Propagation of plasmids containing at least one inverted repeat
By cultivating Escherichia coli bacteria at elevated temperatures, the method addresses the challenge of maintaining inverted repeat integrity during plasmid propagation, achieving high yields and improved stability for therapeutic applications.
Patent Information
- Application Number
- PCT/EP2024/085349
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-07
- Filing Date
- 2024-12-09
- Publication Date
- 2025-06-12
AI Technical Summary
Existing methods for propagating plasmids containing inverted repeats, especially those of viral origin, often result in undesirable deletions of the inverted repeat sequences, which can impair the functionality of the nucleic acid and complicate large-scale therapeutic applications.
Cultivating Escherichia coli bacteria at elevated temperatures of at least 39°C, preferably between 41°C and 43°C, to propagate plasmids containing inverted repeats, thereby maintaining the integrity of these sequences and achieving high yields.
This method effectively maintains the integrity of inverted repeats during plasmid propagation, leading to high yields of intact plasmids and improved stability of viral nucleic acids, which is crucial for therapeutic applications.
Smart Images

Figure 00000045_0000 
Figure 00000045_0001 
Figure 00000046_0000
Abstract
Description
[0001] Propagation of plasmids containing at least one inverted repeat
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to a method for propagating plasmids containing at least one inverted repeat, wherein said method comprises the step of cultivating the Escherichia coli bacteria at a temperature of at least 39°C, preferably at a temperature between 41 °C and 43°C. Moreover, the invention relates to a plasmid encoding for a cargo nucleic acid including at least one inverted repeat from a method of the present invention. The invention further relates to a cargo nucleic acid including at least one inverted repeat obtained from a method of the present invention. In addition, the invention relates to a synthetic gene vector containing a cargo nucleic acid including at least one inverted repeat obtained from a method of the present invention.
[0004] BACKGROUND
[0005] Nucleic acids containing one or more inverted repeats, optionally as palindromic sequences, bear a wide range of uses in research and therapy. For instance, inverted terminal repeats (ITRs) are regularly found. Nucleic acids can be genetic encoding material that allows expression of polypeptides by the target cell or can be intended for other purposes such as for decreasing expression rates of inherent genes of the target cell (e.g., by encoding for silencing RNA (siRNA) or micro RNA, etc.). The presence of one or more alien nucleic acids (also: (deoxy)ribonucleic acids) in the target cell can be transient or persistent. It may be inserted into the target cell's genome or may remain extrachromosomal. For instance, viral nucleic acids such as nucleic acids originating from adeno-associated virus (AAV), commonly used as vectors to import one or more cargo sequences such as one or more alien nucleic acids (e.g., DNA and, in particular in other viruses, RNA) in eukaryotic cells, are known to bear inverted terminal repeats (ITRs). Vectors such as viral vectors allow a systemic and a cell-type specific import of cargo sequences in vivo. This also allows gene therapy of humans and other mammals.
[0006] When using nucleic acids on a large scale, such as required for therapeutic uses, efficient preparation thereof is required. Technical means such as polymerase chain reaction (PCR) often do not provide sufficient amounts with reasonable effort or are inhibited by the inverted repeat structure. Therefore, when higher amounts of nucleic acids are desired, often plasmids containing the nucleic acid sequence (also: cargo nucleic acid) of interest are amplified in Escherichia coli (E coli) bacteria. Such propagation of plasmids efficiently provides a reasonably large amount of plasmid DNA. Propagation of E. coli bacteria containing the plasmids may be performed as a seed train for several consecutive days to reach sufficient biomass for large-scale plasmid production in a stirred tank reactor. However, when preparing cargo nucleic acids that include at least one inverted repeat, in particular, at least one inverted repeat of longer nucleic acid sequence length, such as e.g. an ITR, there are special challenges when propagating the plasmids. Doherty et al. (Gene, 1993, 124:29-35), for instance, reported that it is challenging to obtain libraries of lambda phages that comprise such palindromic sequences in commonly used Escherichia coli strains. Often, deletions of inverted repeats incur when preparing plasmids encoding for ITRs as shown in Samulski et al. (Proc. Natl. Acad. Sci. USA, 1982, 79:2077-2081). Deletion mutants have also been purposefully prepared by Samulski et al. (Cell, 1983, 33:135-143), of which some were considered as not feasible for replication as taught in Samulski et al. (Journal of Virology, 1987, 3096-3101). Indeed, deletions can significantly impair the quality of the inverted repeats of viral nucleic acid as also taught by Wang et al. (J. Mol. Biol., 1995, 250:573-580). Analysis of the deletions in a production process can be laborious and challenging.
[0007] It is desired to maintain the integrity of the at least one inverted repeat in the final product as this may support the functionality of the desired nucleic acid such as, e.g., a viral nucleic acid which may be usable for inserting into the target cell’s genome and / or for replication.
[0008] Unfortunately, deletions of sequence motifs, which can form extensive intra- and / or intersequence secondary structures such as inverted repeats, are for example found, when propagating plasmids encoding for viral nucleic acids that contain at least one ITR in Escherichia coli bacteria by routine techniques.
[0009] Typically, Escherichia coli bacteria are cultivated at a temperature of 37°C. Propagation of plasmids is typically performed by means of cultivating the proliferating Escherichia coli bacteria at such standard conditions. When labile proteins are intended to be expressed, the temperature may be decreased to 30°C or even ambient temperature. Decreasing the temperature may reduce the proliferation of the bacteria and may have other effects reducing the plasmid copy number and thus led to long processing times and decreased yields per time. Additionally, it was found that undesirable deletions of inverted repeats are found at such conditions. Also, applying a brief heat shock, as known in the art, did not affect the quality of the inverted repeats of a viral nucleic acid.
[0010] Remaut et al. (Gene, 1983, 22:103-113) described a brief temperature shift from 28°C to 42°C of three or six hours to select plasmids with temperature-inducible promoters. In another instance, a plasmid containing a temperature-inducible promoter was maintained at 30°C before shifting the culture to 42°C for 16 h to induce the expression of a protein of interest (Waldman et al., J Biol Chem, 1983 19: 11571-11575). Furthermore, brief temperature shocks of less than two minutes have been described. These methods, however, do not allow sufficient preparation of cargo nucleic acids that include at least one inverted repeat and maintain the integrity of the inverted repeat.
[0011] Various conditions of cultivating the Escherichia coli bacteria and propagating plasmids encoding for a viral nucleic acid that contains at least one inverted repeat were previously tested, like using recombination-deficient E. coli strains, selecting smaller colonies, and reducing culture times. The undesirable deletion of inverted repeats has nonetheless remained a challenging issue, as described in Wilmott et al. (Human Gene Therapy Methods, 2019, 30(6):206-213). An undesirable heterogeneity of more and less deleted versions may be the result of a standard process known in the art. Some deletions are detectable by using digestion enzymes. For others, a more detailed analysis is required.
[0012] In production processes, the problem of undesirable deletions is tried to be avoided by truncating the inverted repeats, like ITRs, from the onset such as, e.g., by 22 or 11 base pairs in the ITR internal inverted repeat, in addition to truncating the ITR outer inverted repeat by 15 base pairs. A meta-analysis of published plasmids available for AAV research shows that all available ITRs are truncated at least by 15 base pairs (cf. Example 1). This is, however, not desirable. On the one hand, the disadvantage that still deletions occur remains. On the other hand, the efficacy of nucleic acids, such as viral nucleic acids usable in the production of vectors such as viral vectors, may be negatively affected.
[0013] Therefore, there was an unmet need for an efficient method for propagating plasmids containing at least one inverted repeat that widely maintains the integrity of at least one inverted repeat.
[0014] SUMMARY
[0015] Surprisingly, the inventors found that permanently cultivating the Escherichia coli bacteria at an elevated temperature of at least 39°C, preferably at a temperature of between 41 °C and 43°C led to a desirable method for propagating plasmids encoding for a viral nucleic acid that contains at least one inverted repeat. It was experimentally found that high yields of such plasmids could be achieved, and the integrity of the inverted repeats could be widely maintained.
[0016] An aspect of the present invention relates to a method for propagating plasmids containing at least one inverted repeat, wherein said method comprises the following steps:
[0017] (i) providing Escherichia coli bacteria comprising one or more of the plasmids; and (ii) cultivating the Escherichia coli bacteria of step (i) at a temperature of at least 39°C, preferably at a temperature of between 41 °C and 43°, even more preferred at a temperature of 42°C.
[0018] FIGURES
[0019] Figure 1 : Recovery of full-length ITRs from a recombinant AAV source, (a) Cloning scheme starting from a source plasmid (ITR plasmid) with shortened ITRs and recovery of Sacl-restricted upstream and downstream fragments in separate cloning procedures, (b) ITR length distributions from nanopore sequencing of the vectorized upstream and downstream fragments compared to the source ITRs (fat lines). Arrows indicate plasmids with almost complete ITR loss.
[0020] Figure 2: Effect of E. coli propagation on full-ITR integrity, (a) Experimental scheme, (b) ITR integrity over cultivation time for strain DH5a and Stbl3.
[0021] Figure 3: Effect of propagation temperature on ITR integrity in E. coli Stbl3. (a) Histograms of ITR length at different propagation temperatures. The dashed line indicates the expected length for a full ITR. (b) Derived ITR integrity in percent versus propagation temperature after three days.
[0022] Figure 4: ITR integrity in other common strains of E. coli. (a) ITR integrity in DH5a and BL21 (DE3) after three days of propagation at 42 °C. (b) Derived ITR degradation in comparison to propagation at 37 °C.
[0023] Figure 5: Stability of full length ITRs cloned from oligonucleotides in Stbl3 at 37 °C (a) and 42 °C (b) after day 1 (fat line) and day 3 of propagation. Percentages in the chart are percent correct ITRs compared to the ori distal ITR, pZMB990, JW0387, 42 °C, day 1.
[0024] Figure 6: Influence of gyrase inhibition with nalidixic acid (a) and SSB overexpression (b) on ITR integrity. Percentages and reference as in Figure 5.
[0025] Figure 7: Influence of an SbcC knockout on ITR stability at 42 °C propagation (a) and at 37 °C propagation. The arrow indicates plasmids with complete ITR loss, n.s.: not significant. Ref.: reference for calculation of ITR integrity.
[0026] Figure 8: Mechanistic investigation of the degradation mechanism, (a) Data from Figure 5a divided into regions of interest R1 to R3. (b) Underlying main sequences per R1 to R3 in a. (c) Single reads of R2 aligned to the reference, (d-f) Model for possible degradation mechanism by SbcCD attack or slipped misalignment, (d) Replication may stall at an inverted repeat within the replication fork, which is then cut by SbcCD, leading to complete plasmid loss, (e) Slippage at a direct repeat flanking an inverted repeat leads to a loss of the inverted repeat, (f) Model for a more complex deletion-inversion based on slippage.
[0027] Figure 9: Investigation of plasmid quality, (a) The temperature increase leads to a slight increase in plasmid concatemerization (black arrows) as seen by long-read sequencing, (b) Per-read percent identity as a measure of base quality shows no difference between tests, (c) Methylated base calling for 5mC (dem motifs marked by red arrows) and 6mA (dam motifs marked by green arrows) shows a slight decrease in unwanted bacterial base methylation when plasmids are propagated in accordance with the method of the present invention. All data based on pZMB990.
[0028] Figure 10: Impact of full-length ITRs on recombinant AAV production. Test plasmids only differed in ITR integrity, as indicated, (a) Absolute rAAV productivity per transfected cell as determined by qPCR on the packaged transgene, (b) Mispackaged backbone DNA per viral genome (qPCR on backbone and transgene), (c) Viral genomes per assembled capsids as determined by qPCR and ELISA.
[0029] Figure 11 : Transfection of HEK293 cells with synthetic AAV genomes from pZMB990 packaged in SM-102-based lipid nanoparticles. The transfection efficiency (bars) was determined by flow cytometry on the eGFPd2 reporter fluorescence. The cell viability was determined in flow cytometry based on propidium iodide staining.
[0030] DETAILED DESCRIPTION
[0031] As used herein, the term “propagating plasmids” may be understood in the broadest sense as any means for increasing the amount of the plasmid of interest. The person skilled in the art will know that propagating plasmids is typically associated with proliferation of the Escherichia coli bacteria.
