at 4°C and the cell pellet was used for isolation of fibroblasts. [000241] Primary human fibroblasts enrichment by MACS. Fibroblast enrichment was done using magnetic activated cell sorting (MACS) as previously described (Kadur Lakshminarasimha Murthy et al., Nature.2022; 604(7904): 111-119). Briefly, following lung dissociation, cells were incubated in MACS buffer (1% BSA, 2 mM EDTA, antibiotic / antimycotic in PBS, pH 7.2) containing CD146 (Miltenyi Biotec, Bergisch Gladbach, Germany; 130-093-596, 1:50), CD45 (Miltenyi Biotec, Bergisch Gladbach, Germany; 130-045-801, 1:50), and CD326 (Miltenyi Biotec, Bergisch Gladbach, Germany; 130-061-101, 1:50) microbeads at 4°C for one hour with rotation. Cells were then washed and incubated with CD31 biotinylated antibody (Miltenyi Biotec, Bergisch Gladbach, Germany; 130-110-805, 1:50) at 4°C for 10 minutes followed by washes and incubation with streptavidin microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany; 130-048-102, 1:10) at 4°C for 15 minutes. Magnetic separation of antibody bound cells was performed using LS columns (Miltenyi Biotec, Bergisch Gladbach, Germany; 130-042-401). Fibroblasts collected from the flowthrough were resuspended in fibroblast growth media (advanced DMEM / F12, Antibiotic / Antimycotic (Gibco, Waltham, MA; 15240062, 100X), HEPES (ThermoFisher Scientific, Waltham, MA; 15630080), GlutaMAX®(ThermoFisher Scientific; Waltham, MA; 35050061), B27 supplement (ThermoFisher Scientific; Waltham, MA; 17504044), N2 supplement (ThermoFisher Scientific; Waltham, MA; 17502048), N-acetylcysteine (Sigma-Aldrich, St. Louis, MO; A9165) and 10 ng / mL PDGFα (Biolegend, San Diego, CA; 773708), plated cultured on 5% Matrigel®(Corning, Corning, NY; 354230) coated dish. Media was changed every 2-3 days. [000242] Primary human fibroblast culture and viral transduction. To facilitate gene loss of function, fibroblasts were first transduced with lentivirus (1:50) containing dCas9-KRAB.Medium was changed 24 hours post transduction followed treatment with 8 µg / mL blasticidin for 5 days. Blasticidin-selected fibroblasts were then grown in fibroblast growth media without blasticidin for 24 hours, trypsinized, and re-plated in a 24 well plate. Fibroblasts were then transduced with one of the following lentiviruses (1:100): Skp2 gRNA, CCN1 gRNA, CCN2 gRNA, Mint3 gRNA, or non-targeting control. Medium was changed 24 hours after transduction, and fibroblasts were grown for one day in fibroblast growth media followed by treatment with 0.5 µg / mL puromycin for 3 days. After selection, the media was changed to either standard fibroblast growth media, or fibroblast growth media supplemented with 10 ng / mL hTGFβ1 (Biolegend, San Diego, CA; 580702). Cells were collected for RNA isolation on day 5. [000243] Immunofluorescence staining of primary human fibroblasts. Fibroblasts were fixed in 4% paraformaldehyde for 15 minutes at room temperature. Samples were washed three times with PBS, permeabilized with PBST (0.1%Triton-X 100 in PBS) followed by blocking and incubation with primary antibodies: PDGFRA (R&D Systems, Minneapolis, MN; AF-307-SP, 1:500), Ki67 (eBioscience, San Diego, CA; 14-5698-82, 1:500), and αSMA-cy3 (Sigma-Aldrich, St. Louis, MO; C6198, 1:500) overnight at 4°C with. Fibroblasts were washed 3 times with PBST and incubated with the following secondary antibodies: Donkey-anti-goat IgG Alexa Fluor 647 (Invitrogen, San Diego, CA; A-21447, 1:500) and donkey-anti-rat IgG Alexa Fluor 488 (Invitrogen, San Diego, CA; A-21208, 1:500) for one hour. Samples were then washed three times with PBST, once with PBST containing DAPI followed by one wash in PBST. Confocal images were captured using Olympus FV3000 microscope with 10X objective. Human lung specimens are shown in TABLES 7-8. TABLE 7. Healthy donors. Age Cause of death Smoking historyTABLE 8. IPF donors. Age Gender Smoking historyDonor 1 63 female Unknown Donor 2 75 male Unknown[000244] Supplementary Text 1. Strand bias of gRNAs in the MYH9 screen. In the MYH9 CRISPRi screen, it was noted that there was strong enrichment of Z-scores in a strand- dependent fashion, wherein nearly any gRNA that fell in the MYH9 gene body on the non- template (+) strand showed a strongly repressive phenotype (FIG.7). This intragenic strand bias is likely related to steric hindrance of dCas9 interfering with RNA polymerase. For subsequent analyses only gRNAs targeting the coding strand were utilized, which do not lead to the non-specific steric effects of dCas9 on MYH9 transcription (2,863 gRNA total). [000245] Supplementary Text 2. Accessibility of pREs regulating growth and migration phenotypes varies across diverse cell types. The pREs were intersected with accessible chromatin regions in ENCODE biosamples (N=95) and three clusters of pREs were observed: 1) pREs that overlap accessible regions in all or most biosamples (“ubiquitous”; N=79 regions), 2) pREs that overlap accessible regions in a majority of biosamples (“prevalent”, N=23 regions), and 3) pREs that overlap accessible regions only in biosamples of similar cell or tissue types (“lineage-specific”; N=13) (FIG.16). Additionally, similar proportions of pREs that also overlap an accessible region for cell types from similar lineages and / or with similar culture conditions (e.g., suspension versus adherent) were observed (TABLE 9). For example, 99.1% (N=114 / 115) and 96.5% (N=111 / 115) of pREs overlap accessible chromatin regions in fibroblasts from thigh (AG04449) and in human skeletal muscle myoblasts (HSMM), respectively, which are highly adherent cell types. H7 human embryonic stem cells (H7-hESC) are cultured on soft substrates and 49.6% (N=57 / 115) of pREs are accessible in that cell type, consistent with the intermediate level of H3K27ac signal of the MYH9 intronic mechanoenhancer. In contrast, only 19.1% (N=22 / 115) of pREs are accessible in K562 cells and Jurkat cells, with similar overlap observed in other blood lineage cell types (e.g., monocytes, GM12878). TABLE 9. Fisher’s exact test results for overlap of significant screen regions in ENCODE biosamples. biosamplefisher_pval_tfisher_OR_t fisher_pval fisher_OR fisher_pv fisher_O open close open close prop_si wo sidedwo sided greater greater al less R less sig d sig ns d ns g open 130 5AG04449 0.716284579 2.4499899950.320496002.4499899 0.911232 2.449989114 10.991304 3 95 576995837 18348 AG04450 0.377076997 0.7656228860.840039360.7656228 0.255469 0.765622 0.895652 6 86 386886103 12 785 70174 521 9 782 9 217 1 086 7 173 3 217 1 173 3 478 1 608 6 913 3 608 6 913 3 869 5 478 1 652 4 304 8 782 9 565 7 869 5 391 4 956 2 434 3 608 6 739 826 7 608 6 869 5 521 9 739 695 2HepG2 0.092938799 0.6241911530.973698880.6241911 