Nucleic acid molecule and use thereof as specific promoter

Abstract

A nucleic acid molecule and the use thereof as a specific promoter. Provided is a nucleic acid molecule, which has a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 9. A recombinant promoter obtained by means of artificial modification can specifically express an exogenous gene in retinal structural cells of an eye, thus reducing the expression in non-targeted cells, such that the effect on other normal tissue and organs can be reduced. The provided recombinant promoters are all no more than 500 bp in length, are suitable for expressing large exogenous genes in AAV vectors, and have a wide application range. Some of the provided promoters have relatively high expression intensity in PR cells, and are also applicable to certain scenarios that require high expression levels of target genes.

Description

Nucleic acid molecules and their use as specific promoters

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on December 5, 2023, with application number 202311663547.5 and invention name “Nucleic Acid Molecules and Their Application as Specific Promoters”, the entire contents of which are incorporated by reference into this application.

[0002] This application claims priority to the Chinese patent application filed with the China Patent Office on December 5, 2023, with application number 202411187019.1 and invention name “Nucleic acid molecules and their use as specific promoters”, the entire contents of which are incorporated by reference into this application. Technical Field

[0003] The present invention relates to the field of genetic engineering, in particular to nucleic acid molecules and their application as specific promoters. Background Art

[0004] A promoter is a DNA sequence located upstream of the 5' end of a structural gene that activates RNA polymerase, enabling accurate binding to the template DNA and specific transcription initiation. Based on their mode of action and function, they can be divided into three categories: constitutive promoters, tissue-specific promoters, and inducible promoters. Constitutive promoters are active in continuously expressing exogenous genes in most or all tissues and are generally used for widespread expression of exogenous genes. Tissue-specific promoters often restrict gene expression to specific tissues or organs and exhibit properties such as developmental regulation. This overcomes the waste caused by constitutive promoters, which result in non-specific, sustained, and efficient expression of exogenous genes in recipient cells / tissues, and enhances the effectiveness of transgenics. Consequently, the research and application of specific promoters is gaining increasing attention.

[0005] Gene therapy refers to a biological treatment method that introduces exogenous normal genes into target cells through gene transfer technology to correct or compensate for diseases caused by genetic defects and abnormalities, ultimately achieving the purpose of treatment. Inherited retinal diseases (IRDs) are a general term for a group of retinal diseases caused by genetic factors. Such diseases can be caused by more than 300 different gene mutations associated with retinal pathology. The correct expression of these genes is crucial for the function of photoreceptors (PR) and retinal pigment epithelium (RPE). Once these genes are not expressed correctly, progressive cell death will occur, causing blindness in patients. For such genetic diseases, the most ideal and effective treatment method is to correct the pathogenic genes through technologies such as gene enhancement, editing or silencing.

[0006] Although specific exogenous genes can be delivered to the vicinity of target cells through methods such as in situ injection and tissue-specific serotype AAV delivery, it is still difficult to avoid infection of other non-target tissues or cells. In this case, a specific promoter is needed to specifically control the expression of the exogenous gene, further reducing the expression of the exogenous gene in non-target tissues or cells, thereby reducing the impact on other normal tissues and organs.

[0007] The genome capacity of AAV is approximately 4.7kb, and the length of the packaged and delivered gene is limited. Therefore, in most cases, a shorter promoter is required to drive the expression of the exogenous gene. In order to achieve better therapeutic effects, the promoter used should preferably be a promoter specifically expressed in PR or RPE layer cells. In addition, the expression strength of the promoter needs to be considered. Therefore, considering these three aspects, it is almost impossible to find a suitable promoter sequence as a promoter for the expression of exogenous genes. Summary of the Invention

[0008] In view of this, the present invention provides a nucleic acid molecule and its use as a specific promoter. The recombinant promoter obtained by artificial modification of the present invention can specifically express exogenous genes in the retinal structural cells of the eye, reduce the expression in non-target cells, and reduce the impact on other normal tissues and organs. The length of the recombinant promoter provided by the present invention does not exceed 500bp, which is suitable for the needs of expressing larger exogenous genes in AAV vectors and has a wide range of applications. Some of the promoters provided by the present invention have a high expression intensity in PR cells and are also applicable in certain scenarios where the expression amount of the target gene is required to be high.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a nucleic acid molecule having:

[0011] (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 9; or

[0012] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or

[0013] (3) A nucleotide sequence having at least 85% sequence homology with the nucleotide sequence described in (1) or (2).