[0032] The term “inverted repeat” may be understood as commonly understood in the art in the broadest sense. The person skilled in the art commonly knows what is an inverted repeat. In short, an inverted repeat may be understood as a nucleic acid comprising a respective single-stranded sequence of nucleotides that is followed downstream by its reverse complement on the same single strand. These complementary sequences may or may not be interrupted by other sequences, e.g., with one or more inverted repeats or other sequences. When there is no intervening sequence, the composite sequence may be understood as a palindromic sequence. The person skilled in the art knows that inverted repeats are sometimes called hairpin structures, hairpin loops, or stem-loop structures. The person skilled in the art is aware that inverted repeats present on double-stranded DNA may form structures that resemble holiday junctions, sometimes called cruciforms.
[0033] The at least one inverted repeat may be any inverted repeat. An inverted repeat may be of any origin. In preferred embodiments, an inverted repeat may be of viral origin, of bacterial origin, of human or animal origin, or plant origin, of fungal origin, of synthetic origin, possibly aided by computational design, or of a combination of two or more thereof. In a preferred embodiment, an inverted repeat is of viral origin. In a preferred embodiment, an inverted repeat is of AAV viral origin, in particular AAV virus serotype 2 origin. In a preferred embodiment, the cargo nucleic acid is selected from the group consisting of recombinant adeno-associated virus (AAV) vector genomes. In a preferred embodiment, the cargo nucleic acid is a recombinant AAV vector genome optionally comprising one or more cargo peptide and / or protein expression cassettes.
[0034] An inverted repeat may be present in the plasmid as originally obtainable or may be present in a cargo nucleic acid.
[0035] As used herein in the context of the plasmid, the term “cargo nucleic acid” may be understood in the broadest sense as any nucleic acid sequence that has been inserted into the plasmid. In other words, the plasmid may serve as a vector for one or more cargo nucleic acids contained therein.
[0036] In a preferred embodiment, the at least one inverted repeat is an inverted repeat of viral origin. In a preferred embodiment, the at least one inverted repeat is an inverted repeat of the same viral origin as the other sequences of the viral nucleic acid. In a preferred embodiment, the at least one inverted repeat is an inverted repeat of an adeno-associated virus (AAV). Inverted repeats of AAV are exemplarily described in Lusby et al. (Journal of Virology, 1980, 34(2):402-409), Berns (Human Gene Therapy, 2020, 31(9-10): 518-523), and Wilmott et al. (Human Gene Therapy Methods, 2019, 30(6):206-213).
[0037] In a preferred embodiment, the at least one inverted repeat is an inverted terminal repeat (ITR).
[0038] The term “inverted terminal repeat” and its abbreviation “ITR” are used as commonly used in the art in the broadest sense. The person skilled in the art commonly knows what an ITR is. In short, an ITR may be understood as an inverted repeat located at a terminal end of a DNA sequence of interest.
[0039] The at least one ITR may be an ITR of any origin. In a preferred embodiment, the at least one ITR is an ITR of viral origin, typically referred to as a wild-type ITR. In a preferred embodiment, the at least one ITR is an ITR of the same viral origin as the other sequences of the viral nucleic acid. In a preferred embodiment, the at least one ITR is an ITR of an adeno-associated viruses (AAV) serotype 2, which can also be designated as AAV2-ITR. AAV2-ITRs are exemplarily described in Lusby et al (Journal of Virology, 1980, 34(2):402-409), Berns (Human Gene Therapy, 2020, 31 (9-10): 518-523), and Wilmott et al. (Human Gene Therapy Methods, 2019, 30(6):206- 213). Many other AAV-ITRs from other AAV serotypes are known in the art. In addition, synthetic AAV-ITRs with altered sequences are known in the art.
[0040] AAV-ITRs are characterized by having four sequence elements, typically referred to as A, B, C, and D, arranged in a pattern of A-B-B'-C-C'-A'-D, where the prime indicates the reverse complement of the respective sequence element. The pattern A-B-B'-C-C'-A'-D is typically referred to as the FLIP-configuration, and A-C-C'-B-B'-A'-D is typically referred to as the FLOP configuration. The D sequence is not part of the inverted repeat but is typically still considered part of the ITR. The person skilled in the art is aware that any combination of the sequence elements A, B, C, and D able to form an inverted repeat would still be considered an ITR. For example, the pattern A- A'-D would still be considered an ITR. The person skilled in the art is aware that any combination of shortened sequence elements able to form an inverted repeat would still be considered an ITR. For example, the pattern A(short)-A'-D would still be considered an ITR when A(short) was shorter in length compared to A'.
[0041] In a preferred embodiment, the inverted repeat is characterized in that it is at least 4 bp in length, at least 10 bp in length, at least 25 bp in length, at least 50 bp in length, at least 75 bp in length, at least 80 bp in length, at least 90 bp in length, at least 93 bp in length, at least 94 bp in length, at least 100 bp in length, at least 110 bp in length, at least 120 bp in length, at least 140 bp in length, or at least 130 bp in length, or at least 150 bp in length.
[0042] In a preferred embodiment, the inverted repeat is characterized in that it is not more than 1000 bp in length, not more than 300 bp in length, not more than 200 bp in length, not more than 150 bp in length, not more than 100 bp in length, or not more than 50 bp in length. The molar content of guanosine and cytidine (guanosine / cytidine content, GC content), based on the overall nucleoside content, of the inverted repeat may be any content. In a preferred embodiment, the inverted repeat is characterized in that it has a guanosine / cytidine content of at least 50 mol%, at least 60 mol%, at least 65 mol%, at least 70 mol%, at least 75 mol%, or at least 80 mol%, based on the overall nucleoside content.
[0043] In a preferred embodiment, the inverted repeat is characterized in that at least 50 mol%, at least 60 mol%, at least 70 mol%, at least 80 mol%, at least 90 mol%, at least 95 mol%, at least 99 mol%, or 100 mol%, of the bases are paired in a folded single strand.
[0044] In a preferred embodiment, the inverted repeat is characterized in that: it is of viral origin, in particular adeno-associated virus (AAV) origin; it is an ITR, in particular an ITR of adeno-associated virus (AAV) origin; at least 131 base pairs in length including the D-sequence; characterized by a guanosine / cytidine content of at least 70 mol%, based on the overall nucleoside content; and / or characterized in that at least 80 mol% of the bases are paired in a folded single strand.
[0045] The plasmid may or may not encode for one or more cargo nucleic acids.
[0046] In a preferred embodiment, the plasmid encodes for at least one cargo nucleic acid.
[0047] In a preferred embodiment, the plasmid encodes for at least one cargo nucleic acid that comprises or consists of a sequence encoding for: one or more polypeptides;
[0048] RNA, in particular messenger RNA encoding for a polypeptide of interest small interfering RNA and / or trans-activating crRNA;
[0049] DNA of interest, in particular DNA encoding recognition motifs for analytical or therapeutic applications.
[0050] A cargo nucleic acid may have any length and may be of any origin. In preferred embodiments, a cargo nucleic acid may be 10 to 100000 base pairs (bp) in length, 10 to 80000 bp in length, 50 to 50000 bp in length, 100 to 10000 bp in length, 500 to 5000 bp in length, or 600 to 3000 bp in length. In preferred embodiments, a cargo nucleic acid may be of viral origin, of bacterial origin, of human or animal origin, or plant origin, of fungal origin, or of a combination of two or more thereof. In a preferred embodiment, the method of the present invention is a method for propagating plasmids encoding for a vector that contains at least one inverted terminal repeat (ITR), wherein said method comprises the following steps:
[0051] (i) providing Escherichia coli bacteria comprising one or more of the plasmids; and
[0052] (ii) cultivating the Escherichia coli bacteria of step (i) at a temperature of at least 39°C, preferably at a temperature of between 41 °C and 43°C, most preferably of 42°C for at least 6 hours.
[0053] As used herein, the term “encoding for a vector” may be understood in the broadest sense as bearing a deoxyribonucleic acid (DNA) sequence of viral origin. Preferably, the DNA sequence of viral origin (in which one or more non-viral cargo sequences may optionally be inserted) has at least 80%, more preferably at least 90%, in particular at least 95% or at least 98% or at least 99% sequence homology with the corresponding wild-type viral sequence or is identical with a wildtype viral sequence, in particular of an AAV virus. A vector may or may not contain a cargo sequence. As used herein, the term “cargo sequence” may be understood in the broadest sense as any sequence that is typically not of the same viral origin as the one or more inverted repeats, in particular ITRs. A cargo sequence may be transferred to a cell as a cargo of the vector. In a preferred embodiment, the vector comprises one or more cargo sequences. In a preferred embodiment, the one or more cargo sequences are located between two inverted repeats, in particular two ITRs. In a preferred embodiment, the one or more cargo sequences are not of the same origin as the at least one inverted repeat, in particular the at least one ITR. In a preferred embodiment, the one or more cargo sequences are one or more non-viral cargo sequences. In a preferred embodiment, the one or more cargo sequences are of origin of the target cell. In a preferred embodiment, the vector comprises one or more non-viral cargo sequences, preferably wherein the one or more non-viral cargo sequences are located between two inverted repeats, in particular ITRs. In addition to the at least one inverted repeat, in particular ITR, and optional one or more cargo sequences, the virus vector may optionally comprise one or more further encoding sequences. In a preferred embodiment, the vector encodes for one or more further viral and / or non-viral polypeptides.
[0054] The inverted repeat may be located at any terminal end of the cargo sequence. In a preferred embodiment, the at least one inverted repeat is at least one ITR of a cargo nucleic acid.
[0055] In a preferred embodiment, an inverted repeat is at least one ITR at the 5' terminus of a cargo nucleic acid. In another preferred embodiment, an inverted repeat is at least one ITR at the 3' terminus of a cargo nucleic acid. In a preferred embodiment, the plasmid contains two ITRs located at the terminal ends of the cargo nucleic acid. In a preferred embodiment, the cargo nucleic acid contains at least one ITR located at the 5' terminus of the coding strand of the cargo nucleic acid and at least one ITR located at the 3' terminus of the coding strand of the cargo nucleic acid.
[0056] The at least one inverted repeat, in particular the at least one ITR, may be shortened or may not be shortened in comparison to a wild-type ITR. In a preferred embodiment, the at least one inverted repeat, in particular the at least one ITR, that is not shortened by more than 20, by more than 19, by more than 18, by more than 17, by more than 16, by more than 15, by more than 14, by more than 13, by more than twelve, by more than eleven, by more than ten, by more than nine, by more than eight, by more than seven, by more than six, by more than five, by more than four, by more than three, or by more than two base pairs in length in comparison to the respective wildtype ITR.
[0057] In a preferred embodiment, the two inverted repeats, in particular at least two ITRs, are characterized in that they are both each not shortened by more than 20, by more than 19, by more than 18, by more than 17, by more than 16, by more than 15, by more than 14, by more than 13, by more than twelve, by more than eleven, by more than ten, by more than nine, by more than eight, by more than seven, by more than six, by more than five, by more than four, by more than three, or by more than two base pairs in length in comparison to the respective wild-type ITR.
[0058] In a preferred embodiment, when conducting the method of the present invention, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of inverted repeats are not shortened after 1 day of cultivating in accordance with step (ii) (in comparison to the respective inverted repeat provided in step (i)).
[0059] In a preferred embodiment, when conducting the method of the present invention, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of inverted repeats are not shortened after 3 days of cultivating in accordance with step (ii) (in comparison to the respective inverted repeat provided in step (i)).
[0060] In a preferred embodiment, at least 80% of inverted repeats are not shortened after 1 day of cultivating in accordance with step (ii) (in comparison to the respective inverted repeat provided in step (i)). and / or at least 80% of inverted repeats are not shortened after 3 days (in comparison to the respective inverted repeat provided in step (i)). It will be understood that, as used herein, the “obtained at least one inverted repeat” or the “obtained cargo nucleic acid” is that obtained as a product of the method of the present invention. It may be obtained as an outcome of step (ii) or if present, any of steps (iii) or (iv).
[0061] It will be understood that, as used herein, the respective inverted repeat provided in step (i) is that as originally inserted in the method as used as original material (also: educt or basis) for propagating.
