Tuberculosis vaccine composition comprising fusion protein inducing bactericidal immunity against mycobacterium tuberculosis

A tuberculosis vaccine composition using fusion proteins like Rv2299cD2D3-ESAT6-Ag85B or Rv2299cD2D3-Rv3463-Ag85B induces sterilizing immunity, overcoming the limitations of current vaccines by achieving high bactericidal activity and long-term protection against tuberculosis.

WO2025121814A1PCT designated stage expired Publication Date: 2025-06-12MYCO RAPHA INC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/019479
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-06
Filing Date
2024-12-02
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Current tuberculosis vaccines, including BCG, have limited efficacy in inducing sterilizing immunity, which is necessary to completely eliminate Mycobacterium tuberculosis bacteria, and there is a need for a vaccine that can replace BCG and provide long-term protection against tuberculosis.

Method used

Development of a tuberculosis vaccine composition comprising a fusion protein, specifically Rv2299cD2D3-ESAT6-Ag85B (REA) or Rv2299cD2D3-Rv3463-Ag85B (RRA), which induces bactericidal immunity by activating T cells and antigen-presenting cells, leading to a significant increase in protective immune responses.

Benefits of technology

The vaccine composition induces sterilizing immunity, with a bactericidal activity of 99% or more against Mycobacterium tuberculosis, effectively replacing BCG and providing long-term protection against tuberculosis in both adults and infants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024019479_12062025_PF_FP_ABST
    Figure KR2024019479_12062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a tuberculosis vaccine composition comprising a fusion protein inducing bactericidal immunity against Mycobacterium tuberculosis. Specifically, a tuberculosis vaccine composition comprising a fusion protein of Rv2299cD2D3-ESAT6-Ag85B(REA) or Rv2299cD2D3-Rv3463-Ag85B(RRA) induces sterilization of 99% or more of Mycobacterium tuberculosis, and thus can prevent adult tuberculosis and can be used as a vaccine for infants / toddlers.
Need to check novelty before this filing date? Find Prior Art

Description

Tuberculosis vaccine composition comprising a fusion protein that induces bactericidal immunity against tuberculosis bacteria

[0001] The present invention relates to a tuberculosis vaccine composition comprising a fusion protein that induces bactericidal immunity against tuberculosis bacteria.

[0002] Tuberculosis, an infectious disease caused by the Mycobacterium tuberculosis (MTB) bacterium, remains one of the most devastating infectious diseases worldwide. Recently, 1.5 million people have died from tuberculosis worldwide, and South Korea ranks among the 32 OECD member countries with the most severe tuberculosis problems in terms of incidence and mortality rates.

[0003] The most effective strategy to address this tuberculosis problem is the development of a safe and effective vaccine. However, the only vaccine against tuberculosis, Mycobacterium bovis, is Bacillus Calmette-Guille ... The preventive efficacy of BCG (bacterial cholera vaccine) is controversial, ranging from 0% to 80% depending on the reporter, and it has been reported to have no effect on the reactivation of latent tuberculosis or on adult tuberculosis. However, because it is effective in preventing severe tuberculosis in children, it is being administered in many countries, but a vaccine with superior efficacy than BCG has not yet been developed. Furthermore, the goal of the World Health Organization (WHO) End TB strategy is to reduce the incidence of tuberculosis by 90% and the mortality rate by 95% by 2035 based on the 2015 figures. South Korea has also set and is pursuing the goal of reducing the incidence of tuberculosis to less than 10 per 100,000 people through its End TB 2030 plan. To achieve this goal of a tuberculosis-free world, the development of a tuberculosis vaccine with excellent preventive efficacy and a game-changing effect is essential.

[0004] Currently, approximately 10 tuberculosis vaccines are undergoing clinical trials worldwide. These can be categorized by function: ① live-cell-based vaccines intended to replace the prime vaccine, BCG; ② BCG booster vaccines using adjuvants or viral vectors; and ③ immunotherapeutic vaccines intended to shorten treatment periods or prevent relapse. Live-cell-based vaccines intended to replace BCG are primarily developed using genetically recombinant BCG strains and tuberculosis strains with two genes deleted simultaneously. These live-cell-based vaccines contain more antigens than subunit vaccines, inducing a variety of immune responses and thus offering high protective efficacy. However, the development of recombinant or gene-defective strains requires a long development period due to issues such as the removal of antimicrobial resistance markers and safety verification. Furthermore, rigorous quality control is required during the vaccine strain manufacturing process. Due to these limitations, tuberculosis vaccine development has focused on protein-based subunit vaccines. These subunit vaccines have limitations in replacing BCG, and are therefore primarily being developed as BCG booster vaccines.

[0005] Accordingly, for a vaccine to be more effective, it must induce sterilizing immunity—an immune response that completely eliminates the invading bacteria when vaccinated animals or humans are exposed to tuberculosis. In such cases, a protective efficacy of over 95% can be expected. However, no vaccine currently undergoing clinical trials can induce this sterilizing immunity.

[0006] The antigens used in the development of existing subunit vaccines currently in clinical trials are mainly T cell stimulating antigens such as Ag85 or ESAT6 antigen, PE / PPE antigen, some pathogenicity-related antigens, and protein antigens related to latent tuberculosis induction. H56 and ID93 vaccines are multiprotein vaccines that fuse proteins related to latent tuberculosis induction with proteins that mainly activate T cells or proteins related to bacterial virulence. However, considering that tuberculosis bacteria cannot be completely eliminated even in people with a normal immune response, vaccines using only T cells have limitations in inducing sterilizing immunity, and research on this is urgent.

[0007] The present invention provides a tuberculosis vaccine composition comprising a fusion protein that induces bactericidal immunity against tuberculosis bacteria.

[0008] To solve the above problem, the present invention provides a tuberculosis vaccine composition comprising a Rv2299cD2D3-ESAT6-Ag85B (REA) fusion protein. The Rv2299cD2D3-ESAT6-Ag85B (REA) fusion protein is characterized in that it is encoded by the base sequence of SEQ ID NO: 1. In addition, the Rv2299cD2D3-ESAT6-Ag85B (REA) fusion protein is characterized in that it comprises the amino acid sequence of SEQ ID NO: 2.

[0009] The present invention also provides a tuberculosis vaccine composition comprising a Rv2299cD2D3-Rv3463-Ag85B (RRA) fusion protein. The Rv2299cD2D3-Rv3463-Ag85B (RRA) fusion protein is characterized in that it is encoded by the base sequence of SEQ ID NO: 3. The Rv2299cD2D3-Rv3463-Ag85B (RRA) fusion protein is characterized in that it comprises the amino acid sequence of SEQ ID NO: 4.

[0010] The tuberculosis vaccine composition according to the present invention induces sterilization of tuberculosis bacteria by 99% or more.

[0011] The tuberculosis vaccine composition according to the present invention comprises IFN-γ + IL-2 + TNF-α + or IL-2 + TNF-α + Antigen-specific CD4 producing + By increasing the proportion of T cells, bactericidal immunity against tuberculosis bacteria can be induced.

[0012] The present invention provides a recombinant polynucleotide for bactericidal immunity against tuberculosis comprising the base sequence set forth in SEQ ID NO: 1 or 3. The present invention also provides a recombinant vector comprising the recombinant polynucleotide. The vector may be composed of pET-22b(+)_Rv2299cD2D3-ESAT6-Ag85B or pET-22b(+)_Rv2299cD2D3-Rv3463-Ag85B, and may be constructed using a commonly available plasmid, phage, etc., including the sequence comprising the antigens of Rv2299cD2D3, ESAT6, Ag85B and Rv2299cD2D3, Rv3463, Ag85B. The above vector can transform a host cell including commonly available E. coli, and in particular, the Rv2299cD2D3-ESAT6-Ag85B(REA) fusion protein or the Rv2299cD2D3-Rv3463-Ag85B(RRA) fusion protein can be obtained from a host cell specialized in protein production and secretion.

[0013]

[0014] The present invention provides a recombinant polypeptide for bactericidal immunity against tuberculosis comprising an amino acid sequence set forth in SEQ ID NO: 2 or 4. The recombinant polypeptide for bactericidal immunity against tuberculosis comprising an amino acid sequence set forth in SEQ ID NO: 2 or 4 may be a Rv2299cD2D3-ESAT6-Ag85B(REA) fusion protein or a Rv2299cD2D3-Rv3463-Ag85B(RRA) fusion protein.

[0015] The tuberculosis vaccine composition comprising a fusion protein that induces sterilizing immunity against tuberculosis bacteria of the present invention can replace BCG, and thus can be used as a vaccine for preventing tuberculosis in adults as well as for infants and children.

[0016] The present invention relates to a tuberculosis vaccine composition comprising a fusion protein that induces sterilizing immunity against tuberculosis bacilli, and more specifically, a tuberculosis vaccine composition comprising a fusion protein of Rv2299cD2D3-ESAT6-Ag85B (REA) or Rv2299cD2D3-Rv3463-Ag85B (RRA) induces sterilization of tuberculosis bacilli by 99% or more, thereby being used not only for the prevention of tuberculosis in adults but also as a vaccine for infants and children.

[0017] Figure 1 is a graph showing the purification and endotoxin detection of REA and RRA. (A) SDS-PAGE of E. coli extracts transformed with pET plasmids containing REA and RRA, followed by Coomassie blue (CB) staining and Western blot (WB) analysis with an anti-His antibody. (B) Comparison of TNF-α production in BMDMs treated with LPS, RRA, or REA, depending on whether or not polymyxin B was pretreated (****p < 0.0001).

[0018] Figure 2 is a graph showing the effects of REA and RRA on antigen-presenting cell activity. (A) Changes in IL-12p70, TNFα, and IL-10 production in BMDM / BMDCs stimulated with LPS, Ag85b, ESAT6, Rv2299cD2D3, and different concentrations of REA. (B) Expression of surface markers MHC II, CD80, and CD86 in BMDM / BMDCs stimulated with LPS, Ag85b, ESAT6, Rv2299cD2D3, and different concentrations of REA (bar graphs represent the percentage of each surface molecule in anti-Mo F4 / 80 BMDM / CD11c+ BMDC cells). (C) Changes in IL-12p70, TNFα, and IL-10 production in BMDM / BMDCs stimulated with Rv3463, Rv2299c, and different concentrations of RRA. (D) Expression of surface markers MHC II, CD80, and CD86 in BMDM / BMDCs stimulated with Rv3463, Rv2299c, and different concentrations of RRA. (Data shown are mean ± SD (n = 3); *p < 0.05, **p < 0.01, or ***p < 0.001, compared with the medium control (MC)).

[0019] Figure 3 is a graph showing the Th1 response by REA-matured DCs. (A) Changes in the production of IFNγ and IL-10 after 72 h of co-culture with naive T cells (DC:T cell = 1:10) of unstimulated DCs (control DCs) and DCs stimulated with Rv2299cD2D3 (5 μg / mL), Ag85B (5 μg / mL), ESAT6 (2 μg / mL), or REA (1 or 2 μg / mL). (B) Proliferation of transgenic OVA-specific CD4+ T cells isolated from B6.Cg-Tg(TcraTcrb)425Cbn / J mice, stained with CFSE, and co-cultured with DCs treated with REA (2 μg) or LPS (100 ng / ml) for 96 h, followed by T cell proliferation pulsed with OVA323-339 (1 μg / ml). (Controls were T cells co-cultured with T cells or untreated DCs). (C) Quantitative comparison of IFNγ, IL-2, IL-17, and IL-4 in culture supernatants under each condition using ELISA. (Data shown are mean ± SD (n = 3); *p < 0.05, **p < 0.01, ***p < 0.001, or ****p < 0.0001 compared to the appropriate controls (T cells / OVA257-264-pulsed DCs or T cells / OVA323-339-pulsed DCs); ns.: no significant difference.)

