Composition for treating or preventing recurrence of chondrosarcoma comprising SIRT1 inhibitor

The use of a SIRT1 inhibitor in a pharmaceutical composition addresses the resistance of chondrosarcoma to conventional therapies by inhibiting tumor growth and recurrence, and offers a diagnostic and prognostic approach by measuring SIRT1 expression levels.

WO2025121958A1PCT designated stage expired Publication Date: 2025-06-12SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/019998
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-07
Filing Date
2024-12-06
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Chondrosarcoma is highly resistant to radiation therapy and drug therapy due to its thick extracellular matrix, leading to frequent recurrence and progression of tumors, with no effective targeted therapy demonstrated in clinical settings.

Method used

A pharmaceutical composition comprising a SIRT1 inhibitor, such as EX527 or shRNA targeting SIRT1, is used to treat or prevent the recurrence of chondrosarcoma, potentially in combination with doxorubicin or other inhibitors like NAMPT and NAPRT inhibitors.

Benefits of technology

The SIRT1 inhibitor composition effectively inhibits tumor growth and recurrence of chondrosarcoma, exhibiting a synergistic effect when combined with existing chemotherapeutic agents, and provides a diagnostic and prognostic tool by measuring SIRT1 expression levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024019998_12062025_PF_FP_ABST
    Figure KR2024019998_12062025_PF_FP_ABST
Patent Text Reader

Abstract

The present specification relates to a composition for treating or preventing recurrence of chondrosarcoma, and a composition for diagnosing or predicting prognosis of chondrosarcoma. More specifically, i) the composition for treating or preventing recurrence of chondrosarcoma according to one aspect comprises a SIRT1 inhibitor (e.g., EX527, shRNA, nicotinamide), and thus can inhibit chondrosarcoma (or a tumor thereof) and, particularly when used in combination with a commercially available anticancer therapeutic agent (e.g., doxorubicin), can exhibit a synergetic effect in treating chondrosarcoma, and ii) the composition for diagnosing or predicting the prognosis of chondrosarcoma can diagnose chondrosarcoma with high accuracy or predict the prognosis of chondrosarcoma by measuring the expression levels of one or more selected from the group consisting of SIRT1, NAMPT, and NAPRT.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for treating or preventing recurrence of chondrosarcoma comprising a SIRT1 inhibitor

[0001] Cross-reference to related applications

[0002] This application claims priority to Republic of Korea Patent Application No. 10-2023-0176277, filed December 7, 2023, the entire contents of which are incorporated herein by reference.

[0003] The present specification relates to a pharmaceutical composition for treating or preventing recurrence of chondrosarcoma, a composition for diagnosing or predicting the prognosis of chondrosarcoma, and a composition for screening for a chondrosarcoma inhibitory substance.

[0004] [National Research and Development Project Supporting This Invention]

[0005] [Project ID]1711186354

[0006] [Task Number] 2023R1A2C3003864

[0007] [Ministry Name] Ministry of Science and ICT

[0008] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0009] [Research Project Name] Individual Basic Research (Ministry of Science and ICT)

[0010] [Research Project Name] Study on the liver-joint transport pathway of trace element selenium and the mechanism of cell aging and degenerative arthritis caused by abnormal selenium metabolism in cartilage cells.

[0011] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0012] [Research Period] March 1, 2023 - February 28, 2027

[0013]

[0014] [National Research and Development Project Supporting This Invention]

[0015] [Project ID]2710018412

[0016] [Project Number] RS-2024-00440273

[0017] [Ministry Name] Ministry of Science and ICT

[0018] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0019] [Research Project Name] Biomedical Technology Development

[0020] [Research Project Name] Biomarker Identification and Development of Rare Cancer Metabolic Targeting Treatment Technologies through the Construction of Standardized Sarcoma Big Data

[0021] [Name of the project performing organization] Ewha Womans University

[0022] [Research Period] July 1, 2024 - December 31, 2024

[0023]

[0024] Chondrosarcoma is the third most common tumor of bone and soft tissue and the most common bone and soft tissue tumor in adults. While surgical resection, radiotherapy, and chemotherapy are commonly used to treat chondrosarcoma, chondrosarcoma is highly resistant to these treatments. For example, chondrosarcoma has a thick extracellular matrix, making it difficult to effectively deliver commonly used chemotherapeutic agents, such as doxorubicin and cisplatin, making it difficult to expect a complete anticancer effect from chemotherapy. Consequently, patients with chondrosarcoma frequently relapse even after surgery and adjuvant therapy, and recurrent tumors are often more malignant than the original tumor. However, to date, no clinical trial has demonstrated the efficacy of targeted therapy for chondrosarcoma, and survival rates for chondrosarcoma have not improved significantly over the past several decades.

[0025] Furthermore, chondrosarcomas exhibit a wide range of differentiation levels, and the current diagnostic method, which relies on tissue biopsy, has limitations, resulting in diagnostic variability among specialists. To address this, there is a need to identify targets for the treatment, diagnosis, and prognosis of chondrosarcoma.

[0026]

[0027] One aspect of the present disclosure is to provide a pharmaceutical composition for treating or preventing recurrence of chondrosarcoma.

[0028] One aspect of the present disclosure is to provide a composition for screening a substance for treating chondrosarcoma.

[0029] One aspect of the present disclosure is to provide a composition for diagnosing or predicting the prognosis of chondrosarcoma.

[0030] One aspect of the present disclosure is to provide a prognostic prediction system for chondrosarcoma.

[0031]

[0032] A pharmaceutical composition for treating or preventing recurrence of chondrosarcoma according to one aspect of the present specification comprises a SIRT1 (Sirtuin 1) inhibitor.

[0033] In one embodiment, the SIRT1 inhibitor may be EX527, a salt thereof, a hydrate thereof, or a solvate thereof; nicotinamide, a salt thereof, a hydrate thereof, or a solvate thereof; or an shRNA represented by SEQ ID NO: 1.

[0034] In one embodiment, the pharmaceutical composition may be administered in combination with doxorubicin.

[0035] In one embodiment, the pharmaceutical composition may further comprise doxorubicin.

[0036] In one embodiment, the pharmaceutical composition may further comprise at least one of a NAMPT (nicotinamide phosphoribosyltransferase) inhibitor or a NAPRT (nicotinate phosphoribosyltransferase) inhibitor.

[0037] In one embodiment, the NAMPT inhibitor may be FK866, and the NAPRT inhibitor may be 2-Hydroxynicotinic Acid.

[0038] In one embodiment, the pharmaceutical composition may inhibit tumor growth of chondrosarcoma.

[0039] A composition for screening a substance for treating chondrosarcoma according to one aspect of the present specification comprises an agent for measuring the expression level of a SIRT1 gene; or an agent for measuring the activity of a SIRT1 protein.

[0040] A composition for screening a substance for treating chondrosarcoma according to one aspect of the present specification may further include an agent for measuring the expression level of one or more genes of NAMPT or NAPRT; or an agent for measuring the activity of one or more proteins of NAMPT or NAPRT.

[0041] A composition for diagnosing or predicting the prognosis of chondrosarcoma according to one aspect of the present specification comprises a preparation for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT.

[0042] In one embodiment, the agent for measuring the expression level of the gene may be at least one of an agent for measuring the amount of mRNA of the gene and an agent for measuring the amount of protein expressed from the gene.

[0043] In one embodiment, the agent for measuring the amount of mRNA of the gene may be a primer pair or probe that specifically binds to mRNA or cDNA of the gene.

[0044] In one embodiment, the agent for measuring the amount of protein expressed from the gene may be an antibody or aptamer specific for the protein expressed from the gene.

[0045] A system for predicting the prognosis of chondrosarcoma according to one aspect of the present disclosure includes: a data storage unit storing expression level data of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT measured from a sample isolated from a chondrosarcoma patient; and a data analysis unit determining that the prognosis of the chondrosarcoma patient is poor if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT stored in the data storage unit is equal to or higher than a predetermined value or higher than that of a normal group.

[0046] In one embodiment, the data analysis unit may predict that the chondrosarcoma patient will die within 5 years if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT stored in the data storage unit is equal to or higher than a predetermined value or higher than that of a normal group.

[0047]

[0048] A pharmaceutical composition for treating or preventing recurrence of chondrosarcoma according to one aspect of the present disclosure can suppress chondrosarcoma (or tumor growth thereof) by inhibiting SIRT1, and in particular, can exhibit a synergistic effect in the treatment of chondrosarcoma when used in combination with commercially available anticancer agents (e.g., doxorubicin, cisplatin). The composition and method according to the present disclosure can effectively reduce tumors, recurrence, etc. of chondrosarcoma by regulating SIRT1 during the development of chondrosarcoma. In addition, the present inventors confirmed the effect of inhibiting chondrosarcoma growth and recurrence by SIRT1 inhibition in in vivo and in vitro experiments using EX527 (CAS number 49843-98-3) and SIRT1 shRNA (SEQ ID NO: 1: TTCTGGTGAACTTGAGTCT) as examples of SIRT1 inhibitors.

[0049] A composition for diagnosing or predicting the prognosis of chondrosarcoma according to one aspect of the present specification can easily and accurately diagnose chondrosarcoma or predict the prognosis of chondrosarcoma by measuring the expression level of SIRT1 and / or SIRT1-related biomarkers (e.g., NAMPT, NAPRT).

[0050] A composition for screening a chondrosarcoma inhibitory substance according to one aspect of the present specification can screen a substance for treating chondrosarcoma that exhibits excellent efficacy by measuring the level of SIRT1 expression or the activity of SIRT1.

[0051]

[0052] Figures 1a to 1i show that SIRT1, which interacts with HIF-2α, is associated with chondrosarcoma malignancy.

[0053] Figure 1a is a representative image of hematoxylin and eosin (H&E) and safranin-O histological staining and immunohistochemical (IHC) staining for SIRT1 expression in normal cartilage and chondrosarcoma biopsies.

[0054] Figure 1b shows the quantitative analysis of SIRT1 expression in normal cartilage (n = 5) and chondrosarcoma biopsies of various grades: grade I (G1) (n = 15), grade II (G2) (n = 24), grade III (G3) (n = 49), and dedifferentiated (Dediff) (n = 5).

[0055] Figure 1c shows a GSEA plot for the 'M1' module gene set using RNA sequencing (RNA-seq) data from SW1353 cells transduced with SIRT1 shRNA compared to cells transduced with control shRNA.

[0056] Figures 1d and 1e show the results of IPA disease and function analysis (Figure 1d) and upstream regulator analysis (Figure 1e) performed on the DEGs determined by comparing the transcriptomes of SW1353 cells introduced with SIRT1 and control shRNA. The top 10 annotations and top 20 upstream regulators were -log 10 (p value) is displayed in order.

[0057] Figure 1f shows a GSEA plot for the HIF-2α target gene set in RNA-seq data from SW1353 cells transduced with SIRT1shRNA compared to cells transduced with control shRNA.

[0058] Figure 1g shows the Pearson correlation between the H-index of HIF-2α and SIRT1 in normal cartilage (n = 5) and chondrosarcoma biopsies (n = 69).

[0059] Figure 1h shows in situ PLA to detect the interaction between endogenous SIRT1 and HIF-2α in SW1353 (top) and JJ012 (bottom) cells. The red signal indicates the interaction between endogenous SIRT1 and HIF-2α. DAPI was used as a nuclear counterstain.

[0060] Figure 1i shows the results of co-immunoprecipitation (coIP) of endogenous SIRT1 and HIF-2α in SW1353 and JJ012 cells. MW indicates molecular weight.

[0061] The scale bar in Figure 1a is 50 μm, and in Figure 1h, it is 25 μm. The data in Figure 1b are expressed as the mean ± SEM. Significance was assessed using the Kruskal-Wallis test followed by Dunn's multiple comparison test. Normalized enrichment scores (NES) and nominal p values ​​in Figures 1c and 1f are as indicated. Significance in Figures 1d and 1e was determined using the right-tailed Fisher's exact test. In Figure 1g, R and p values ​​were calculated using the two-tailed Pearson correlation.

[0062] Figures 2a to 2q show that SIRT1 amplifies HIF-2α transcriptional activity and promotes chondrosarcoma growth in a tumor xenograft mouse model.