[0062] In a preferred embodiment, at least 80% of the obtained at least one inverted repeat, in particular at least one ITR, are not shortened after 1 day of cultivating in accordance with step (ii) of the method (in comparison to the respective inverted repeat provided in step (i)) and / or at least 80% of inverted repeats are not shortened after 3 days (in comparison to the respective inverted repeat provided in step (i)). In a preferred embodiment, the obtained cargo nucleic acid contains two inverted repeats, in particular two ITRs, at least 95% of both of which are not shortened after 1 day of cultivating in accordance with step (ii) (in comparison to the respective inverted repeat provided in step (i)) and / or at least 90% of inverted repeats are not shortened after 3 days (in comparison to the respective inverted repeat provided in step (i)).
[0063] In a preferred embodiment, the obtained cargo nucleic acid contains at least one inverted repeat, in particular at least one ITR, that is the respective inverted repeat provided in step (i) of the method of the cargo nucleic acid. In a preferred embodiment, the obtained cargo nucleic acid contains two inverted repeats, in particular two ITRs that are both each the respective inverted repeats provided in step (i) of the method of the cargo nucleic acid.
[0064] In a preferred embodiment, the plasmid contains two ITRs flanking a cargo nucleic acid. In other words, the plasmid contains two ITRs that are preferably located at the terminal ends of a cargo nucleic acid.
[0065] In a preferred embodiment, the cargo nucleic acid comprises or consists of a sequence encoding for: viral polypeptides and / or nucleic acids, preferably one or more adeno-associated virus (AAV) polypeptides and / or nucleic acids, preferably a whole adeno-associated virus (AAV), in particular an AAV serotype 2;
[0066] RNA, in particular messenger RNA, small interfering RNA and / or trans-activating crRNA; DNA of interest, in particular DNA encoding for a polypeptide of interest. The term “plasmid” as used herein may be understood in the broadest sense as generally understood in the art. A plasmid may be understood as an extrachromosomal DNA molecule that is physically separated from chromosomal DNA and can replicate independently.
[0067] In a preferred embodiment, the plasmid is characterized in that:
[0068] (a) it contains at least one origin of replication suitable for replication in Escherichia coir,
[0069] (b) it contains at least one sequence enabling selecting Escherichia coli comprising the plasmid, preferably at least one sequence mediating antibiotic resistance or at least one sequence encoding for an enzyme that enables growth in the absence of an essential nutrient component or significant for the metabolism (i.e., plasmid maintenance components such as antibiotic resistance mediating enzymes); and / or
[0070] (c) is a circular plasmid of double-stranded DNA of at least 1000 base pairs in length, preferably of at least 2000 base pairs in length, in particular of at least 3000 base pairs in length.
[0071] An origin of replication (ori) may be understood in the broadest sense as generally understood in the art as the site of the plasmid where replication is initiated. The origin of replication may enable replication (also: duplication) of the plasmid in the bacteria. In a preferred embodiment, the plasmid comprises at least one origin of replication suitable for replication in Escherichia coli. This, in a preferred embodiment, the plasmid comprises at least one origin of replication suitable for replication in the Escherichia coli strain as used in the method of the present invention. In one embodiment, the origin of replication may be that of a pUC ori.
[0072] In a preferred embodiment, the plasmid contains at least one sequence mediating antibiotic resistance. In a preferred embodiment, such sequence mediating antibiotic resistance may be a sequence encoding for an enzyme that facilitates at least partial inactivation of an antibiotic. For instance, kanamycin (Kan) and nptll or beta-lactamase facilitating the cleavage of a beta-lactam cycle of beta-lactam antibiotics. This enables selecting Escherichia coli comprising the at least one plasmid, because only those bacteria containing the plasmid will be widely resistant against the antibiotic.
[0073] In another embodiment, the plasmid contains at least one sequence encoding for an enzyme that enables growth in the absence of an essential nutrient component. For instance, a deficiency mutant of the bacteria which is not autotrophic for a certain nutrient such as for an amino acid may only grow in a medium that is essentially lacking this nutrient, when the plasmid that cures the deficiency is present in the bacterium. This enables selecting Escherichia coli comprising the at least one plasmid. A plasmid may be circular or linear. In a preferred embodiment, the plasmid is a circular plasmid. In a preferred embodiment, the plasmid is a circular plasmid of double-stranded DNA. In a preferred embodiment, the plasmid is a circular plasmid of double-stranded DNA of at least 1000 base pairs in length, preferably of at least 2000 base pairs in length, in particular of at least 3000 base pairs in length.
[0074] In a preferred embodiment, the plasmid is a circular plasmid of double-stranded DNA of 100 to 100000 base pairs in length, of 500 to 50000 base pairs in length, of 750 to 25000 base pairs in length, of 1000 to 10000 base pairs in length, of 1500 to 7500 base pairs in length, or of 2000 to 5000 base pairs in length.
[0075] The Escherichia coli bacteria (also: E. coli) may be any Escherichia coli bacteria known in the art. In a preferred embodiment, the Escherichia coli bacteria may be a strain that may be cultivated at a temperature of up to at least 42°C, up to at least 43°C, up to at least 44°C, up to at least 45°C, up to at least 46°C, or even above 46°C. In a preferred embodiment, the Escherichia coli bacteria may be a strain that may be able to proliferate at least at a temperature of 10 to 46°C, of 15 to 45°C, of 18 to 44°C, of 20 to 43.5°C, of 25 to 43°C, of 30 to 42°C, or of 35 to 42°C.
[0076] In a preferred embodiment, the Escherichia coli bacteria may be any strain that is not heat-labile at the intended temperature. In a preferred embodiment, the Escherichia coli bacteria are wildtype Escherichia coli bacteria. In a preferred embodiment, the Escherichia coli bacteria are K-12 derivative Escherichia coli bacteria. In a preferred embodiment, the Escherichia coli bacteria are B derivative Escherichia coli bacteria.
[0077] It was shown that there are strains of Escherichia coli bacteria available that are cultivated to adapt to high temperatures up to 48.5°C as shown, for example, in Rudolph et al. (The Journal of Biological Chemistry, 2010, 285(25): 19029-19034). Such bacteria strains may, for instance, be used when higher temperature ranges are of interest.
[0078] In a preferred embodiment, the Escherichia coli bacteria may be adapted to maintain proliferative at an elevated temperature above 37°C, above 38°C, above 39°C, above 40°C, above 41 °C, above 42°C, above 43°C, or above 44°C by selecting bacteria by cultivating these for several proliferation cycles at such elevated temperature.
[0079] In another embodiment, the Escherichia coli bacteria are not adapted to growth at elevated temperatures and are subjected to elevated temperatures only after transformation. Step (i) of the method of providing Escherichia coli bacteria comprising one or more of the plasmids may be conducted by any means.
[0080] The provision of the Escherichia coli bacteria may be understood in the broadest sense as the mere presence of the Escherichia coli bacteria by any means. The Escherichia coli bacteria may be of any origin. For instance, the Escherichia coli bacteria may be obtained from a stock or may be obtained from a cell culture. A stock may optionally be a frozen stock (e.g., stored in liquid nitrogen, at -80°C, or at -20°C). A stock may optionally contain one or more freezing protective agents such as glycol, glycerol, and / or one or more sugars. Alternatively, a stock may also be freeze-dried (also: lyophilized) and stored at any suitable condition. A cell culture may be any cell culture, such as, e.g., a liquid culture or a culture using a gel-like cell culture plate (e.g., agar plate).
[0081] Step (ii) of the method of cultivating the Escherichia coli bacteria of step (i) may be conducted by any means. The person skilled in the art will be aware of a large variety of cell culture methods. Cultivating may be conducted in a liquid culture, a culture using a gel-like cell culture plate (e.g., agar plate), or a sequential combination thereof.
[0082] In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 6 hours, for at least 8 hours, at least 16 hours, for at least 24 hours, for at least 36 hours, for at least 48 hours, or for at least three days. In a most preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for 6-8 hours. When the step (ii) of cultivating the Escherichia coli bacteria is conducted for more than 16 hours, the cultivating exceeding 16 hours may be optionally conducted at the same temperature or at a different temperature such as a lower temperature.
[0083] In a preferred embodiment, the Escherichia coli bacteria comprising one or more of the plasmids containing at least one inverted repeat have not been incubated for more than 12 hours, preferably not incubated for more than 6 hours, in particular not incubated for more than 3 hours, at a temperature below 39°C before step (ii) is conducted. In a preferred embodiment, the Escherichia coli bacteria comprising one or more of the plasmids containing at least one inverted repeat were not incubated for more than 12 hours, preferably not incubated for more than 6 hours, in particular not incubated for more than 3 hours, at a temperature below 39°C after step (ii) is conducted.
[0084] Surprisingly, the inventors found that cultivating Escherichia coli bacteria comprising one or more of the plasmids containing at least one inverted repeat permanently at elevated temperatures of at least 39°C, preferably at a temperature between 41 °C and 43°C widely maintained the integrity of the at least one inverted repeat contained by the one or more plasmids. Hence, step (ii) as (essentially) the only cultivation step conducted at a temperature of at least 39°C, preferably at a temperature of between 41 °C and 43°C, even more preferred at a temperature of 42°C turned out to be of special advantage in comparison to prior art methods.
[0085] Specifically, the inventors found that the method of the invention is particularly advantageous in propagating Escherichia coli bacteria comprising one or more of the plasmids containing at least one inverted repeat, wherein (i) the inverted (terminal) repeat comprises at least 125 base pairs in length, (ii) once the E. coli bacteria comprise the plasmid, the bacteria are permanently cultivated at a temperature of at least 39°C, preferably of between 41 and 43°C, even more preferred at a temperature of 42°C, and (iii) harvesting the Escherichia coli bacteria after step (ii) has been conducted and optionally isolating the plasmids.
[0086] Specifically, it was found that not only ori-distal, but also ori-proximal ITRs could be stabilized and their integrity maintained. This was insofar surprising as these ITRs are usually prone to deletions and instability at typical propagation temperatures, such as 37°C.
[0087] It is hence a most preferred embodiment that the entire method of the invention be conducted at a temperature of at least 39°C. In another most preferred embodiment, the entire method of the invention is conducted at a temperature of between 41°C and 43°C.
[0088] Hence, in a most preferred embodiment, the cultivating step (ii) is (essentially) the only cultivating step conducted with the Escherichia coli bacteria comprising one or more of the plasmids containing at least one inverted repeat. The cultivating step (ii) may then be conducted at a temperature of at least 39°C, of at least 40°C, of at least 41°C or at least 42°C. In a most preferred embodiment, the cultivating step (ii) is (essentially) the only cultivating step conducted and is conducted at a temperature of between 41 °C and 43°C. The cultivating step (ii) may be conducted for 6-8 hours. In another embodiment, the cultivating step (ii) is conducted for at least 16 hours.
[0089] It will be understood that the bacteria may optionally be cultivated at lower temperatures before the one or more of the plasmids containing at least one inverted repeat are inserted.
[0090] If the step (ii) of cultivating the Escherichia coli bacteria is conducted for more than 16 hours, the cultivating exceeding 16 hours may also be understood as additional cultivating. This may be understood as or may include or may be followed by storing a cryogenic culture, like freezing the culture in liquid nitrogen, at -80°C, or at -20°C, optionally in presence of one or more freezing protective agents.
[0091] In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 6 hours at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41°C, of at least 41 ,5°C, or of at least 42°C. In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for 6-8 hours at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41°C, of at least 41.5°C, or of at least 42°C. In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 16 hours at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41 °C, of at least 41.5°C, or of at least 42°C. In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 24 hours at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41°C, of at least 41.5°C, or of at least 42°C. In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 36 hours at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41 °C, of at least 41.5°C, or of at least 42°C. In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 48 hours at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41 °C, of at least 41.5°C, or of at least 42°C. In a preferred embodiment, step (ii) of cultivating the Escherichia coli bacteria is conducted for at least three days at a temperature of at least 39.5°C, more preferably of at least 40°C, of at least 40.5°C, of at least 41 °C, of at least 41 ,5°C, or of at least 42°C.
[0092] In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41°C to 44°C or of from 41 °C to 43°C or at 42°C. In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 6 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41 °C to 44°C or of from 41 °C to 43°C or at 42°C. In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for 6-8 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41°C to 44°C or of from 41 °C to 43°C or at 42°C. In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 16 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41°C to 44°C or of from 41 °C to 43°C or at 42°C.
[0093] In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 24 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41 °C to 44°C or of from 41 °C to 43°C or at 42°C. In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 36 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41 °C to 44°C or of from 41°C to 43°C or at 42°C. In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 48 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41 °C to 44°C or of from 41 °C to 43°C or at 42°C. In a preferred embodiment, the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least three days at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41 °C to 44°C or of from 41 °C to 43°C or at 42°C.