[0020] Figure 4 is a graph showing the Th1 response by RRA-matured DCs. (A) Changes in the production of IFNγ, TNFα, and IL-17 after 72 h of co-culture with naive T cells (DC:T cell = 1:10) of unstimulated DCs (control DCs) and DCs stimulated with Rv2299cD2D3 (5 μg / mL) or RRA (2 μg / mL). (B) Transgenic OVA-specific CD4+ T cells isolated from B6.Cg-Tg(TcraTcrb)425Cbn / J mice were stained with CFSE and co-cultured with DCs treated with RRA (2 μg) or LPS (100 ng / ml) for 96 h, followed by proliferation of T cells pulsed with OVA323-339 (1 μg / ml). (Controls are T cells co-cultured with T cells or untreated DCs.) (C) Quantitative comparison of IL-17, IL-2, IFNγ, and IL-4 in culture supernatants under each condition using ELISA. (Data shown are mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, or ****p < 0.0001 compared to appropriate controls (T cells / OVA257-264-pulsed DCs or T cells / OVA323-339-pulsed DCs); ns.: no significant difference.)

[0021] Figure 5 shows the results showing the activation of BMDM through Toll-like receptor 2, 4 (TLR2 / TLR4) by REA. (A) Comparison of TNF-α, IL-12, and IL-6 production in culture supernatants of BMDMs derived from WT, TLR2- / -, and TLR4- / - mice after 24 h of treatment with REA (5 μg / mL), LPS (100 ng / mL), and the TLR2 agonist Pam3CSK4 (100 ng / mL) using ELISA. (One-way ANOVA with Tukey's multiple comparison test; p values ​​shown are comparisons of cytokines released by BMDMs from TLR2- / - and TLR4- / - mice with or without antigen.) (B, C) BMDM cells (1 × 10) treated with REA (5 μg / mL) for the indicated times. 5 / well) Immunoblotting results for (B) phospho-p38 (p-p38), p38, phospho-ERK1 / 2 (p-ERK1 / 2), ERK1 / 2, (C) GSK3β, P-PI3K, (D) P-AKT and (E) p-IκBα, IκBα in the membrane fraction.

[0022] Figure 6 shows the results showing the activation of BMDM through Toll-like receptor 2, 4 (TLR2 / TLR4) by REA. (A) Comparison of TNF-α, IL-12, and IL-6 production in culture supernatants of BMDMs derived from WT, TLR2- / -, and TLR4- / - mice after 24 h of treatment with RRA (5 μg / mL), LPS (100 ng / mL), and the TLR2 agonist Pam3CSK4 (100 ng / mL) using ELISA (one-way ANOVA with Tukey's multiple comparison test; p values ​​shown are for cytokines released by BMDMs from TLR2- / - and TLR4- / - mice and WT-derived BMDMs with or without antigen; ns: no significant difference). (B, C) BMDM and BMDC cells (1 × 10 5 / well) Immunoblotting results of (B) phospho-p38 (p-p38), p38, phospho-ERK1 / 2 (p-ERK1 / 2), ERK1 / 2, (C) p-PI3K, P-PI3K, p-AKT, p-IκBα, IκBα, and NFκB p65 in the membrane fraction. (D) Intracellular localization of the p65 subunit of NF-κB detected by immunofluorescence.

[0023] Figure 7 shows the effects of pharmacological inhibitors on the surface marker expression and cytokine production of BMDM of REA and RRA. (A, B) BMDM (1 × 10 6 / well) were treated with pharmacological inhibitors of p38 (SB203580, 20 μM), ERK1 / 2 (U0126, 10 μM), and NF-κB (Bay11-7082, 5 μM) or DMSO (vehicle control) for 1 h, followed by treatment with REA (A) or RRA (B) (5 μg / mL) for 24 h. Results of measurement of costimulatory surface markers (CD80, CD86) by flow cytometry and TNF-α and IL-6 in culture supernatants by ELISA. (Data shown are mean ± SD (n = 3) *p < 0.05, **p < 0.01, or ***p < 0.001).

[0024] Figure 8 shows the results showing the effect of REA on the inhibition of intracellular growth of MTB in BMDM and on the activation of infected cells. (A) Intracellular MTB growth under LPS, Rv2299c, and REA conditions. (B) Analysis of the expression of surface molecules by two-color flow cytometry to determine antigen-presenting ability during infection (in BMDM infected with H37Rv [MOI: 1]). (C) ELISA results of cytokine production in the culture supernatants shown in (B). (n=3, expressed as mean±SD, analyzed using one-way ANOVA followed by Tukey's post hoc test, p values ​​represent comparison of surface molecule and cytokine levels between MC and antigen-treated BMDM, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0025] Figure 9 shows the results showing the effect of RRA-matured T cells on the inhibition of intracellular bacterial growth. (A) Intracellular MTB growth after incubation of BMDM infected with H37Rv with LPS, Rv2299c, or RRA. (B) Analysis of the expression of surface molecules MHC II, CD80, and IL-12 (P70) by two-color flow cytometry to determine antigen-presenting ability during infection (in BMDM infected with H37Rv [MOI: 1]). (C) ELISA results of intracellular MTB growth and cytokine production in culture supernatants after incubation of BMDM infected with MTB with T cells activated by LPS, Rv2299cD2D3, or RRA-matured BMDCs. (n=3, expressed as mean±SD, analyzed using one-way ANOVA and Tukey's post hoc test, p values ​​represent comparison of surface molecule and cytokine levels between MC and antigen-treated BMDM, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

[0026] Figure 10 shows the effect of REA on early endosome maturation in BMDM infected with MTB. (A) BMDM infected with H37Rv tuberculosis strain (RFP-MTB) (MOI: 1) (red fluorescent protein labeled) were treated with LPS, Rv2299c, or REA. Endosomal colocalization was imaged by confocal microscopy after staining with Ras-related protein 5 (Rab5). The bar graph represents the colocalization ratio of Rab5. (B, C) Cells were stained with anti-phosphoinositide 3-kinase vacuolar protein sorting 34 (hVPS34) (B) or anti-EEA1 (C) under the same conditions as in (A). (D) Western blot analysis of time-dependent phosphorylation and total protein levels of class I PI3K and p38 MAPK signaling components. (E) Colocalization of anti-EEA1 with BMDM pretreated with SB303580 and then treated with REA during H37Rv infection. Phagocytoses containing MTB were observed by confocal microscopy for colocalization of the indicated markers. (F) Growth of intracellular bacteria in MTB-infected BMDM pretreated with SB303580 and then treated with REA or LPS. (*p < 0.05 and **p < 0.01).

[0027] Figure 11 shows the results showing the effect of REA on phagocyte acidification. (A, B, C) BMDM (1x10) infected with RFP-MTB [MOI: 1] 6 / well) were stained with RAB7 (A), LAMP1 (B), Lyso Tracker™ Green DND-26 (C), and phagocytes containing MTB after treatment with Rv2299c or REA (5 μg mL-1). (D, E) Colocalization of LAMPs after BMDMs were infected with RFP-H37Rv [MOI: 1] for 4 h and treated with SB203580 p38 inhibitor (D) or LY2940029 PI3K inhibitor (E) 1 h before Rv2299c or REA treatment. (*p < 0.05, **p < 0.01, and ***p < 0.001 for Rv2299c- or REA-treated infected BMDMs compared to untreated MTB H37Rv-infected BMDMs).

[0028] Figure 12 Intracellular Ca inducing EEA1 co-localization in BMDM infected with MTB of REA 2+ Results showing the effect on the increase. (A) Colocalization of calcium with REA treatment for the indicated period after Fluo-4 / AM loading in BMDM infected with RFP-MTB [MOI: 1]. (**p < 0.01, ***p < 0.01, and ****p < 0.001 P values ​​indicate the time-dependent intensity of Fluo-4 / AM.) (B) In (A), BAPTA / AM, Ca 2 + Colocalization of EEA1 with REA after chelator application. (C) Intracellular tuberculosis growth following BAPTA / MA treatment. (*p < 0.05, **p < 0.01, ns: not statistically significant difference).

[0029] Figure 13 shows the results showing the effect of REA on intracellular ROS and NO production. (A) Intracellular ROS levels in BMDM infected with RFP-MTB [MOI: 1] were measured by DCDF-based staining according to NAC treatment. The bar graph represents DCF fluorescence intensity calculated using ImagJ.exe. (B) NO levels were measured in culture supernatants after 72 h of treatment with REA or LPS, regardless of infection. (C) After DPI pretreatment, BMDM (1 × 10) infected with RFP-MTB (MOI: 1) were 6 / well) were stimulated with LPS or REA, and intracellular ROS levels were measured by DCDF-based staining. (D) Measurement of intracellular bacterial growth following NAC treatment 1 h before infection. (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, ns: not statistically significant difference).

[0030] Figure 14 shows the effects of RRA on RAB5 and the activation of PI3K and p38 MAPK. (A) BMDM cells infected with red fluorescent protein-labeled MTB H37Rv strain (RFP-MTB) (MOI: 1) were treated with RRA or Rv2299c, stained for RAB5, and imaged by confocal microscopy for endosomal colocalization. The histogram represents the percentage of RAB5 colocalization induced by REA relative to Rv2299c and untreated controls. (B) Western blot analysis of time-dependent phosphorylation and total protein levels of Class I PI3K and p38 MAPK signaling components. (C) Western blot analysis of time-dependent phosphorylation of Class I PI3K following treatment with SB303580 or LY2940029. (D) Growth of bacteria in RRA- or LPS-treated MTB-infected BMDM cells following SB303580 treatment. (**p < 0.01, ns: not statistically significant difference).

[0031] Figure 15 shows that RRA recruits hVPS34, EEA1, and RAB7 through PI3K activation and induces phagolysosome fusion. (A, B, D, E, F) BMDM cells infected with red fluorescent protein-labeled MTB H37Rv strain (RFP-MTB) (MOI: 1) were treated with RRA or Rv2299c together with LY2940029 or SB203580, and then stained with anti-hVPS34 (A), anti-EEA1 (B), anti-Rab7 (D), or anti-LAMP1 (E) antibodies and Lyso Tracker™ Green DND-26 (F). Endosomal colocalization was imaged by confocal microscopy. The bar graph represents the colocalization ratio of each detected protein. (C) Growth of intracellular M. tuberculosis in response to LY2940029 treatment. (*p < 0.05, **p < 0.01, ***p < 0.001, ns: no statistically significant difference).