0.046434 0.62419118 97 10.156521 3 53 9115396 659739 HFF 0.303176672 2.4818406450.150324072.4818406 0.952565 2.481840 0.982608 7 45 283645113 2 819 36696 956 2 826 7 130 5 391 4 695 2 956 2 434 3 130 5 130 5 739 434 3 652 4 608 6 217 1 086 7 521 9 739 260 695 2 478 1 391 4 217 1 130 5 739 608 6 304 8 304 8 086 7 739 782 9 347 6MCF-7 0.609269631 1.114454660.331050181.1144546 0.739082 1.114454 3 6 1176646 69 320 535 0.4MCF- 7+E tr di l 1000 765575925 1 0745074690.395968311.0745074 0.678137 1.07450756 59 401 4540.486956 2 130 5 434 3 304 8 739 391 4 956 2 478 1 869 5 521 9 173 3 347 6 565 7 173 3 652 4 304 8 913 3 652 4 913 3 304 8 521 9 391 4 869 5 173 3 521 9[000246] Supplementary Text 3. pRE accessible across various cell- and tissue-types regulates many genes. Of the “ubiquitous” pREs identified in FIG.16, chr1:28648521−28649567 was linked to >10 genes in the scRNA-seq screen (FIGS.19A-19C).After thresholding to remove small effect sizes, 10 pRE-gene links were considered, with 5 / 10 links having at least two gRNAs for each connection supporting the change in expression (FIGS.19A-19B). Notably, the pRE also overlaps five non-promoter FANTOM5 TSS peaks, all of which are annotated on the plus strand and could potentially indicate the presence of enhancer RNAs (FIG.19A). Also, significant enrichment of eight TFs in the promoters of the genes, including ZMIZ1 and ZNF384 was observed (FIG.19C). ZMIZ1 has previously been shown to regulate p53 signaling and ZNF384 regulates key ECM components and regulators including MMP1, MMP3, MMP7, and COL1A1. [000247] Supplementary Text 4. Example pREs that regulate cell migration. Validated pRE- gene linkages include intronic and intergenic regions of many genes known to regulate cell migration. For example, a region ~30kb downstream of the gene CYR61 / CCN1, a canonical YAP / TAZ transcriptional target has been strongly linked to migratory phenotypes (FIGS.12A- 12H and FIG.24A-24D). Epigenetic repression of this region led to ~50% reduction in CYR61 expression. Notably, this pRE overlaps an annotated TEAD1 / 3 binding site, which may suggest that YAP / TAZ binding may facilitate the gene expression and phenotypic changes. Additionally, perturbation of an intronic region of RASGRP1 led to decreased cell migration, decreased expression of RASGRP1 and SPRED1, and increased expression of FAM98B (FIGS.26A- 26C). RASGRP1 is a Ras GEF that activates the ERK / MAPK cascade and can tune migration, and SPRED1 also regulates ERK / MAPK cascade activation but has also been implicated in Neurofibromatosis Type 1-Like Syndrome and Noonan Syndrome, and was previously shown to reduce formation of F-actin stress fibers by inhibiting TESK1. FAM98B is a positive regulator of cell proliferation and has been implicated in colorectal cancer progression. Notably, the second intron of RASGRP1 contains functionally-validated single nucleotide variants implicated in systemic lupus erythematosus (SLE). Likewise, a region ~4.6kb upstream of RANGAP1 and ~10.7kb upstream of ZC3H7B regulated the expression of both genes (FIGS.27A-27E). Importantly, RANGAP1 is a crucial cytoplasmic-nuclear shuttling mediator, and it’s mechanoactivation further suggests a feedback loop wherein increased ECM stiffness can lead to enhancer activation, increased RANGAP1 expression, and increase nuclear to cytoplasmic shuttling, thereby reinforcing and amplifying mechanical signals. In contrast, a region ~200kb upstream was found to regulate DUSP4, which inhibits the ERK / MAPK cascade by negatively regulating ERK & JNK kinases (FIGS.25A-25D). [000248] Supplementary Text 5. Example pREs that regulate cell proliferation. Similar to pREs that regulated migration, the target genes for pREs regulating cell proliferation were alsoidentified. For example, one particular pRE, which when perturbed with dCas9KRABsignificantly regulated cell proliferation and is located ~135kb away from CTGF / CCN2, was found to function as a mechanoenhancer of CTGF. Repression of this pRE led to ~90% reduction in CTGF expression (FIGS.17A-17N). Interestingly, this pRE is near the annotated promoter of a lncRNA but overlaps an ENCODE-predicted distal regulatory element, demonstrates physical interaction with the CTGF promoter (ChIA-PET), and overlaps both H3K4me1 and H3K27ac peaks. When HFF cells are cultured on increasingly stiff surfaces, the pRE becomes more accessible and CTGF expression increases, supporting a gene expression response to the mechanical stimulus (FIGS.17A-17N). CTGF is a key downstream transcriptional target of YAP / TAZ following mechanical activation, and knockdown of CTGF blocks the YAP-dependent growth phenotype. The results herein further suggest one important genomic mediator of this stiffness-dependent change is a distal mechanoenhancer that helps drive increased CTGF expression. [000249] Likewise, other novel mechanoresponsive pREs that regulate genes known to be key drivers of cellular growth, including NF2 (FIGS.24C-24D), SKP2 (FIGS.12A-12H and FIGS. 28A-28D), and RFLNB (FIG.25C-25D) were validated. RFLNB has previously been implicated in perinuclear actin organization, SKP2 is a potent cell cycle regulator driven by YAP / TAZ activity, and NF2 is a potent tumor suppressor. Accordingly, it was identified herein that epigenetic repression of the pREs linked to these genes led to either increased cell growth (NF2) or decreased cell growth (RFLNB, SKP2) in the bulk screen and decrease in expression of the target genes by both scRNA-seq and qRT-PCR. Additionally, these genes showed differential expression and the pREs were differentially accessible following exposure to varying culture substrate stiffness (FIGS.1A-1H). Example 2 Widespread changes in chromatin accessibility result from short-term exposure to physiologically soft or stiff substrates [000250] First, the response of gene expression and chromatin structure to changes in ECM stiffness cues was characterized by culturing primary human neonatal foreskin fibroblasts (HFF cells) A549 tumor-derived lung epithelial cells on substrate stiffness conditions that represent a wide range of pericellular niches across various tissues in health and disease. Fibroblasts were chosen for these analyses because they have a wide range of available functional genomicsdata, play a key role in ECM synthesis, and can contribute to disease states in tissue fibrosis. HFF cells were cultured for 20 hours on either soft (Elastic modulus, E = 1 kPa, mimicking the softest connective tissues) or stiff (E= 50 kPa, mimicking organized musculoskeletal tissues or fibrotic lesions) polyacrylamide hydrogels as well as on tissue culture plastic (TCP, E= ∼1 GPa). The 20-hour time point