[0094] In a most preferred embodiment, the Escherichia coli bacteria are permanently cultivated at the temperature ranges as indicated above.
[0095] In an alternative preferred embodiment, the Escherichia coli bacteria are cultivated at different temperatures including at least one time interval of cultivating at the temperature ranges at indicated above. In an alternative preferred embodiment, the Escherichia coli bacteria are cultivated for a time interval of cultivating at the temperature ranges at indicated above before harvesting the bacteria.
[0096] In a preferred embodiment, the method of the present invention comprises the following steps:
[0097] (i) providing Escherichia coli bacteria comprising one or more plasmids encoding for a cargo nucleic acid that contains two inverted repeats, in particular two ITRs; and
[0098] (ii) cultivating the Escherichia coli bacteria of step (i) permanently at a temperature of 41 °C to 43°C, preferably at 42°C.
[0099] In another preferred embodiment, the method of the present invention comprises the following steps:
[0100] (i) providing Escherichia coli bacteria comprising one or more plasmids encoding for a cargo nucleic acid that contains two inverted repeats, in particular two ITRs; and
[0101] (ii) cultivating the Escherichia coli bacteria of step (i) at a temperature of at least 39°C, preferably of between 41°C and 43°C, even more preferably at 42°C, for 6-8 hours, wherein the entire method is conducted at a temperature of at least 39°C, preferably at a temperature of between 41 ° and 43°C.
[0102] The method of the present invention may optionally contain one or more further steps conducted subsequent to step (ii) of cultivating the Escherichia coli bacteria.
[0103] In a preferred embodiment, the method further comprises a step (iii) of harvesting the Escherichia coli bacteria after step (ii) has been conducted. The harvesting of the Escherichia coli bacteria may be conducted by any means known in the art. For instance, harvesting of the Escherichia coli bacteria may be conducted by may comprise centrifugation and / or filtration (e.g., dead end filtration and / or cross-flow filtration) of a bacterial suspension obtained from step (ii). In a preferred embodiment, the method further comprises a step (iii) of harvesting the Escherichia coli bacteria after step (ii) has been conducted and optionally isolating the plasmids.
[0104] Isolating the plasmids bacteria may be conducted by any means known in the art. For instance, the bacteria may be lysed in a lysis buffer and the plasmid may be obtained by using an anion exchanger. Different means are commercially available.
[0105] In a preferred embodiment, the method of the present invention is a method for preparing an isolated plasmid, comprising the following steps:
[0106] (i) providing Escherichia coli bacteria comprising one or more plasmids encoding for a cargo nucleic acid that contains two inverted repeats, in particular two ITRs;
[0107] (ii) cultivating the Escherichia coli bacteria of step (i) at a temperature of at least 39°C, preferably of between 41 °C and 43°C, preferably at 42°C; and
[0108] (iii) optionally harvesting the Escherichia coli bacteria after step (ii) has been conducted and isolating the plasmids, wherein the entire method is conducted at a temperature of at least 39°C, preferably at a temperature of between 41 ° and 43°C.
[0109] The plasmid may be such that is suitable for use in eukaryotic cells or may be such that is not suitable for use in eukaryotic cells.
[0110] In particular, when the plasmid is not suitable for use in eukaryotic cells, the cargo nucleic acid containing at least one inverted repeat may be optionally isolated. Such isolation of the cargo nucleic acid may be conducted by any means. The person skilled in the art is aware of a large variety of means for isolating such sequences such as, e.g., using digestion enzymes and separating sequences of different length by electrophoretic techniques.
[0111] A cargo nucleic acid may be used further either directly or may form part of a vector such as a viral vector or in a non-viral vector. This may be conducted by any means. The person skilled in the art is aware of a large variety of means for inserting a sequence into a gene vector such as, e.g., digestion enzymes providing sequences that are complementary with a gene vector's ends.
[0112] In a preferred embodiment, the method further comprises a step (iv) of isolating the cargo nucleic acid from the isolated plasmids of step (iii) and optionally an additional step (iv-a) of inserting the cargo nucleic acid into a gene vector.
[0113] Such gene vector may be any gene vector known in the art such as, e.g., another cargo nucleic acid, a recombinant virus, a micelle, a liposome, a lipid-nanoparticle, an extracellular vesicle, a virus-like particle of an enveloped or non-enveloped virus, a chitosan nanoparticle, a poly(L- lysine) complex, a poly(ethylenimine) complex, a calcium phosphate complex, a dextran complex, dendrimers, a high-density lipoprotein-mimicking system, a metal nanoparticle, a quantum dot, a carbon nanotube, a silica-based system, a conjugate of a cell-penetrating peptide, or combinations of two or more thereof. Alternatively, the isolated cargo nucleic acid may also be inserted into a target cell by other means, such as, e.g., by electroporation, hydrodynamic delivery, microinjection, nucleofection, sonoporation, magnetofection, and / or a gene gun.
[0114] In a preferred embodiment, the method of the present invention is a method for preparing an isolated cargo nucleic acid, comprising the following steps:
[0115] (i) providing Escherichia coli bacteria comprising one or more plasmids encoding for a cargo nucleic acid that contains two inverted repeats, in particular two ITRs, that are both each not shortened by more than five base pairs in length in comparison to the respective wildtype ITR;
[0116] (ii) cultivating the Escherichia coli bacteria of step (i) at a temperature of at least 39°C, preferably of between 41 °C and 43°C, preferably at 42°C;
[0117] (iii) harvesting the Escherichia coli bacteria after step (ii) has been conducted and optionally isolating the plasmids; and
[0118] (iv) isolating the cargo nucleic acid from the isolated plasmids of step (iii); and
[0119] (iv-a) optionally inserting the cargo nucleic acid into a gene vector; wherein the entire method is conducted at a temperature of at least 39°C, preferably at a temperature of between 41 ° and 43°C.
[0120] In a preferred embodiment, the gene vector is a vector, preferably a viral vector, such as, e.g., a recombinant adeno-associated virus, and the further step (iv) of isolating the cargo nucleic acid from the isolated plasmids of step (iii) and an additional step (iv-a) of inserting the cargo nucleic acid into a gene vector are performed by transfecting cells with the plasmid of step (iii) and optionally additional plasmids containing factors for assembly of the vector, then, harvesting the assembled and packaged vector from the transfected cells.
[0121] The plasmids of step (iii) and / or the isolated cargo nucleic acid of step (iv) and / or a gene vector of step (iv-a) into target cells may be used for any purpose. For instance, such products may be used for providing virus particles or virus-like particles.
[0122] In a preferred embodiment, the method further comprises a step (v) of inserting the isolated plasmids of step (iii) and / or the isolated cargo nucleic acid of step (iv) and / or a gene vector of step (iv-a) into target cells, in particular eukaryotic target cells optionally expressing the cargo nucleic acid. Such insertion of products into target cells may be conducted by any means known in the art such as, e.g., by electroporation and / or a gene gun.
[0123] A target cell may be any cell that may express the sequences of interest contained in the cargo nucleic acid containing at least one inverted repeat. In a preferred embodiment, the target cell is a eukaryotic cell. In a preferred embodiment, the target cell is an animal cell. In a preferred embodiment, the target cell is a mammal cell or an insect cell. In a preferred embodiment, the target cell is a human cell, in particular a cell of a human cell line.
[0124] In a preferred embodiment, the method of the present invention is a method for preparing virus particles or virus-like particles, comprising the following steps:
[0125] (i) providing Escherichia coli bacteria comprising one or more plasmids encoding for a cargo nucleic acid that contains two ITRs;
[0126] (ii) cultivating the Escherichia coli bacteria of step (i) for at least 12 hours at a temperature of at least 39°C, preferably of between 41 °C and 43°C, preferably at 42°C;
[0127] (iii) harvesting the Escherichia coli bacteria after step (ii) has been conducted and optionally isolating the plasmids; and
[0128] (iv) isolating the cargo nucleic acid from the isolated plasmids of step (iii);
[0129] (iv-a) optionally inserting the cargo nucleic acid into a gene vector; and
[0130] (v) inserting the isolated plasmids of step (iii) and / or the isolated cargo nucleic acid of step (iv) and / or the gene vector of step (iv-a) into target cells, in particular eukaryotic target cells optionally expressing the cargo nucleic acid, preferably wherein virus particles or viruslike particles are obtained, wherein the entire method is conducted at a temperature of at least 39°C, preferably at a temperature of between 41 ° and 43°C.
[0131] As indicated above, the at least one ITR, preferably all ITRs may preferably be essentially not deleted during conducting the method. In a preferred embodiment, the isolated plasmids of step (ii) and / or step (iii) and / or the isolated cargo nucleic acid of step (iv) and / or the gene vector of step (iv-a) comprises at least one ITR not shortened in comparison to the at least one ITR of the corresponding cargo nucleic acid contained in the plasmid comprised in the Escherichia coli bacteria in step (i).
[0132] The plasmid obtainable from the present invention bears unexpectedly beneficial properties in that the ITRs are particularly complete and homogeneously obtained.
[0133] Therefore, a further aspect of the present invention relates to a plasmid including at least one inverted repeat obtainable from a method of the present invention. It will be understood that the definitions and preferred embodiments as defined in the context of the method of the present invention above mutatis mutandis apply to the plasmid of the present invention. A structural special characteristic is that inverted repeats, in particular ITRs, contained in the plasmid are maintained.
[0134] In a preferred embodiment, the plasmid is characterized in that at least 95% of the inverted repeat obtained from propagating of the method have a nucleotide identity of at least 98 mol%, more preferably of at least 99 mol%, in particular of 100 mol%, compared to the respective inverted repeat provided in step (i) of the method.
[0135] In a preferred embodiment, at least 95% of the at least one inverted repeat, in particular at least 95% of the at least one ITR, is not shortened by more than 20, by more than 19, by more than 18, by more than 17, by more than 16, by more than 15, by more than 14, by more than 13, by more than twelve, by more than eleven, by more than ten, by more than nine, by more than eight, by more than seven, by more than six, by more than five, by more than four, by more than three, or by more than two base pairs in length in comparison to the respective inverted repeat provided in step (i) of the method.
[0136] In a preferred embodiment, the two inverted repeats, in particular at least two ITRs, that are both each not shortened by more than 20, by more than 19, by more than 18, by more than 17, by more than 16, by more than 15, by more than 14, by more than 13, by more than twelve, by more than eleven, by more than ten, by more than nine, by more than eight, by more than seven, by more than six, by more than five, by more than four, by more than three, or by more than two base pairs in length in comparison to the respective wild-type ITR.
[0137] In a preferred embodiment, the obtained at least one inverted repeat is not shortened by more than five base pairs in length in comparison to the respective inverted repeat provided in step (i) of the method, preferably is not shortened by more than two base pairs in length in comparison to the respective inverted repeat provided in step (i) of the method, in particular is identical with the respective inverted repeat provided in step (i) of the method.
[0138] A further aspect of the present invention relates to a plasmid encoding for a cargo nucleic acid including at least one inverted repeat, in particular at least one ITR, obtainable from a method of the present invention. The cargo nucleic acid including at least one inverted repeat, in particular at least one ITR, obtained from a method bears unexpectedly beneficial properties in that the ITRs are particularly complete and homogeneously obtained.
[0139] Therefore, a further aspect of the present invention relates to a cargo nucleic acid including at least one inverted repeat obtained from a method of the present invention, characterized in that the inverted repeat obtained from propagating of the method has a nucleotide identity of at least 98 mol% compared to the respective inverted repeat provided in step (i) of the method.
[0140] It will be understood that the definitions and preferred embodiments as defined in the context of the method of the present invention and the plasmid of the present invention above mutatis mutandis apply to the cargo nucleic acid of the present invention. A structural special characteristic is that inverted repeats, in particular ITRs, contained in the plasmid are maintained.
[0141] In a preferred embodiment, the cargo nucleic acid is characterized in that the inverted repeat obtained from propagating of the method has a nucleotide identity of at least 99 mol% or even 100 mol% compared to the respective inverted repeat provided in step (i) of the method.
[0142] It will be understood that the respective inverted repeat provided in step (i) of the method is the inverted repeat provided that is contained in the plasmid as used in the onset of the method of the present invention.
[0143] In a further aspect, the invention relates to a synthetic gene vector containing a cargo nucleic acid including at least one inverted repeat obtained from a method of the present invention.