[0032] Figure 16 shows the results showing the effect of RRA on intracellular ROS and NO production. (A, B) BMDM (1 × 10) infected with RFP-MTB [MOI: 1] 6 / well) after stimulation with LPS or RRA, and pretreatment with DPI (A) or NAC (B). Intracellular ROS levels were measured by DCDF fluorescence-based staining. Bar graphs represent DCF fluorescence intensities calculated using ImagJ.exe. (C) NO levels in culture supernatants 72 h after infection and RRA treatment. (D) Measurement of intracellular M. tuberculosis in BMDMs treated with RRA or LPS following pretreatment with NAC before infection. (E) Immunoblot analysis of phosphorylation of p38 and pI3K in MTB infected with DPI and treated with RRA. (*p < 0.05, **p < 0.01, ***p < 0.001, ns: not statistically significant difference).

[0033] Figure 17 shows intracellular Ca that induces hVPS34 and EEA1 co-localization in BMDM infected with MTB of RRA. 2+The effect on the increase of calcium was shown. (A) After loading Fluo-4 / AM into BMDM infected with RFP-MTB [MOI: 1], RRA treatment was performed for the indicated periods, and then co-localization of calcium was imaged using a confocal microscope. The bar graph represents the percentage of fluorescence intensity Fluo-4 / AM obtained for infected cells. (B) After BAPTA / AM application to infected BMDM, RRA treatment was performed, and then co-localization of hVPS34 or EEA1 was imaged using a confocal microscope. (C) Measurement of intracellular M. tuberculosis growth following BAPTA / MA pretreatment. (D) Co-localization of intracellular ROS by RRA following BAPTA / MA pretreatment in BMDM infected with RFP-MTB. (E) Intracellular Ca by RRA following DPI pretreatment in BMDM infected with RFP-MTB. 2+ Co-localization. (**p < 0.01).

[0034] Figure 18 shows the results of Th1 / Th17 responses and antimycobacterial responses of T cells activated by REA-treated DCs and macrophages. (A) Splenic CD4 isolated from BCG-vaccinated mice (4 weeks after vaccination) + T cells were treated with REA-treated DCs (1×10 5 / well), REA-treated macrophages (1 × 10 5 / well), or REA-treated DC (5×10 4 / well) and macrophages (5×10 4 / well) were treated with APC:T cell ratio 1:10 for 72 h, and cytokines in the supernatant of the cell lysate were measured by ELISA. (B, C) T cells co-cultured for 3 days in the same manner as in (A) were co-cultured with BMDM infected with MTB for 72 h. Growth of M. tuberculosis in BMDM (B) and cytokines in the culture supernatant (C). (T: T cell, M: Macrophage, DC: Dentritic cell, mean ± SD (n = 3), ns; no significant difference, *P < 0.05, **p < 0.01, ***p < 0.001, ****P < 0.0001, compared with T cells).

[0035] Figure 19 shows the results of in vivo T cell responses in antigen-immunized mice. (A) Schedule of vaccine administration and necropsy in mice (unit: weeks). (B) Amount of cytokines in culture supernatants after stimulation of splenocytes isolated from mice 6 weeks after immunization in (A) with the indicated antigen (2 μg / ml). (**p < 0.01, ***p < 0.001, ****p < 0.0001).

[0036] Figure 20 shows the results comparing the vaccine potential of BCG, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and the REA of the present invention (Rv2299cD2De-ESAT6-Ag85B). (A) Schedule of vaccine administration and necropsy in mice. (B) Bacilli burden in the lungs and spleen of individual mice at the start of immunization. (C) Lung cells (2.0 × 10 6 ) were stimulated with Rv2299c, ESAT-6 and REA (5 μg / ml) in the presence of GolgiStop, and IL-2 production was measured in cells isolated from the lungs of each group of mice. + , IL-2 + TNF-α + , IFN-γ + , TNF-α + , IFN-γ + IL-2 + TNF-α + and IFN-γ+ IL-2 + Antigen-specific CD4 producing + T cell ratio (circle graph) and IFN-γ in each group when stimulated with each antigen + IL-2 + TNF-α + or IL-2 + TNF-α + Antigen-specific CD4 producing + Proportion of T cells (bar graph). (n = 5). (Mean ± SD, statistical significance was determined using an unpaired t-test, *p < 0.05, **p < 0.01, ***p < 0.001 compared to the MPL-DDA alone group (unpaired t-test)).

[0037] Figure 21 shows the results of antigenic immune responses of mice immunized with BCG, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and REA (Rv2299cD2De-ESAT6-Ag85B). Spleen cells (2.0 × 10 6 ) were stimulated with Rv2299c, ESAT-6 and REA (5 μg / ml) in the presence of GolgiStop, and IL-2 production was measured in cells isolated from the lungs of each group of mice. + , IL-2 + TNF-α + , IFN-γ + , TNF-α + , IFN-γ + IL-2 + TNF-α + and IFN-γ + IL-2 + Antigen-specific CD4 producing + T cell ratio (circle graph) and IFN-γ in each group when stimulated with each antigen + IL-2 + TNF-α + or IL-2 + TNF-α + Antigen-specific CD4 producing +Proportion of T cells (bar graph). (n = 5) (mean ± SD, statistical significance determined using unpaired t-test, *p < 0.05, **p < 0.01, ***p < 0.001 compared to MPL-DDA alone group (unpaired t-test)).

[0038] Figure 22 shows the levels of IFN-γ and IL-2 in each group according to each stimulus after 14 weeks of mouse immunization with 2 μg of Rv2299cD2D3, ESAT6, or REA in cells of the lungs, spleen, and lymph nodes, as in Figure 20.

[0039] Figure 23 shows the levels of IL-17 and TNF-α according to each stimulus in each group after the same experiment as Figure 22.

[0040] Figure 24 shows the results of evaluating the vaccine efficacy of mice immunized with REA / DDA-MPL and RRA / DDA-MPL against virulent MTB H37Rv infection. (A) Timeline of immunization with REA and RRA. (B) Bacterial counts in the lungs and spleen of each mouse group at 6 or 16 weeks post-challenge. (C) Representative histological images of lung lobes from each group using Masson's trichrome (MT) and Acid-Fast Bacillus (AFB) staining at 6 or 16 weeks post-challenge. (D) Granuloma area (%) in lung sections (n ​​= 5 each). (E) Intracellular MTB counts in BMDMs 3 days after co-culture of MTB-infected BMDMs with lung and spleen cells from 6- or 16-week-old mice. (n = 3, mean ± SD, *p < 0.05, **p < 0.01, ***p < 0.001 ****p < 0.0001. ns: no significant difference).

[0041] Our research team has developed a fusion protein that links a T cell antigen to dendritic cell-activating protein or macrophage-activating protein and has been evaluating the efficacy of a tuberculosis vaccine (PMID:34572519, PMID:33105734, PMID:32664238, PMID:32545304, PMID:30862819, PMID:28193909). Recently, the Rv2299c-Ag85B-ESAT6 fusion protein was produced and evaluated. As a result, it induced dendritic cell activation well, and by fusing Rv2299c to Ag85-ESAT6, which is well known as a vaccine composition, the CD4+ T cell response to Ag85B-ESAT6 was enhanced, and in a short-term vaccine evaluation mouse model (evaluation 3 weeks after challenge test), it was observed that the vaccine efficacy of Ag85B-ESAT6 was increased (PMID: 33105734). However, there were limitations in maintaining long-term vaccine efficacy, and its large molecular weight made it difficult to purify.

[0042] Our research team demonstrated that the N-terminal portion of the Rv2299c protein, a dendritic cell activation protein, does not exhibit immune activity (PMID: 36032688). In addition, preliminary experimental results showed that the vaccine efficacy of a fusion protein inserted after Rv229c was better than that of attaching the ESAT6 antigen to the end of the fusion protein when constructing the fusion protein. Therefore, we modified the Rv2299c-Ag85B-ESAT6 protein by removing the N-terminal portion (D1) of Rv2299c to reduce the molecular weight by approximately 25 kDa, and constructed a fusion protein, Rv2299cD2D3-ESAT6-Ag85B, by changing the order of Ag85B-ESAT6. In addition, the IGRA (IFN-γ release assay) test, which is used to detect tuberculosis infection, uses the ESAT6 / CFP-10 antigen, which is not present in BCG. Therefore, if ESAT6 is included in the vaccine antigen, there is a disadvantage that even vaccinated individuals may test positive in IGRA tests. Therefore, we constructed the Rv2299c-Rv3463-Ag85B fusion protein, which uses the Rv3463 antigen instead of the ESAT6 antigen. The Rv3463 protein has been reported by our research team to be a macrophage-activating protein and a potential vaccine antigen (PMID: 30862819).

[0043] The two types of fusion proteins above, Rv2299cD2D3-ESAT6-Ag85B, were named REA, and Rv2299cD2D3-Rv3463-Ag85B, RRA. These proteins were produced and purified in Escherichia coli, and their immune activity was analyzed targeting antigen-presenting cells (APCs). When the vaccine efficacy was measured in a mouse model, both fusion proteins showed remarkable vaccine efficacy as prime vaccines, with no bacteria detected in the lungs and spleen. In other words, although BCG vaccine efficacy decreases significantly after 14 weeks after the challenge test, the mouse groups that were vaccinated three times with each type of vaccine showed vaccine efficacy that surpassed the efficacy of BCG and eliminated the bacteria. To date, no tuberculosis vaccine has been reported that induces an immune response that completely eliminates the bacteria in a mouse model. Therefore, REA and RRA invented by our research team can be tuberculosis vaccines that induce sterilizing immunity, and although both vaccines are subunit vaccines, they can replace BCG, so they can be used not only to prevent tuberculosis in adults but also as vaccines for infants and children.

[0044] Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. The contents introduced herein are provided to sufficiently convey the spirit of the present invention.

[0045] Experimental Materials and Methods

[0046] 1. Cloning, production, and purification for recombinant protein production

[0047] 1.1 Cloning for production of recombinant proteins by protein domain

[0048] To produce each recombinant protein required for the experiment, the corresponding gene was amplified by PCR using the primers in Table 1 below, using genomic DNA from Mycobacterium tuberculosis (MTB) H37Rv (ATCC 27294) as a template. The generated PCR product was inserted into the pET-22b (+) vector (Novagen, Madison, WI, USA) using the inserted restriction enzyme sequence, and the generated plasmid sequence was analyzed and confirmed.

[0049] Primer Gene sequence Inserted restriction enzyme sequence Rv2299cD2D3-ESAT6-Ag85B (REA) Rv2299c2FCATATGAACCTGGTCAAGAAATACNdeIRv2299cRGAATTCG GCAAGGTACGCGCGAGACGTTCEcoRIESAT6FGAATTCGATGACAGAGCAGCAGTGGAATEcoRIESAT6RAAGCTTTGCGAACATCCCAGTGACGTTHindIIIAg85BF1GATGTTCGCAAAGCTTTTCTCCCGGCCGGGGCHindIIIAg85BRTGCTCGAGTGCGGCCGCGCCGGCGCCTAACGNotIRv2299cD2D3-Rv3463-Ag85B (RRA) Rv2299c2FCATATGAACCTGGTCAAGAAATACNdeIRv2299cRGAATTCG GCAAGGTACGCGCGAGACGTTCEcoRIRv3463FGAATTCGATGACCAATTGTGCCGCCEcoRIRv3463RAAGCTTAGTCAGTCGGAGCGGCTTHindIIIAg85BF1GATGTTCGCAAAGCTTTTCTCCCGGCCGGGGCHindIIIAg85BRTGCTCGAGTGCGGCCGCGCCGGCGCCTAACGNotI

[0050]

[0051] 1.2 Cloning for fusion protein production

[0052] (1) pET-22b(+)_Rv2299cD2D3-ESAT6-Ag85B.