minimizes transcriptional feedback that could further complicate understanding the direct influence of ECM stiffness on epigenetic state. Following 20 hours of culture on the soft or stiff hydrogels, HFF cells were harvested to examine both transcriptional changes (RNA-seq) and chromatin accessibility changes (ATAC-seq) in response to these ECM stiffness cues (FIG.1A). All sequencing experiments were performed in at least duplicate per condition, and all RNA-seq and ATAC-seq data were highly reproducible and passed quality control metrics established by the ENCODE Consortium (FIGS.2A-2B and TABLE 10). Transcriptomic analysis identified 4,009 differentially expressed genes in HFFs and 221 differentially expressed genes in A549 cells (defined as FDR<0.05 and absolute value(log2[Fold-Change]) > 0.5) (FIGS.1B-1C)(TABLES S2-S3 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference). The disparity in the number of differentially expressed genes between the two cell types may reflect the difference in mechanical memory between primary cells and immortalized lines, with transcriptional adaptation potentially occurring after longer subculturing and increased mechanical memory in A549 cells. Notably, 76 genes were differentially expressed in both cell types, including canonical genes associated with YAP / TAZ translocation (CYR61, CTGF, AMOTL2, ANKRD1, and NUAK2) upregulated on stiffer materials (FIG.1D), consistent with previous studies. TABLE 10. ATAC-seq QC metrics. P percen C tage_u S_e ich_ int al 34.0 34.0 32.328A- cseq.12 D kPa.20 h.rep3 34.5 33.1 33.7 33.7 32.4 31.4 30.6 30.9 34.9 45.3 45.7 55.8 49.6el_50k pa.brep 1 49.0 44.3[000251] Next, changes in chromatin accessibility between the soft and stiff hydrogel conditions were compared by ATAC-seq. Following 20 hours of culture on these materials, widespread changes in chromatin accessibility in both cell types were observed, with ~23% of identified accessible chromatin peaks showing significant differential accessibility in HFF cells and ~15% in A549 cells between the two materials (FIGS.1E-1F)(TABLES S4-S5 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference). In both cell types, there was an equal distribution of peaks exhibiting increased accessibility on soft and stiff conditions. Both cell types shared only about 10% of peaks that were more accessible on soft hydrogels (N=1,071 peaks) or stiff hydrogels (N=4,522 peaks) (FIG.1G). This highlights that the vast majority of these regions were cell-type specific, in accordance with previous observations of cell-type specificity of genomic enhancers. To further understand which TF signaling modules might be mediating these changes in accessibility, de novo TF motif analysis was performed in the entire set of differentially-accessible peaks for both material conditions and cell types. On soft hydrogels, motifs for ATF4, FOXF1, and CEBPA were most significantly enriched (FIG.1H). On stiff hydrogels, TEAD4, FOXA, HNF1B, and LEF1 motifs were enriched (FIG.1I), consistent with the known role of TEAD in YAP / TAZ-mediated mechanotransduction. A small number of motifs were enriched in both cell types, including CEBPA, ATF, TEAD4, indicating some convergent pathways between cell types that regulate differential accessibility on both soft and stiff hydrogels (FIGS.1J-1K). Many of these differentially accessible peaks were located in intronic or distal non-coding regions (FIGS.3A-3B). [000252] Next, the short-term reversibility of changes in accessibility following changes in intracellular acto-myosin contractility was explored. Rho-associated protein kinases (ROCKs) are regulators of both acto-myosin contractility and actin organization in the cell, and are a key driver of the cellular sensing of matrix stiffness cues that are relevant to cellular growth,migration, and apoptosis. ROCK inhibitors (ROCKi) disrupt intracellular contractility, and can be used to explore whether this disruption reduces the impact of hydrogel stiffness on chromatin accessibility (though it should be noted that ROCKi can also have effects on cells outside of purely changes in mechanotransduction). HFF cells were cultured on stiff (50 kPa) hydrogels overnight, and then treated the cells with either DMSO or 10 µM of the ROCK inhibitor Y-27632 (ROCKi) for 1 hour prior to harvest for ATAC-seq directly on the culture substrates. This allowed for the reduction of cell contractility while avoiding other changes associated with cell trypsinization. 2,052 peaks with differential accessibility relative to DMSO-treated cells cultured on the same surface were observed, demonstrating that cell contractility is required for the maintenance of the stiffness-induced changes and that downstream remodeling of chromatin accessibility could happen within an hour of contractile changes (FIG.4)(TABLE S6 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference). This is also consistent with the previous observation that external mechanical stimuli and increases in intracellular contractility drive similar mechanosensitive processes. [000253] Previous work suggests chromatin looping can facilitate interactions between cis- regulatory elements and the genes they regulate. To investigate if mechanical stimuli altered 3- D chromatin interactions, HiCAR (Hi-C on accessible regulatory DNA) was performed on HFF cells cultured on either soft (1 kPa) or stiff (50 kPa) hydrogels. Of the called loops (TABLES S7-S8 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference), ~12.5-12.8% were unique to a given stiffness while both loop anchors overlapped for ~43.5-46.7% of called loops (FIGS.6A-6B). Next, the chromatin loops and the differentially accessible ATAC-seq peaks for each ECM stiffness condition were compared, and 42.4%- 42.9% of chromatin loop anchors overlap at least one differentially accessible ATAC-seq peak. For both soft and stiff hydrogels, a larger proportion of ATAC-seq peaks that overlap loop anchors were significantly more accessible in the ECM stiffness condition for which the loop was called (FIG.6C). Specifically, 51.2% of differentially accessible ATAC-seq peaks that overlapped a chromatin loop in cells cultured on soft hydrogels were more accessible on soft hydrogels compared to stiff hydrogels (FIG.6D). Similarly, 55.7% of differentially accessible ATAC-seq peaks that overlapped a chromatin loop in cells cultured on stiff hydrogels were more accessible on stiff hydrogels compared to soft hydrogels (FIG.6D). These results indicate thatlong-range chromatin interactions, in part, may facilitate the observed changes in gene expression between cells cultured on soft or stiff hydrogels. Example 3 An intronic mechanoenhancer increases