[0014] In some embodiments of the present invention, the nucleic acid molecule has:

[0015] (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 9; or

[0016] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or

[0017] (3) A nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence homology with the nucleotide sequence described in (1) or (2).

[0018] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 is: GCCCTAATCCAATTAGCAGAGCCGGTGAAGGCCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGGCCCCTTCCTCCAAGGGGCCGCCTCACTTTTCCCCTGAGAAGGACAAACAACCACCAGGCTTCTGGGGCCCAA. (RetinaE11)

[0019] In some embodiments of the invention, SEQ ID The sequence of NO:2 is: CCTGGCCACTAATCTGTGATCACTTATCCGTTGCCTTTGTGTATTTGGAATGGATATCCAACCATTGGATTTTCATTTTTGCAGAGAACAAGAATAGGGTTGGGAGGAAGGGGCCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTCCTCTCCCTCTTGACCGAGATTCCCCTTCT GTCTAGAGGGAGATAAGCAACTCTGAGGCCATTCAGAGGATTGTGGATATAAGAGGCTGGGAGGCCAGCCCGGGCAGAGCAGAGGGCGCTGACATTGGGATATCAAGACTGTACCGAGTAGGGGGCGGCCCCTTGGAGGAAGGGGCCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGAATGAAGCGATCGC. (Retina2A11)

[0020] In some embodiments of the present invention, the sequence of SEQ ID NO:3 is: CCCTTTTTGACTTCTGACCTTCCTACCTCGTTCACTAATCTGTTTTCCAAACTCTTGGCCCTTTGTATAGAAAAGTTGAGAGGCAGGCCGAGTTTGAGGCCAGCCTGGTCTACACAGGCGTTCTAGGAGAACCTGTCTCCCGGCCCCTTCCTCCAAGGGGCCGCCTCACTTTTCCCCTGGTTGCTAAGCTGGAGACCGGGCCCTGTCGAGGGTTCCTGGGGACCACTGGGAAGCCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGCAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGG. (RetinaB3) In some embodiments of the present invention, the sequence of SEQ ID NO:4 is: TAGAAAAAGACAATCCCCTGAGCTGCTTGAGGGCTAACAGAAGATCAAGTCCCATTTTAGCCTCCCTAGCTCTGGCCTACCTCCTCAGTTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCCCTGGCTCATCTCTCAGGATGCCTATCTTGTCCTTAGCACGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGCTAGAAAAAGACAATCCCCGCCTGGCCCGGATCACTTATCCGTTGCCTTTGTGTATTTGGAGGCTGGGAGGCCAGCTGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGATGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA. (RetinaC8)

[0021] In some embodiments of the invention, SEQ ID The sequence of NO:5 is: CCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGCTGGCCTGTGGGATCAGCCCGGGCCTCTTCACCTTAAAAGCTCCCAAACCCCCTCCAGCTCTGGTTGCTAAGCTGGCCTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGGCCCTCCTCCAAGGGGCCGG ACAGAGTGTGTGCAGAGAGACTGACTGTGTGTGCTTCTTCCCATTCCGGAGGTGGCAGAGGTGGGACATAAACACAGAGAGGGCCCCTTGCTGGACGAGAGACCGGGCCCTGTCGAGACTTATACGTTGCCTTTGTGTATTTGGAATGGATATCCAACCATTGGATTTTCATTTTTGTGTGGTTAAACATCATTTGTTCCCTTTTTGACTTCTGACCTTCC. (RetinaD9)