[0053] Using the genomic DNA of Mycobacterium tuberculosis (MTB) H37Rv (ATCC 27294) as a template, Rv2299c DNA and ESAT6 DNA were obtained through PCR, and an overlapping PCR method was used to construct an Rv2299cD2D3-ESAT6 DNA fragment containing the nucleotide sequence of SEQ ID NO: 1 with NdeI restriction enzymes inserted at the 5' end and HindIII restriction enzymes inserted at the 3' end, and the fragment was inserted into the pET22b vector. The primers used at this time were as shown in Table 1 above, and the amino acid sequence of the polypeptide decoded by the nucleotide sequence of SEQ ID NO: 1 is as shown in SEQ ID NO: 2.

[0054]

[0055] (2) pET-22b(+)_Rv2299cD2D3-Rv3463-Ag85B

[0056] Using the same method as above, the Rv2299c, Rv3463, and ESAT6 DNAs obtained were used as templates, and the PCR method was used to produce an Rv2299cD2D3-Rv3463-ESAT6 DNA fragment containing the nucleotide sequence of SEQ ID NO: 3 with NdeI restriction enzymes inserted at the 5' end and XhoI restriction enzymes inserted at the 3' end, and the fragment was inserted into the pET22b vector. The primers used at this time were as shown in Table 1 above, and the amino acid sequence of the polypeptide decoded by the nucleotide sequence of SEQ ID NO: 1 was as shown in SEQ ID NO: 4.

[0057]

[0058] 1.3 Recombinant protein production

[0059] The recombinant plasmid prepared above was transformed into Escherichia coli BL21 cells. E. coli cells containing the recombinant plasmid were grown in a shaking incubator at 37°C. When the desired optical density (OD) was reached at a wavelength of 600 nm, isopropyl-D-thiogalactopyranoside (IPTG; Daejeon, ELPIS-Biotech) was added at a concentration of 1 mM. After 4 to 6 hours, the bacterial cells were harvested by centrifugation and suspended in 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 6 M urea, and 1 mM phenylmethylsulfonylfluoride (Sigma). For the purification of a single protein, the same composition was used except for urea. After sonication, the recombinant proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) agarose chromatography according to the manufacturer's instructions (Qiagen, Chatsworth, CA, USA). Each purified protein was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by Western blotting using Coomassie brilliant blue stain and an anti-His antibody (Santa Cruz). The purified proteins were concentrated and dialyzed against phosphate-buffered saline (PBS, pH 7.4). PBS was used for dialysis of all single proteins. To remove endotoxins, the dialyzed proteins were incubated with polymyxin B-agarose (PMB, Sigma) at 4°C for 2 h. Finally, the purified endotoxin-free recombinant proteins were filter-sterilized and frozen at -70°C. Protein concentration was calculated using the Bicinchoninic Acid (BCA) Protein Assay Kit (Pierce, Rockford, IL) using bovine serum albumin (BSA) as the standard. The purity of all proteins was assessed by Coomassie Blue (CB) staining and Western Blot (WB) using an anti-histidine antibody.

[0060]

[0061] 2. Culture of mouse bone-marrow-derived dendritic cells (BMDCs)

[0062] Bone marrow-derived dendritic cells (BMDCs) were cultured at 37°C in 5% CO2 using RPMI 1640 medium (Roswell Park Memorial Institute) supplemented with 10% fetal bovine serum, 1% antibiotics (Wellgene), 0.1% 2-mercaptoethanol, 5 mM HEPES buffer, 1% MEM solution, 20 ng / ml granulocyte-macrophage colony-stimulating factor (GM-CSF), and 2 ng / ml IL-4. Nonadherent cells and loosely attached proliferating DC aggregates were harvested on days 7 or 8 and used for further experiments.

[0063]

[0064] 3. Culture of mouse bone marrow-derived macrophages (BMDMs)

[0065] BMDM obtained from the femur and pelvis were cultured in a cell incubator at 5% CO2 and 37°C using DMEM (Dulbecco's modified Eagle's medium) containing 10% FBS (fetal bovine serum), 50 ng / ㎖ M-CSF (macrophage colony stimulating factor) (R&D System, USA), and 1% antibiotics (Welgene, Korea).

[0066]

[0067] 4. Preparation of MTB strains

[0068] MTB H37Rv (ATCC 27294) and H37Ra (ATCC 25177) were cultured in 7H9 medium containing 0.5% glycerol, 0.05% Tween-80, 10% oleic acid, albumin, dextrose, and catalase.

[0069]

[0070] 5. Animal preparation

[0071] Female C57BL / 6 mice, 5-6 weeks old and not infected with specific pathogens, were housed in the Biohazard Animal Laboratory at Chungnam National University College of Medicine. They were housed under a 12-hour light / 12-hour dark cycle and fed a sterilized, standard diet. Mice were monitored daily, and no clinical signs or illnesses were observed during the experiment.

[0072]

[0073] 6. Cell infection experiment and intracellular tuberculosis growth test

[0074] BMDMs 1×10 per well 5 After culturing the BMDMs by distributing them on plates, they were infected with Mtb H37Rv (MOI=1) for 4 hours. Afterwards, to remove any tuberculosis bacteria remaining outside the BMDMs that had not been infected, the antibiotic amikacin was added at a concentration of 200 μg / ml and treated for 2 hours, and then washed with PBS. Specific antigens were added to the BMDMs and cultured for 3 or 5 days, and the number of intracellular tuberculosis bacteria was measured.

[0075] Alternatively, BMDCs stimulated by each antigen and T cells isolated from spleen cells or splenocytes were cultured at a ratio of 1:10 for 3 days to activate the lymphocytes, and the number of intracellular tuberculosis bacteria was measured by co-culturing them with BMDMs infected with tuberculosis bacteria for 3 or 5 days.

[0076] To measure intracellular bacterial counts, BMDMs were collected and treated with distilled water for 30 minutes to lyse the cells. The lysate was serially diluted, plated onto 7H10 solid medium, and incubated at 37°C. After incubation, the number of colonies formed on the solid medium (colony forming units, CFU) was analyzed.

[0077]

[0078] 7. In vitro T-cell proliferation assay

[0079] Responder T cells participating in the naive T cell response were isolated from total mononuclear cells extracted from BALB / c mice using a MACS column (Miltenyi Biotec). Responder OVA-specific CD4 + T cells were obtained from spleen cells of OT-2 mice, respectively. These T cells were stained with 1 μM CFSE (Invitrogen). DCs (2 × 10 per well) treated with OVA peptide in the presence of 10 μg / ml tuberculosis antigen for 24 h 5 CFSE-stained CD4 cells + T cells (2×10 6 ) and DC: T cell were co-cultured at a ratio of 1:10. On day 3 or 4 of co-culture, each batch of T cells was treated with PerCP-Cy5.5-conjugated anti-CD4 + The cells were stained with monoclonal Ab and analyzed by flow cytometry, and the supernatants were harvested and analyzed for the levels of IFN-γ, IL-2, and IL-4 by ELISA.

[0080]

[0081] 8. Enzyme-linked immunosorbent assay (ELISA)

[0082] Cytokines produced after antigen stimulation of BMDMs or BMDCs and under various conditions were detected in the culture medium using a sandwich enzyme-linked immunosorbent assay for TNF-α, IL-1β, IFN-γ, IL-2, IL-4, and IL-12p70. Cytokine analysis was performed in the culture medium according to the manufacturer's recommendations (eBioscience and BD Biosciences). The levels of cytokines released into the culture medium were determined by measuring the absorbance at a wavelength of 450 nm using a microplate reader. Cytokine concentrations were calculated using a standard curve of recombinant cytokines, and the results were expressed as pictograms per milliliter.

[0083]

[0084] 9. Measurement of reactive oxygen species (ROS)

[0085] Intracellular ROS levels were assessed by staining cells with H2DCFDA (Molecular Probes). BMDM cells were stimulated with recombinant REA protein and incubated with 10 μM H2DCFDA in phosphate-buffered saline (PBS) at 37°C for 30 min in the dark, then washed with PBS. Samples were immediately analyzed on a FACS Canto II cytometer, and data were processed using FlowJo.

[0086]

[0087] 10. Cell surface staining and flow cytometry

[0088] Regardless of infection, antigen-treated BMDM or BMDC cells were harvested, washed, and stained with specifically labeled fluorescently conjugated Abs (monoclonal antibodies against CD80 (16-10A1), CD86 (GL1), MHC class I (34-1-2S), and MHC class II (IA / IE, M5 / 114.15.2), eBioscience). Staining intensities were measured using a flow cytometer (NovoCyte), and data were analyzed using FlowJo data analysis software (BD Bioscience). To identify cell surface molecules during infection, BMDM were infected with MTB H37Rv (1 × 10 5 / well) for 4 hours and then treated with antigenic stimulant for 72 hours.

[0089]

[0090] 11. Immunoblotting analysis

[0091] Activated / inhibited / transfected BMDM or BMDC cells were collected and lysed using RIPA lysis buffer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, PMSF, 1 mM phenylmethanesulfonyl fluoride, and 1% (vol / vol) protease inhibitor cocktail (Thermo Scientific, Rockford, IL, USA) and phosphatase inhibitor cocktail tablets (Sigma-Aldrich, St. Louis). The lysates were centrifuged at 13475 × g for 20 min at 4°C. Total protein concentrations were then measured using the Bradford assay (Bio-Rad, Hercules, CA, USA), and equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, MA, USA) for immunoblotting. These membranes were blocked in Tris-buffered saline containing 0.1% Tween-20 (TBS / T) buffer with 5% (w / v) nonfat milk for 1 h at room temperature and then probed with primary antibodies for 12 h at 4°C. They were then incubated with the corresponding specific peroxidase-conjugated secondary antibodies. The immunoblots were incubated with a chemiluminescent substrate for horseradish peroxidase (HRP) (Millipore), and the target proteins were detected using a BioRad ChemiDoc imaging system.

[0092]

[0093] 12. Immunofluorescence and confocal microscopy analysis

[0094] To track the maturation of MTB-containing phagosomes, colocalization of RAB5, hVPS34, EEA1, RAB7, and LAMP1 was stained using antibodies against each protein marker. Briefly, BMDM (2 × 10 5 / well) were seeded overnight on 18 mm diameter circular glass coverslips in 12-well cell culture plates. Cells were then infected with RFP-MTB H37RV (MOI 1) in antibiotic-free medium and incubated for 4 h in a 5% CO2 incubator at 37°C. The cells were then gently seeded in regular medium and treated with LPS, Rv2299c, RRA, or REA for the indicated times. To determine colocalization, cells were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature, permeabilized with 0.1% Triton X-100, and blocked with 3% BSA in PBS. Rabbit anti-Rab5, anti-hVPS34, anti-EEA1, anti-Rab7, or mouse anti-LAMP1 primary antibodies were then diluted according to the manufacturer's protocol and applied overnight. Next, the cells stained for Rab 5, Hvps34, EEA, and Rab 7 were incubated with secondary Alexa Flour ® 488-conjugated antibodies, whereas the cells stained with LAMP were incubated with goat anti-Rat Alexa Flour ® 488-conjugated secondary antibodies. Finally, cellular nucleic acids were stained with 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) and imaged using a confocal microscope. Cells were washed three times with PBS between each step. To quantify lysosomes in cells, cells were stained with LysoTracker Green (Molecular Probes) and LysoTracker Green uptake was analyzed.