[0144] It will be understood that the definitions and preferred embodiments as defined in the context of the method of the present invention and the plasmid or cargo nucleic acid of the present invention above mutatis mutandis apply to the synthetic gene vector of the present invention.
[0145] The Examples are intended to illustrate methods of the state of the art in comparison to embodiments of the present invention.
[0146] Examples EXAMPLE 1
[0147] Prevalence of truncated inverted terminal repeat sequences in the art
[0148] The state of the art regarding inverted repeat stability in recombinant E. coli plasmids is exemplified through a meta-analysis on the integrity of ITRs in plasmids available in the art. Sequences of 188 ITR-encoding plasmids were programmatically downloaded from the Addgene database (Addgene.org, accessed 17 January 2023, all plasmids satisfying the search terms “AAV” and “ITR” available from Addgene at the time of analysis). 123 of these plasmids had been sequence-verified by Addgene and were further analyzed (Addgene IDs 104839, 105669, 105677, 105678, 105679, 113763, 120219, 121502, 121921 , 125713, 126520, 126521 , 129267, 135964,
[0149] 135965, 135966, 135967, 137188, 139979, 139980, 154849, 154871 , 160069, 163791 , 163792,
[0150] 163793, 163794, 163795, 163796, 163797, 164468, 165441 , 166870, 166871 , 166872, 166873,
[0151] 167577, 167578, 167579, 167580, 167581 , 170117, 170118, 170120, 170121 , 170122, 170123,
[0152] 174703, 180183, 180184, 180191 , 180192, 180193, 183078, 183079, 183081 , 184002, 184003,
[0153] 186418, 186419, 187181 , 187182, 190473, 190474, 190475, 191523, 191795, 192569, 192570,
[0154] 192572, 192573, 192575, 192576, 193166, 193168, 193169, 193170, 193171 , 193172, 193174,
[0155] 193175, 193176, 193177, 193178, 193179, 193180, 193181 , 193182, 193183, 193185, 193186,
[0156] 193187, 193188, 26968, 26969, 26971 , 26972, 26973, 26975, 26976, 50455, 50464, 50466, 60226, 60227, 60229, 65417, 65418, 82705, 85451 , 86949, 86950, 86954, 86955, 87951 , 89256, 89570, 98216, 98217, 98218, 98219, 98220, 98704). Mapping analysis revealed that, of these plasmids, 122 had ITRs with wild-type D sequences, but none had full-length ITRs, and no ITR exceeded 130 bp. Furthermore, of the sequence-verified plasmids, 75 ITRs (encoded on 69 plasmids) had an internal deletion, and the internal deletions were 11 bp long in 73 cases and 22 bp and 25 bp long in one case each. Six plasmids had internal deletions in both ITRs. Consequently, the findings indicate that plasmids with stable, full-length ITRs are currently challenging to obtain.
[0157] EXAMPLE 2
[0158] Qualification of a direct sequencing approach to investigate ITR degradation
[0159] A bioinformatic approach based on direct Oxford Nanopore sequencing reads was developed to analyze the degradation of ITRs on plasmid DNA. The length of each ITR is measured on a perread basis as the number of basecalled bases between two references mapped (minimap2 version 2.17) on the individual read (e.g., transgene and plasmid backbone, the typical ITR position). With the applied sequencing technology, each sequencing read represents a single nucleic acid molecule. The approach, therefore, allows a statistical, ITR position-aware evaluation of length distributions between experimental groups. The method was qualified on sequencing reads of pUC19 backbone DNA (propagated at 37°C, 16 h cultivation from a single colony, sequencing kit SQK-RBK114, R10.4.1 flow cell), which is regarded as stable in E. coli. Two ITR- sized 145 bp stretches, one in the bla gene (GenBank M77789.2 nucleotides 949 to 1093) and one in the ori (GenBank M77789.2 nucleotides 1989 to 2133), were selected for qualification. The ori sequence was called at 144 bp ± 3 bp on average, and the bla sequence was called at 143 bp ± 4 bp on average (n = 3774). These distribution histograms agree with the expected, context- dependent inaccuracy of the sequencing technology. The plasmid was propagated for another two days (carrying over 10 pl of overnight culture to 5 ml fresh medium and diluting the culture again 1 :5 in the afternoon for each consecutive day of culture) and again sequenced. The ori and bla sequences were again called at 144 bp ± 3 bp and 143 bp ± 4 bp (n = 7726), respectively. The distributions were similar to those obtained for the sequences after 16 h of cultivation, even considering the large sample sizes (two-sided, heteroscedastic t-test: ori p = 0.48, bla p = 0.24). Comparable results were obtained when an older Oxford Nanopore sequencing chemistry was used (SQK-RBK004, R9 flow cell). However, the distribution was slightly broader and downshifted with 142 bp ± 5 bp (day 1 , 143 bp ± 5 bp on day 3) called for the ori sequence and 143 bp ± 5 bp (day 1 , 143 bp ± 5 bp on day 3) called for the bla sequence (day 1 : n = 1022, day 3: n = 620). These distributions were also not significantly different after three days of culture (p = 0.31 and p = 0.93 for ori and bla, respectively). The sensitivity of the bioinformatic approach was tested towards deletion detection by decreasing the size of the ITR-sized stretches by one nucleotide to 144 bp and re-calculating the distributions. These distributions were then compared to the original distributions for the 145 bp reference. The size-reduced ori sequence (day 1 of propagation) was now called at 143 bp ± 3 bp, and the size-reduced bla sequence was now called at 142 bp ± 4 bp on average. The null hypotheses could still be rejected with p < 0.05 for an artificial distribution comprised of a mixture of more than 83% reads of the undeleted population and the remainder being reads of the deleted population, showcasing the sensitivity of the approach. Alternative methods to investigate the ITR truncation status are easily conceived and include a Sanger sequencing approach previously published by Feiner et al. (Int. J. Mol. Sci., 2019, 20:5702), and restriction digestion of plasmid DNA, followed by capillary electrophoresis.
[0160] EXAMPLE 3
[0161] Recovery of full-length ITRs from a recombinant viral source
[0162] Since full-length ITRs were not available from plasmid DNA, full-length ITRs were initially obtained from a recombinant viral source. The property of the AAV ITR to self-heal during cell culture rAAV production has been described in the literature (Radukic, Brandt, et al., NAR Genomics and Bioinformatics, 2020, 2(4), doi: 10.1093 / nargab / lqaa074), although the impact on AAV yield and packaged genome integrity of the healing process from imperfect ITRs encoded on plasmids has not been previously discussed. Extracted genomes from a recombinant AAV source (encoding a fluorescence reporter) were hybridized to form double-stranded DNA (source plasmid). The hybridized genomes were then digested with Sacl, resulting in separate dsDNA fragments encoding the two ITRs (downstream fragment and upstream fragment). The fragments were subsequently ligated to a pUC19 (GenBank M77789.2) plasmid backbone opened with Sacl and Hindi, resulting in two libraries of single ITR containing E. coli colonies (E. coli DH5a, DSMZ No. 6897), also encoding their respective parts of the transgene (Figure 1a for workflow). Plasmids from day-old liquid cultures of these colonies were sequenced by Oxford Nanopore sequencing to select full-length ITR sequences based on the plasmid consensus. The consensus sequences of twelve ITR plasmids (six containing the upstream and six containing the downstream fragment) were determined and were highly diverse, with four plasmids encoding 145 bp ITRs identical to ITRs of the AAV2 reference genome (NC_001401), three plasmids encoding 144 bp ITRs (missing one A towards the ITR terminus), three plasmids encoding 143 bp ITRs (missing two A toward the terminus), and three plasmids encoding truncation variants smaller than 115 bp. It is likely that ITRs in the range 143 - 145 bp arise from an error-prone terminal resolution during intracellular genome replication and were regarded as intact ITRs for the purpose of the study. Histograms of the ITR distributions obtained according to EXAMPLE 2 highlighted the obtained full-length ITRs in contrast to the source ITRs and showed the beginning degradation of these recovered ITRs (Figure 1 b). Some plasmid molecules had almost completely lost the ITR sequence (Figure 1 b; black arrows). Truncated ITRs were seen as indicative of problems in cloning and maintaining ITRs in E. coli. One 145 bp ITR (upstream fragment) was then excised with Sacl and Pvull and cloned into a 143 bp ITR-containing plasmid (downstream fragment) opened with Sacl and Sfol, giving rise to a pUC19-like plasmid encoding a 143 bp ITR distal to the plasmid origin of replication (upstream of the transgene) flanking a gene of interest, and a 145 bp ITR proximal to the plasmid origin of replication (downstream of the transgene) with the two parts of the transgene carried over together with the ITRs from the recombinant AAV source previously described. The final plasmid is named pZMB938 (SEQ ID NO: 1):
[0163] TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCA CAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGT GTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTG CACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCCT GGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTT AGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGG AATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT GCATGCCTGCAGGTCGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGC GACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCCTATCGAGAC CGGCGCGAATTCTTCTAGAGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGC CTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGC GTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG
[0164] ACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATG
[0165] GGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGT
[0166] ACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATG
[0167] ACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGT
[0168] GATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCC
[0169] AAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTT
[0170] CCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGG
[0171] GAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCG
[0172] AAATTACTAGATGGCCGGCATGAGCAAAGGCGAAGAACTGTTTACCGGCGTGGTGCCGAT
[0173] TCTGGTGGAACTGGATGGTGATGTGAACGGCCATAAATTTAGCGTGAGCGGCGAAGGCGA
[0174] AGGTGATGCGACCTATGGCAAACTGACCCTGAAACTGATTTGCACCACCGGCAAACTGCC
[0175] GGTTCCGTGGCCGACCCTGGTTACCACCCTGGGCTATGGCCTGCAATGCTTTGCGCGTTA
[0176] TCCGGATCATATGAAACAGCACGATTTCTTTAAAAGCGCCATGCCGGAAGGCTATGTGCAG
[0177] GAACGCACCATCTTTTTTAAAGATGATGGCAACTATAAAACCCGTGCGGAAGTGAAATTTGA
[0178] AGGCGATACCCTGGTGAACCGTATTGAACTGAAAGGCATCGATTTCAAAGAAGATGGCAAC
[0179] ATTCTGGGCCATAAACTGGAATATAACTACAACAGCCATAACGTGTATATCACCGCGGATA
[0180] AACAGAAAAACGGCATCAAAGCGAACTTTAAAATCCGCCACAACATTGAAGATGGCGGCGT
[0181] GCAGCTGGCCGATCATTATCAGCAGAACACCCCGATTGGTGATGGCCCGGTGCTGCTGCC
[0182] GGATAACCATTATCTGAGCTACCAGAGCAAACTGAGCAAAGATCCGAACGAAAAACGTGAC
[0183] CATATGGTGCTGCTGGAATTTGTGACCGCGGCCGGTATTACCCATGGCATGGATGAACTG
[0184] TATAAAACCGGTTAATACTAGAGACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTC
[0185] CTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCA
[0186] TCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAG
[0187] CAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCT
[0188] GGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTC
[0189] TCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATT
[0190] TTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAAT
[0191] CTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTG
[0192] CTCCCTTCCCTGTCCTTTACTAGTACCGGTGGTCTCTGGCGGCGGCCGCAGGAACCCCTA
[0193] GTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC
[0194] AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC
[0195] AGAGAGGGAGTGGCCAAGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTG
[0196] TTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA
[0197] GTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTG
[0198] CCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCG
[0199] GGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGC
[0200] TCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCC ACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGG
[0201] AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT
[0202] CACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG
[0203] GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGA
[0204] TACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGT
[0205] ATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTC
[0206] AGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACG
[0207] ACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCG
[0208] GTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGG
[0209] TATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGC
[0210] AAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA
[0211] AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGA
[0212] AAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTT
[0213] TAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTT
[0214] ACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTT
[0215] GCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGT
[0216] GCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAG
[0217] CCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCT
[0218] ATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTG
[0219] TTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTC
[0220] CGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
[0221] TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTA
[0222] TGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT
[0223] GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCG
[0224] GCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAA
[0225] AACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTA
[0226] ACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA
[0227] GCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA
[0228] ATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGC
[0229] GGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCG
[0230] AAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGC
[0231] GTATCACGAGGCCCTTTCGTC
[0232] EXAMPLE 4
[0233] Impact of E. coli propagation at 37°C on ITR integrity