[0022] In some embodiments of the present invention, the sequence of SEQ ID NO: 6 is: CACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGG. (RetinaA12)

[0023] In some embodiments of the present invention, the sequence of SEQ ID NO: 7 is: CCTACAGCAGCCAGGGTGAGATTACATGAAACGGAAGCTCTGTCCTCATGAAACACCCATGCCCTTTCCCCACCCCTCAGCCTCCTGCACCCACCCTTCTATTCCTATGCATTTGGGAGCTCTGAGTGCAATCCTACGGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGGCCCCTTCCTCCAAGGGGCCGCCTCACTTTTCCGTGGATATAAGAGGCTGGGAGGCC. (RetinaB4)

[0024] In some embodiments of the present invention, the sequence of SEQ ID NO: 8 is: TGTGAGATAGAGGAAAAATATGTTAGGATAGAGTAACATTCTCTTCTTCCCGTAAAAGCTGGGCGAGAGTGCGGACCGGTGGTGCTTGCCTACCTTGCCTTGAGACTCCTTACCCGAGCTGGAGAGCTCCTTCCTAATCCGGGGATTGTCCCCTAAATCTGATCTGCTAGTAGGTCACAGAGAGCTGACAGATGAGGTGGGTTCCGTGTCTGTGAAATTCCGATTCTCCTGCTTCCGCTTTCC. (RetinaL02)

[0025] In some embodiments of the present invention, the sequence of SEQ ID NO: 9 is: ACAAGTCCAACATCTAATCTTCCACCCTGGCCAGGGCCCCAGCTGGCAGCGAGGGTGGGAGACTCCGGGCAGAGCAGAGGGCGCTGACATTGGGGCCCGGCCTGGCTTGGGTCCCTCTGGCCTTTCCCCAGCCTATCTTGTCCTTAGCACGATGAGGAGGAGGCCTGGCCTCCAGCTCTGGTTGACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGGGAGGAGGCCTGG. (RetinaA2)

[0026] In some embodiments of the present invention, the size of the nucleic acid molecule is no greater than 500 bp.

[0027] The present invention also provides the use of the nucleic acid molecule as a promoter.

[0028] The present invention also provides a recombinant expression vector comprising: the above nucleic acid molecule and the target gene.

[0029] In some embodiments of the present invention, the above-mentioned recombinant expression vector further comprises: a fluorescent protein.

[0030] In some embodiments of the present invention, in the above-mentioned recombinant expression vector, the fluorescent protein includes nuclear-importing green fluorescent protein and / or nuclear-importing red fluorescent protein.

[0031] In some embodiments of the present invention, in the above-mentioned recombinant expression vector, the nuclear-importing green fluorescent protein includes: NLS-EGFP.

[0032] In some embodiments of the present invention, in the above-mentioned recombinant expression vector, the nuclear-importing red fluorescent protein includes: NLS-mCherry.

[0033] The present invention also provides a method for constructing the above-mentioned recombinant expression vector, wherein the recombinant expression vector is obtained by connecting the nucleic acid molecule and the target gene.

[0034] The present invention also provides virus particles, transformation and / or transfection of the above-mentioned recombinant expression vector and / or the recombinant expression vector obtained by the above-mentioned construction method.

[0035] The present invention also provides a method for preparing the above-mentioned virus particles, which comprises taking the recombinant expression vector for virus packaging, collecting the virus, and purifying the virus to obtain the virus particles.

[0036] In some embodiments of the present invention, in the above preparation method, the cells include: 293T cells.

[0037] In some embodiments of the present invention, in the above preparation method, the virus includes AAV.

[0038] In some embodiments of the present invention, in the above preparation method, the purification uses cesium chloride.

[0039] The present invention also provides the use of the above-mentioned nucleic acid molecule, the above-mentioned recombinant expression vector, the recombinant expression vector obtained by the above-mentioned construction method, the above-mentioned lentiviral particle and / or the viral particle obtained by the above-mentioned preparation method in cells that specifically express retinal structures.