[0095]

[0096] 13. Mixing of proteins with DDA / MPL

[0097] A mixture of protein, dimethyl dioctadecylammonium bromide (DDA), and monophosphoryl lipid A (MPL) was prepared according to the method of Andersen et al. (PMID; 10639447). Five μg of protein, 250 μg of DDA, and 25 μg of MPL were mixed, and 0.2% triethylamine was added to make a final volume of 200 μl. The mixture was then heated in a 70°C water bath for 30 s and sonicated for 30 s. This process was repeated 2–3 times. All mixtures of protein, DDA, and MPL were mixed immediately before use.

[0098]

[0099] 14. Vaccine Experiments

[0100] In the preventive vaccine experiment, mice were first immunized subcutaneously three times with the immunovaccine composition to be tested, and then challenged with MTB (H37Ra or H37Rv) four or six weeks later. After a certain period, the number of bacteria in the organs of the mice was measured. For the bacterial infection for the challenge test, the mice were first anesthetized with 1.2% 2,2,2-tribromoethanol (Avertin), and the trachea was exposed through a small midline incision. MTB contained in 50 μl saline was then inoculated intratracheally (IT). To determine the bacterial count in the lung and spleen, mice were euthanized with CO2, tissues were removed, homogenized, and serial dilutions of the lung homogenate were plated on Middlebrook 7H10 agar (Difco Laboratories, Detroit, MI) supplemented with 10% OADC (Difco Laboratories), amphotericin B (Sigma-Aldrich, St. Louis), and 2 μg / ml 2-thiophenecarboxylic acid hydrazide (Sigma-Aldrich). Colonies were counted after 4 weeks of incubation at 37°C. Data on CFU and assessment of lung inflammation were calculated using log 10 It was performed as CFU ± interquartile range (IQR).

[0101]

[0102] 15. Statistical Analysis

[0103] All experiments were repeated at least three times. The significance level for comparisons between samples was determined using Tukey's multiple comparison test distribution using statistical software (GraphPad Prism Software, version 4.03; GraphPad Software, San Diego, CA). Data in the graphs are expressed as mean ± SEM, and differences from each value were considered statistically significant if * p < 0.05, ** p < 0.01, or *** p < 0.001.

[0104]

[0105] <Experimental Results>

[0106] 1. Confirmation of endotoxin contamination in purified REA and RRA fusion proteins

[0107] As described above, E. coli was transformed using expression pET plasmids cloning DNAs encoding each REA and RRA fusion protein, and the proteins were purified from these E. coli extracts, and analyzed by SDS-PAGE, Coomassie blue (CB) staining, and Western blotting (WB) using anti-His antibody. The results are shown in Fig. 1A. As shown in Fig. 1A, the expression of the recombinant proteins of REA and RRA was confirmed. In addition, to confirm whether endotoxin was contaminated during the purification process, BMDMs were pretreated with or without polymyxin B for 1 hour, then cultured with LPS, RRA, or REA for 24 hours. TNF-α production was analyzed in the culture supernatant by ELISA, which is shown in Fig. 1B. As shown in Fig. 1B, it was confirmed that the recombinant proteins of REA and RRA were not contaminated, and did not exhibit significant cytotoxicity in BMDMs at 10 μg / ml.

[0108]

[0109] 2. Activity of REA and RRA on antigen-presenting cells (APCs)

[0110] Because the proteins constituting REA and RRA include proteins that activate dendritic cells or macrophages, the activity of each fusion protein against APCs was evaluated. For the activity evaluation, single antigen components (Rv3463, Ag85B, ESAT6, Rv2299c, or Rv2299cD2D3) constituting the fusion protein and LPS were used as controls.

[0111] First, BMDM or BMDC 1 × 10 5 / Wells were stimulated with 100 ng / mL LPS or 1, 2, 5, or REA and RRA (10 μg / mL), ESAT-6 (2 μg / mL), Ag85B, Rv2299cD2D3, Rv2299c, or Rv3463 (each 5 μg / mL) for 24 h, and the cytokines IL-12p70, TNF-α, and IL-10 in the culture supernatants were measured and shown in Fig. 2A and Fig. 2C. As shown in Fig. 2A, REA stimulated BMDMs and BMDCs to induce IL-12 and TNF-α production in a concentration-dependent manner, and high concentrations of REA increased IL-10 production in BMDCs. Also, as shown in Figure 2C, similar to REA, RRA significantly induced the production of inflammatory cytokines IL-12 and TNF-α from BMDMs and BMDCs compared to unstimulated cells, and induced higher production of IL-10 compared to REA. In particular, in BMDMs, RRA was higher than Rv3463, while in BMDCs, there was no significant difference between RRA and Rv2299c.

[0112] The effects of REA and RRA recombinant proteins on the expression of MHC class II, CD80, and CD86, which are surface molecules of BMDMs and BMDCs, were investigated. Activated BMDMs or BMDCs were stained with anti-CD80, anti-CD86, or anti-MHC class II antibodies, and the expression of surface markers was confirmed by fluorescence-activated cell sorting (FACS), as shown in Fig. 2B and Fig. 2D. As shown in Fig. 2B, FACS analysis also showed that the expression of MHC class II, CD80, and CD86, which are surface molecules of BMDMs and BMDCs, was significantly increased by REA stimulation. In the case of BMDCs, cytokine production and surface molecule expression induced by individual antigens Ag85B, ESAT6, and Rv2299cD2D3 were similar to or lower than those of REA. In particular, the expression induction ability induced by Ag85B was the lowest. Additionally, as shown in Figure 2D, surface molecule expression by RRA was significantly increased compared to the culture control (MC) in both BMDMs and BMDCs, and there was no significant difference compared to individual antigens Rv3463 or Rv2299c.

[0113] Since both REA and RRA contain Rv2299cD2D3, we analyzed the activity of dendritic cells matured by each fusion protein. Unstimulated DCs (control DCs) and DCs stimulated with Rv2299cD2D3 (5 μg / mL), Ag85B (5 μg / mL), ESAT6 (2 μg / mL), or REA (1 or 2 μg / mL) were co-cultured with naive T cells for 72 h (DC:T cell = 1:10). The production of IFN-γ and IL-10 in the culture supernatants was analyzed by ELISA, and the results are shown in Fig. 3A. As shown in Fig. 3A, T cells activated by BMDCs matured by REA produced significantly higher IFN-γ and lower IL-10 compared to T cells activated by BMDCs matured by other antigens.

[0114] In addition, transgenic OVA-specific CD4+ T cells isolated from OVA peptide-specific transgenic mice (B6.Cg-Tg(TcraTcrb)425Cbn / J) were stained with CFSE and co-cultured with DCs treated with REA (2 μg) or LPS (100 ng / ml) for 96 hours, then pulsed with OVA323-339 (1 μg / ml) to determine T cell proliferation using flow cytometry. As shown in Fig. 3B, REA-matured DCs effectively induced significant T cell proliferation. At this time, the concentrations of FNγ, IL-2, IL-17, and IL-4 in the culture supernatant under each condition were measured by ELISA, and as shown in Fig. 3C, IL-17, IL-2, and IFN-γ production were also significantly high.

[0115] Similar to the above REA, unstimulated DCs (control DCs) and DCs stimulated with Rv2299cD2D3 (5 μg / mL) or RRA (2 μg / mL) were co-cultured with naïve T cells for 72 hours (DC:T cell = 1:10). The production of IFNγ, TNF-α, and IL-17 in the culture supernatant was analyzed by ELISA and is shown in Fig. 4A. As shown in Fig. 4A, T cells activated by RRA-matured DCs produced high levels of IFN-γ and TNF-α. In addition, in experiments using transgenic mice, as shown in Figs. 4B and 4C, RRA-matured DCs induced T cell proliferation and Th17 and Th1 responses well, and induced the production of IL-17, IL-2, and IFNγ.

[0116]

[0117] 3. Activation of APCs through the TLR2 and TLR4 pathways

[0118] We analyzed the pathways by which the two proteins, REA and RRA, activate antigen-presenting cells (APCs). Several tuberculosis components have been reported to signal through the TLR2 or TLR4 pathway. Therefore, we confirmed the signaling pathway through which this fusion protein binds to TLRs present on the surface of BMDMs.

[0119] BMDM derived from wild-type (WT), TLR2- / -, and TLR4- / - mice were treated with REA (5 μg / mL), LPS (100 ng / mL), and the TLR2 agonist Pam3CSK4 (100 ng / mL) for 24 h. The production of TNF-α, IL-12, and IL-6 in the culture supernatant was determined using ELISA, and the results are shown in Fig. 5A. As shown in Fig. 5A, LPS, a TLR4 ligand, did not induce cytokine secretion in BMDM from TLR4-deficient mice, and Pam3, a TLR2 ligand, did not induce cytokine secretion in BMDM from TLR2-deficient mice. REA significantly, but not completely, suppressed cytokine secretion in BMDMs that did not express TLR2 or TLR4 compared to WT cells. This implies that at least TLR4 and TLR2 are simultaneously involved in REA-induced macrophage activation. Next, MAPK activity was confirmed by immunoblotting and is shown in Figs. 5B to 5E. As shown in Figs. 5B to 5E, REA-stimulated BMDM showed phosphorylation of p38 and ERK, and induced phosphorylation of glycogen synthase kinase-3β (GSK-3β), as well as PI3K and AKT. This suggests that REA induces macrophage activation through the PI3K-AKT signaling axis pathway, ultimately activating NF-κB.

[0120] In the same manner as described above, BMDMs derived from wild-type (WT), TLR2- / -, and TLR4- / - mice were treated with RRA (5 μg / mL), LPS (100 ng / mL), and the TLR2 agonist Pam3CSK4 (100 ng / mL) for 24 h. The production of TNF-α, IL-12, and IL-6 in the culture supernatant was confirmed using ELISA, and the results are shown in Fig. 6A. As shown in Fig. 6A, RRA, like REA, significantly suppressed cytokine secretion in BMDMs that do not express TLR2 or TLR4 compared to WT cells, but the suppression was not complete. This suggests that at least TLR4 and TLR2 are simultaneously involved in macrophage activation induced by RRA. In addition, immunoblotting results of phosphorylated-p38 (p-p38), p38, phospho-ERK1 / 2 (p-ERK1 / 2), ERK1 / 2, p-PI3K, P-PI3K, p-AKT, p-IκBα, IκBα and NFκB p65 in membrane fractions from BMDM and BMDC, and analysis of the intracellular localization of the p65 subunit of NF-κB detected by immunofluorescence, as shown in Figures 6B to 6D, confirmed that RRA also induced phosphorylation of p38, ERK, AKT, PI3K and ultimately NF-κB activation in both BMDM and BMDC.