MYH9 expression on stiff materials [000254] As cell contractility was required for the maintenance of changes in chromatin accessibility observed in stiff hydrogels, cis-regulation of the non-muscle myosin genes MYH9, MYH10, and MYH14 was next investigated. These genes encode for non-muscle myosin IIA IIB, and IIC respectively, which are the primary drivers of cellular contractility in non-muscle cells. In primary HFF cells, MYH9 is the predominantly expressed non-muscle myosin and the only non-muscle myosin that showed ECM stiffness-dependent changes in expression, with a large absolute transcriptional shift between 1 and 50kPa hydrogels (FIG.5A). The ATAC-seq analysis identified 14 regions that were differentially-accessible between soft and stiff substrates that mapped within 100kb of the MYH9 transcriptional start site (TSS). Whether any of these 14 stiffness-dependent peaks near MYH9 functioned as stiffness-induced modulators of MYH9 expression was tested. To perturb the epigenetic state at any specific genomic locus we utilized CRISPR interference (CRISPRi) with the dCas9KRAB epigenome editor. dCas9KRAB catalyzes the addition of repressive histone marks at the target site (e.g., H3K9me3) along with the removal of active histone marks (e.g., H3K4me3 / H3K27ac) to decrease chromatin accessibility and induce epigenetic silencing. First, a CRISPRi screen was performed using dCas9KRABcombined with a gRNA library tiling all ATAC-seq peaks in HFF cells (regardless of if they were mechanically-sensitive) within + / - 440 kb of the MYH9 TSS (114 regions, 5,192 gRNAs; FIG.5B). To identify regions regulating MYH9 expression, cells were fixed and stained for MYH9 (NMIIA), sorted into MYH9-high and MYH9-low expression bins, and compared for their distributions of gRNAs (see Supplementary Text 1, FIG.7, TABLE 11)(TABLE S9 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference). Across these gRNAs, five putative regulatory elements (pREs) were identified as strong regulators of MYH9 protein expression including two pREs in the MYH9 promoter / TSS region and three pREs within a ∼5 kb section of intron 3 of MYH9 (FIGS.5C-5D). Of the three pREs in intron 3, only the first pRE was differentially accessible between the soft and stiff hydrogel culture conditions (FIG.5E). Further examination of H3K27ac signatures across diverse ENCODE biosamples around the sub-region of differential accessibility showed low signal insuspension or weakly adherent cell lines (e.g., K562 cells), but greater histone signal (adjacent to the open chromatin region) across increasingly adherent and contractile cell lines (e.g., HUVEC / HSMM; FIG.5F). Thus, as the stiffness of the culture environment increases, canonical indicators of enhancer activity also increase, suggesting that the activity of the MYH9 pRE#1 is responsive to mechanical cues across cell types. TABLE 11. MYH9 FACS screen results. DHSDHS_cmedian_foldch medianFC_normT ountan eoCtlmedian_log2FC pZ tscore67 14 76 33 54 83 03 67 88 11 39 79 86 69- 0.738883557060.0375796365902 0.4365810713620.28871164386610.0519599101354 112 17 2219 169 145 88 878 85 63 23 96 77 51 42 77 28 27 36 62 18 93 12- 0.731940835660.0306369151950 0.4502010577700.23649589433200.0329313501934 25 10 7024 213 731 15 075 76 11 72 44 27 97 12 23 35 50 08 82 44 27 13 66- 0.846542189360.1452382688950 0.2403461249661.04102919422750.1512740032172 42 11 7065 63 197 7 46 61 06 23 08 22 81 73 18 57 38 42 91 16 45 13 96 40 08- - - - 0.690842435150.0104614853215 0.5335713914340.08312589753870.0074010104653 6 4 0451 518 509 904 6438 53 35 02 56 77 25 01 95 21 74 62 14 95 63 09 62 30 78- 0.758006316870.0567023964000 0.3997182236910.43003492887860.0724584274879 78 15 205 475 514 21 44 12 22 85 91 19 72 12 13 90 49 30 42 88 70 71 16 10- 0.763045419210.0617414987407 0.3901591608640.46668207487310.0925294831792 94 21 2788 854 467 16 324 76 33 60 81 44[000255] To validate the screen results, first, single gRNAs targeting the three MYH9 intron 3 pREs (pREs #1 / 2 / 3, two gRNA per pRE) along with dCas9KRABwere delivered via lentivirus and analyzed MYH9 mRNA expression by qPCR, revealing all three of the MYH9 pREs regulated MYH9 mRNA expression (FIG.8). For follow-up experiments the most effective gRNA targeting the stiffness-sensitive pRE#1 were used. At nine days post-transduction, targeting the MYH9 intron 3 pRE#1 led to ∼54% repression of MYH9 transcript levels compared to HFF cells that received a non-targeting gRNA and dCas9KRAB(FIG.5G). This degree of change of MYH9 mRNA levels following epigenetic repression of the MYH9 intron 3 pRE#1 is consistent with the decreases observed in MYH9 mRNA expression between cells cultured on TCP and soft 1kPa hydrogels by RNA-seq (FIG.5A, levels marked on FIG.5G graph). When delivering a MYH9 promoter-targeting gRNA along with dCas9KRAB, an ∼87% repression of MYH9 transcript levels was observed (FIG.5G). Following immunostaining of MYH9 and FACS, similar fold-changes in MYH9 protein levels 15 days after transduction of the gRNA along with dCas9KRABwere also identified (FIG.9). Thus, the MYH9 intron 3 pRE#1 functions as a mechanoenhancer and dictates MYH9 expression in response to ECM stiffness cues. [000256] To further identify the influence of the MYH9 mechanoenhancer on cellular contractility, changes in cell morphology and in key mechanosensitive machinery were assessed 9 days after epigenetic repression of the MYH9 promoter or mechanoenhancer on rigid tissue culture plastic. Vinculin-containing focal adhesions (FAs) are a key mechanoresponsive subcellular structures, and their size and shape are strongly dependent on myosin activity. Epigenetic repression of the promoter led to substantial changes in cell sizeand a near complete loss of vinculin-containing focal adhesions (FIGS.10A-10D). Epigenetic repression of the MYH9 intronic mechanoenhancer (MYH9 intron 3 pRE#1) did not cause large changes in cell morphology, but altered acto-myosin organization (FIG.5H and FIGS.10A- 10D). Immunostaining with vinculin and FA quantification revealed no significant changes in total cell area (FIG.5J) or total number of FAs per cell (FIG.5I). However, a significantly lower area per FA was observed (FIG.5K), suggesting a lower contractile state of these cells compared to cells that received the non-targeting control gRNA. Collectively, this work identifies an ECM stiffness responsive MYH9 enhancer in intron 3 that behaves as a mechanoenhancer. [000257] Nuclease-active Cas9 and densely tiled saturating gRNA libraries have been used to determine key motifs involved in enhancer function by introducing a variety of disruptive small insertions and deletions through non-homologous end joining (NHEJ)-based