[0063] Figure 2a is a representative immunofluorescence (IF) staining image for HIF-2α and FLAG tag in SW1353 cells transfected with SIRT1-FLAG overexpression vector.

[0064] Figure 2b shows the results of hypoxia response element (HRE) luciferase reporter assays after transfection with empty vector or SIRT1-FLAG overexpression vector in HIF-2α overexpressing SW1353 (n = 4) and JJ012 (n = 4) cells.

[0065] Figure 2c shows the results of Western blot analysis of HIF-2α and SIRT1 expression in lysates of SW1353 and JJ012 cells transduced with control (Ctrl) or SIRT1shRNA lentivirus.

[0066] Figure 2d shows the results of HRE luciferase reporter analysis after transfection with Ctrl or SIRT1shRNA vectors in SW1353 (n = 3) and JJ012 (n = 4) cells overexpressing HIF-2α.

[0067] Figure 2e shows the immunoblot results of HIF-2α in SW1353 and JJ012 cell lysates after EX527 treatment.

[0068] Figure 2f shows EPAS1 or EPAS1 after treatment with DMSO or EX527 at the indicated doses. K3R Results of HRE luciferase reporter assay in SW1353 (n = 6, left) and JJ012 (n = 7, right) cells transfected with overexpression vectors.

[0069] Figure 2g shows FLAG-SIRT1 or FLAG-SIRT1 in SW1353 cells. H363Y IP of HA-HIF-2α using . Hemagglutinin (HA)-tagged proteins were pulled down using an anti-HA tag antibody. Acetylated HIF-2α proteins were immunoblotted using an anti-acetyl lysine antibody. Equal loading of samples was confirmed using actin.

[0070] Figure 2h shows HIF-2a after treatment with the indicated doses of DMSO or EX527. P2A Results of HRE luciferase reporter assay in SW1353 and JJ012 cells transfected with overexpression vectors (n = 4).

[0071] Figure 2i shows FLAG-HIF-2α and FLAG-HIF-2α including HA-PHD1, -PHD2, and -PHD3 in HEK293T cells. K3R The IP of FLAG-tagged proteins was pulled down using anti-FLAG tag antibody. Exogenous PHD1, PHD2, and PHD3 proteins were immunoblotted using anti-HA tag antibody. Cells were treated with 100 μM EX527 or DMSO for 6 h after transfection.

[0072] Figure 2j shows representative images and quantitative results of colony formation assays by SW1353 cells transduced with Ctrl or EPAS1shRNA and Ctrl or SIRT1 overexpressing lentivirus.

[0073] Figure 2k shows representative H&E stained images (top) showing intramedullary chondrosarcoma tumors in the tibia following orthotopic xenografting of SW1353 cells harboring the indicated shRNA. Sham surgery, which included all procedures except cell transplantation, was performed as a control. Representative histological results (bottom) showing the extent of local growth of the transplanted cells into the surrounding muscle. EP is the epidermal plate; T is the tumor; B is the bone; and BM is the bone marrow.

[0074] Figure 2l is a 3D reconstructed image obtained from micro-computed tomography (μCT) scans of the leg that underwent sham surgery and the leg with the tumor. The yellow arrow indicates an osteolytic lesion caused by tumor growth.

[0075] Figure 2m shows the proportion of mice with outgrowths originating from the intramedullary area and infiltrating into surrounding muscle (top) and a representative H&E image (bottom).

[0076] Figures 2n and 2o are representative IF staining images and quantification results of Ki-67 positive cells (n = 4) (Figure 2n) and TUNEL positive cells (n = 4) (Figure 2o) in orthotopic xenograft tissues of SW1353 cells transduced with Ctrl or SIRT1shRNA.

[0077] Figure 2p shows tumor growth of JJ012 tumors harboring Ctrl or SIRT1shRNA in a subcutaneous xenograft model (n = 7).

[0078] Figure 2q shows the gross images (n = 7, left) and weights (n = 7, right) of resected JJ012 tumors at the end of the experiment.

[0079] The scale bars are 25 μm in Fig. 2a, 500 μm (top) and 50 μm (bottom) in Fig. 2k, 100 μm in Fig. 2m, 50 μm in Fig. 2n and Fig. 2o, and 10 mm in Fig. 2q. The data in Figs. 2b, 2d, 2f, 2h, 2j, and 2n to 2q are expressed as mean ± SEM. Significance was assessed using a two-way ANOVA followed by Tukey's post hoc test. The images in Figs. 2k to 2m represent one of six experimental replicates. Significance in Figs. 2n, 2o, and 2q was assessed using a two-tailed Student's t-test. Significance in Fig. 2p was assessed using a two-way ANOVA followed by a Sidak post hoc test.

[0080] Figures 3a to 3m show that SIRT1 is required for the survival of chondrosarcoma cells by NAD + We demonstrate that metabolism and HIF-2α activation are coupled.

[0081] Figure 3a shows the relative NAD in SW1353 cells in the presence or absence of glucose (Glc) for 24 hours. + / NADH ratio (n = 6) is shown.

[0082] Figure 3b shows the results of Western blot analysis of HIF-2α in lysates of SW1353 cells after treatment with the indicated Glc concentrations for 24 hours.

[0083] Figure 3c shows the results of Western blot analysis of SIRT1 and HIF-2α in lysates of SW1353 and JJ012 cells transduced with Ctrl or SIRT1shRNA lentivirus after Glc depletion.

[0084] Figure 3d shows flow cytometry analysis of Zombie Aqua staining to identify dead cell populations in SW1353 (n = 4) and JJ012 (n = 4) cells transduced with Ctrl or SIRT1shRNA lentiviruses in the presence or absence of Glc.

[0085] Figure 3e shows Western blot analysis of SIRT1, Bcl-2, and cleaved PARP in lysates of SW1353 and JJ012 cells transduced with Ctrl or SIRT1shRNA lentiviruses after glucose (Glc) deprivation. Actin was used to confirm equal loading of samples.

[0086] Figure 3f shows Western blot analysis of HIF-2α and cleaved PARP expression in lysates of SW1353 cells treated with EX527 or DMSO for 12 h in the presence or absence of Glc. Equal loading of samples was confirmed using actin.

[0087] Figure 3g shows flow cytometric analysis of Zombie Green staining to identify dead cell populations in SW1353 (n = 4) and JJ012 (n = 4) cells treated with EX527 or DMSO for 12 h in the presence or absence of Glc.

[0088] Figure 3h shows RT-qPCR analysis of relative BCL2 and BCL2L1 mRNA levels in SW1353 (n = 5) and JJ012 (n = 6) cells treated with EX527 or DMSO for 12 h in the presence or absence of Glc.

[0089] Figure 3i shows Western blot analysis of HIF-2α and cleaved PARP in lysates of SW1353 and JJ012 cells transduced with Ctrl or EPAS1 shRNA. Equal loading of samples was confirmed using actin.

[0090] Figure 3j shows flow cytometric analysis results of Zombie Aqua staining to identify dead cell populations after Glc depletion in SW1353 (n = 4) and JJ012 (n = 7) cells transduced with Ctrl or EPAS1 shRNA lentiviruses.

[0091] Figure 3k shows RT-qPCR analysis of relative BCL2 and BCL2L1 mRNA levels in SW1353 (n = 4) and JJ012 (n = 4) cells transduced with Ctrl or EPAS1 shRNA lentiviruses after Glc depletion.

[0092] Figure 3l shows Ctrl or EPAS1 or EPAS1 after Glc depletion, after treatment with EX527 or DMSO for 12 h in the presence or absence of Glc. K3R Flow cytometry analysis of Zombie Green staining to determine the dead cell population in SW1353 (n = 7) and JJ012 (n = 5) cells overexpressing .

[0093] Figure 3m shows representative images (left) and quantification (right) of colony formation assay results after treatment of SW1353 cells transduced with the indicated lentiviruses with DMSO or EX527 (n= 4).

[0094] The data in Figures 3a, 3d, 3g, 3h, 3j, and 3m are expressed as mean ± SEM. The significance of Figure 3a was assessed using the Wilcoxon test. The significance of Figures 3d, 3g, 3h, and 3j, and 3m was assessed using a two-way ANOVA followed by Tukey's post hoc test.

[0095] Figures 4a to 4j show that the combination of EX527 and doxorubicin enhances tumor regression in a murine model of chondrosarcoma.

[0096] Figures 4a and 4b show synergy plots resulting from doxorubicin and EX527 treatment in SW1353 (n = 3) (Figure 4a) and JJ012 (n = 3) (Figure 4b) cells. Blue indicates a synergistic effect, and red indicates an antagonistic effect. The Loewe synergy score is indicated by the numbers in the boxes.

[0097] Figure 4c shows the relative NAD of SW1353 (left) and JJ012 (right) cells in the presence or absence of doxorubicin or EX527 for 24 h. + / NADH ratio (n = 5).

[0098] Figure 4d is a schematic illustration of combination chemotherapy using EX527 in a subcutaneous xenograft model using JJ012 cells. Mice were injected intraperitoneally with vehicle, doxorubicin, EX527, or doxorubicin and EX527.

[0099] Figure 4e shows the results of subcutaneous transplantation of JJ012 cells into athymic mice. The indicated drugs were injected intraperitoneally into the xenografted mice twice a week for 4 weeks. Body weights were measured on the indicated days after tumor transplantation (n = 7, vehicle; n = 7, doxorubicin; n = 7, EX527; n = 7, doxorubicin + EX527).

[0100] Figure 4f shows the growth of JJ012 tumors in a subcutaneous xenograft model after injection of the indicated drugs (n = 7, vehicle; n = 7, doxorubicin; n = 7, EX527; n = 7, doxorubicin + EX527). Tumor volumes were measured on the indicated days after transplantation.

[0101] Figure 4g shows the gross image (left) and weight (right) of the resected chondrosarcoma tumor at the end of treatment.

[0102] Figure 4h is a schematic illustration of combination chemotherapy using EX527 in an orthotopic xenograft model using SW1353 cells.

[0103] Figure 4i is a representative H&E stained image showing the extent of extension of an intramedullary chondrosarcoma tumor in the tibial bone. EP is the periosteal plate; T is the tumor; B is the bone; and BM is the bone marrow.

[0104] Figure 4j shows the percentage of mice with extramedullary tumor outgrowths (left). Representative H&E images showing the extent of local invasion of transplanted SW1353 cells into surrounding muscle after indicated treatments (n = 5, vehicle; n = 4, doxorubicin; n = 4, EX527; n = 4, doxorubicin + EX527) (right).

[0105] The scale bar is 10 mm in Fig. 4g, 500 μm (top) and 50 μm (bottom) in Fig. 4i, and 50 μm in Fig. 4j. The statistical significance of Figs. 4a and 4b was assessed using Combenefit software. Statistical differences are reported by the software as one-sample t tests, with *p < 0.05, **p < 0.001, and ***p < 0.0001. The data in Figs. 4c and 4e to 4g are expressed as mean ± SEM, and significance was assessed using two-way ANOVA and Tukey's post hoc test.

[0106] Figures 5a to 5l are NAD + Expression profiles of biosynthetic genes show that two distinct subgroups of chondrosarcoma patients with contrasting prognoses.

[0107] Figure 5a is NAD + This is a silhouette plot to determine the optimal number of clusters for clustering patients with chondroma based on transcriptome profiling of the biosynthetic process gene (GO: 0009435) (E-MTAB-7264). The k value that achieved the maximum average silhouette width was considered the optimal number of clusters.

[0108] Figure 5b shows an example of clusters classified by the expression level of candidate metabolic pathways using unsupervised learning. Specifically, k-means clustering was performed based on the values ​​of the principal component axes to group patients with cartilage tumors into two groups, Cluster 1 and Cluster 2, and principal component analysis (PCA) was performed. PCA showed that NAD in cartilage tumors derived from patients + It was performed based on the collective expression profile of biosynthetic process genes. NAD searched in GO + The biosynthetic pathway genes are: ACMSD, IDO2, NAPRT, NMNAT3, PARP10, QPRT, AFMID, KMO, NAXD, NMRK1, PARP16, RNLS, ASPDH, KYNU, NAXE, NMRK2, PARP9, SLC22A13, HAAO, NADSYN1, NMNAT1, NNMT, PTGIS, SLC5A8, IDO1, NAMPT, NMNAT2, NUDT12, PTGS2.