[0121] Meanwhile, to confirm the effect of pharmacological inhibitors on the surface marker expression and cytokine production of BMDM of REA and RRA, BMDM (1 × 10 6 / well) were treated with pharmacological inhibitors of p38 (SB203580, 20 μM), ERK1 / 2 (U0126, 10 μM), and NF-κB (Bay11-7082, 5 μM) or DMSO (vehicle control) for 1 hour, and then treated with REA or RRA (5 μg / mL) for 24 hours. The results of measuring the levels of costimulatory surface markers (CD80, CD86) by flow cytometry and TNF-α and IL-6 in the culture supernatant by ELISA are shown in Figures 7A and 7B. As shown in Figures 7A and 7B, the production of inflammatory cytokines and the increase in surface molecule expression mediated by RRA and REA were inhibited to varying degrees by MAPKs inhibitors [SB203580 (p38 MAPK inhibitor), SP600125 (JNK inhibitor), U0126 (ERK1 / 2 inhibitor), BAY 11-7082 (NF-κB inhibitor), LY294002 (PI3K inhibitor)].

[0122]

[0123] 4. Antituberculosis activity of REA and RRA

[0124] Mycobacterium tuberculosis has the ability to survive and multiply in macrophages, which are phagocytic cells. Therefore, activating macrophages to induce the death of ingested bacteria is a crucial aspect of the anti-tuberculosis immune response. Therefore, we investigated whether REA or RRA stimulation could induce intracellular tuberculosis death in BMDMs infected with Mycobacterium tuberculosis.

[0125] BMDM(1×10 5Cells / well) were infected with H37Rv at a multiplicity of infection (MOI) of 1 for 4 h and treated with kanamycin for an additional 2 h. After washing three times to eradicate extracellular M. tuberculosis, the infected BMDMs were cultured with Rv2299c or REA (5 μg / mL) and LPS (100 ng / mL) for 72 h, and intracellular MTB growth was confirmed. As a result, stimulation of BMDMs infected with M. tuberculosis with REA for 72 h significantly inhibited intracellular M. tuberculosis growth compared to cells stimulated with LPS or Rv2299c (Fig. 8A).

[0126] Antigen presentation capacity during infection (in BMDM infected with H37Rv [MOI: 1]) was analyzed for the expression of surface molecules using two-color flow cytometry. BMDM cells were stained with F4 / 80+ antibody, while surface molecules were stained with anti-CD80, anti-CD86, anti-MHC class I, or anti-MHC class II antibodies. Each histogram in Figure 8B represents five representative experiments, and the bar graphs represent the percentage (mean ± SD of five experiments) of each surface molecule in F4 / 80+ cells. In addition, cytokine production in the culture supernatant was measured by ELISA and is shown in Figure 8C. As shown in Figures 8B and 8C, stimulation of BMDMs infected with M. tuberculosis with REA significantly enhanced the expression of surface molecules (MHC molecules, CD80, and CD86) and the production of inflammatory cytokines and CCL-2 chemokines compared to cells infected with M. tuberculosis. While these enhancement effects did not differ significantly between LPS and REA, IL-12 was significantly increased by REA stimulation compared to LPS (Figure 8C).

[0127] To confirm the effect of inhibiting intracellular bacterial proliferation by T cells matured by RRA and REA, BMDM (1 × 10 5Cells / well) were infected with H37Rv at a multiplicity of infection (MOI) of 1 for 4 hours and then treated with kanamycin for an additional 2 hours. After washing three times to eradicate extracellular bacilli, the cells were cultured for 72 hours and intracellular MTB growth was confirmed. As a result, as shown in Figure 9A, when RRA was treated with BMDMs infected with M. tuberculosis, intracellular bacterial growth was significantly inhibited compared to the cell culture control and Rv2299c. IL-12 production and surface molecule expression were also significantly increased, but there was no significant difference between Rv2299c and RRA (Figure 9B). In addition, when T cells matured with RRA or Rv299cD2D3, which constitutes RRA, were co-cultured with BMDMs infected with M. tuberculosis, intracellular bacterial growth was significantly inhibited compared to other conditions (Figure 9C). The inhibition effect of bacterial growth was better by T differentiated into RRA than by Rv299cD2D3. At this time, cytokines produced in the cell culture medium were also significantly higher, but there was no significant difference among LPS, Rv2299cD2D3, and RRA.

[0128] These results suggest that REA and RRA can overcome the inhibitory effect induced by tuberculosis infection and also induce appropriate activation of macrophages to eliminate engulfed tuberculosis bacilli.

[0129]

[0130] 5. Clarification of the anti-tuberculosis mechanism of action of REA

[0131] 5.1 REA induces early endosomal maturation by recruiting the P38-PI3K signaling pathway and effector molecules.

[0132] Phagosome maturation begins with the recruitment of Rab (Ras-associated protein) molecules to the phagosome membrane. To analyze this, BMDMs infected with red-fluorescent Mycobacterium tuberculosis (RFP-MTB) were stimulated with LPS, Rv2299c, and REA, stained with a green-fluorescent Rab5 antibody, and observed using confocal microscopy.

[0133] BMDMs were infected with red fluorescent protein-labeled H37Rv strain (RFP-MTB) (MOI-1) for 4 h. Subsequently, they were treated with LPS (100 ng / mL), Rv2299c (5 μg / mL), or REA (5 μg / mL) for 1 h on microscope coverslips. Cells were then stained with Ras-related protein 5 (Rab5), and endosomal colocalization was imaged by confocal microscopy, as shown in Figure 10A. The bar graph represents the colocalization ratio of Rab5. As shown in Figure 10A, colocalization of M. tuberculosis and Rab5 was significantly increased under REA stimulation compared to other conditions.

[0134] In the next step, we analyzed the location of Vps34 [vacuolar protein sorting 34, type III PI(3)K], which plays an important role in PI(3)P production and accumulation in the phagosome membrane. Using the same settings as above, cells were stained with anti-phosphoinositide 3-kinase vacuolar protein-sorting 34 (hVPS34). As shown in Fig. 10B, when stimulated with REA, co-localization of M. tuberculosis and Vps34 was significantly increased compared to other groups. Since this process is important for the recruitment of EEA1 (early endosomal antigen 1), the results of analyzing the location of EEA1 are shown in Fig. 10C. The bar graph represents the co-localization ratio of hVPS34 or EEA1 with phagosomes containing MTB. As shown in Figure 10C, REA stimulation increased the movement of EEA1 into the phagosome where tuberculosis bacteria are present.

[0135] PI3K and P38 play a crucial role in early endosome maturation. Therefore, we examined the time-dependent phosphorylation and total protein levels of class I PI3K and p38 MAPK signaling components by Western blot analysis. BMDM were treated with or without REA for 0.25, 0.5, 1, 2, and 6 h and infected with RFP-MTB [MOI=1]. Cell lysates were then collected and stained with antibodies to p-P38 MAPK, P38 MARK, p-PI3K, PI3K, and β-actin, and the results are shown in Figure 10D. As shown in Figure 10D, P38 was initially transiently phosphorylated only when infected with M. tuberculosis alone, but P38 was activated for a longer period when stimulated with REA. PI3K phosphorylation was not evident when infected with M. tuberculosis, but REA stimulation resulted in marked PI3K activation.

[0136] Additionally, BMDMs were pretreated with SB303580, a p38 inhibitor (10 μM), for 1 h and treated with REA (5 μg mL-1) during H37Rv infection. Cells were then stained with anti-EEA1, and MTB-containing phagosomes were observed by confocal microscopy for colocalization of the indicated markers, as shown in Figure 10E. As shown in Figure 10E, pretreatment with the p38-specific inhibitor significantly inhibited REA-induced colocalization of EEA1 with M. tuberculosis. Furthermore, intracellular bacterial growth was measured in MTB-infected BMDMs pretreated with SB303580 (10 μM) for 1 h before infection and treated with REA (5 μg / mL) or LPS (100 ng / mL), as shown in Figure 10F. As shown in Figure 10F, the REA-induced inhibition of M. tuberculosis growth was also lost.

[0137] 5.2 REA induces acidification of phagosomes and their fusion with lysosomes.

[0138] The next step in endosome maturation is the recruitment of Rab7, a late endosome-lysosome-associated small GTPase. Inhibition of Rab7 trafficking inhibits fusion of phagosomes with late endosomes. BMDM (1 × 10 6 / well) were infected with RFP-MTB [MOI: 1] for 4 h and treated with Rv2299c (5 μg / mL) or REA (5 μg / mL) for an additional 1 h. The cells were then stained with anti-Ras-associated protein 7 (RAB7), anti-lysosomal-associated membrane protein 1 (LAMP1), and Lyso Tracker™ Green DND-26, and phagosomes containing MTB were observed by confocal microscopy for co-localization of the indicated markers, as shown in Figures 11A to 11C. As shown in Figure 11A, stimulation with REA significantly increased the co-localization of Rab7 with phagosomes containing M. tuberculosis compared to other conditions. In addition, co-localization of lysosomal marker LAMP1 (lysosomal-associated membrane protein 1) with M. tuberculosis was also significantly increased upon REA treatment (Figure 11B). The acidified environment of late phagosomes fused with lysosomes was analyzed using pH-sensitive LysoTracker. LysoTracker, conjugated with a blue fluorophore, is weakly alkaline, allowing it to bind and persist in acidified organelles. As expected, colocalization of LysoTracker with M. tuberculosis was significantly increased by REA treatment compared to Rv2299c-rich cells (Fig. 11C).

[0139] BMDMs were infected with RFP-MTB [MOI: 1] for 4 h and pretreated with SB203580 p38 inhibitor or LY2940029 PI3K inhibitor for 1 h. Then, Rv2299c or REA was treated, and the colocalization of LAMP1 with M. tuberculosis was shown in Figures 11D and 11E. As shown in Figures 11D and 11E, pretreatment with p38 and PI3K inhibitors significantly suppressed the colocalization of LAMP1 increased by REA. These results imply that the fusion of phagosomes containing M. tuberculosis with lysosomes involves the p38-PI3K signaling pathway.

[0140]

[0141] 5.3 REA is intracellular Ca 2+ Inducing localization of EEA1 through increase

[0142] Intracellular Ca 2+ It acts as a variety of signaling molecules. In particular, it plays an important role in molecules involved in phagosome-lysosome fusion and NADPH oxidase activity. Fluo-4 / AM (dynamic single-wavelength fluorescent Ca 2+ Ca in BMDMs infected with Mycobacterium tuberculosis using a 2+ The concentration was measured. BMDM (1 × 10 6 / well) were infected with RFP-MTB [MOI: 1] for 4 h, and then loaded with calcium-sensing Fluo-4 / AM for 30 min. Subsequently, after treatment with REA (5 μg / mL) for 0, 1, 5, and 10 min, the colocalization of calcium was imaged using a confocal microscope and is shown in Fig. 12A. The bar graph represents the percentage of fluorescence intensity Fluo-4 / AM obtained from infected cells according to REA treatment. As shown in Fig. 12A, treatment with REA significantly reduced intracellular Ca 2+This increased and reached a peak at 5 minutes and then decreased. The same number of BMDMs as above were treated with BAPTA / AM, Ca 2+ After applying the chelator, the cells were treated with REA for 1 hour. Afterwards, the colocalization ratio of EEA1 was imaged using a confocal microscope and is shown in Figure 12B. The bar graph shows Ca 2+ The percentage of fluorescence intensity EEA obtained for infected cells following chelator treatment is shown. As shown in Figure 12B, pretreatment with the calcium chelator BAPTA inhibited the colocalization of EEA1 increased by REA. In addition, intracellular bacterial growth was measured 1 hour before infection following BAPTA / MA treatment, and is shown in Figure 12C. As shown in Figure 12C, pretreatment with the calcium chelator BAPTA also abolished the REA-induced inhibition of intracellular tuberculosis growth.