[0234] The sequencing approach (R9 pore chemistry) was used to investigate the impact of cloning and propagation in E. coli (DH5a, 37°C, LB Lennox) on the integrity of the ITRs encoded on plasmid pZMB938 (SEQ ID NO: 1). After the first overnight culture starting from a single colony (termed day 1 , Figure 2a for experimental scheme), the ori distal ITR in the originally obtained plasmid stock (consensus 143 bp) was called at 134 bp ± 9 bp, and the ori proximal ITR was called at 120 bp ± 26 bp (n = 208), indicating that, at least, the ori proximal ITR was already severely truncated from the cloning and propagation procedure. The culture was propagated at 37°C for a total of seven days, diluting 10 pl overnight culture to 5 ml each morning, and the analysis was repeated (n average = 124). The ori distal ITR showed moderately significant signs of degradation. However, the distributions for day one and day seven were not significant (ori distal ITR, t-test for day one to day x: p1 2 = 0.0009, p1-3 = 0.04, p1-4 = 0.001 , p1-5 = 0.004, p1-6 = 0.003, p1-7 = 0.21). Using the normalized histogram subtraction method (normalization to total read count, 5 nt bin width), the degradation extent compared to the ori distal ITR on day 1 can be estimated for significantly different distributions. For the ori distal ITR, at most, 20% degradation was observed (day 2). Distributions for the ori proximal ITR were all significantly different compared to the ori distal ITR on day 1 , and the extent of degradation was estimated to be at most 49% (days 1 - 7: 32%, 37%, 34%, 44%, 41 %, 48%, 42%, Figure 2b, left). These findings indicate that wild-type ITR sequences are unstable in E. coli DH5a, cultivated under standard conditions. The ability to clone these sequences was probably due to screening many clones, which will be a mixture of variants. The mixture will also be present after each single overnight culture starting from a single colony. The analysis was repeated with E. coli Stbl3 (Thermo Fisher #C737303, 37°C, LB Lennox), starting from a single colony after transformation with the originally obtained plasmid stock. As before, several clones were initially investigated to find one with presumably intact ITRs since ITRs were already mostly degraded in the original stock, as described above. In the bestobserved clone (day 1), the ori distal ITR was called at 133 bp ± 8 bp. The ori proximal ITR was called at 131 bp ± 12 bp (n = 353, p = 0.001 , 12% degradation distal-to-proximal), indicating that the ITRs are more stable in E. coli Stbl3 over one day of culture, compared to E. coli DH5a. However, while the ori distal ITR, again, remained relatively stable in Stbl3 over the culture time (p1-2 = 0.003, p1-3 = 0.14, p1 4 = 0.02, p1-5 = 0.003, p1-6 = 0.0006, p1-7 = 0.03, at most 18% degradation on day 2 of the culture), the ori proximal ITR was more heavily damaged in Stbl3 over seven consecutive days, as compared to DH5a (degradation according to histogram subtraction: day 1 : 12%, day 2: 39%, day 3: 47%, day 4: 54%, day 5: 60%, day 6: 61%, day 7: 65%, Figure 2b, right). On day 7 of culture, the ori proximal ITR was called, on average, at 113 bp ± 22 bp. It can, therefore, not be concluded that an E. coli strain generally regarded as suitable for difficult sequences is adequate for maintaining these large inverted repeats and that inverted repeat stability is generally challenging in E. coli propagation. EXAMPLE 5
[0235] Temperature-dependent ITR stability
[0236] The test with Stbl3 was repeated with cultivation at 30°C, which is commonly cited as optimal to maintain challenging sequences in this strain, starting again from a single colony. At this temperature, a single overnight culture after plating was enough to severely damage the ori proximal ITR, which was called, on average, at 96 bp ± 39 bp, compared to the ori distal ITR, called at 133 bp ± 14 bp, estimated by histogram subtraction as 69% degradation after one day of propagation. It was also notable that 23% of ori proximal ITRs were called at < 50 bp of length (22% < 40 bp, 18% < 30 bp, 0% < 20 bp), representing severely deleted ITRs. These severe deletions were observed to a lesser extent when the plasmid was propagated at 37°C (e.g., 8% of ori proximal ITRs were < 50 bp after three days of propagation in Stbl3 at 37°C). This finding of an apparent correlation between cultivation temperature and inverted repeat stability was surprising and non-obvious. Thus, it was hypothesized that an even further increase in cultivation temperature would stabilize full-length ITRs (Figure 3a for histograms, Figure 3b for derived ITR degradation). Indeed, when the experiment was repeated with transformation and cultivation at 40°C, the ori distal ITR was called with an average of 132 bp ± 8 bp, and the ori proximal ITR was called at 129 bp ± 14 bp (11 % degradation) after one overnight culture. When the cultivation temperature was further increased to 42°C, the ori distal ITR was again called with an average of 132 bp ± 8 bp, and the ori proximal ITR was called at an average length of 128 bp ± 23 bp (8% degradation). Extended propagation at 42°C did not further degrade the ori distal ITR (12% degradation after three days). It affected the ori proximal ITR, which was still called at an average of 132 bp ± 14 bp (p1-3 = 0.004, 7% degradation), moderately but measurable compared to propagation at 37°C. Thus, it can be concluded that, surprisingly, an increased propagation temperature stabilizes ITRs and a measurable benefit in ITR stability is obtained at an increased propagation temperature, preferably at 42 °C.
[0237] EXAMPLE 6
[0238] Influence of common E. coli strains on ITR integrity at elevated propagation temperatures
[0239] It was of interest whether the effect of the method according to the invention was unique to propagation in Stbl3, so the experiment was repeated with other E. coli strains (Figure 4). In DH5a, after three consecutive days of culture at 42°C, the ori distal ITR was called at 133 bp ± 8 bp. The ori proximal ITR was called at 130 bp ± 9 bp (p = 0.029, 25% degradation), showing only a moderately significant difference, as opposed to the 34% degradation from a 37°C culture described above. In addition, with E. coli BL21(DE3) (Thermo Fisher #EC0114), a stabilizing effect from cultivation at elevated temperatures was observed from 70% degradation of the ori proximal ITR at 37°C after three days to an estimated 37% degradation when propagated at 42°C (Figure 4). It was concluded that the effect of the method, according to the invention is primarily a function of E. coli propagated at increased cultivation temperature, while the extent of the effect might depend on the utilized strain.
[0240] EXAMPLE 7
[0241] Cloning of synthetic full ITR sequences
[0242] Results so far clearly indicated an improved ITR stability, but degradation of the ori proximal ITR was nonetheless observed. Due to the cloning strategy, plasmid pZMB938 (SEQ ID NO: 1) contains a large repetition of the pUC19 backbone directly adjacent to both ITRs. As this inverted duplication might negatively affect genomic and ITR stability and with the intent to provide a universal option to generate ITRs, completely synthetic ITRs from hybridized oligonucleotides were cloned. Previous efforts to obtain ITRs from full-length chemical oligonucleotide or gene synthesis failed due to the repeat sequence, and PCR strategies were biased towards truncation variants. An initial attempt to construct synthetic ITRs had previously failed and was enabled in the end only by the method according to the invention. A scaffolding plasmid was first conceived that accepts the oligos hybridized to full-length ITRs. The scaffolding plasmid was constructed by knocking out the singular Pcil recognition site of an unmodified pUC19 plasmid by opening the pUC19 plasmid with Pcil, blunting, and re-ligation. Then, the multi-cloning site of the resulting plasmid was excised with EcoRI and Pstl and replaced with four hybridized oligos using overhang ligation. The novel multi-cloning site comprised (in this order): Sall, Pstl, Mlyl, Ncol, EcoRI, Spel, Pcil, Mlyl(inv), Pstl, and Xhol. Sall and Xhol, as well as Ncol and Pcil, produce compatible cohesive ends. Six phosphorylated oligonucleotides comprising the full-length 144 bp ITR sequence with overhangs for ligation to Sall and Ncol overhangs and already containing the Mlyl and Pstl sites of the novel multi-cloning sites were then hybridized and ligated. The ligation product was separated on an agarose gel (1%, TAE, 120 V, 50 min.), the band of the expected size was cut out, and the DNA was purified. The scaffolding plasmid was cut with Sall and Ncol, and the backbone was ligated with the purified ITR fragment. E. coli Stbl3 were transformed with the ligation product and plated and cultured at 42°C (previous efforts to clone these synthetic ITRs at 37°C had all failed). A test digest then identified correct clones containing the singular ITR intermediate plasmid. The transgene of the previous experiment was then cloned into the intermediate plasmid using the EcoRI and Spel restriction sites (all culturing steps at 42°C), except that the coding sequence was of d2eGFP resulting in a second intermediate plasmid. The first ITR was then excised from the second intermediate plasmid with Sall and Ncol and purified by gel extraction. Separately, the second intermediate plasmid was digested with Pcil and Xhol. The ITR fragment was then ligated with the prepared backbone, giving rise to plasmid pZMB990 (SEQ ID NO: 2), containing two 144 bp synthetic ITRs of AAV serotype 2, flanking a gene of interest:
[0243] TGAATTGTCGACCTGCAGAAAGAGTCAAGTGTGGCCACTCCCTCTCTGCGCGCTCGCTCG
[0244] CTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCT
[0245] CAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTCC
[0246] ATGGGAATTCGCGGCCGCTTCTAGAGCGATGTACGGGCCAGATATACGCGTTGACATTGA
[0247] TTATTGCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGA
[0248] GTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCG
[0249] CCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGAC
[0250] GTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATAT
[0251] GCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCA
[0252] GTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTA
[0253] CCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGTCTCACGGG
[0254] GATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACG
[0255] GGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGT
[0256] ACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTG
[0257] GCTTATCGAAATTACTAGATGGTGTCCAAGGGCGAGGAACTGTTCACCGGCGTGGTGCCC
[0258] ATCCTGGTGGAACTGGATGGCGACGTGAACGGCCACAAGTTCTCCGTGTCTGGCGAGGG
[0259] CGAAGGCGACGCTACCTATGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCT
[0260] GCCCGTGCCTTGGCCTACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCTCCAG
[0261] ATACCCCGACCATATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAGGGCTACGT
[0262] GCAGGAACGGACCATCTTCTTTAAGGACGACGGCAACTACAAGACCAGGGCCGAAGTGAA
[0263] GTTCGAGGGCGACACCCTCGTGAACCGGATCGAGCTGAAGGGCATCGACTTCAAAGAGG
[0264] ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTACAACTCCCACAACGTGTACATCAT
[0265] GGCCGACAAGCAGAAAAACGGCATCAAAGTGAACTTCAAGATCCGGCACAACATCGAGGA
[0266] CGGCTCCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCTATCGGCGACGGCCCTG
[0267] TGCTGCTGCCTGACAACCACTACCTGTCCACCCAGTCCGCCCTGTCCAAGGACCCTAACG
[0268] AGAAGCGGGACCACATGGTGCTGCTGGAGTTCGTGACCGCCGCTGGCATCACCCTGGGC
[0269] ATGGACGAGCTGTACAAGAAGCTGTCCCACGGCTTCCCACCCGAGGTGGAAGAACAGGAC
[0270] GATGGCACCCTGCCCATGTCCTGCGCTCAGGAATCCGGCATGGACAGACACCCTGCCGC
[0271] CTGTGCCTCTGCCCGGATCAATGTCTGAACTATACAACCTACTACCTCAACTAGAGACGGG
[0272] TGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTG
[0273] CCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTA
[0274] TAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCT
[0275] GTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCA
[0276] CTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGG
[0277] GATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTT CACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCT
[0278] CCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTTACTAGTACA
[0279] TGGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTG
[0280] AGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAG
[0281] CGAGCGAGCGCGCAGAGAGGGAGTGGCCACACTTGACTCTTTCTGCAGGTCGAGATGCA
[0282] GGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCT
[0283] CACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGA
[0284] GTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGT
[0285] CGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGG
[0286] CGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG
[0287] GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGA
[0288] AAGAACATGAGGTGGACTACGATTGCATTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGG
[0289] AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT
[0290] CACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG
[0291] GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGA
[0292] TACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGT
[0293] ATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTC
[0294] AGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACG
[0295] ACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCG
[0296] GTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGG
[0297] TATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGC
[0298] AAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA
[0299] AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGA
[0300] AAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTT
[0301] TAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTT
[0302] ACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTT
[0303] GCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGT
[0304] GCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAG
[0305] CCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCT
[0306] ATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTG
[0307] TTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTC
[0308] CGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
[0309] TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTA
[0310] TGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT
[0311] GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCG
[0312] GCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAA
[0313] AACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTA
[0314] ACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA GCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA ATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGC GGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCG AAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGC GTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACAT GCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCC GTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCA GAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGG AGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGA TCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCG ATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAG
[0315] EXAMPLE 8
[0316] Temperature-dependent stability of synthetic ITRs
[0317] A colony of E. coli Stbl3 transformed with pZMB990 (SEQ ID NO: 2) and plated at 42° was picked and propagated in LB medium for 37°C or 42°C for three days, and the ITR degradation status was determined as before, this time using the Oxford Nanopore Technology R10 sequencing chemistry (Figure 5, percentages indicate percent correct ITRs). When propagated at 37°C for one day, the ori distal ITR was called at 142 bp ± 6 bp on average, while the ori proximal ITR was called at 138 bp ± 14 bp, corresponding to 10% degradation. After three days of propagation at 37°C, there was no significant effect on the ori distal ITR (p = 0.21) but 32% of the ori proximal ITRs were degraded. When the culture was propagated at 42°C for one day, the ori distal ITR was called at 142 bp ± 6 bp, and the ori proximal ITR was called at 140 bp ± 12 bp (significant, 4% degradation). After three days of propagation at 42°C, the ori distal ITR was not significantly affected (p = 0.77), while the effect on the ori proximal ITR remained minor (significant, 5% degradation). The effect of the invention on the ITR stability is thus demonstrated to be 27% less ITR degradation in the case of plasmid pZMB990 (SEQ ID NO: 2). Therefore, the invention presents a clear and vast improvement in ITR integrity over a standard procedure.