[0040] In some embodiments of the present invention, the above application, the retinal structure includes: photoreceptors and / or retinal pigment epithelium

[0041] The present invention also provides the use of the above-mentioned nucleic acid molecule, the above-mentioned recombinant expression vector, the recombinant expression vector obtained by the above-mentioned construction method, the above-mentioned virus particle and / or the virus particle obtained by the above-mentioned preparation method in the preparation of products for treating and / or preventing hereditary retinal diseases.

[0042] The present invention also provides a product, comprising: the above-mentioned nucleic acid molecule, the above-mentioned recombinant expression vector, the recombinant expression vector obtained by the above-mentioned construction method, the above-mentioned virus particle and / or the virus particle obtained by the above-mentioned construction method.

[0043] The present invention also provides a method for treating diseases by taking the above product; the diseases include retinal diseases.

[0044] The present invention provides a nucleic acid molecule having:

[0045] (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 9; or

[0046] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or

[0047] (3) A nucleotide sequence having at least 85% sequence homology with the nucleotide sequence described in (1) or (2).

[0048] The beneficial effects of the present invention include:

[0049] (1) The recombinant promoter obtained by artificial modification in the present invention can specifically express exogenous genes in the retinal structural cells of the eye, reduce the expression in non-target cells, and reduce the impact on other normal tissues and organs.

[0050] (2) The length of the recombinant promoter provided by the present invention does not exceed 500 bp, which is suitable for expressing larger exogenous genes in AAV vectors and has a wide range of applications.

[0051] (3) Some promoters provided by the present invention have high expression intensity in PR cells and are also applicable in certain scenarios where high expression levels of target genes are required. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 shows vector 1, wherein: upstream is a recombinant promoter (CAG promoter is used in the example), and downstream is an expression vector structure of nuclear green fluorescent protein (NLS-EGFP);

[0053] FIG2 shows vector 2, wherein: upstream is a recombinant promoter (the CAG promoter is used in the example), and downstream is an expression vector structure of nuclear red fluorescent protein (NLS-mCherry);

[0054] Figure 3 shows the results of mouse eye sections after subretinal injection of AAV expressing downstream fluorescent proteins using different recombinant promoters. Anti-Arrestin C antibody was used as the primary antibody to perform immunofluorescence staining on the sections, and the sections were photographed and recorded. The left side shows the slides taken at the annotated exposure time (1000ms / 500ms), which are mainly used for expression intensity comparison; the middle side shows a merged image of two photos obtained by taking photos after cell expression fluorescence and immunofluorescence staining (the exposure time for each channel was adjusted); the right side shows a merged image of three photos obtained by taking photos after cell expression fluorescence, immunofluorescence staining, and DAPI staining (the exposure time for each channel was adjusted);

[0055] Figure 4 shows the statistical results obtained by semi-quantitative analysis of the brightness of sections of the group expressing nuclear green fluorescent protein using Image J software;

[0056] Figure 5 shows the statistical results obtained by semi-quantitative analysis of the brightness of sections of the group expressing nuclear red fluorescent protein using Image J software;

[0057] FIG6 shows a comparison of expression profiles using the CAG promoter as a representative example of a broad-spectrum expression promoter and different recombinant promoters obtained. DETAILED DESCRIPTION

[0058] The present invention discloses a nucleic acid molecule and its use as a specific promoter. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is obvious that relevant personnel can modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0059] The raw materials and reagents used in Example 1 and Example 2 provided by the present invention can all be purchased from the market.

[0060] The present invention will be further described below in conjunction with the embodiments:

[0061] The present invention obtains nine shorter recombinant promoters through artificial recombination modification methods, all of which are less than 500bp in length and are basically or mostly specifically expressed only in PR or RPE layer cells, and these specific promoter elements have been verified in animal experiments.