[0143]

[0144] 5.4 REA induces ROS production in cells infected with Mycobacterium tuberculosis

[0145] Reactive oxygen species (ROS) and nitric oxide (NO) are substances that mediate the death of intracellular bacteria. NADPH oxidase (NOX2) is an electron transport chain that transfers electrons from professional phagocytic cells to the phagosome to produce superoxide. Intracellular Ca 2+ The increase initiates the production of ROS and NO through NADPH oxidase activity in the phagosomal membrane.

[0146] BMDM (1 × 10 ) on 18 mm coverslips 6 / well) were infected with RFP-MTB [MOI: 1] for 4 hours and confirmed by dihydrodichlorofluorescein (DCDF 10 μM) fluorescence staining, as shown in Fig. 13A. As shown in Fig. 13A, although tuberculosis infection itself does not induce ROS production, REA treatment of cells infected with tuberculosis increased ROS in the phagosome. In addition, when NO levels were measured in the culture supernatant 72 hours after REA or LPS, treatment of cells infected with tuberculosis with REA also increased the concentration of NO released in the cell culture medium within the phagosome (Fig. 13B). Pretreatment with diphenyleneiodonium (DPI), a NOX enzyme inhibitor, significantly inhibited the localization of REA-induced ROS into phagosomes (Fig. 13C), and the same effect was observed when N-acetyl-L-cysteine ​​(NAC, 10 mM), a ROS scavenger, was treated (Fig. 13A). In addition, when intracellular bacterial growth was measured 1 h before infection, regardless of the presence or absence of NAC, the inhibitory effect of REA on intracellular mycosis was partially abolished by NAC (Fig. 13D).

[0147] In summary, the inhibition effect of REA on the proliferation of intracellular tuberculosis bacteria is due to the promotion of fusion and acidification of phagosomes and lysosomes, and ROS and NO are also involved, and P38-PI3K and Ca are involved in the induction of this reaction. 2+ This suggests that the signaling pathway is involved.

[0148]

[0149] 6. Clarification of the anti-tuberculosis mechanism of action of RRA

[0150] 6.1 RRA induces phagosome maturation through the P38-PI3K signaling pathway.

[0151] Similar to REA, RRA also inhibits intracellular tuberculosis proliferation. Therefore, BMDMs infected with tuberculosis (RFP-MTB) were stimulated with Rv2299c or REA, stained with green fluorescent Rab5 antibody, and observed by confocal microscopy.

[0152] BMDMs were infected with red fluorescent protein-labeled MTB H37Rv strain (RFP-MTB) (MOI-I) for 4 h and treated with RRA (5 μg / mL) or Rv2299c (5 μg / mL). The cells were stained with Ras-related protein 5 (RAB5) and imaged for endosomal colocalization using confocal microscopy, as shown in Fig. 14A . The bar graph represents the percentage of RAB5 colocalization induced by REA compared to Rv2299c and untreated controls. As shown in Fig. 14A , colocalization of M. tuberculosis and Rab5 was significantly increased under RRA stimulation compared to the other conditions.

[0153] In addition, to analyze the signal transduction pathway related to this, time-dependent phosphorylation and total protein levels of class I PI3K and p38 MAPK signaling components were examined by Western blot analysis. As shown in Fig. 14B, RRA significantly increased the phosphorylation of P38 and PI3K in BMDMs. Although the phosphorylation of PI3K was not evident in M. tuberculosis infection itself, PI3K activation was uniquely maintained in BMDMs infected with M. tuberculosis by RRA. In addition, the phosphorylation of P38 was transient by M. tuberculosis itself, but the activity was maintained continuously when RRA was treated. In addition, pretreatment with a P38 inhibitor (SB203580) and a PI3K inhibitor (LY294002) significantly inhibited the phosphorylation of P38 and PI3K induced by RRA (Fig. 14C), and pretreatment with a P38 inhibitor abolished the intracellular bacterial growth inhibition effect induced by RRA (Fig. 14D).

[0154] BMDM cells were infected with red fluorescent protein-labeled MTB H37Rv strain (RFP-MTB) ([MOI-I)) for 4 h and treated with RRA (5 μg / mL) or Rv2299c (5 μg / mL) for 1 h, followed by pretreatment with LY2940029 (20 μM) or SB203580 on a microscope cover glass, and stained with anti-hVPS34, anti-EEA1, anti-Rab7, or anti-LAMP1 antibodies and Lyso Tracker™ Green DND-26. Co-localization of endosomes was analyzed by confocal microscopy, as shown in Figures 15A to 15F. As shown in Figures 15A and 15B, the colocalization of class III PI3K hVPS4 and EEA1, which are the next effector molecules involved in phagosome maturation, with phagosomes containing M. tuberculosis was significantly increased in cells stimulated with RRA compared to untreated cells or cells stimulated with Rv2299c alone. Furthermore, this colocalization was significantly inhibited by pretreatment with LY294002, a PI3K inhibitor, and the RRA-induced inhibition of bacterial growth was also abolished (Figure 15C). In the next step, colocalization between Rab7, a late endosomal marker, and phagosomes containing M. tuberculosis was also significantly increased under RRA treatment compared to other conditions (Figure 15D). Taken together, these results suggest that RRA induces the maturation of phagosomes containing M. tuberculosis through the P38 and PI3K signaling pathways.

[0155] In addition, co-localization of LAMP1 (lysosomal-associated membrane protein 1), a lysosomal marker, with M. tuberculosis was significantly increased by RRA treatment (Fig. 15E). Analysis of the acidified environment of late phagosomes fused with lysosomes using pH-sensitive LysoTracker revealed that co-localization of LysoTracker with M. tuberculosis was significantly increased by RRA treatment compared to Rv2299c-rich cells, as shown in Fig. 15E. Furthermore, pretreatment with a P38 inhibitor significantly suppressed the RRA-induced co-localization of LAMP1. These results imply that the fusion of phagosomes containing M. tuberculosis with lysosomes involves the P38-PI3K signaling axis.

[0156]

[0157] 6.2 RRA induces ROS production in cells infected with Mycobacterium tuberculosis

[0158] Similar to REA, we analyzed whether RRA also induces ROS production. BMDM (1 × 10) in 18 mm coverslips infected with RFP-MTB [MOI: 1] for 4 h 6 / well) were stimulated with LPS or RRA for 4 h after pretreatment with NAC or DPI (10 μM). Thereafter, intracellular ROS levels were measured using a DCDF (10 μM) fluorescence-based assay, and the results are shown in Fig. 16A and Fig. 16B. As shown in Fig. 16A, stimulation of BMDMs infected with M. tuberculosis with RRA induced significantly higher ROS production compared to LPS, and pretreatment with DPI, a NOX enzyme inhibitor, completely inhibited ROS production. In addition, the increased ROS production when BMDMs infected with M. tuberculosis were treated with RRA was also inhibited by pretreatment with NAC (Fig. 16B). In addition, although nitrite in the cell culture medium was not increased by M. tuberculosis or RRA alone, treatment of cells infected with M. tuberculosis with RRA significantly increased nitrite production (Fig. 16C). Furthermore, when intracellular bacterial growth was measured in RRA- or LPS-treated BMDMs pretreated with NAC 1 hour before infection, the inhibitory effect of RRA on intracellular tuberculosis proliferation was abolished by NAC pretreatment (Fig. 16D). Furthermore, as shown in Fig. 16E, the increased p38 and PI3K activities, which were observed when BMDMs or BMDMs infected with tuberculosis were treated with RRA, were suppressed by DPI pretreatment.

[0159]

[0160] 6.3 Increased intracellular Ca by RRA 2+ Induces localization of hVPS34 and EEA1

[0161] Like REA, RRA also regulates intracellular Ca 2+ We analyzed whether Fluo-4 / AM (dynamic single-wavelength fluorescent Ca) could induce an increase in 2+ Ca in BMDMs infected with Mycobacterium tuberculosis using a 2+ The concentration was measured. BMDM (1 × 10 6 / well) were infected with RFP-MTB [MOI: 1] for 4 h and loaded with calcium-sensing Fluo-4 / AM for 30 min. After treatment with RRA (5 μg / mL) for the indicated periods, the co-localization of calcium was imaged using a confocal microscope and is shown in Fig. 17A. The bar graph represents the percentage of fluorescence intensity Fluo-4 / AM obtained for infected cells. As shown in Fig. 17A, treatment with RRA induced intracellular Ca 2+ This increased at 1 min, reached a peak at 5 min, and then decreased. Furthermore, pretreatment of infected BMDM with the calcium chelator BAPTA / AM inhibited the colocalization of hVPS4 and EEA1, a class III PI3K increased by RRA (Fig. 17B). Furthermore, the RRA-induced inhibition of intracellular tuberculosis growth was abolished, and pretreatment with BAPTA increased intracellular bacterial growth in both cell culture medium control and LPS-treated conditions (Fig. 17C).

[0162] Ca in the mechanism of ROS production 2+ It is known that signaling through RRA is involved. Pretreatment with BAPTA in BMDM infected with RFP-MTB significantly inhibited the colocalization of ROS produced by RRA with phagosomes containing M. tuberculosis (Fig. 17D). In addition, pretreatment with DPI, a NOX enzyme inhibitor, significantly inhibited the Ca increase by RRA. 2+ The co-localization of Ca was also significantly inhibited (Fig. 17E). These results indicate that Ca is involved in phagosome maturation induced by RRA. 2+ It can be seen that the signal is related and is deeply connected to the signaling pathway by ROS.

[0163]

[0164] 7. Evaluation of vaccine efficacy by REA and RRA

[0165] The present inventors have demonstrated that dendritic cells matured by the Rv2299c protein effectively induce T cell activity capable of killing intracellular tuberculosis bacteria, and that the Rv2299c-ESAT6 fusion protein has excellent BCG booster vaccine efficacy (PMID: 28193909). In addition, we observed that Rv2299c-Ag85B-ESAT6, which is a fusion protein of Rv2299c to the Ag85B-ESAT6 fusion protein, increased the vaccine efficacy of Ag85B-ESAT6 in a short-term vaccine evaluation mouse model (evaluation 3 weeks after challenge test) (PMID: 33105734). The present inventors obtained preliminary results that, when constructing various fusion proteins, vaccine efficacy is superior when other proteins are inserted later than between Rv2299c-ESAT6. Based on these results, the order of antigen linkage was changed to construct the Rv2299c-ESAT6-Ag85B fusion protein, and finally, since a smaller molecular weight is advantageous for commercialization, the Rv2299cD2D3-ESAT6-Ag85B fusion protein REA was constructed by linking ESAT6-Ag85B to Rv2299cD2D3, which lacks the N-terminal (D1 region) of Rv2299c. In addition, the Rv2299cD2D3-Rv3463-Ag85B fusion protein RRA was constructed using Rv3463 instead of the ESAT6 antigen, which is used as a stimulating antigen in the IGRA test, which is widely used instead of the tuberculin skin test.