[0318] EXAMPLE 9
[0319] Influence of superhelical stress and SSB overexpression on ITR stability
[0320] In an attempt to elucidate the low inverted repeat stability in E. coli, Stbl3 containing pZMB990 (SEQ ID NO: 2) was propagated in the presence of 1 pg / ml nalidixic acid (Figure 6a) or 2% ethanol at 37°C. Nalidixic acid inhibits E. coli DNA gyrase, which might be implicated in ITR truncation through the overcorrection of superhelical stress, leading to high negative supercoiling, which can also be relieved by adding ethanol to the culture media. Addition of ethanol did not influence the stability of the ori distal ITR compared to cultivation at 42°C without additives (day 1 : p = 0.35, day 3: p = 0.16), while the ori proximal ITR was more heavily degraded when ethanol was present (day 1 : 31 %, day 3: 80% degradation). Similarly, the addition of nalidixic acid did not affect the ori distal ITR, which remained stable (day 1 : p = 0.30, day 3: p = 0.14), while the ori proximal ITR was degraded (day 1 : 17%, day 3: 50% degradation). It can be concluded that gyrase inhibition by viable concentrations of nalidixic acid does not prevent ITR degradation.
[0321] ITRs may also be prone to secondary structure formation within the replication fork, which may lead to instability. Overexpression of an endogenous single-strand binding protein (SSB) was tested (Figure 6b) as a possible preventive measure, but did not stabilize ITRs (Figure 6b) and only 35% correct ori-proximal ITRs were seen after three days of propagation.
[0322] EXAMPLE 10
[0323] Influence of SbcC on ITR stability
[0324] Instability of other large inverted repeats has been described in the art (Lilley, Nature, 1981 , 380- 382(292)). In a common model of inverted repeat instability on plasmids, E. coli SbcCD, a homolog of the human MRN complex Mre11 / RAD50, incises DNA hairpins and possesses 3'^5' exonuclease activity. Indeed, a ASbcC strain, JW0387 (Keio Collection), showed no ITR degradation over the course of three days when propagated at 42 °C (p > 0.05 compared to the ori distal ITR at day one of propagation, Figure 7a). Under standard conditions, ITR degradation was 9% and a minority of plasmids had completely lost the ori proximal ITR (Figure 7b, black arrow), which was not observed when propagation was at 42 °C. Thus, it can be concluded that SbcCD is a major driver of ITR instability, since ITRs were most stable in ASbcC strain JW0387 compared to all strains tested. Similar results were obtained with JW0388, which has a ASbcD genotye, highlighting the involvement of the SbcCD complex, not the individual proteins. However, ITR instability remains even in this strain at typical temperatures, indicating that SbcCD is not actually responsible for ITR deletions but, rather, exerts selective pressure on full-length ITRs towards acquiring mutations. Other examples of large inverted repeat instability in an SbcC- strain, SURE2, are known in the art (Palmer et al., Anal. Biochem., 1995, 109-114 (231); Inagaki et al., Hum. Mutat., 2005, 332-342(26); Kogo et al., Nucleic Acids Res., 2007, 1198-1208(35)). Therefore, the present invention of an increase in propagation temperature presents an important improvement to the art. Cultivation at increased temperatures as described for the method of the present invention is preferably advantageous in a ASbcC strain although the present invention provides a clear benefit in all strains tested. EXAMPLE 11
[0325] Investigation of the degradation mechanism
[0326] ITR degradation from EXAMPLE 5 (pZMB990, Stbl3, 37 °C, ori proximal ITR) was investigated on the single-molecule ITR-sequence level. Three regions of interest were defined in the ITR distribution histogram (Figure 8a). Corresponding ITR sequences (Figure 8b for a representative excerpt of R2) conformed to four main groups: R1 ITRs were mostly intact, R2 ITRs were missing either the C hairpin and the B hairpin was inverted, or were missing the B hairpin and the C hairpin was not inverted, and R3 ITRs were missing most of the ITR sequence. Upon closer investigation, it became evident that the R2 simple deletion and the deletion-inversion occurred at a CG dinucleotide direct repeat, while the almost complete R3 deletion occurred at a GA dinucleotide direct repeat. Such observations can be rationalized by a slippage model, in which an inverted repeat is flanked by a direct repeat and replication “slips” over the inverted repeat (Figure 8d-f). The indirect involvement of SbcC conforms with this model as replication may stall at such inverted repeats and recognition by SbcCD, cleavage and plasmid loss by an exonuclease can be viewed as a safety of last resort in E. coli (Figure 8d). The simple deletion occurs by simple slippage (Figure 8e), while the deletion-inversion requires a strand-switch, fork regression and continued amplification on the forward strand (Figure 8f).
[0327] Obviously, it can be assumed that the knock out of the DNA binding domain of the SbcCD nuclease removes a potentially interfering protein and the nuclease action. The increased temperature may reduce DNA twist (Krieger et al., Nucleic Acids Res., 2018, 7998-8009(46)) as well as the slipped mispairing.
[0328] Additional mechanisms may contribute. For example, the ITR D-A' interface 5' -GTTG-3' bears similarity to the Holliday-resolvase RuvC consensus cleavage site 5'-(A / T)TT(C / G)-3'. Initial high level of positive supercoiling near the origin of replication, when the replication bubble is first established, and overcorrection by DNA gyrase, could extrude ITRs near the ori to Holliday-like structures and predominantly destabilize this ITR. Isomerization of these structures would lead to non-replicative hairpin inversion. Resulting closed-ended intermediates then share terminal homologies amenable to homologous RecA-independent repair, with the specific observed deletion depending on the extent of exonuclease digestion prior to joining. The near-complete ITR loss would be facilitated, in this sense, by a partial homology between the D and A sequence, which forms the ITR terminal resolution site.
[0329] The results show that ITR degradation is a complex issue rooted in basic nucleic acids properties and not in specific enzymatic processes, highlighted again by ITR degradation in ASbcC strains. Therefore, the present invention presents an important and non-intuitive solution which makes use of the same basic nucleic acids properties, likely by reducing the propensity of DNA pairing within the replication fork, to solve this challenging problem. EXAMPLE 12
[0330] Influence of the method according to the invention on plasmid yield
[0331] It was determined whether the method according to the invention would influence the overall plasmid yield, an important consideration for large-scale plasmid production. Single colonies of E. coli Stbl3 transformed with pZMB938 (SEQ ID NO: 1) (plated at 42°C) were picked in 4 ml lysogeny broth and propagated at 37°C or 42°C for 17 h. Cells were then pelleted and the pellet wet-weight was determined to be 80 mg and 60 mg for the 37°C and 42°C cultures, respectively. Plasmids were isolated from both pellets and the total mass of prepared plasmid was determined spectroscopically to be 12.25 pg and 21.88 pg for the 37°C and 42°C cultures, respectively. These results indicate that the volumetric plasmid yield is probably not negatively influenced and might even be increased when the cultures are propagated at elevated temperatures.
[0332] EXAMPLE 13
[0333] Influence of the method according to the invention on plasmid quality
[0334] Plasmid quality is an important consideration in implementation of a production process and the influence of the presented method on plasmid concatemerization, base quality, and methylation was determined (Figure 9). A slight increase in concatemerization was observed when shifting from 37 °C to 42 °C (Figure 9a). In contrast, histograms of the per-read percent identity as a measure of base quality showed no difference between cultivation temperatures and strains (Figure 9b), while dam methylation decreased from 72% ± 9% (Stbl3, 37 °C) to 62% ± 13% (JW0387, 42 °C) and dem methylation decreased from 64% ± 7% to 42% ± 13% in the same strains as determined by modified basecalling (Figure 9c). Concatemerization in JW0387 may be reduced further by strain optimization through recombination deficiency and is not necessarily a result of the described method. The present invention, thus, can be implemented with minor to no concessions in plasmid quality.
[0335] EXAMPLE 14
[0336] Impact of full-length ITRs on recombinant adeno-associated virus production
[0337] Recombinant AAV were produced, purified, and quantified as previously described (Radukic, Brandt, et al., NAR Genomics and Bioinformatics, 2020, 2(4)), doi: 10.1093 / nargab / lqaa074; however, downscaling the production to 6-well plate format by growth area. The viral titer produced from plasmid pZMB938 (SEQ ID NO: 1) (encoding a 143 bp ori distal ITR and a 145 bp ori proximal ITR, 8% degradation) as described herein were compared to parallel productions with an ITR plasmid pZMB522 described by Feiner et al. (Int. J. Mol. Sci., 2019, 20:5702), encoding a 130 bp ori distal ITR and a 119 bp ori proximal ITR while keeping all other parameters constant (Figure 10). Both plasmids encoded the same transgene. Plasmid pZMB522 yielded 1.9x1010vg / well ± 0.5x1010vg / well (qPCR on the transgene), while the production utilizing pZMB938 (SEQ ID NO: 1) yielded 7.4x1O10vg / well ± O.5X 1 O10vg / well (standard deviation from three biological replicates), showcasing a highly significant 4-fold increase in titer from the change in ITR integrity alone (Figure 10a). Mispackaged plasmid backbone DNA was also investigated (qPCR on the bla gene). The original plasmid was found to mispackage 2.1 xio9bla copies / well ± 0.4x109bla copies / well (2.4% of packaged genomes), while AAV production with pZMB938 (SEQ ID NO: 1) was found to mispackage 1 .2X 109bla copies / well ± 0.2x109bla copies / well (0.5% of packaged genomes, p = 0.002, Figure 10b). In addition, obtained assembled capsid ELISA data in relation to the qPCR data indicates that packaging increases with ITR integrity (Figure 10c). A decrease in mispackaging from full ITRs is in line with the inventors’ previous observations of an error-prone ITR repair mechanism in AAV producing cells (Radukic, Brandt, et al., NAR Genomics and Bioinformatics, 2020, 2(4)), which is prevented when plasmids are prepared according to the described invention.
[0338] These results demonstrate that plasmids obtained with the method according to the invention are useful in increasing the viral genome titer, but are especially important in increasing the genetic homogeneity of recombinant AAV preparations, and, therefore, increasing an important quality attribute of a therapeutic product currently used in human gene therapy.
[0339] EXAMPLE 15
[0340] Use of the plasmids or their derivatives according to the invention in production of synthetic AAV genomes
[0341] Synthetically produced AAV genomes can be derived from plasmids propagated according to the invention by various means. Such synthetic AAV genomes may be advantageous over plasmids in certain circumstances because they are devoid of bacterial backbone sequences and closely represent AAV genomes due to their full-length ITRs and linear nature. They may, thus, be used to transfect producer cell lines to obtain recombinant AAV with high genetic purity or be packaged in a non-viral delivery system as a fully chemically defined gene therapeutic.