[0062] Explanation of terms:

[0063] The term "nucleic acid" is a polymer composed of individual nucleotides, i.e., a polynucleotide. It refers to naturally occurring, or partially or completely non-naturally occurring nucleic acids, which, for example, encode recombinantly produced polypeptides. Nucleic acids can be composed of DNA fragments isolated or synthesized by chemical means. Nucleic acids can be integrated into another nucleic acid, for example, into an expression plasmid or into the genome / chromosome of a host cell. Plasmids include shuttle and expression vectors. Typically, the plasmid will also contain a prokaryotic propagation unit, which contains a replication origin (e.g., the replication origin of ColE1) and a selective marker (e.g., a penicillin or tetracycline resistance gene) for vector replication and selection in bacteria, respectively.

[0064] The term "promoter" refers to a nucleic acid, i.e., a polynucleotide sequence, that controls the transcription of an operably linked nucleic acid. A promoter may include signals for RNA polymerase binding and transcription initiation. The promoter or promoters used will be functional in the cell type of the host cell in which the expression of the operably linked nucleic acid is directed. A large number of promoters, including constitutive, inducible, and repressible promoters from a variety of different sources, are well known in the art (and identified in databases such as GenBank).

[0065] Example 1

[0066] 1. Expression vectors 1 and 2 (vector frameworks shown in Figures 1 and 2) with nuclear-importing green fluorescent protein (NLS-EGFP) and nuclear-importing red fluorescent protein (NLS-mCherry) genes downstream, respectively, with the links https: / / en.vectorbuilder.com / vector / VB211226-1096bhj.html and https: / / en.vectorbuilder.com / vector / VB900129-0788gfe.html, were used to replace the CAG promoter with a recombinant promoter using conventional enzyme digestion and ligation methods to construct gene expression vectors with each recombinant promoter upstream.

[0067] 2. Each expression vector containing a recombinant promoter is packaged into AAV virus, and the virus is harvested and purified with cesium chloride to obtain viral particles for in vivo animal verification experiments.

[0068] 3. The same dose was injected into the subretinal space of mice, and the virus injection dose was 1E+10GC / eye.

[0069] 4. After 2 weeks, the samples were sliced ​​and immunofluorescently stained: the primary antibody used in the immunofluorescence process was the Anti-Arrestin C antibody, which is a rabbit anti-mouse polyclonal antibody that can specifically bind to the cone surface protein in the PR layer, thereby effectively distinguishing cones from rods. If the recombinant promoter is downstream of the nuclear green fluorescent protein (NLS-EGFP), the secondary antibody for subsequent immunofluorescence staining will use red fluorescence; if the promoter is downstream of the nuclear red fluorescent protein (NLS-mCherry), the secondary antibody will use green fluorescence. At the same time, DAPI is used to stain the nuclei of cells in each layer, and the image is blue.

[0070] 5. Take photos of the slices to finally obtain the expression slice diagrams of each recombinant promoter.

[0071] As shown in Figure 3, the slice image results are explained: each recombinant promoter shows slices taken at two magnifications (100x / 200x), and there are three slices for each magnification. The first slice is taken at the annotated exposure time (1000ms / 500ms), which is mainly used for comparison of expression intensity; the second slice is a merged image of two photos obtained by taking pictures after cell expression fluorescence and immunofluorescence staining (the exposure time of each channel is adjusted); the third slice is a merged image of three photos obtained by taking pictures after cell expression fluorescence, immunofluorescence staining, and DAPI staining (the exposure time of each channel is adjusted).

[0072] 6. Semi-quantitative analysis of the brightness of each group of slices was performed using Image J software, and the graphs were drawn as shown in Figures 4 and 5;

[0073] 7. Compare and summarize the slice results and Image J software. The results are shown in Table 1:

[0074] Table 1

[0075] Results: Animal slice analysis indicated that most of the aforementioned promoters demonstrated the ability to express specifically in photoreceptor cells. Further analysis using Image J software revealed that the expression specificity and intensity of promoters RetinaE11, RetinaB3, RetinaC8, and RetinaA12 were relatively strong. Different promoters can be selected based on different application requirements.