[0109] Figure 5c shows the characterization results of patients with cartilaginous tumors belonging to two identified clusters (benign, n = 8: chondroma, enchondroma, osteochondroma, and chondroblastoma; malignant, n = 156: G1-G4 chondrosarcoma, undifferentiated chondrosarcoma, and chondrosarcoma without grade information): NAD + Transcriptional profiles of biosynthetic process genes, histological grade, and molecular subtypes.

[0110] Figure 5d is a Kaplan-Meier plot to determine the overall survival rate of patients with chondrosarcoma in the two clusters (see Figure 11a for the overall survival rate of patients with cartilage tumors, including benign tumors).

[0111] Figure 5e shows the results of HRE luciferase reporter analysis in HIF-2α overexpressing SW1353 cells after transfection with IDO1, NAMPT or NAPRT overexpression vectors (n = 3).

[0112] Figure 5f is NAD+ This is the result of determining the statistical significance of the survival difference between two clusters after removing the transcriptional information for each gene in the biosynthetic pathway. If the statistical difference becomes insignificant after removing the transcriptional information for a specific gene, that gene is considered a key feature gene for classification between the two clusters.

[0113] Figures 5g and 5h show immunoblot results of HIF-2α in lysates of SW1353 cells 24 hours after treatment with FK866 (Figure 5g) and 2-HNA (Figure 5h).

[0114] Figures 5i and 5j show the results of HRE luciferase reporter assays in HIF-2α-overexpressing SW1353, JJ012 and OUMS-27 cells treated with DMSO or EX527 at the indicated doses in the presence or absence of NAMPT-(n = 4) (Figure 5i) or NAPRT-overexpressing (n = 4) (Figure 5j) vectors.

[0115] Figures 5k and 5l show relative NAD+ / − levels in SW1353 cells transduced with SIRT1, NAMPT, and NAPRT inhibitors and NAMPT and NAPRT overexpression vectors (n = 4). + / NADH ratio (Fig. 5k) and doxorubicin-induced cytotoxicity (Fig. 5l).

[0116] The significance of Fig. 5d was assessed using a two-sided log-rank test. The data in Figs. 5e, 5i, 5k, and 5l are expressed as mean ± SEM. The statistical significance of Figs. 5e and 5i to 5l was assessed using a two-way ANOVA followed by Tukey's post hoc test.

[0117] Figures 6a to 6e show that SIRT1 inhibition suppresses HIF-2α transcription in chondrosarcoma cells, requiring both acetylation and hydroxylation sites of HIF-2α.

[0118] Figure 6a shows the relative mRNA levels of SIRT1 in SW1353, JJ012, and OUMS-27 cells transfected with control shRNA or SIRT1 shRNA, as assessed by qRT-PCR (n = 3).

[0119] Figure 6b shows the relative mRNA levels of HIF-2α target genes, DEPP1, DTNA, and PLOD2, in SW1353, JJ012, and OUMS-27 transfected with control shRNA or SIRT1 shRNA, as assessed by qRT-PCR (n = 3).

[0120] Figure 6c shows the results of Western blot analysis of HIF-2α in lysates of SW1353 and JJ012 cells after treatment with the indicated doses of nicotinamide (NIC).

[0121] Figure 6d shows the results of HRE luciferase reporter assay in HIF-2α overexpressing SW1353, JJ012, and OUMS-27 cells after nicotinamide (NIC) treatment at the indicated doses (n = 4).

[0122] Figure 6e shows the relative mRNA levels of HIF-2α target genes, DEPP1, DTNA, and PLOD2, in SW1353 and JJ012 cells treated with 100 μM EX527 or DMSO.

[0123] The data in Figures 6a, 6b, 6d, and 6e are expressed as the mean ± SEM. The significance of Figures 6a and 6b was assessed using a two-tailed Student's t-test. The significance of Figures 6d and 6e was assessed using a two-way ANOVA and Tukey's post hoc test.

[0124] Figures 7a and 7b show that SIRT1 promotes tumor progression by selectively regulating HIF-2α stability and transcriptional activity in chondrosarcoma cells.

[0125] Figure 7a shows HIF-2α, HIF-2α after treatment with DMSO or EX527 at the indicated doses. K3R and HIF-2α P2A Results of HRE luciferase reporter assay in overexpressing OUMS-27 cells (n = 4).

[0126] Figure 7b is a gross 3D reconstruction image of micro-CT scans of a non-operated and sham-operated knee (left), and a gross 3D reconstruction image of micro-CT scans after orthopedic SW1353-shCtrl or SW1353-shSIRT1 xenograft transplantation into a knee with intramedullary chondrosarcoma tumor of the tibial bone 7 weeks later (right).

[0127] In Figure 7a, data are presented as mean ± SEM, and significance was assessed using two-way ANOVA and Tukey's post hoc test.

[0128] Figure 8 demonstrates that SIRT1 enhances the survival of chondrosarcoma cells under glucose starvation conditions by regulating the expression of anti-apoptotic genes in a HIF-2α-dependent manner. Specifically, Figure 8 shows Western blot analysis of HIF-2α and cleaved PARP in cell lysates from JJ012 and OUMS-27 cells treated with DMSO or EX527 (100 μM) in the presence or absence of Glc for 24 hours.

[0129] Figure 9 shows that combination therapy did not affect the body weight of mice receiving xenografts. SW1353 cells were transplanted intramurally into erythropoietic mice. The indicated drugs were injected intraperitoneally into the orthotopically transplanted mice twice a week for 2.5 weeks. Body weights were measured on the indicated days after tumor transplantation (n = 5, vehicle; n = 4, doxorubicin; n = 4, EX527; n = 4, doxorubicin + EX527). Data are presented as mean ± SEM.

[0130] Figures 10a to 10d show doxorubicin, NAD + Synergistic effect of SIRT1 inhibitor and synthetic enzyme inhibitor on chondrosarcoma cell death. The results of the study on the effect of inhibitor on chondrosarcoma cell death.

[0131] Figure 10a is a Kaplan-Meier plot to determine the overall survival rate of patients with cartilage tumors, including benign tumors, in both clusters.

[0132] Figure 10b shows the effect of SIRT1, NAMPT, and NAPRT inhibitors on doxorubicin-induced cytotoxicity in SW1353 (n = 4) and JJ012 cells (n = 4). Cells were treated with vehicle; or 1 μM doxorubicin in combination with 5 nM FK866, 0.5 mM 2-HNA, 100 μM EX527, or vehicle for 24 h.

[0133] Figure 10c shows the effect of SIRT1 inhibitors on doxorubicin-induced cytotoxicity in SW1353 cells transfected with lentivirus control (n = 4) or NAMPT and NAPRT overexpression vectors (n = 4; left) and JJ012 cells transfected with lentivirus control (n = 4) or NAMPT and NAPRT overexpression vectors (n = 4; right).

[0134] Figure 10d shows the relative NAD in SW1353 cells (n = 4) transfected with NAMPT- and NAPRT overexpression vectors. + Effects of SIRT1, NAMPT, and NAPRT inhibitors on the / NADH ratio (left) and doxorubicin-induced cytotoxicity (right). Cells were treated with vehicle or 2 μM doxorubicin. Cells were treated with 5 nM FK866, 1 mM 2-HNA, 100 μM EX527, or vehicle for 24 h.

[0135] Figures 10b to 10d show data as mean ± SEM, and significance was assessed using a two-way ANOVA and Tukey's post hoc test. Figure 10c calculates Cohen's D score to assess the observed significance between groups.

[0136] Figures 11aa to 11bc show data showing that transcriptional information of NAMPT and NAPRT is essential for generating clusters with large survival differences. In Figures 11aa to 11bc, the y-axis represents survival probability.

[0137] Figure 12 shows the training results (left) and validation results for the test set (right) of an artificial intelligence model that predicts the survival of cancer patients up to a specific point in time using the transcript expression level of the target metabolic pathway.

[0138]

[0139] It should be understood that the various embodiments and terms used in this document are not intended to limit the technical features described in this document to specific embodiments, but rather to include various modifications, equivalents, or substitutes of the embodiments.

[0140]

[0141] The present inventors have elucidated that SIRT1 plays an important role in the development and recurrence of chondrosarcoma (e.g., chondrosarcoma grade III, dedifferentiated chondrosarcoma), and confirmed that inhibition of SIRT1 in a chondrosarcoma mouse model inhibits the growth of chondrosarcoma. In addition, when used in combination with existing chemotherapeutic agents, the inhibition of SIRT1 according to the present invention has a synergistic effect on the apoptosis of chondrosarcoma cells in mice, and eliminates malignant chondrosarcoma. In addition, the present inventors have identified NAD, which has a significant correlation with SIRT1. +We found that NAMPT and NAPRT, biosynthetic genes, were closely related to the development, recurrence, and poor prognosis of chondrosarcoma (e.g., chondrosarcoma grade III, dedifferentiated chondrosarcoma).

[0142]

[0143] Definition of terms

[0144] All scientific and technical terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0145] The term "NAD (Nicotinamide adenine dinucleotide)" used herein refers to an essential metabolite involved in all cellular metabolism. Treatment of diseases characterized by NAD deficiency has been reported to induce cytotoxicity and adverse effects at both preclinical and clinical levels.

[0146] The term "SIRT1 (Sirtuin 1)" used herein refers to a deacetylase that uses NAD as a coenzyme, and is known as a factor that mainly regulates the response to cellular stress and energy metabolism in normal cells. Sirtuin 1 is also called NAD-dependent deacetylase sirtuin-1. The amino acid sequence of the SIRT1 protein and the base sequence of the SIRT1 gene encoding the SIRT1 protein used herein can be obtained from public databases such as NCBI's GenBank or literature. The NCBI GENE ID of the SIRT1 gene may be 23411. For example, the SIRT1 gene may be Human SIRT1.

[0147] The term “chondrosarcoma” used herein refers to a malignant tumor that forms cartilage, which is the second most common bone tumor after osteosarcoma and accounts for 10-20% of primary malignant bone tumors. Chondrosarcoma most commonly occurs in the pelvic bones, but can also occur in the femur, humerus, and ribs. Chondrosarcoma can be divided into primary, which occurs without a preceding lesion, and secondary, which is caused by malignant changes such as enchondroma and osteochondroma. In addition, chondrosarcoma can be classified into central, which occurs inside the bone, and peripheral, which occurs on the surface, depending on the location of occurrence. Furthermore, chondrosarcoma can be histologically classified into conventional, mesenchymal, myxoid, dedifferentiated, and clear cell.

[0148] Chondrosarcomas range from low-grade tumors with little metastatic potential to high-grade, dedifferentiated, aggressive tumors characterized by metastatic spread and recurrence. Malignant chondrosarcomas can be graded from Grade I (also referred to as Grade I) to Grade III (also referred to as Grade III) based on nuclear size, staining pattern (hyperchromasia), mitotic activity, and the extent of cytoplasm. High-grade chondrosarcomas include dedifferentiated chondrosarcomas. Dedifferentiated chondrosarcomas may be a mixture of low-grade malignant hyaline cartilage tumors, low-grade chondrosarcomas, and high-grade dedifferentiated chondrosarcomas. High-grade dedifferentiated chondrosarcomas have diverse features, including those of dedifferentiated sarcomas, osteosarcomas, angiosarcomas, fibrosarcomas, rhabdomyosarcomas, leiomyosarcoma, and giant cell tumors. Dedifferentiated chondrosarcoma is a serious malignant tumor with a very poor prognosis, with a short median survival time of approximately 6 months, a low 5-year patient survival rate of 10% to 13%, and very few patients surviving more than 2 years after surgery.