DNA repair. Sequence changes in cells with a loss of enhancer function are then used to identify key motifs. This Cas9 screening approach was adapted to identify motifs in the MYH9 intron 3 mechanoenhancer that controls MYH9 expression. A stable HFF-Cas9 cell line was used and all 64 potential gRNAs tiling across the MYH9 intron 3 mechanoenhancer were introduced, and cells were sorted based on MYH9 protein expression as the screen endpoint (FIG.5L and TABLE 12). Three gRNAs that substantially decreased MYH9 expression on TCP relative to the other gRNAs across the mechanoenhancer were identified (FIG.5M). gRNA #24 and gRNA #43 had cut sites directly overlapping an SRF / CaRG motif and an HLTF (helicase like transcription factor) motif, respectively (FIGS.5N-5O). Upon delivery of these individual gRNAs, MYH9 mRNA expression was significantly decreased, with a maximum of ∼30% repression by gRNA #24 (FIG.5P). Cytosolic G-actin ratios regulate the mechanically responsive nuclear shuttling of MRTF-A, which then interacts with DNA-bound SRF to further regulate transcription. HLTF is a key member of the SWI / SNF complex, which has been implicated in actin-based YAP / TAZ release and subsequent DNA binding. Together, these results suggest that actin-associated mechanosensitive processes drive MYH9 mechanoenhancer activity. TABLE 12. gRNA counts and results for MYH9 Cas9 tiling screen. Zreg 0.710.85 0.862.8 CGGT ulat 075 346 1.02284 246 gR TGCC ory 8217.1156 1214 1423 1064 1039 080 897 432 833 232NA ACAC h 363 363 r 5483 17857280283151882391325 027 524 942 246 611 7 5.0 395 765 425 684 7 8.9 470 387 959 264 2 4.3 830 655 334 877 8 2.0 683 322 588 578 6 5.8 851 196 884 778 3 3.4 777 733 583 451 1 1.9 959 608 904 752 8 5.0 926 970 938 778 2 8.8 599 420 319 750 2 7.5 571 532 296 279reg CGGC ulat 2.013.833.503.118.3 gR CCAA ory 3980 1972 3306 8615. 3374 9641. 768 796 033 866 663NA TGCT h 363 363 r 4313771165546485 70080837 531 461 350 114 185 284 669 5.6 273 638 843 809 9 7.6 157 207 419 502 6 5.2 102 449 335 143 1 2.9 133 417 922 842 3 5.6 908 597 176 808 7 9.4 180 201 234 641 2 2.9 741 267 711 503 3 3.0 392 785 251 826 8 5.9 751 335 541 416 3 8.1 345 759 732 154 4reg 6.5 GACA ulat 2.374.212.483.02110 gR GTGT ory 8297 3488 3023 7164. 1211 4881. 894 978 145 672 495NA GGCA h 363 363 r 9429074435407074 29994116 659 714 426 933 750 578 4 3.2 257 097 462 308 8 7.9 666 651 915 078 3 3.1 976 071 163 299 5 5.2 728 607 472 745 9 2.0 451 143 290 113 9 6.3 267 311 264 612 2 3.6 578 122 293 701 8 4.5 637 728 204 733 2 6.5 548 296 838 085 4 0.4 459 178 837 549 5reg CGCA ulat 2.142.592.342.357.2 gR CGCA ory 6831 3190 5834 2251 5416 2310 083 107 389 860 672NA CGCA h 363 363 r 301295473379702467129661299 852 899 350 682 203 68 7.8 679 609 601 238 7 9.1 019 242 736 949 7 6.8 923 295 427 993 4.5 923 930 512 465 5 5.0 815 246 151 412 1 6.2 591 002 675 991 6 3.5 472 130 977 336 2 8.7 941 687 949 217 3 5.8 565 910 828 162 8 7.0 071 170 316 915 5- reg 0.1 GTTT ulat 1.051.361.001.14409 R CCTT r 5773 5473 7945 5811 5610 5556 471 722 974 389 806 580 855 6 5.8 879 776 545 764 9 7.3 162 547 416 486 8 9.4 577 233 943 098 1 9.3 000 616 307 091 1 5.3 907 135 966 092 8 3.8 429 134 134 977 2 4.9 100 275 352 415 9 8.2 118 685 589 426 3 6.8 265 047 941 598 4 4.4 266 431 801 816 2reg 4.9 gR ACCA ulat 0.861.061.471.13595 NA_ CAGG ory 5613.6505. 9890.9277. 8469.5751. 295 604 253 384 359 45 GAGA h 363 363 r 9187 4870 4317 6815 5604 6761 132 561 777 490 201 127 2 5.6 060 434 165 905 6 8.1 509 006 914 403 9 7.1 398 325 386 809 3 5.8 909 547 532 616 1 5.6 459 729 934 836 2 6.5 815 764 434 796 2 2.8 913 386 605 169 6 3.7 339 701 221 514 4 NA NAnon - 0.780.680.770.74 targ GTGT 608 630 348 862 tin GCAA n n 6447 8201 5699 8304 5756 7442 216 158 271 215 NA NA NA NA NA NA NA NA NA NA001 1 non NA NA NA NA NA NA NA NA NA NAetin GACT rge 6293 0164 0810 0336 9513 2791 756 027 062 615 g_0 TTCT ting 415 09 892 601 135 066 040 369 928 446 002 5 8 6 3 1 NA NA NA NA NA NA NA NA NA NA0.46 0.84 GAAT saf 1.22119 0.86924 BA ACTG e_t 5686.4647. 3067.6651. 2894.3353. 345 444 306 001SSI GAGT 118 118 r 0214 4974 8373 9392 5131 7531 874 234 684 077 NA NA NA NAExample 4 An intronic mechanoenhancer of BMF is more active on soft materials and is a key driver of the ECM stiffness-driven apoptotic response [000258] Low material substrate stiffness, low adhesion states, and restriction of cell spreading have been shown to increase apoptosis or adipogenesis. Increased apoptosis due to lack of ECM engagement is termed anoikis. A key step in cancer progression is developing anoikis-resistance. From the RNA-seq data BMF, a key transcriptional effector of anoikis, was strongly upregulated on soft substrates (FIG.11A). Also, a cluster of three ATAC-seq peaks that were significantly more accessible on soft hydrogels located near BMF was identified (FIG. 11B). First, a luciferase reporter of enhancer activity was used to determine whether these differentially-accessible peaks near BMF functioned as putative regulatory elements governing BMF transcription. Genomic DNA from all three regions was cloned into the luciferase reporter plasmid, reporter plasmids were transfected into HFF cells cultured on TCP, and luciferase activity was measured 24 hours later. Since BMF transcription was increased in the low contractility context of soft materials, it was hypothesized that the addition of ROCKi Y-27632 should increase luciferase reporter activity. Only BMF pRE#1 in intron 4 demonstrated any basal enhancer reporter activity on TCP. Following treatment with 10 µM Y-27632, pRE#1 enhancer reporter activity was significantly greater than the activity in DMSO-treated cells, while other regions remained at basal levels. This indicates that pRE#1 enhancer activity is increasedin lower contractility environments, further supporting the function of this region in increasing BMF expression preferentially on soft substrates (FIG.11C). [000259] Next, the ability of BMF pRE#1 to regulate BMF transcription and anoikis was tested. To study this behavior, a canonical model system for anoikis was utilized wherein Latrunculin-A (LatA) treatment is used to depolymerize the actin cytoskeleton to induce loss of FAs and integrin engagement to mimic loss of adhesion to the ECM. First, HFF cells were transduced with dCas9KRABand either a non-targeting gRNA or a gRNA targeting either BMF pRE#1 or the BMF promoter. After eight days of culture, BMF mRNA levels were evaluated. Treatment with LatA increased BMF expression ∼60-fold compared to DMSO-treated cells (FIG.11D). Repression of BMF pRE #1 and the BMF promoter reduced the LatA-dependent increase in BMF expression by ∼60% and ∼85%, respectively (FIG.11D). Then, changes