[0076] Example 2

[0077] 1. Vector 1 and vector 2, which are vectors expressing nuclear green fluorescent protein and nuclear red fluorescent protein respectively under the CAG promoter, were packaged into AAV viruses. The viruses were harvested and purified with cesium chloride to obtain viral particles for in vivo animal verification experiments.

[0078] 2. Mix the two viruses obtained in step 1 at a ratio of 1:1, and then inject them into the subretinal space of mice. The virus injection dose is 2E+9GC / eye.

[0079] 3. After 2 weeks, the mouse eyes were sampled and sliced, and DAPI staining was performed to obtain the expression section map of the CAG promoter.

[0080] As shown in Figure 6, the slice image results illustrate: The CAG promoter shows slides taken at two magnifications (100x / 200x), with three slides for each magnification. The first slide is a red channel slide with annotated exposure times (1000ms / 500ms), mainly used to observe the expression of red fluorescent protein entering the nucleus; the second slide is a green channel slide with annotated exposure times (1000ms / 500ms), mainly used to observe the expression of green fluorescent protein entering the nucleus; the third slide is a merged image of three photos obtained by cells expressing two different fluorescent colors and after DAPI staining (the exposure time for each channel was adjusted). Other recombinant promoters only have images expressing one nuclear fluorescent protein and a merged image after DAPI staining.

[0081] Analysis of results: The results of animal sections showed that CAG was strongly expressed in INL, RPE and PR layer cells, while the promoters RetinaE11, RetinaB3, RetinaC8 and RetinaD9 all showed higher expression specificity than the broad-spectrum expression promoter CAG, basically expressing only in the PR layer or mainly in the PR layer, and a very small part was specifically expressed in the RPE layer cells.

[0082] The nucleic acid molecules provided by the present invention and their use as specific promoters are described in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above examples is only intended to help understand the methods of the present invention and its core concept. It should be noted that those skilled in the art may make several improvements and modifications to the present invention without departing from the principles of the present invention, and such improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A nucleic acid molecule, characterized in that It has: (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 9; or (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or (3) A nucleotide sequence having at least 85% sequence homology with the nucleotide sequence described in (1) or (2).

2. Use of the nucleic acid molecule as claimed in claim 1 as a promoter.

3. A recombinant expression vector, characterized in that: include: The nucleic acid molecule and target gene as claimed in claim 1.

4. The method for constructing a recombinant expression vector according to claim 3, characterized in that: After the nucleic acid molecule and the target gene are connected, the recombinant expression vector is obtained.

5. A virus particle, characterized in that Transform and / or transfect the recombinant expression vector according to claim 3 and / or the recombinant expression vector obtained by the construction method according to claim 4.

6. The method for preparing virus particles according to claim 5, characterized in that: The recombinant expression vector is taken for virus packaging, and then the virus is collected and purified to obtain the virus particles.

7. Use of the nucleic acid molecule according to claim 1, the recombinant expression vector according to claim 3, the recombinant expression vector obtained by the construction method according to claim 4, the viral particle according to claim 5 and / or the viral particle obtained by the preparation method according to claim 6 in cells that specifically express retinal structures.

8. The use according to claim 7, characterized in that The retinal structure includes: photoreceptors and / or retinal pigment epithelium.

9. Use of the nucleic acid molecule according to claim 1, the recombinant expression vector according to claim 3, the recombinant expression vector obtained by the construction method according to claim 4, the virus particle according to claim 5 and / or the virus particle obtained by the preparation method according to claim 6 in the preparation of products for treating and / or preventing retinal diseases.

10. A product, characterized in that include: The nucleic acid molecule according to claim 1, the recombinant expression vector according to claim 3, the recombinant expression vector obtained by the construction method according to claim 4, the virus particle according to claim 5 and / or the virus particle obtained by the construction method according to claim 6.

11. A method for treating a disease, characterized in that: Taking the product as claimed in claim 10; the disease includes: retinal disease.

Images