[0149] As used herein, "salt" means a salt according to one aspect of the present disclosure that is acceptable in medicine, cosmetics, and foodstuffs and has the desired activity of the parent compound. For example, the salt may be prepared by reacting the salt with an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; Acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl) benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo [2,2,2] oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, Acid addition salts formed with organic acids such as tert-butylacetic acid, lauryl sulfate, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, and muconic acid; or salts formed when an acidic proton present in the parent compound is substituted, may include, but are not limited to, salts. In addition, the salt may be a pharmaceutically acceptable salt.

[0150] As used herein, “pharmaceutically acceptable” means that it does not exhibit significant toxicity when used in usual medicinal dosages and is approved or has been approved by a government or similar regulatory body for use in animals, specifically humans, or is listed in a pharmacopoeia or is otherwise generally recognized as a pharmacopoeia.

[0151] In this specification, “hydrate” means a compound to which water is bound, and is a broad concept that includes inclusion compounds in which there is no chemical bonding between water and the compound.

[0152] As used herein, "solvate" may refer to a crystalline form containing a stoichiometric or non-stoichiometric amount of a solvent, for example, a higher-order compound formed between solute molecules or ions and solvent molecules in solution. A solvate in which the solvent is water may be commonly referred to as a hydrate.

[0153] As used herein, the term "treatment" refers to any action that improves or beneficially alters the symptoms of chondrosarcoma or a disease caused by it through the administration of a composition according to the present disclosure. Those skilled in the art to which this disclosure pertains will be able to accurately determine the criteria for the disease and determine the extent of improvement, enhancement, and treatment by referring to materials provided by the Korean Medical Association and other sources.

[0154] As used herein, the term "diagnosis" may refer to assessing the full spectrum of a patient's condition. The assessment may include the name of the disease, etiology, type, severity, detailed description of the condition, and the presence or absence of complications. In this context, diagnosis may refer to determining the presence or absence of chondrosarcoma and / or its progression level.

[0155] The term “antibody” in this specification may include a complete antibody, an antigen-binding fragment of an antibody molecule, and antibodies or fragments functionally equivalent thereto.

[0156]

[0157] Exemplary implementations

[0158] Pharmaceutical composition for the treatment or prevention of recurrence of chondrosarcoma

[0159] One aspect of the present disclosure provides a pharmaceutical composition for treating or preventing recurrence of chondrosarcoma, comprising a SIRT1 inhibitor. Furthermore, one aspect of the present disclosure may provide a pharmaceutical composition for treating or preventing recurrence of chondrosarcoma, comprising at least one selected from the group consisting of a SIRT1 inhibitor, a NAMPT inhibitor, and a NAPRT inhibitor.

[0160] In one embodiment, the SIRT1 inhibitor is sufficient as long as it is a substance capable of inhibiting SIRT1, and the type thereof is not limited.

[0161] Inhibiting SIRT1 may mean inhibiting the expression of SIRT1 at the transcriptional and / or translational level of SIRT1, and / or inhibiting the activity of SIRT1.

[0162] In one embodiment, the SIRT1 inhibitor may be a substance that inhibits the activity of the SIRT1 protein. In one embodiment, the SIRT1 inhibitor may be a substance that inhibits the expression of the SIRT1 gene into protein.

[0163] In this specification, the term “expression” includes all steps in the process of making a gene into a protein, and may include, for example, transcription of a gene into mRNA and translation of mRNA into protein.

[0164] In this specification, the term “activity” may mean a biological action that enables an expressed protein to perform its original function.

[0165] In one embodiment, the SIRT1 inhibitor may include a variety of substances capable of inhibiting the expression or activity of SIRT1 at the transcriptional and / or translational level. For example, the SIRT1 inhibitor may be at least one selected from the group consisting of, but not limited to, small molecule compounds, antibodies, polypeptides, proteins, antisense oligonucleotides, siRNAs, shRNAs, and miRNAs.

[0166] In one embodiment, the SIRT1 inhibitor may be a substance previously known as a SIRT1-specific inhibitor. For example, the SIRT1 inhibitor may be, but is not limited to, EX527 (CAS No: 49843-98-3), a salt thereof, a hydrate thereof, or a solvate thereof; or nicotinamide (CAS No: 98-92-0), a salt thereof, a hydrate thereof, and a solvate thereof. The present invention has, for the first time, been found to inhibit the growth of chondrosarcoma (e.g., malignant chondrosarcoma).

[0167] In one embodiment, the SIRT1 inhibitor may be an antibody capable of blocking, inhibiting, and / or interfering with the activity and / or mechanism of action of SIRT1. For example, the antibody may be of the IgG, IgM, IgD, IgE, IgA, or IgY type, and may be of the IgG1, IgG2, IgG3, IgG4, IgA1, or IgA2 class or a subclass thereof. For example, the antibody may include monoclonal, polyclonal, chimeric, single-chain, bispecific, simian, and humanized antibodies, as well as active fragments and antibody mimetics thereof.

[0168] In one embodiment, the SIRT1 inhibitor may be a polypeptide capable of inhibiting, suppressing, and / or interfering with the activity and / or mechanism of action of SIRT1. The polypeptide may be a natural or synthetic amino acid polymer, and its length, type, etc. are not limited. The polypeptide may also include polypeptides that have been modified naturally or artificially, such as by glycosylation, acetylation, phosphorylation, etc.

[0169] In one embodiment, the SIRT1 inhibitor may be a nucleotide capable of inhibiting, suppressing, and / or interfering with the activity and / or mechanism of action of SIRT1. For example, the nucleotide may be, but is not limited to, an antisense oligonucleotide, siRNA (small interfering RNA), shRNA (small hairpin RNA), or miRNA (microRNA). In one embodiment, the SIRT1 inhibitor may be an antisense oligonucleotide, siRNA, shRNA, and / or miRNA that targets the SIRT1 gene, and may also include bioequivalents, derivatives, and analogs thereof.

[0170] siRNA, shRNA, or miRNA may have a sequence complementary to a target nucleic acid to a certain degree or more. A sequence complementary to a target nucleic acid to a certain degree or more means a sequence that is at least about 70% complementary, at least about 80% complementary, at least about 90% complementary, or about 100% complementary to a sequence of at least 15 contiguous bases in length of the target nucleic acid.

[0171] Antisense oligonucleotides are known in the art and are short synthetic nucleic acids that bind to a nucleotide sequence encoding a target protein, thereby inhibiting / reducing the expression of the target protein. Antisense oligonucleotides may have an appropriate length depending on the target gene and / or delivery method, and may be, for example, about 6 or more, 8 or more, 10 or more, or 40 or less, 60 or less, 100 or less, or a combination thereof.

[0172] In one embodiment, the SIRT1 inhibitor may be, but is not limited to, an shRNA represented by SEQ ID NO: 1 (TTCTGGTGAACTTGAGTCT).

[0173] Chondrosarcoma is known to exhibit anticancer resistance to conventional anticancer chemotherapeutics (e.g., doxorubicin, cisplatin) due to its pathological and / or cellular characteristics. In one embodiment, the inventors have demonstrated that a SIRT1 inhibitor (e.g., EX527) exhibits a synergistic effect of inducing apoptosis of chondrosarcoma cells when administered to a subject together with conventional anticancer chemotherapeutics (e.g., doxorubicin, cisplatin), thereby effectively alleviating chondrosarcoma. Therefore, a pharmaceutical composition according to one aspect of the present disclosure can be used in combination with various anticancer chemotherapeutic agents that can be used for chondrosarcoma.

[0174] A pharmaceutical composition according to one aspect of the present disclosure may be administered in combination with an anticancer chemotherapy agent. The anticancer chemotherapy agent may be a commercially available anticancer chemotherapy agent, such as, but not limited to, doxorubicin or cisplatin.

[0175] In one embodiment, a pharmaceutical composition according to one aspect of the present disclosure may be administered in combination with doxorubicin. In one embodiment, treatment with a SIRT1 inhibitor according to one aspect of the present disclosure may improve resistance to doxorubicin. In another embodiment, treatment with a SIRT1 inhibitor according to one aspect of the present disclosure may increase sensitivity to doxorubicin.

[0176] A pharmaceutical composition according to one aspect of the present disclosure may be administered in combination with cisplatin. Cisplatin acts by binding to DNA and interfering with its replication. Therefore, in another embodiment, a pharmaceutical composition according to one aspect of the present disclosure may be administered in combination with various other anticancer chemotherapeutic agents that interfere with DNA replication in anticancer cells. In one embodiment, treatment with a SIRT1 inhibitor according to one aspect of the present disclosure may improve resistance to cisplatin. In another embodiment, treatment with a SIRT1 inhibitor according to one aspect of the present disclosure may increase sensitivity to cisplatin.

[0177] In one embodiment, the anticancer chemotherapeutic agent may be administered simultaneously, separately, or sequentially with the pharmaceutical composition according to one aspect of the present disclosure, and may be administered singly or in multiple doses.

[0178] For example, as an exemplary method for administering the anticancer chemotherapeutic agent simultaneously with a pharmaceutical composition according to one aspect of the present disclosure, the pharmaceutical composition according to one aspect of the present disclosure may further comprise an anticancer chemotherapeutic agent.

[0179]

[0180] In one embodiment, the present inventors have NAD + NAD+ with SIRT1 in chondrosarcoma cells with increased expression of the synthetic enzyme + We confirmed that inhibition of the synthetic enzymes (i.e., NAMPT and NAPRT) improved anticancer resistance to doxorubicin (Fig. 5l).

[0181] Accordingly, the pharmaceutical composition according to one aspect of the present specification may further comprise at least one of a NAMPT (nicotinamide phosphoribosyltransferase) inhibitor or a NAPRT (nicotinate phosphoribosyltransferase) inhibitor. In this case, the pharmaceutical composition according to one aspect of the present specification may further comprise an NAD + It may be treated in chondrosarcoma cells that overexpress synthetic enzymes (e.g., NAMPT and NAPRT).

[0182] In one embodiment, the NAMPT inhibitor may be FK866 (CAS No. 658084-64-1). In one embodiment, the NAPRT inhibitor may be 2-hydroxynicotinic acid (CAS No. 609-71-2).

[0183] A pharmaceutical composition according to one aspect of the present disclosure can inhibit tumor growth of chondrosarcoma. A pharmaceutical composition according to one aspect of the present disclosure can inhibit tumor volume and tumor weight of chondrosarcoma.

[0184] In one embodiment, a SIRT1 inhibitor (e.g., EX527) can reduce tumor volume and tumor weight of chondrosarcoma. In one embodiment, a SIRT1 inhibitor (e.g., EX527) can be combined with an anticancer chemotherapy agent (e.g., doxorubicin) to reduce tumor volume and tumor weight of chondrosarcoma. In one embodiment, a SIRT1 inhibitor (e.g., EX527) can increase apoptosis of chondrosarcoma cells. In one embodiment, a SIRT1 inhibitor (e.g., EX527) can be combined with an anticancer chemotherapy agent (e.g., doxorubicin) to increase apoptosis of chondrosarcoma cells.

[0185] A pharmaceutical composition according to one aspect of the present disclosure may further include suitable carriers, excipients, and diluents commonly used for manufacturing pharmaceutical compositions. Furthermore, the composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as topical preparations, suppositories, and sterile injectable solutions, according to conventional methods.

[0186] Carriers, excipients, and diluents that may be included in the above composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulating the above composition, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0187] A pharmaceutical composition according to one aspect of the present disclosure may be administered in a pharmaceutically effective amount. In one aspect of the present disclosure, a "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level may be determined based on the type and severity of the patient's disease, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field.

[0188] Pharmaceutical compositions according to one aspect of the present disclosure may be administered by various routes. Any route of administration is contemplated, including oral administration, intranasal administration, intrabronchial administration, intraarterial injection, intravenous injection, subcutaneous injection, intramuscular injection, or intraperitoneal injection.

[0189] The dosage of the pharmaceutical composition according to one aspect of the present specification may vary depending on body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. For example, the dosage of the pharmaceutical composition according to one aspect of the present specification may be about 0.0001 mg to 100 mg, but ranges below and above the above range are not excluded. For example, the pharmaceutical composition according to one aspect of the present specification may be administered once to several times per day; or once to several times per week, but is not limited thereto.

[0190]

[0191] In addition, one aspect of the present specification provides a method for treating or preventing recurrence of chondrosarcoma, comprising the step of administering the aforementioned pharmaceutical composition to a subject.