in apoptosis were assessed by measuring Caspase-3 / 7 activity using a luciferase reporter system at day 14 post-transduction (8 days +LatA). Repression of BMF pRE #1 reduced LatA-induced cell apoptosis by ∼50% while BMF promoter repression completely prevented LatA-induced apoptosis relative to the DMSO-treated control condition (FIG.11E). Collectively, these data show that pRE#1 acts as a mechanoenhancer of BMF that is more active on softer ECMs and functions to promote anoikis. Example 5 An intergenic mechanoenhancer of FZD2 is more active on stiff substrates and responds to intracellular mechanical changes. [000260] Among the shared peaks between A549 and HFF cells, one of the most differentially accessible regions was an intergenic pRE located ~14kb upstream of FZD2 (FIG.13A). FZD2 expression was significantly upregulated in HFF cells cultured on 50 kPa hydrogels but showed no significant change in A549 cells (FIG.13B). Interestingly, the 1791 bp fragment encompassing the entire pRE showed ~18-fold increased enhancer activity in an exogenous plasmid based luciferase assay, while the MYH9 intron 3 enhancer showed ~2.5-fold increased enhancer activity (FIG.13C). Whether this pRE upstream of the FZD2 promoter regulated FZD2 transcription by epigenetically repressing the pRE using dCas9KRABwas tested. HFF cells were transduced with dCas9KRABand either a non-targeting gRNA or gRNAs targeting either the FZD2 putative pRE or promoter. Eight days post-transduction, both the pRE- and promoter- targeting gRNAs resulted in ~80% repression in FZD2 RNA levels (FIG.13D). Finally, the effectof mechanical perturbations on the transcriptional activity of the FZD2 mechanoenhancer was tested. A dose-dependent decrease in luciferase enhancer activity of the FZD2 pRE sequence in HFF cells following treatment with the actomyosin inhibitor blebbistatin at multiple doses was noted (FIG.13E). This pRE also exhibited luciferase enhancer activity in A549 cells, and blebbistatin treatment significantly reduced this activity (FIG.13F). Treatment with contractility inhibitors, such as Y-27632 and blebbistatin, reduced enhancer activity, with blebbistatin almost completely blocking transcriptional activity compared to DMSO-treated controls (FIG.13G). Conversely, treatment with both the Rho agonist CN03 and microtubule disruption with nocodazole increased mechanoenhancer activity (FIG.13G). The role of Rho activation in promoting ROCK activity and cell contractility is well established. Previous work has also shown that nocodazole treatment leads to the release of a microtubule-associated guanine nucleotide exchange factor (GEF-H1), promoting Rho activity to increase actomyosin contractility. Taken together, this data highlights how mechanoenhancers, such as the FZD2 pRE, can rapidly respond to mechanical signals and modulate transcriptional changes in response to shifts in intracellular mechanical states. Example 6 High-throughput CRISPR screening identifies key mechanoenhancers that modulate cellular growth and migration [000261] To understand which cis-regulatory elements contribute most strongly towards mechanosensitive cellular behaviors, high-throughput CRISPRi screening with cellular growth and migration as the phenotypic readouts was performed. First, a library of 21,458 gRNAs targeting the top 1000 non-promoter ATAC-seq peaks ranked by increased accessibility on stiff hydrogels was generated (TABLES S4 and TABLE S8 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference). Also, gRNAs targeting the promoters of 53 genes that had previously been shown to modulate migration were included as positive controls, and 1000 negative control non-targeting gRNAs were also included. HFF cells were transduced at an MOI of 10.8 to maximize library coverage across a smaller subset of cells and then were assessed for changes in growth or migration (FIG.12A). For the growth screen, genomic DNA was collected on day 8 and day 29 / 30 (14 population doublings), sequenced, and gRNA enrichment was compared across groups. For the migration screen, at eight days post- transduction a transwell migration assay that allowed cells to migrate overnight was performed.These populations were then separated and used in an additional migration assay the next day. Cell populations that either successfully migrated through the transwell assay twice and those that never migrated through the transwell were collected, genomic DNA was harvested, and gRNA enrichment across populations was determined from sequencing. [000262] Strong effects from promoter-targeting of the positive control genes were observed. In the growth screen, perturbation of both DepMap essential genes (GPKOW, EIF3E, ACTG1, CSNK1A1, PCYT1A, PTPN23) and genes related to cell growth (ABL1, ITGB8, G3BP2, OTUD6B) led to decreases in cell proliferation. In the migration screen, the promoter-targeted repression of key genes known to influence cell adhesion and force generation, including ITGAV, ACTG1, CDC42, and TPM3, decreased cell migration (FIG.14). Perturbations to mechanically-sensitive test regions led to similar degrees of enrichment as perturbations of positive control genes (FIG.14). When analyzing the distribution of effect sizes for gRNAs across a given peak, strong Z-score enrichment of only a fraction of the gRNAs across both screens was observed (FIG.12B-12C), which is consistent with previous reports of epigenetic editing of regulatory elements. [000263] In total, 58 and 50 pREs that regulated either migration or proliferation, respectively, and 7 regions regulating both phenotypes were identified (FIG.12D)(TABLES S12-S13 of Cosgrove et al., Mechanosensitive genomic enhancers potentiate the cellular response to matrix stiffness. bioRxiv 2024 Jan 10:2024.01.10.574997, incorporated herein by reference). Although ECM stiffness is known to influence both cell growth and migration, no correlation between phenotype scores across pREs regulating either or both phenotypes was found (FIG. 15A). Furthermore, perturbations of pREs that regulated only migration or both phenotypes, had greater effects on migration compared to pREs that regulated only growth. There was no difference between the same groups for the growth phenotype (FIG.15B). The genomic contexts of two strong hit pREs were examined: 1) an intronic pRE located within the gene SKP2 that was identified in the growth screen (pRE #32; FIG.12C, FIG.12E), and 2) an intergenic pRE located near the gene CYR61 that was identified in the migration screen (pRE #62; FIG.12B, FIG.12E). Both SKP2 and CYR61 were more highly expressed on 50kPa versus 1kPa surfaces (FIGS.1B-1C). Upregulation of SKP2 has been linked to metastasis and i...