[0166] The above REA and RRA can effectively enhance Th1 and Th17 responses to epitopes contained in each fusion protein through activation of dendritic cells as well as macrophages, which may have vaccine efficacy as a prime vaccine rather than a BCG booster vaccine. Since it is known that subunit vaccines cannot replace the prime vaccine BCG, if REA and RRA can become prime vaccines that can replace BCG as subunit vaccines, they can be developed as vaccines for infants as well as adults.

[0167] In the above anti-tuberculosis activity assay, REA and RRA demonstrated similar effects and were able to simultaneously activate dendritic cells and macrophages. Therefore, the aim was to verify whether REA and RRA could increase anti-tuberculosis activity by simultaneously activating these cells.

[0168] First, BCG-vaccinated mice were sacrificed 4 weeks after vaccination, and the spleen was removed, from which CD4 + T cells were isolated. The CD4 + T cells were treated with REA-treated DCs (1×10 5 / well), REA-treated macrophages (1 × 10 5 / well), or REA-treated DC (5×10 4 / well) and macrophages (5×10 4 / well) were treated at an APC:T cell ratio of 1:10 for 72 hours, and cytokines in the cell supernatant were measured by ELISA, and the results are shown in Fig. 18A. As shown in Fig. 18A, the concentrations of TNF-α, IFN-γ, IL-2, and IL-17 produced by T cells simultaneously activated by two types of APCs (macrophages and dendritic cells) were significantly higher compared to T cells activated by macrophages or dendritic cells activated by REA. After co-culturing for 3 days in the same manner as above, T cells were harvested and co-cultivated with BMDM infected with MTB for 72 hours, and bacteria in BMDM were measured, and the results are shown in Fig. 18B, and cytokines in the culture supernatant were measured, and the results are shown in Fig. 18C. As shown in Fig. 18B, when these T cells were added to macrophages infected with Mycobacterium tuberculosis, the inhibitory effect on intracellular bacterial growth was significantly higher. Additionally, the production of TNF-α, IFN-γ, and IL-17 at this time was significantly increased compared to when T cells activated by a single APC were added (Figure 18C).

[0169] Next, we analyzed whether the fusion of Rv2299cD2D3 could increase the ability to induce immune responses to Ag85B and ESAT6 in vivo. As shown in Figure 19A, mice were randomly divided into five groups and immunized once with G0; saline, G1: Rv2299cD2D3_DDA / MPL, G2: ESAT6_DDA / MPL, G3: Ag85B_DDA / MPL, G4: REA_DDA / MPL. After 6 weeks, the mice were sacrificed and splenocytes were isolated. DDA / MPL was used as an immune adjuvant. The cytokines IFN-γ and TNF-α produced by restimulating the isolated splenocytes with each immune antigen were measured, and the results are shown in Figure 19B. As shown in Figure 19B, when immunized with REA, compared to when immunized with a single antigen, it was confirmed that IFN-γ and TNF-α increased for all stimulated antigens except Rv2299c antigen, indicating an enhanced T cell response. The above results imply that REA and RRA, which activate both types of APCs, can effectively induce anti-tuberculosis responses, and Rv2299cD2D3 can increase T cell responses to other antigens that constitute REA.

[0170] Because REA and RRA exhibit similar antituberculosis activities, their vaccine potential was evaluated using a mouse infection model using the H37Ra strain, a weakly pathogenic tuberculosis strain, utilizing REA. The vaccine efficacy of REA and the Rv2299c-ESAT6 and Rv2299cD2D3-ESAT6 fusion proteins, which constitute the REA fusion protein, was compared and analyzed.

[0171] As shown in Figure 20A, mice were divided into 6 groups of 5 each and immunized with G1: saline (PBS), G2: adjuvant alone (DDA / MPL), G3: BCG alone, G4: Rv2299c-ESAT6_DDA / MPL, G5: Rv2299cD2D3-ESAT6_DDA / MPL, and G6: REA_DDA / MPL, and 6 weeks after the final immunization, H37Ra tuberculosis bacilli (1×106 A challenge test was conducted by directly injecting 100 CFU / mouse into the trachea. Fourteen weeks after infection, the mice were sacrificed, the lungs and spleen were removed, and cells were isolated. Afterwards, lung cells (2.0 × 10 6 ) were stimulated with each antigen (5 μg / ml) for 12 hours at 37°C in the presence of GolgiStop, and bacterial counts and immunoassays were performed. As shown in Fig. 20B, no significant vaccine efficacy was observed with saline, adjuvant alone (DDA / MPL), BCG alone, Rv2299c-ESAT6_DDA / MPL, and Rv2299cD2D3-ESAT6_ DDA / MPL. However, tuberculosis bacilli were not detected in the lungs of mice immunized with REA except for one lung, and no bacteria were detected in the spleens of any mice. This indicates that sterilizing immunity, which eliminates the infection, was induced.

[0172] The immunological factor reported to be related to vaccine efficacy is INF-γ. + IL-2 + TNF-α + CD4 + T cells and IL-2 + TNF-α + CD4 + It is known to be proportional to the number of T cells. As a result of analyzing antigen-specific multifunctional T cells, as shown in Figure 20C, when lung and spleen cells were re-stimulated with ESAT6 and REA, INF-γ + IL-2 + TNF-α + CD4 + T cell counts were significantly increased in mice immunized with REA compared to other antigen-immunized groups (also shown in Figure 21). When lung cells were restimulated with antigen, IL-2 + TNF-α + CD4 +The number of T cells significantly increased when immunized with the fusion protein (Fig. 20C), but there was no significant difference in the spleen (Fig. 21). Similarly, the results of measuring the cytokines INF-γ, IL-2, TNF-α, and IL-17 produced by restimulating lung, spleen, and lymph node cells with antigen are shown in Figs. 22 and 23. As shown in Figs. 22 and 23, when immunized with the fusion antigen containing Rv2299c, the production was much higher than that of the BCG or infected control group, and in particular, there was no significant production of IL-2 and IL-17 in mice vaccinated with only BCG or an adjuvant. In summary, when immunized with REA, no bacteria were detected in the lungs and spleen, and the memory immune cell response was well maintained for up to 14 weeks after the challenge test, especially INF-γ. + IL-2 + TNF-α + CD4 + It was confirmed that the number of T cells was proportional to the vaccine efficacy of REA.

[0173] Finally, the protective efficacy of REA and RRA was evaluated in a mouse model using the pathogenic H37Rv tuberculosis strain. As shown in Fig. 24A, immunization was performed, and a challenge test with tuberculosis bacteria was performed 6 weeks after the final immunization. The number of tuberculosis bacteria in the lungs and spleen was measured at 6 and 16 weeks after the challenge test, and the results are shown in Fig. 24B. At 6 weeks after the challenge test, the number of bacteria in the lungs and spleen of mice immunized with REA or RRA was significantly reduced compared to the adjuvant control group. At 16 weeks after the challenge test, BCG and the adjuvant did not show any protective efficacy, but surprisingly, no bacteria were detected in the lungs and spleen of all mice immunized with the two types of vaccines, confirming that they induced bactericidal immunity that killed tuberculosis bacteria by more than 99% and 100%, respectively.

[0174] The histopathological findings also showed results that could overturn the above-mentioned bacterial count results. Lung tissues were stained with MT (Masson's trichrome) and AFB (Acid-Fast Bacillus) 6 or 16 weeks after challenge, and are shown in Fig. 24C. As shown in Fig. 24C, after 6 and 16 weeks, a large number of tuberculosis bacilli stained with blue dots were detected in the control group, but in the lungs of mice vaccinated with REA or RRA vaccines, fewer tuberculosis bacilli were observed compared to the control group after 6 weeks, and almost no bacteria were observed after 16 weeks. Analysis of the granulomatous lesion area in the lung tissue using an image program also showed that the lesion area was significantly reduced in mice vaccinated with REA or RRA vaccines compared to the control group (Fig. 22D). Finally, lung and spleen cells obtained 6 and 16 weeks after the challenge test were isolated and added to BMDMs infected with Mycobacterium tuberculosis. The inhibitory effect on intracellular tuberculosis proliferation was measured, as shown in Figure 22E. As shown in Figure 22E, only lung and spleen cells from mice immunized with REA significantly inhibited intracellular tuberculosis proliferation. This result demonstrates that the anti-tuberculosis efficacy of immunized mice is maintained.

[0175] In conclusion, no tuberculosis vaccine, including live attenuated vaccines, has been reported to induce sterilizing immunity that clears infection in a mouse model. Furthermore, it is currently known that no protein-based vaccine can replace BCG. However, the REA and RRA vaccines are subunit vaccines that induce immune responses that clear infection to a level where bacteria are undetectable in mouse tissues. Therefore, they can be used as adult tuberculosis vaccines regardless of BCG vaccination. Furthermore, they have been confirmed to be a viable alternative to BCG as subunit vaccines.

[0176] Attach an electronic file of the sequence list

Claims

1. A tuberculosis vaccine composition comprising a Rv2299cD2D3-ESAT6-Ag85B(REA) fusion protein.

2. In paragraph 1, A tuberculosis vaccine composition, characterized in that the above Rv2299cD2D3-ESAT6-Ag85B(REA) fusion protein is encoded by the base sequence of sequence number 1.

3. In paragraph 1, A tuberculosis vaccine composition characterized in that the above Rv2299cD2D3-ESAT6-Ag85B(REA) fusion protein comprises the amino acid sequence of sequence number 2.

4. A tuberculosis vaccine composition comprising a Rv2299cD2D3-Rv3463-Ag85B (RRA) fusion protein.

5. In paragraph 4, A tuberculosis vaccine composition, characterized in that the above Rv2299cD2D3-Rv3463-Ag85B (RRA) fusion protein is encoded by the base sequence of sequence number 3.

6. In paragraph 4, A tuberculosis vaccine composition, characterized in that the above Rv2299cD2D3-Rv3463-Ag85B (RRA) fusion protein comprises the amino acid sequence of sequence number 4.

7. In any one of paragraphs 1 to 6, The above-mentioned tuberculosis vaccine composition is a tuberculosis vaccine composition characterized in that it induces sterilization of tuberculosis bacteria by 99% or more.

8. A recombinant polynucleotide for tuberculosis sterilization immunity comprising the base sequence described in sequence number 1 or 3.

9. A recombinant polypeptide for bactericidal immunity against tuberculosis comprising the amino acid sequence set forth in sequence number 2 or 4.

Citation Information

Patent Citations

  • Maturation compositions of dendritic cell containing the Rv2299c protein or Rv2299c fused ESAT-6 protein

    KR101749165B1

  • Boosting composition for BCG vaccine comprising Rv2299c-ESAT6-HspX-RipA fusion protein

    KR102193304B1

  • M. tuberculosis vaccines

    WO2014063704A2

  • KR20200065257A