[0192] In one embodiment, the subject may be a subject in need of treatment for a disease.

[0193] In one embodiment, the subject may include, but is not limited to, a mammal. The mammal may be, but is not limited to, a human, a mouse, a cow, a dog, a rabbit, or a cat.

[0194] In one embodiment, a method for treating or preventing recurrence of chondrosarcoma according to one aspect of the present disclosure may further comprise administering an anticancer chemotherapy agent to the subject. The anticancer chemotherapy agent may be a commercially available anticancer chemotherapy agent, such as, but not limited to, doxorubicin or cisplatin.

[0195] In one embodiment, the anticancer chemotherapeutic agent may be administered simultaneously, separately, or sequentially with the pharmaceutical composition described above, and may be administered singly or in multiple doses.

[0196]

[0197] Composition for screening substances for the treatment of chondrosarcoma

[0198] The present invention has identified that SIRT1 is an important factor in the development and initiation of chondrosarcoma, and substances that inhibit the expression and / or activity of SIRT1 can be screened and developed as treatments for chondrosarcoma (e.g., malignant chondrosarcoma, dedifferentiated chondrosarcoma).

[0199] In this specification, the term “substance for treating chondrosarcoma” may mean any substance that can improve or treat chondrosarcoma, and the type thereof is not limited.

[0200]

[0201] One aspect of the present specification provides a composition for screening a substance for treating chondrosarcoma, comprising: a preparation for measuring the expression level of a SIRT1 gene; or a preparation for measuring the activity of a SIRT1 protein. In addition, one aspect of the present specification may provide a composition for screening a substance for treating chondrosarcoma, comprising: a preparation for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT; or a preparation for measuring the activity of one or more proteins selected from the group consisting of SIRT1, NAMPT, and NAPRT.

[0202] In addition, one aspect of the present specification is a preparation for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, NUDT12; Alternatively, a composition for screening a substance for treating chondrosarcoma may be provided, comprising an agent for measuring the activity of one or more proteins selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, NUDT12.

[0203] In one embodiment, the substance for treating chondrosarcoma may be a substance that exhibits a chondrosarcoma inhibitory effect when administered in combination with an anticancer chemotherapeutic agent (e.g., doxorubicin, cisplatin). In one embodiment, the substance for treating chondrosarcoma may be a substance that exhibits a chondrosarcoma inhibitory effect when administered in combination with doxorubicin. Since the anticancer chemotherapeutic agent has been described above, a detailed description thereof will be omitted.

[0204] In one embodiment, the agent for measuring the expression level of a gene may be at least one of an agent for measuring the amount of mRNA of the gene or an agent for measuring the amount of protein expressed from the gene.

[0205] In one embodiment, the agent for measuring the amount of mRNA of a gene may be, but is not limited to, a primer pair or probe that specifically binds to the mRNA or cDNA of the gene. In one exemplary embodiment, the agent may be a sense and antisense primer; or a probe.

[0206] In an exemplary embodiment, the expression level can be measured according to a method commonly used in the art. For example, the expression level can be measured by a method such as, but not limited to, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase reaction (RealtimeRT-PCR), RNase protection assay (RPA), Northern blotting, or gene chip.

[0207] In one embodiment, the agent for measuring the amount of protein expressed from a gene may be, but is not limited to, an antibody or aptamer specific for the protein expressed from the gene.

[0208] In one embodiment, the agent for measuring protein activity is sufficient as long as it can measure the activity of the protein, and the type thereof is not limited. For example, the agent for measuring protein activity may be a component used in an enzyme activity assay kit. For example, protein activity may be measured using an enzyme activity assay kit.

[0209] In an exemplary embodiment, the expression level can be measured by a method such as, but not limited to, Western blot, protein microarray (protein chip), Enzyme Linked Immunosorbent Assay (ELISA), 2-dimentional electrophoresis, Immunohistochemistry (IHC), immunofluorescence, co-immunoprecipitation assay, Fluorescence activated cell sorter (FACS), Radioimmunoassay (RIA), Radioimmunodiffusion, Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry (MALDI-TOF).

[0210] A primer is a short genetic sequence that serves as the starting point for DNA synthesis. It can refer to an oligonucleotide synthesized for purposes such as diagnosis and DNA sequencing. Primers are typically synthesized to a length of 15 to 30 base pairs, but this can vary depending on the intended use, and can be modified by methylation, capping, etc. using known methods. A probe can refer to a nucleic acid that can specifically bind to miRNA, ranging from a few bases to several hundred bases in length, produced through an enzymatic, chemical, or synthetic process for separation and purification. The presence or absence of miRNA can be confirmed by labeling the probe with a radioisotope, enzyme, or fluorescent substance, and can be designed and modified using known methods. Primers or probes can be appropriately designed by those skilled in the art based on known sequences. For example, primers or probes can be chemically synthesized using a phosphoramidite solid support method or other widely known methods. These nucleic acid sequences can also be modified using various means known in the art.

[0211] An antibody can be an immunoglobulin molecule that binds specifically to an epitope of a target protein and has reactivity, and can include monoclonal antibodies, polyclonal antibodies, antibodies with a full-length chain structure, antibodies with functional fragments that have at least an antigen-binding function, and recombinant antibodies. An aptamer refers to a single-stranded nucleic acid molecule that has the characteristic of being able to form a specific binding with a target protein and forms a stable tertiary structure, and an aptamer with specificity for a target protein can be synthesized using techniques such as SELEX (Systematic Evolution of Ligands by Exponential Enrichment).

[0212] In an exemplary embodiment, the composition for screening for a substance for treating chondrosarcoma according to one aspect of the present disclosure can be used to determine the effect of a test substance (e.g., a candidate substance for treating chondrosarcoma) on treating, improving, and / or preventing recurrence of chondrosarcoma.

[0213]

[0214] In addition, one aspect of the present specification provides a kit for screening substances for the treatment of chondrosarcoma, comprising the composition for screening substances for the treatment of chondrosarcoma described above. The composition for screening substances for the treatment of chondrosarcoma and chondrosarcoma have been described above, and thus a detailed description thereof will be omitted.

[0215] In an exemplary embodiment, the kit may further include an agent for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT described above; and / or an agent for measuring the activity of one or more proteins selected from the group consisting of SIRT1, NAMPT and NAPRT; and components, tools, reagents, etc. commonly used in the art to be suitable for use as a screening kit for a substance for the treatment of chondrosarcoma.

[0216]

[0217] Additionally, one aspect of this specification is:

[0218] (a) a step of treating a test substance to chondrosarcoma cells;

[0219] (b) a step of measuring the expression level of the SIRT1 gene or the activity of the SIRT1 protein in the above chondrosarcoma cells; and

[0220] (c) a step of selecting the test substance as a substance for treating chondrosarcoma when the expression level of the gene or the activity of the protein measured in step (b) decreases due to the treatment of the test substance; a method for screening a substance for treating chondrosarcoma is provided.

[0221] In one embodiment, a method of screening a substance for treating chondrosarcoma comprises:

[0222] After performing step (b) and before performing step (c), the method may further include a step of measuring (b-1) the expression level of one or more genes among NAMPT or NAPRT; or the activity of one or more proteins among NAMPT or NAPRT. In this case, step (c) may be a step of selecting the test substance as a substance for treating chondrosarcoma when the expression level of the gene or the activity of the protein measured in steps (b) and (b-1) decreases due to the treatment of the test substance.

[0223] In one embodiment, the chondrosarcoma cells may be contained within chondrosarcoma tissue.

[0224] Additionally, one aspect of this specification is:

[0225] (a) a step of treating a test substance to chondrosarcoma cells;

[0226] (b) the expression level of at least one gene selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, NUDT12 in the chondrosarcoma cells; or a step of measuring the activity of at least one protein selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, NUDT12; and

[0227] (c) a step of selecting the test substance as a substance for treating chondrosarcoma when the expression level of the gene or the activity of the protein measured in step (b) decreases due to the treatment of the test substance; a method for screening a substance for treating chondrosarcoma can be provided.

[0228] In one embodiment, the expression level of a gene can be measured using a formulation for measuring the expression level of the aforementioned gene. In one embodiment, the expression level of a gene can be measured using a method for measuring the expression level of a gene as described above.

[0229] In one embodiment, the expression level of a gene can be determined through transcriptome analysis commonly used in the art.

[0230] In one embodiment, protein activity can be measured using, but is not limited to, an enzyme activity assay kit. In one embodiment, protein activity can be measured using any method known in the art for measuring protein activity.

[0231]

[0232] Composition for diagnosis or prognosis of chondrosarcoma

[0233] In one embodiment, the inventors have confirmed that SIRT1 is overexpressed or its activity is increased in chondrosarcoma. In another embodiment, the inventors have confirmed that NAD+, which is associated with SIRT1, is + Among the biosynthetic genes, upregulation of NAMPT and NAPRT was confirmed to be associated with poor prognosis of chondrosarcoma.

[0234]

[0235] One aspect of the present disclosure provides a composition for diagnosing or predicting the prognosis of chondrosarcoma, comprising a preparation for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT.

[0236] In addition, one aspect of the present specification provides a composition for diagnosing or predicting the prognosis of chondrosarcoma, comprising an agent for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, NUDT12.

[0237] As used herein, the term "prognosis" means an outlook on the future medical outcome of a patient's disease (e.g., overall survival, recurrence-free survival, etc.), and includes a positive prognosis including disease remission (e.g., disease recovery, etc.), disease improvement (e.g., tumor regression, etc.), or disease stabilization, and a negative prognosis including disease recurrence, disease progression, or lethality (e.g., tumor growth, metastasis, drug resistance, etc.).

[0238] In the present invention, “prediction” means to guess in advance the future medical outcome of a patient’s disease, and includes prediction of the course of the patient’s disease (e.g., the degree of improvement, stabilization, relapse, progression, fatality, deterioration, etc.).

[0239] In an exemplary implementation, the expression level may be an expression amount.

[0240] In one embodiment, the agent for measuring the expression level of a gene may be at least one of an agent for measuring the amount of mRNA of the gene or an agent for measuring the amount of protein expressed from the gene.

[0241] In one embodiment, the agent for measuring the amount of mRNA of a gene may be, but is not limited to, a primer pair or probe that specifically binds to the mRNA or cDNA of the gene. In one exemplary embodiment, the agent may be a sense and antisense primer; or a probe.

[0242] In an exemplary embodiment, the expression level can be measured according to a method commonly used in the art. For example, the expression level can be measured by a method such as, but not limited to, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase reaction (RealtimeRT-PCR), RNase protection assay (RPA), Northern blotting, or gene chip.

[0243] In one embodiment, the agent for measuring the amount of protein expressed from a gene may be, but is not limited to, an antibody or aptamer specific for the protein expressed from the gene.

[0244] In an exemplary embodiment, the expression level can be measured by a method such as, but not limited to, Western blot, protein microarray (protein chip), Enzyme Linked Immunosorbent Assay (ELISA), 2-dimentional electrophoresis, Immunohistochemistry (IHC), immunofluorescence, co-immunoprecipitation assay, Fluorescence activated cell sorter (FACS), Radioimmunoassay (RIA), Radioimmunodiffusion, Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry (MALDI-TOF).

[0245] Primers, probes, antibodies, and aptamers have been described above, so detailed descriptions are omitted.

[0246] In an exemplary embodiment, a composition for diagnosing or predicting the prognosis of chondrosarcoma according to one aspect of the present disclosure may be used to diagnose chondrosarcoma and / or predict the prognosis of chondrosarcoma by measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT from at least one selected from the group consisting of blood, serum, plasma, tissue, saliva, and urine isolated from a subject.

[0247]

[0248] In addition, one aspect of the present specification provides a kit for diagnosing or predicting the prognosis of chondrosarcoma, comprising the composition for diagnosing or predicting the prognosis of chondrosarcoma described above.

[0249] Compositions for diagnosing or predicting the prognosis of chondrosarcoma, and chondrosarcoma have been described above, so detailed descriptions thereof are omitted.