[0342] In a first example, such synthetic AAV genomes were derived from plasmids propagated according to the invention by rolling circle amplification (RCA). pZMB990 was previously designed with this process in mind. In a first step, a re-ligated DNA fragment containing only the transgene and ITRs was created from pZMB990 by restriction-digestion and relegation. For this, 5 pg plasmid DNA were digested with 40 units Pvul-HF (NEB) and Pstl-HF (NEB) in 1x CutSmart (NEB) in 50 pl water at 37 °C for 1 .5 h. Fragments were separated in 1 % agarose in tris-acetate- EDTA at 120 V for 1 h and the target fragment containing the transgene was extracted from the gel (MachereyNagel PCR cleanup). The obtained fragment was religated to a non-supercoiled 1 DNA construct, 6.6 ng fragment DNA, 1 mM ATP, 8 mM DTT, 1x phi29 buffer (NEB), 400 units T4-ligase in 13.3 l at room temperature for 1 h and 95 °C for 2 min. A single RCA primer (5 - GGCGGAGTTGTTACGACA) was annealed by adding 0.6 pl phi29 buffer, 3.2 pM final concentration of primer, and 52 mM final concentration of dNTPs and incubating 95 °C, 2 min. For RCA, bovine serum albumin was added to 0.3 mg / ml and 6.6 units phi29 DNA polymerase (NEB), giving a final reaction volume of 20 pl. The mixture was incubated at 30 °C, 72 h and 65 °C, 10 min. The synthetic AAV genomes were finally released from the concatemers by adding 7 pl CutSmart, 200 U of Mlyl (NEB), filling up with water to 100 pl, and incubating at 37 °C over night. The RCA yield was then determined by qPCR as described in EXAMPLE 14 to be at least 1 pg synthetic AAV genomes from the 20 pl reaction starting with 6.6 ng template and was typically 2.3 pg to 3.4 pg and at most 10 pg. These released genomes can then be purified from the reaction mix by any convenient means of DNA extraction, for example using commercial kits (e.g., MachereyNagel PCR Cleanup), precipitation, phenol-chloroform extraction, anion exchange chromatography, size exclusion chromatography, or other means (e.g. Chelex resin or EchoCLEAN DNA Cleanup Kit). Such a cell-free RCA process holds the additional potential to introduce base-modifications to the product, e.g., M.Sssl in combination with S- adenosylmethionine (21.4 mM S-adenosylmethionine and 4 units M.Sssl (NEB) in the amplification step with phi29 polymerase as described above) was determined to be compatible with RCA and introduced up to a 100% of 5mCpG in synthetic AAV genomes as determined by comparative Hpall (NEB) and Mspl (NEB) digest and sequencing. Additionally, other natural or non-natural nucleotides compatible with the utilized polymerase can be used and non-natural nucleotides compatible with and introduced by the utilized polymerase can be further modified following amplification, e.g., 5-Ethynyl-2 ' -deoxyuridine (5-Edll) is compatible with phi29 polymerase and can be further modified by click chemistry following amplification. In addition, both ends of the synthetic AAV genome can be further modified, e.g., by enzymatic transfer of clickable moieties (Schdnegger et al., Chembiochem., 2024, e202300701 (25)).
[0343] In a second example of obtaining AAV genomes by a cell-free method from plasmids propagated according to the invention, the AAV genomes containing full length ITRs were cut from the plasmid at base-precision with the blunt-end typellS enzyme Mlyl (NEB). Plasmid pZMB990 was specifically designed with this possibility in mind. 40 pg plasmid DNA were digested with 80 units of enzyme in 1x CutSmart buffer overnight and the synthetic AAV genomes were extracted by agarose gel electrophoresis as described above. EXAMPLE 16
[0344] Use of the full ITR-encoding plasmids or its derivatives or amplicons according to the invention in non-viral delivery
[0345] The AAV genomes - not the AAV capsids - are the principal determinants of long-term transgene expression success in a gene therapy approach. Long-term transgene expression is thought to be driven by episomal stability of recombined, circular, AAV genomes, which is driven by ITRs intracellularly. It is, therefore, conceivable that synthetic AAV genomes with full-length ITRs as obtained with plasmids according to the present invention and delivered by any means able to reach the nucleus of a target cell suffice for a therapeutic success. Furthermore, the size limitation in AAV gene therapy is lifted. For example, current lipid nanoparticle (LNP) technology can efficiently target the liver for a possible treatment of hemophilia, or other liver-related disorders, can efficiently target the lung epithelia to, for example, possibly treat mucoviscidosis, with the CFTR gene far exceeding the coding capacity of AAV, or can efficiently target muscle for a possible treatment of Duchenne muscular dystrophy, with a corrected dystrophin gene that far exceeds the coding capacity of AAV. Such fully synthetic therapeutics do not require production in cell culture and are chemically defined, presenting a clear advantage in ease of production, homogeneity and patient access by a probable reduction in production cost.
[0346] As an example of such a fully synthetic system, synthetic AAV genomes based on pZMB990 and produced by the restriction-digestion method of EXAMPLE 15 were packaged in lipid nanoparticles. An aqueous solution of 50 mM sodium acetate pH 5, containing 20 pg synthetic AAV genomes in 100 pl was rapidly injected with 32 pl of an ethanolic lipid mixture of SM-102, cholesterol, 1 ,2-DSPC, and DMG-PEG2000 in a 50:38.5:10:1.5 molar ratio. The solution was briefly vortexed and incubated at 57 °C, 300 RPM, 1 cm amplitude, for 30 minutes. The lipid nanoparticles were then rebuffered to PBS (pH 7.4) with 10 kDa-cutoff Amicon Ultra 4 centrifugal filter unit to <0.1 % remaining ethanol. HEK293 cells were seeded in Dulbecco's Modified Eagle (DMEM) media containing 1 % penicillin / streptomycin and 10% Fetal Bovine Serum (FBS) 24h prior to transfection with the obtained nanoparticles to 20% - 30% confluency. Upon transfection, the culture media was exchanged to Opti-MEM adjusted to pH 6.0 with HCI at 50% of the prior culture media volume. LNPs were added dropwise and the cells were incubated at 37 °C, 5% CO2for 3h. Afterwards, Opti-MEM (pH 6) supplemented with 10% FCS was added and the cells were incubated overnight. The next morning, the culture media was exchanged to DMEM and transfection success was determined by flow cytometry. Figure 11 shows successful transfection of HEK293 cells with synthetic AAV genome-packaged LNPs at various DNA masses per cell and at 24h and 51 h post transfection (bars) with the cell viability as determined by propidium iodide staining (points). These findings show that synthetic AAV genomes are biologically active and reach the cell nucleus when transfected using current lipid nanoparticle technology. In this regard, a promising path to solving the long-standing challenge of low rAAV productivity in cell culture is presented, which relies on the present invention to manufacture synthetic AAV genomes containing full-length ITRs.
Claims
Claims1. A method for propagating plasmids containing at least one inverted repeat, wherein said method comprises the following steps:(i) providing Escherichia coli bacteria comprising one or more of the plasmids; and(ii) cultivating the Escherichia coli bacteria of step (i) at a temperature of at least 39°C.
2. The method of claim 1 , wherein the cultivating of step (ii) is conducted at a temperature of at least 41 °C.
3. The method of claim 2, wherein the cultivating of step (ii) is conducted at a temperature of between 41 °C and 43°C, preferably at 42°C.
4. The method of any of the preceding claims, wherein the cultivating of step (ii) is conducted for at least 6 hours, preferably for at least 16 hours.
5. The method of any of the preceding claims, wherein the cultivating of step (ii) is the only cultivation step conducted with the Escherichia coli bacteria of step (i).
6. The method of any of the preceding claims, wherein the entire method is conducted at a temperature of at least 39°C, preferably at a temperature of between 41 ° and 43°C.
7. The method of any of the preceding claims, wherein the at least one inverted repeat is an inverted terminal repeat (ITR).
8. The method of any of the preceding claims, wherein the plasmid encodes for at least one cargo nucleic acid, preferably wherein the at least one cargo nucleic acid comprises or consists of a sequence encoding for: one or more polypeptides;RNA, in particular messenger RNA encoding for a polypeptide of interest small interfering RNA and / or trans-activating crRNA;DNA of interest, in particular DNA encoding recognition motifs for analytical or therapeutic applications.
9. The method of any one of the preceding claims, wherein the inverted repeat is at least 100 bp in length, at least 110 bp in length, at least 120 bp in length, at least 140 bp in length, or at least 130 bp in length.
10. The method of any of the preceding claims, wherein: the at least one inverted repeat is at least one ITR of a cargo nucleic acid; and / or the plasmid contains two ITRs flanking a cargo nucleic acid.
11. The method of any of the preceding claims, wherein at least 80% of inverted repeats are not shortened after 1 day of cultivating in accordance with step (ii) and / or at least 80% of inverted repeats are not shortened after 3 days.
12. The method of any of the preceding claims, wherein the inverted repeat is characterized in that: it is of viral origin, in particular adeno-associated virus (AAV) origin; it is an ITR, in particular an ITR of adeno-associated virus (AAV) origin; at least 131 base pairs in length including the D-sequence; characterized by a guanosine / cytidine content of at least 70 mol%, based on the overall nucleoside content; and / or characterized in that at least 80 mol% of the bases are paired in a folded single strand.
13. The method of any of the preceding claims, wherein the plasmid is characterized in that:(a) it contains at least one origin of replication suitable for replication in Escherichia coir,(b) it contains at least one sequence enabling selecting Escherichia coli comprising the plasmid, preferably at least one sequence mediating antibiotic resistance or at least one sequence encoding for an enzyme that enables growth in the absence of an essential nutrient component; and / or(c) is a circular plasmid of double-stranded DNA of at least 1000 base pairs in length, preferably of at least 2000 base pairs in length, in particular of at least 3000 base pairs in length.
14. The method of any of the preceding claims, wherein the Escherichia coli bacteria are wildtype Escherichia coli bacteria, in particular K-12 or B derivative Escherichia coli bacteria.
15. The method of any of the preceding claims, wherein the step (ii) of cultivating the Escherichia coli bacteria is conducted for at least 12 hours at a temperature in the range of from 39°C to 46°C or of from 40°C to 45°C or of from 41 °C to 44°C or of from 41 °C to 43°C or at 42°C.
16. The method of any of the preceding claims, wherein the method further comprises a step (iii) of harvesting the Escherichia coli bacteria after step (ii) has been conducted and optionally isolating the plasmids, preferably, wherein the method further comprises a step (iv) of isolating the cargo nucleic acid from the isolated plasmids of step (iii) and optionally an additional step (iv-a) of inserting the cargo nucleic acid into a gene vector.
17. The method of claim 16, wherein the method further comprises a step (v) of inserting the isolated plasmids of step (iii) and / or the isolated cargo nucleic acid of step (iv) and / or the gene vector of step (iv-a) into target cells, in particular eukaryotic target cells, optionally expressing the cargo nucleic acid, preferably wherein virus particles or virus-like particles are obtained.
18. The method of any of claims 16 and 17, wherein the isolated plasmids of step (ii) and / or step (iii) and / or the isolated cargo nucleic acid of step (iv) and / or the gene vector of step (iv-a) comprises at least one ITR not shortened in comparison to the at least one ITR of the corresponding cargo nucleic acid contained in the plasmid comprised in the Escherichia coli bacteria in step (i).
19. The method of claim 18, wherein the at least one ITR that is not shortened in comparison to the at least one ITR of the corresponding cargo nucleic acid contained in the plasmid comprised in the Escherichia coli bacteria in step (i) is an ori-proximal ITR.
20. A plasmid including at least one inverted repeat obtainable from a method of any one of claims 1 to 19, preferably characterized in that the inverted repeat obtained from propagating of the method has a nucleotide identity of at least 98 mol% compared to the respective inverted repeat provided in step (i) of the method.
21. A cargo nucleic acid including at least one inverted repeat, obtained from a method of any one of claims 1 to 20, characterized in that the inverted repeat obtained from propagating of the method has a nucleotide identity of at least 98 mol% compared to the respective inverted repeat provided in step (i) of the method.
Citation Information
Patent Citations
Vectors for gene delivery that persist within cells
US20210269828A1
Bacterial host strains
US20230132250A1
Cited By
Detecting and measuring inverted terminal repeat deletions by capillary electrophoresis
WO2025245372A1