Claims

CLAIMS 1. A composition comprising a modulator of a gene or a regulatory element thereof or a chromosome region selected from those listed in TABLE 14.

2. The composition of claim 1, wherein the gene is selected from CCN2, CYR61, MYH9, RFLNB, RANGAP1, RASGRP1, NF2, and BMF.

3. The composition of any one of claims 1-2, wherein the composition modulates apoptosis, mechanotransduction, proliferation, migration, growth, fibrosis, atherosclerosis, ECM secretion, senescence, or a combination thereof, in a cell .

4. The composition of any one of claims 1-3, wherein the modulator comprises a polypeptide, or a polynucleotide, or a small molecule, or siRNA, or shRNA, or a combination thereof.

5. The composition of claim 4, wherein the modulator comprises siRNA, or shRNA, or an antibody, or a combination thereof.

6. The composition of any one of claims 1-5, wherein the modulator is an inhibitor of the gene.

7. The composition of any one of claims 1-5, wherein the modulator is an activator of the gene.

8. The composition of any one of claims 1-4, wherein the modulator comprises a DNA targeting composition, the DNA targeting composition comprising: (a) a Cas9 protein and at least one guide RNA (gRNA) that targets the Cas9 protein to the gene or a regulatory element thereof; or (b) a fusion protein, wherein the fusion protein comprises two heterologous polypeptide domains, wherein the first polypeptide domain comprises a zinc finger protein or a TALE or a Cas12 protein or a Cas13 protein or a Cas9 protein, and wherein the second polypeptide domain has an activity selected from transcription repression activity, transcription activation activity, nuclease activity, base editing activity, prime editing activity, transcriptionrelease factor activity, histone modification activity, nucleic acid association activity, methylase activity, and demethylase activity, wherein when the first polypeptide domain comprises a Cas9 protein the DNA targeting composition further comprises at least one guide RNA (gRNA) that targets the Cas9 protein to the gene or a regulatory element thereof.