[0250] In an exemplary embodiment, the kit may further include a preparation for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT described above, as well as components, tools, reagents and the like commonly used in the art suitable for use as a kit for diagnosing or predicting the prognosis of chondrosarcoma.

[0251] In an exemplary embodiment, the component, tool or reagent may be a carrier, a label capable of generating a detectable signal, a chromophore, a solubilizer, a detergent, a buffer, a stabilizer, etc. When the label is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator. The carrier may be a soluble carrier or an insoluble carrier, and a soluble carrier is a physiologically acceptable buffer known in the art, for example, PBS, and an insoluble carrier may be a polymer such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, a fluororesin, a cross-linked dextran, a polysaccharide, a metal-plated magnetic microparticle on latex, other paper, glass, metal, agarose, and combinations thereof.

[0252]

[0253] Additionally, one aspect of this specification is:

[0254] i) A method for providing information for diagnosing or predicting the prognosis of chondrosarcoma, comprising the step of measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT from a sample isolated from a subject.

[0255] In an exemplary implementation example, the information providing method comprises:

[0256] ii) A step of determining that the subject has chondrosarcoma or is likely to develop chondrosarcoma when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT is higher than that of a normal control group; may further be included.

[0257] In an exemplary implementation example, the information providing method comprises:

[0258] ii) A step of determining that the prognosis of the subject's chondrosarcoma is poor when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT is higher than that of a normal control group; may further include. In this case, the subject may be an individual with chondrosarcoma.

[0259] Additionally, one aspect of this specification is:

[0260] i) A method for providing information for diagnosing or predicting the prognosis of chondrosarcoma is provided, comprising: a step of measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 from a sample isolated from a subject.

[0261] In an exemplary implementation example, the information providing method comprises:

[0262] ii) a step of determining that the subject has chondrosarcoma or is likely to develop chondrosarcoma when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 is higher than that of a normal control group; may further include.

[0263] In an exemplary implementation example, the information providing method comprises:

[0264] ii) a step of determining that the prognosis of chondrosarcoma in the subject is poor when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 is higher than that of the normal control group; may further include. At this time, the subject may be an individual with chondrosarcoma.

[0265] In an exemplary embodiment, the subject may be an individual at risk for developing chondrosarcoma or an individual who has developed chondrosarcoma. The individual may include, but is not limited to, a mammal. The mammal may include, but is not limited to, a human, a mouse, a cow, a dog, a rabbit, or a cat.

[0266] In an exemplary embodiment, the sample may be at least one selected from the group consisting of, but not limited to, blood, serum, plasma, tissue, cancer tissue, cancer cells, saliva, and urine.

[0267] The expression level of a gene can be measured by at least one method selected from the group consisting of polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RPA), microarray, or northern blotting, but is not limited thereto.

[0268]

[0269] Additionally, one aspect of this specification is:

[0270] i) a step of measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT from a sample isolated from a subject;

[0271] ii) a step of diagnosing the subject as having chondrosarcoma or diagnosing that chondrosarcoma will develop when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT is higher than that of the normal control group; and

[0272] iii) a step of administering an effective amount of a chondrosarcoma treatment agent to a diagnosed individual; a method for diagnosing and treating chondrosarcoma is provided.

[0273] Additionally, one aspect of this specification is:

[0274] i) a step of measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 from a sample isolated from a subject;

[0275] ii) a step of diagnosing the subject as having chondrosarcoma or diagnosing that chondrosarcoma will develop when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 is higher than that of a normal control group; and

[0276] iii) a step of administering an effective amount of a chondrosarcoma treatment agent to a diagnosed individual; a method for diagnosing and treating chondrosarcoma is provided.

[0277] In one embodiment, the chondrosarcoma treatment agent may be applied without limitation as long as it exhibits a preventive and / or therapeutic effect on chondrosarcoma. For example, the chondrosarcoma treatment agent may be a commercially available substance.

[0278]

[0279] Prognosis prediction system for chondrosarcoma

[0280] Additionally, one aspect of this specification is:

[0281] A data storage unit storing expression level data of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT measured from a sample isolated from a chondrosarcoma patient; and

[0282] A system for predicting the prognosis of chondrosarcoma is provided, including a data analysis unit that determines that the prognosis of the chondrosarcoma patient is poor if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT stored in the data storage unit is higher than a predetermined value or higher than that of a normal group.

[0283] In one embodiment, the data analysis unit may predict that the chondrosarcoma patient will die within 5 years if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, and NAPRT stored in the data storage unit is equal to or higher than a predetermined value or higher than that of a normal group.

[0284] In one embodiment, the data storage unit may additionally store expression level data of one or more genes selected from the group consisting of KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 measured from a sample isolated from a chondrosarcoma patient.

[0285] In one embodiment, the data analysis unit may determine that the prognosis of the chondrosarcoma is poor when the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 stored in the data storage unit is equal to or higher than a predetermined value or higher than that of a normal group.

[0286] In one embodiment, the data analysis unit may predict that the chondrosarcoma patient will die within 5 years if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT, NAPRT, KMO, IDO1, KYNU, PARP9, NMNAT3, NADSYN1, PARP10, IDO2, ACMSD, SLC5A8, NMNAT2, SLC22A13, ASPDH, NMRK2, PTGS2, QPRT, HAAO, NMNAT1, NAXE, AFMID, NNMT, RNLS, PTGIS, PARP16, NAXD, NMRK1, and NUDT12 stored in the data storage unit is equal to or higher than a predetermined value or higher than a normal group.

[0287] In one embodiment, the prognosis prediction system for chondrosarcoma may further include a display unit that displays the prognosis of chondrosarcoma determined by the data analysis unit.

[0288] In one embodiment, the prognosis prediction system for chondrosarcoma may be, but is not limited to, a computer system.

[0289] In an exemplary embodiment, the sample may be at least one selected from the group consisting of, but not limited to, blood, serum, plasma, tissue, cancer tissue (chondrosarcoma cancer tissue), cancer cells (chondrosarcoma cancer cells), saliva, and urine.

[0290]

[0291] Hereinafter, the present invention will be described in detail with examples. These examples are provided solely for illustrative purposes to aid understanding of the present invention and are not intended to limit the scope and scope of the present invention.

[0292]

[0293] [Experimental Method]

[0294] 1. Human samples

[0295] Human tissue arrays containing cartilage tumors and normal cartilage, OS805a (age range 12–70; n = 48 males, n = 22 females) and OS802c (age range 12–74; n = 20 males, n = 8 females), were purchased from US Biomax, Inc. Therefore, sample allocation and sample size estimation for histological and immunohistochemical studies using these patient samples were not performed. The use of human samples was reviewed and approved by the Institutional Review Board (IRB) of Seoul National University (E2106 / 001-004). Pathologists evaluated the specimens histologically and immunohistochemically without knowing the specimen labeling.

[0296]

[0297] 2. Mouse experimental system

[0298] Four-week-old female BALB / c nu / nu mice were purchased from Daehan-Biolink Co. All animal experiments were reviewed and approved by the Seoul National University Institutional Animal Care and Use Committee (IACUC No. SNU-210218-2). Mice were housed in a specific pathogen-free animal facility at Seoul National University. Mice were maintained under a 12-h light / dark cycle (12-h:12-h) in a temperature-controlled environment (23–25°C) and humidity-controlled environment (45–65%). Mice were fed standard laboratory chow. The sample size for animal experiments was at least three to enable statistical analysis. Mice were randomly assigned to each experimental group, and all experiments were performed in a blinded manner. The orthotopic xenograft model was set up as follows: Prior to the transplantation procedure, mice were anesthetized, and the skin over the knee joint of the right hind leg was incised using a scalpel. A 0.35-mm diameter hole was then made in the cartilage region above the right fibula using sterile H-files. The mixture described below was injected into this area using a syringe. For stereotactic transplantation, 1 x 10 6A mixture of SIRT1shRNA-transduced SW1353 cells and controls, adjusted to 15 μL DMEM and 15 μL LDEV-free Matrigel Matrix (356234; Corning), was used. Mice were euthanized 7 weeks after transplantation, and the right hind limb specimens of the euthanized mice were excised for histological analysis. For combination therapy studies using doxorubicin (15007; Cayman) and EX527 (S1541; Selleckchem), SW1353 cells were seeded at a density of 1 × 10 6 cells / 15 μL DMEM, mixed with 15 μL of Matrigel Matrix without LDEV, and injected intramedullary into the right hind limb of nude mice. Two weeks after orthotopic transplantation of SW1353 cells, 10 mg kg diluted in Kolliphor EL (castor oil, 10% v / v) -1 2 mg kg in the presence or absence of EX527 -1 Mice were injected intraperitoneally with or without doxorubicin. Four and a half weeks after injection, the mice were sacrificed, and the right hind limb was incised. The vehicle solution was composed of DMSO (10% v / v) and Kolliphor EL (10% v / v) mixed in phosphate-buffered saline (PBS).

[0299] For the subcutaneous xenograft mouse model, 100 μL of Matrigel Matrix without LDEV and 5×10 6 A mixture of SIRT1shRNA cells / 100 μL DMEM or JJ012 cells introduced as a control was injected subcutaneously into the right flank of nude mice. Doxorubicin and EX527 were used in combination chemotherapy studies. Two weeks after the subcutaneous injection of JJ012 cells, 2 mg kg of doxorubicin diluted in Kolliphor EL (castor oil, 10% v / v) was administered. -1 In the presence or absence of 10 mg kg -1EX527 was injected intraperitoneally into mice or not. The vehicle solution was composed of DMSO (10% v / v) and Kolliphor EL (10% v / v) mixed in phosphate-buffered saline (PBS). Once tumors were formed, the mice were randomly divided into four groups and administered chemotherapy cocktails or vehicle solution twice a week for 4 weeks. Tumor volume was analyzed using the modified ellipsoid formula: Tumor volume = (length X width) 2 ) / 2.

[0300]

[0301] 3. Cell culture

[0302] SW1353 (HTB-94) and CHON-001 (CRL-2846) cells were purchased from ATCC. OUMS-27 cells were purchased from the JCRB Cell Bank. JJ012 cells were kindly provided by Professor Joel A. Block (Rush University Medical Center, Chicago, USA). Cells were cultured in DMEM supplemented with 10% FBS (26140079; Gibco) and 1% antibiotics at 37°C in 5% CO2 and 20% or 3% O2. For serum starvation, cells were cultured in serum-free DMEM for 12 h at 37°C in 5% CO2 and 3% O2. For glucose deprivation, JJ012 cells were cultured in serum-free DMEM (A1443001, Gibco) without glucose, glutamine, and phenol red supplemented with 4 mM glutamine and 1% antibiotics for 12 h, while SW1353 and OUMS-27 cells were cultured for 24 h under the same conditions. Cultures were performed at 37°C in an atmosphere of 5% CO2 and 3% O2. For hypoxic treatment, cells were cultured for 48 h until 80% confluency was reached before further treatment. For transfection, METAFECTENE PRO (T040; Biontex) or jetPRIME (144-07; Polyplus) was used according to the manufacturer's protocol. Cell lines were tested for authentication using short tandem repeat profiling and confirmed free of mycoplasma by Cosmogenetech. NAD in chondrosarcoma cells + / NADH ratio was measured using the NAD / NADH assay kit (ab65348; Abcam) according to the manufacturer's instructions.

[0303]

[0304] 4. Histology, immunohistology, and immunofluorescence

[0305] Mouse tibial tissue samples were fixed overnight at 4°C in PBS containing 4% paraformaldehyde. The samples were decalcified in 0.5 M EDTA (pH 7.4) for 3 weeks, and the decalcification solution was changed every 3 days. The tibial tissues were dehydrated using gradually increasing concentrations of ethanol and incubated in xylene. After sample processing, the samples were embedded in paraffin and sectioned at 5 μm thickness. For hematoxylin and eosin (H&E), safranin-O, and immunohistochemical staining, the sections were deparaffinized in xylene and rehydrated in gradually decreasing concentrations of ethanol. For immunohistochemical or fluorescent staining, antigens were recovered in Tris-EDTA buffer (10 mM Tris base, 1 mM EDTA, pH 9.0) at 60°C for 3 hours. Tissues were blocked with 1% bovine serum albumin in PBS and incubated with primary antibodies overnight at 4°C. For immunohistochemical staining, tissues were incubated with 0.3% H2O2 for 5 minutes at room temperature after primary antibody incubation. Tissues were then incubated with biotin-conjugated secondary antibodies for 1 hour at room temperature. Samples were incubated with streptavidin-horseradish peroxidase (HRP) for 30 minutes at room temperature. After incubation, signals were amplified using 3-amino-9-ethylcarbazole (AEC) peroxidase substrate (Sk-4200, Vector Laboratories). Histological or immunohistochemical staining images were captured using a DS-Ri2 camera (Nikon) connected to an upright microscope. Immunohistochemical scores were calculated using the Hirsch index (H-index) formula according to the histological scoring system described by Pirker et al ([ref. 50]): 1 X (proportion of weakly stained cells [1+]) + 2 X (proportion of moderately stained cells [2+]) + 3 X (proportion of strongly stained cells [3+]). All human chondrosarcoma biopsies were individually graded by nationally certified pathologists at US Biomax according to the World Health Organization (WHO) guidelines ([ref. 51]).For immunofluorescence staining, tissues were incubated with secondary antibodies for 1 hour at room temperature. For nuclear staining, cells were incubated with 1 μg / mL DAPI for 10 minutes at room temperature. For immunofluorescence staining of SW1353 cells, cells were fixed in phosphate-buffered saline (PBS) containing 4% paraformaldehyde for 15 minutes at room temperature. After washing three times with PBS, cells were permeabilized in 0.2% Triton X-100 in PBS for 10 minutes at 4°C and washed three times with PBS. Cells were blocked with blocking solution (PBS containing 10 mM glycine, 0.1% bovine serum albumin, and 10% goat serum) for 1 hour at room temperature. After washing three times with PBS, cells were incubated with primary antibodies overnight at 4°C. Cells were then incubated with secondary antibodies for 1 hour at room temperature. Cells were counterstained with DAPI for 10 minutes at room temperature. To assess cell death, a TUNEL assay was performed according to the manufacturer's protocol (MK500; Takara). Cells were counterstained with DAPI for 10 minutes at room temperature. For immunofluorescence detection, images were acquired using the EVOS FL Cell Imaging System (AMF4300; Thermo-Fisher).

[0306]

[0307] 5. μCT analysis

[0308] Seven weeks after stereotactic injection, mice were euthanized, and the tibiae were isolated and fixed in 4% paraformaldehyde overnight at 4°C. The tibiae were scanned using a Bruker Skyscan 1276 in vivo μCT instrument. Samples were scanned for 17 minutes at a 70 kV source and 57 μAm current. A 0.5 mm Al filter was used to reduce beam hardening. Scanned images were reconstructed using NRecon software (Bruker, v1.7.3.2). All 3D images were acquired using CTvox software (Bruker, v3.3.0).

[0309]

[0310] 6. Transcriptome analysis

[0311] For transcriptome analysis, SW1353 cells were transfected with firefly or SIRT1 shRNA. Cells were maintained at 37°C in 3% O2 ​​for 48 hours after seeding. Three biological replicates were used for each group. Total RNA was isolated using TRI reagent (TR 118; Molecular Research Center, Inc.). RNA-seq libraries were generated using the TruSeq Stranded mRNA Library Prep kit (Illumina) at Macrogen. Library verification was performed using an Agilent 2100 Bioanalyzer. RNA was sequenced at Macrogen using an Illumina HiSeq2500 sequencer. Sequence reads were trimmed using Trimmomatic and mapped to the human reference genome (GRCh38) using the STAR aligner. The number of reads per gene was calculated using the quantMode GeneCount option in STAR. We used the DESeq2 R package for differential expression analysis. Downregulated differentially expressed genes (DEGs) were selected by setting the cutoff value of Log2FC < -1; p < 0.01. For GSEA, the normalized coefficients from DESeq2 were used as the input expression dataset. GSEA was performed using GSEA software (v4.1.0) as previously described ([Reference] 48). GSEA was performed with 1,000 permutations. RNA-seq results were interpreted using QIAGEN Ingenuity Pathway Analysis (IPA) ([Reference] 47). Core analysis was performed on DEGs (Log2FC < 1; p < 0.01) in the RNA-seq data. Core analysis identified upstream regulators and diseases or functions based on the expression patterns of genes involved in pathways or biological functions. Activation Z scores and p values ​​for DEGs were calculated using IPA.

[0312]

[0313] 7. Proximity ligation assay (PLA)

[0314] SW1353 and JJ012 cells were used for PLA. PLA was performed using the Duolink In Situ Red Starter Kit (DUO92101; Sigma-Aldrich) according to the manufacturer's protocol. For detection, cells were imaged using a confocal laser scanning microscope (TCS SP8; Leica). To evaluate PLA in tissues, sections were deparaffinized in xylene and rehydrated using decreasing concentrations of ethanol. PLA was performed using the Duolink In Situ Red Starter Kit (DUO92101; Sigma-Aldrich) according to the manufacturer's protocol. Images were acquired using the EVOS FL Cell Imaging System (AMF4300; Thermo-Fisher).

[0315]

[0316] 8.Western blot and immunoprecipitation

[0317] SW1353, JJ012, OUMS-27, and HEK 293T cells were used for Western blot analysis. Cell lysates were lysed in radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 1% NP-40, 50 mM Tris, pH 8.0, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate (SDS)) supplemented with a protease inhibitor cocktail (S8820; Sigma-Aldrich). Cell lysates were quantified using the bicinchoninic acid (BCA) assay and analyzed using SDS-polyacrylamide gel electrophoresis (PAGE). For overexpression, pcDNA3.1-FLAG-EPAS1 (subcloned from pcDNA3-HA-EPAS1), pcDNA3.1-FLAG-EPAS1, and pcDNA3.1-HA-EPAS1 were transfected into HEK 293T cells.K3R (pcDNA3-HAEPAS1 K3R (subcloned from ), pcDNA3-HA-EglN1 (plasmid #18963; Addgene), pcDNA3-HA-EglN2 (plasmid #18961; Addgene), or pcDNA3-HAEglN3 (plasmid #18960; Addgene) were transfected. pcDNA3-HA-EPAS1 K3R For cloning, site-directed mutagenesis was performed using mismatch synthetic oligonucleotides using PCR-mediated overlap extension technology. HEK 293T cells were cultured with DMSO or 100 μM EX527 for 12 h and then treated with MG132 for 6 h before harvest. SW1353 cells were cultured for 48 h in 3% O2 ​​and then transfected with pcDNA3-HA-EPAS1, pCMV6-SIRT1 (RC218134; Origene), or pCMV6-SIRT1. H363Y (SIRT1 H363Y -FLAG was subcloned; plasmid #1792; Addgene) was transformed. MG132 was treated for 6 hours before harvest. Cells were lysed using EBC200 buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% NP-40, and 1 mM EDTA) with a protease inhibitor cocktail. Cell lysates were used for pulldown with protein A / G-Sepharose beads (17-5280-01, 17-0618-01, GE Healthcare) and anti-SIRT1 antibody (ab32441, Abcam). Actin was used as a loading control. Primers used for cloning are listed in Table 1. In Table 1, F: forward primer, R: reverse primer.

[0318] Name sequence (5'→3') NAMPT-FCAGATATCGATGAATCCTGCGGCA (SEQ ID NO: 2) NAMPT-RTTGGATCCCTAATGATGTGCTGCTTC (SEQ ID NO: 3) NAPRT-FGGGAGCAGGATGGCGG (SEQ ID NO: 4) NAPRT-RCCCGCTCCGAGTCTCAGG (SEQ ID NO: 5)

[0319]

[0320] 9. Lentivirus production

[0321] Lentiviruses were produced using the pGIPZ vector (clone no. V3LHS_389161; GE Dharmacon), which contains shRNA targeting human SIRT1. The nucleotide sequence of the shRNA targeting human SIRT1 was TTCTGGTGAACTTGAGTCT (SEQ ID NO: 1). As a control vector for pGIPZ-SIRT1, the pGIPZ vector containing shRNA targeting firefly luciferase was kindly provided by Professor Chanhee Kang (Seoul National University, Seoul, Korea). To construct lentiviral NAMPT, NAPRT or IDO1 overexpression vectors, pLVX-NAMPT was subcloned into pCMV10-NAMPT, pLJM1-NAPRT was subcloned into pCMV10-NAPRT and pLVX-IDO1 was subcloned into pSPORT6-IDO1 (hMU003983; KHGB).

[0322] The lentiviral pLKO.1 puro vector containing the sequences of scrambled or EPAS1 shRNA used in a previous study (see Reference 23) was used for lentivirus production. Specifically, to produce lentiviral vectors containing the sequences of EPAS1 shRNA and scrambled shRNA, the sequences of scrambled and EPAS1 shRNA were inserted into the pLKO.1 puro plasmid (Addgene, plasmid # 8453). The sequences used for cloning are as follows:

[0323] 1. scramble shRNA pLKO.1-F (control): CCGGAAACAAGATGAAGAGCACCAACTCGAGTTGGTGGCTCTTCATCTTGTTTTTTTTG (SEQ ID NO: 24)

[0324] 2. Scramble shRNA pLKO.1-R (control): AATTCAAAAAAAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTT (SEQ ID NO: 25)

[0325] 3. EPAS1 shRNA oligo pLKO.1-F: CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTTG (SEQ ID NO: 26)

[0326] 4. EPAS1 shRNA oligo pLKO.1-R: AATTCAAAAACAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTG (SEQ ID NO: 27)

[0327] Lentivirus EPAS1 and EPAS1 K3R To construct the overexpression vector, pLVX-EPAS1 was subcloned into pcDNA3-HA-EPAS1, and pcDNA3-HA-EPAS1 K3R pLVX-EPAS1 in K3R was subcloned. This vector was co-transfected into HEK 293T cells with psPAX2 (plasmid #12260; Addgene) and pMD2.G (plasmid #12259; Addgene). Two days after transfection, cell supernatants were collected and filtered through a 0.45 μm filter. For lentiviral transduction, SW1353, JJ012, and OUMS-27 cells were treated with the indicated lentiviruses in the presence of 8 μg / mL polybrene (Sigma-Aldrich) for 24 h. Infected cells were selected by treatment with 1 μg / mL puromycin or 150 μg / mL hygromycin for 3 days.

[0328]

[0329] 10. Luciferase assay

[0330] SW1353, JJ012, and OUMS-27 cells were transfected with a firefly luciferase vector containing hypoxia-responsive element repeats and the thymidine kinase promoter. The Renilla luciferase reporter plasmid (pRL-TK) was used as a control. HIF-1α, HIF-2α, and HIF-2α K3R , HIF-2α P2A For overexpression of IDO1, NAMPT, NAPRT, and SIRT1, the following plasmids were used: pCMV10-HIF1A, pcDNA3-HA-EPAS1, pcDNA3-HA-EPAS1 K3R , pcDNA3-HA-EPAS1 P2A , pSPORT6-IDO1 (hMU003983; KHGB), pCMV10-NAMPT (cloned from CHON-001 cDNA, see [Key Resources Table] below), pCMV10-NAPRT (cloned from CHON-001 cDNA, see [Key Resources Table] below), and pCMV6-SIRT1 (RC218134; Origene). These plasmids were transfected into SW1353 and OUMS-27 cells using METAFECTENE PRO and into JJ012 cells using jetPRIME. Six hours after transfection, cells were treated with EX527 or nicotinamide in fresh medium at the indicated doses for the indicated periods. Firefly luciferase activity was measured using luciferin, and data were normalized to Renilla luciferase activity. Luciferase assays were performed using a Varioskan LUX microplate reader (VL0L00D0; Thermo-Fisher).