9. A DNA targeting composition comprising: a Cas9 protein or a fusion protein, wherein the fusion protein comprises two heterologous polypeptide domains, wherein the first polypeptide domain comprises a zinc finger protein or a TALE or a Cas12 protein or a Cas13 protein or a Cas9 protein, and wherein the second polypeptide domain has an activity selected from transcription repression activity, transcription activation activity, nuclease activity, base editing activity, prime editing activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methylase activity, and demethylase activity; and at least one guide RNA (gRNA) that targets the Cas9 protein to a target gene or a regulatory element thereof when the DNA targeting composition comprises a Cas9 protein, wherein the target gene is selected from those listed in TABLE 14.

10. The composition of claim 9, wherein the gene is selected from CCN2, CYR61, MYH9, RFLNB, RANGAP1, RASGRP1, NF2, and BMF.

11. The composition of any one of claims 8-10, wherein the gRNA targets or is encoded by a polynucleotide comprising a sequence selected from SEQ ID NOs: 57-441, or comprises a sequence selected from SEQ ID NOs: 442-826.

12. The composition of any one of claims 8-11, wherein the Cas protein comprises a Streptococcus pyogenes Cas9 protein, or a Staphylococcus aureus Cas9 protein, or any fragment thereof.

13. The composition of any one of claims 8-12, wherein the Cas9 protein comprises the amino acid sequence of one of SEQ ID NOs: 26-29, or any fragment thereof, and / or wherein the Cas9 protein is encoded by a polynucleotide comprising a sequence selected from SEQ ID NOs: 30-39, and / or wherein the Cas9 protein comprises an amino acid sequence having at least 90% or greater identity to a sequence selected from SEQ ID NOs: 26-29, or any fragment thereof,and / or wherein the Cas9 protein is encoded by a polynucleotide comprising a sequence having at least 90% or greater identity to a sequence selected from SEQ ID NOs: 30-39, or any fragment thereof, and / or wherein the Cas9 protein comprises an amino acid sequence having one, two, three, four, five or more changes selected from amino acid substitutions, insertions, or deletions, relative to a sequence selected from SEQ ID NOs: 26-29, or any fragment thereof, and / or wherein the Cas9 protein is encoded by a polynucleotide comprising a sequence having one, two, three, four, five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to a sequence selected from SEQ ID NOs: 30-39, or any fragment thereof.

14. The composition of any one of claims 8-13, wherein the fusion protein comprises more than one second polypeptide domain.

15. The composition of any one of claims 8-14, wherein the second polypeptide domain has transcription repression activity.

16. The composition of any one of claims 8-15, wherein the second polypeptide domain comprises KRAB or FokI.

17. The composition of claim 16, wherein KRAB comprises the amino acid sequence of SEQ ID NO: 45, or any fragment thereof, and / or wherein KRAB is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 46, and / or wherein KRAB comprises an amino acid sequence having at least 90% or greater identity to SEQ ID NO: 45, or any fragment thereof, and / or wherein KRAB is encoded by a polynucleotide comprising a sequence having at least 90% or greater identity to SEQ ID NO: 46, or any fragment thereof, and / or wherein KRAB comprises an amino acid sequence having one, two, three, four, five or more changes selected from amino acid substitutions, insertions, or deletions, relative to SEQ ID NO: 45, or any fragment thereof, and / or wherein KRAB is encoded by a polynucleotide comprising a sequence having one, two, three, four, five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to SEQ ID NO: 46, or any fragment thereof.

18. The composition of claim 16 or 17, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 47 or 49, or any fragment thereof, and / or wherein the fusion protein is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 48 or 50, and / or wherein the fusion protein comprises an amino acid sequence having at least 90% or greater identity to SEQ ID NO: 47 or 49, or any fragment thereof, and / or wherein the fusion protein is encoded by a polynucleotide comprising a sequence having at least 90% or greater identity to SEQ ID NO: 48 or 50, or any fragment thereof, and / or wherein the fusion protein comprises an amino acid sequence having one, two, three, four, five or more changes selected from amino acid substitutions, insertions, or deletions, relative to SEQ ID NO: 47 or 49, or any fragment thereof, and / or wherein the fusion protein is encoded by a polynucleotide having one, two, three, four, five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to SEQ ID NO: 48 or 50.

19. An isolated polynucleotide sequence encoding the composition of any one of claims 1- 18.

20. A vector comprising the isolated polynucleotide sequence of claim 19.

21. The vector of claim 20, wherein the vector is a viral vector.

22. The vector of claim 21, wherein the viral vector is a lentiviral vector.

23. The vector of claim 21, wherein the viral vector is an adeno-associated virus (AAV) vector.

24. The vector of claim 23, wherein the AAV vector is selected from AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, and an engineered AAV vector.

25. A cell comprising the composition of any one of claims 1-18, or the isolated polynucleotide sequence of claim 19, or the vector of any one of claims 20-24, or a combination thereof.

26. The cell of claim 25, wherein the cell is a tumor cell, fibroblast, stellate cell, or endothelial cell.

27. A pharmaceutical composition comprising: the composition of any one of claims 1-18, or the isolated polynucleotide sequence of claim 19, or the vector of any one of claims 20-24, or a combination thereof.

28. The composition of claim 27, further comprising at least one cancer therapy.

29. A method of modulating the expression of a mechanoenhancer, the method comprising administering to a cell or a subject the composition of any one of claims 1-18, or the isolated polynucleotide sequence of claim 19, or the vector of any one of claims 20-24, or the cell of claim 25 or 26, or the pharmaceutical composition of claim 27 or 28, or a combination thereof.

30. The method of claim 29, wherein modulating the expression of a mechanoenhancer results in modulation of apoptosis, mechanotransduction, proliferation, migration, or growth, or a combination thereof, in the cell or subject.

31. A method of treating a disease in a subject, the method comprising administering to the subject the composition of any one of claims 1-18, or the isolated polynucleotide sequence of claim 19, or the vector of any one of claims 20-24, or the cell of claim 25 or 26, or the pharmaceutical composition of claim 27 or 28, or a combination thereof.

32. The method of claim 31, wherein the disease comprises cancer.

33. The method of claim 32, the method further comprising administering at least one cancer therapy.

34. The method of claim 31, wherein the disease comprises fibrosis, regeneration, aging, or atheroschlerosis.

Images