[0331]

[0332] 11. Colony formation analysis

[0333] SW1353 cells transduced with lentivirus were suspended in DMEM supplemented with 10% FBS and seeded in 6-well plates. 500 cells transduced with pGIPZ and SIRT1 containing shRNA were seeded in each well, and 500 cells transduced with EPAS1 were seeded in each well. K3R 1 x 10 transduced with overexpressing lentivirus 3 Cells were seeded in each well. The cells were cultured in DMEM supplemented with 10% FBS under hypoxic conditions, with the medium replaced every 3 days for 7 days. The medium was then changed to serum-free DMEM without glucose, glutamine, or phenol red (A1443001, Gibco), followed by 2 PBS washes for 2 days with serum-free DMEM supplemented with 4 mM glutamine, 0.5 mM glucose, and 1% antibiotics. When the medium was changed to serum-free DMEM, EX527 was treated with DMSO. Colonies were fixed in ice-cold 4% paraformaldehyde solution for 2 minutes. Cells were then permeabilized in 100% methanol for 20 minutes. Cells were stained with 0.1% (w / v) crystal violet solution for 20 minutes. The remaining solution was washed twice with PBS, and the cells were then washed with distilled water.

[0334]

[0335] 12. Quantitative PCR (qPCR)

[0336] Total RNA was extracted using TRI reagent and reverse transcribed using EasyScript reverse transcriptase (AE101-02; TransGen Biotech). For quantitative analysis of relative transcript levels, cDNA was amplified using RT-qPCR with SYBR Green PCR Master Mix (4367659; Applied Biosystems) on a StepOnePlus Real-Time PCR System (4376600; Applied Biosystems). Transcript data were analyzed using the DDCt method, and HPRT transcript levels were used as a housekeeping control gene. The primers used for RT-qPCR are listed in Table 2. In Table 2, F: forward primer, R: reverse primer.

[0337] Name sequence (5'→3') HPRT-FCCTGGCGTCGTGATTAGTG (SEQ ID NO: 6) HPRT-RCTTGCGACCTTGACCATCTTT (SEQ ID NO: 7) SIRT1-FTAGTAGGCGTTGATGGTAAT (SEQ ID NO: 8) SIRT1-RCCTTTCTGGTTTCCTTGCTCT (SEQ ID NO: 9) DEPP1-FGGTCTCTGAAAGGGAAATGCT (SEQ ID NO: 10) DEPP1-RGAGCGAACGGGATTGGTAA (SEQ ID NO: 11) DTNA-FCCTGTAACCAGCATGAACGAC (SEQ ID NO: 12) DTNA-RGAGGTGGCTGAGACGAAGAG (SEQ ID NO: 13) PLOD2-FCAACCAACCCCTTTTCTACC (SEQ ID NO: 14) PLOD2-RCCATACTCCTACTCTATTCCCT (SEQ ID NO: 15) NAMPT-FCCGACTCCTACAAGGTTACT (SEQ ID NO: 16) NAMPT-RCCTGGATTTTCTCTTTGGTTACTAC (SEQ ID NO: 17) NAPRT-FGTGGTCTCCCCAACTTCCTA (SEQ ID NO: 18) NAPRT-RATTCACCTCACTGCCCTCC (SEQ ID NO: 19) BCL2-FGTGGCCTTCTTTGAGTTCG (SEQ ID NO: 20) BCL2-RCATCCCAGCCTCCGTTAT (SEQ ID NO: 21) BCL2L1-FTGCGTGGAAAGCGTAGAC (SEQ ID NO: 22) BCL2L1-RTCCACAAAAGTATCCCAGCC (SEQ ID NO: 23)

[0338]

[0339] 13. Flow cytometry

[0340] 35-mm 2 2X10 on a plate 5SW1353 and JJ012 cells were seeded. After culturing for 48 h at 3% O2, the cells were starved in serum-free DMEM for 12 h. The medium was then replaced with DMEM without glucose, glutamine, or phenol red (A1443001; Gibco), to which 4 mM glutamine was added. The cells were treated with the indicated doses of glucose in the presence of DMSO or EX527 for 12 h. For dead cell analysis, the cells were trypsinized and collected after washing with PBS at the end of the treatment. They were then centrifuged and 2 × 10 per sample were collected. 5 Cells were resuspended in phosphate-buffered saline (PBS). For dead cell staining, cells were stained with Zombie green dye at a 1:500 dilution using the Zombie Green Fixable Viability Kit for 20 minutes in the dark. To stain cells transduced with pGIPZ containing shRNA, cells were stained with Zombie aqua dye at a 1:500 dilution using the Zombie Aqua Fixable Viability Kit for 20 minutes in the dark. Cells were then centrifuged and resuspended in PBS containing 5% FBS. Flow cytometry experiments were performed on an Attune NxT flow cytometer (Invitrogen) using Attune NxT software. All collected flow cytometry data were analyzed with FlowJo software (BD Biosciences, v10.7.2).

[0341]

[0342] 14. Survival Analysis

[0343] SW1353 and JJ012 cells stably overexpressing NAMPT and NAPRT were seeded at 4×10 per well in 48-well plates. 4Cells were seeded with 10 μg / ml ...

[0344]

[0345] 15. Bioinformatics analysis

[0346] After performing Z-score normalization on transcriptome profiling data of chondrosarcoma (E-MTAB-7264), NAD + K-means clustering was performed based on biosynthetic processing genes (GO:0009435). The optimal number of clusters was determined using the silhouette method. In the heatmap visualizing the gene expression levels of each cluster, clusters with high expression of key genes, including NAMPT, NARPT, and IDO, which play rate-limiting roles in each synthetic pathway (salvage pathway, Preiss-Handler pathway, and de novo pathway, respectively), were identified. + Pathways were classified into clusters with upregulation. Kaplan-Meier survival estimates and log-rank tests were used to assess survival differences between clusters. NAD for survival in patients with chondrosarcoma + To evaluate the individual contribution of the biosynthetic genes, the transcriptional information of each gene was excluded and the procedure described above (NAD excluding specific genes) was repeated. +The same analysis was performed using K-means clustering based on biosynthetic process genes, Kaplan-Meier survival estimates for each cluster, and log-rank test between clusters. If the significance of the survival difference between clusters decreased when a specific gene was excluded, it was interpreted that the expression level of the excluded gene significantly affected chondrosarcoma survival. The analysis was performed using the R program version 4.2.2. Specifically, the silhouette method and the factoextra package for visualizing clustering results, the stats package for k-means clustering, and the pheatmap package for generating heatmaps were utilized.

[0347]

[0348] 16. Quantification and Statistical Analysis

[0349] All experiments were performed independently at least three times. To measure statistically significant differences between two groups, a two-tailed unpaired Student's t test was used as a parametric test. The Wilcoxon test was used as a nonparametric test for statistical analysis between two groups. To compare multiple groups and repeated measurements, the Kruskal-Wallis test and Dunnett's test were used for nonparametric data, and the two-way ANOVA test and the Turkey or Sida's k post-hoc test were used for parametric data. Cohen's D score was calculated to assess the practical significance of the differences observed between the experimental and control groups. Survival curves were estimated using the Kaplan-Meier method, and significance was determined using the log-rank test. All data are expressed as the mean ± SEM. Statistical significance was considered at p < 0.05. To measure the correlation between two groups, the R and p values ​​were analyzed using the Pearson correlation coefficient. All graphs and statistical analyses were performed using GraphPad Prism 9.0 software. Combenefit software was used to generate Loewe synergy plots and calculate p values. Synergy response data were generated across biological replicates.

[0350]

[0351] 17. Data and Code Availability

[0352] Plasmids generated in this study can be provided under an appropriate material transfer agreement (MTA). The RNA sequencing dataset generated in this study is available in the Gene Expression Omnibus (GEO): Accession number: GSE248490. Unsupervised clustering analysis was performed using mRNA profiling of cartilage tumor arrays (E-MTAB-7264). All analysis code is deposited at Zenodo and is publicly available. DOIs are listed in the main resource table.

[0353] [Key Resources Table]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360] [References]

[0361] 23. Shen, Chuan, et al. “Genetic and Functional Studies Implicate HIF1 α as a 14q kidney cancer suppressor gene.” Cancer discovery 1.3 (2011): 222-235.

[0362] 33. Nicolle, R. et al. (2019). Integrated molecular characterization of chondrosarcoma reveals critical determinants of disease progression. Nat. Commun. 10, 4622.

[0363] 40. Kondo, K., Klco, J., Nakamura, E., Lechpammer, M., and Kaelin, W.G. (2002). Inhibition of HIF is necessary for tumor suppression by the von Hippel-Lindau protein. Cancer Cell 1, 237-246.

[0364] 41. Yan, Q., Bartz, S., Mao, M., Li, L., and Kaelin, W.G. (2007). The hypoxiainducible factor 2 alpha N-terminal and C-terminal transactivation domains cooperate to promote renal tumorigenesis in vivo. Mol. Cell Biol. 27, 2092-2102.

[0365] 42. Ivan, M., Haberberger, T., Gervasi, D.C., Michelson, K.S., Gunzler, V., Kondo, K., Yang, H., Sorokina, I., Conaway, R.C., Conaway, J.W., and Kaelin, W.G. (2002). Biochemical purification and pharmacological inhibition of a mammalian prolyl hydroxylase acting on hypoxia-inducible factor. Proc. Natl. Acad. Sci. USA 99, 13459-13464.

[0366] 43. Lee, S., Nakamura, E., Yang, H., Wei, W., Linggi, M.S., Sajan, M.P., Farese, R.V., Freeman, R.S., Carter, B.D., Kaelin, W.G., Jr., and Schlisio, S. (2005). Neuronal apoptosis linked to EglN3 prolyl hydroxylase and familial pheochromocytoma genes: developmental culling and cancer. Cancer Cell 8, 155-167.

[0367] 44. Brunet, A., Sweeney, L.B., Sturgill, J.F., Chua, K.F., Greer, P.L., Lin, Y., Tran, H., Ross, S.E., Mostoslavsky, R., Cohen, H.Y., et al. (2004). Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303, 2011-2015.

[0368] 45. Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21.

[0369] 46. Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550.

[0370] 47. Kra¨ mer, A., Green, J., Pollard, J., Jr., and Tugendreich, S. (2014). Causal analysis approaches in Ingenuity Pathway Analysis. Bioinformatics 30, 523-530.

[0371] 48. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and Mesirov, J.P. (2005). Gene set enrichment analysis: a knowledgebased approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545-15550.

[0372] 49. Di Veroli, G.Y., Fornari, C., Wang, D., Mollard, S., Bramhall, J.L., Richards, F.M., and Jodrell, D.I. (2016). Combenefit: an interactive platform for the analysis and visualization of drug combinations. Bioinformatics 32, 2866-2868

[0373] 50. Pirker, R., Pereira, JR, von Pawel, J., Krzakowski, M., Ramlau, R., Park, K., de Marinis, F., Eberhardt, WEE, Paz-Ares, L., Sto ̈ rkel, S., et al. (2012). EGFR expression as a predictor of survival for first-line chemotherapy plus cetuximab in patients with advanced non-small-cell lung cancer: analysis of data from the phase 3 FLEX study. Lancet Oncol. 13, 33-4

[0374] 51. Fletcher, CDMWorld Health Organization; International Agency for Research on Cancer (2002). WHO Classification of Tumors of Soft Tissue and Bone, 4th Edition (IARC Press).

[0375]

[0376]

[0377] [실험결과]

[0378] 1. Figure 1. The SIRT1 HIF-2α antibody is shown in Fig. 1 .

[0379] Using a panel of chondrosarcoma biopsies, we observed that high expression of SIRT1 was significantly associated with high-grade tumors, such as grade III and dedifferentiated chondrosarcomas (Figs. 1a and 1b). Gene set enrichment analysis (GSEA) revealed that a characteristic gene set underlying chondrosarcoma malignancy was significantly negatively enriched in the transcriptomes of SIRT1-silenced chondrosarcoma cells (Fig. 1c). Ingenuity Pathway Analysis (IPA) was also performed on differentially expressed genes (DEGs) upon SIRT1 knockdown. Nine of the top ten annotations associated with SIRT1-regulated DEGs fell into the “cancer” category of the IPA disease and function annotations (Fig. 1d, Table 3). IPA upstream regulator analysis predicted potential transcriptional regulators regulating the expression of the identified DEGs, with SMARCA4, ATF4, and HIF-2α (encoded by EPAS1) as key candidates (Fig. 1e, Table 4). GSEA revealed that HIF-2α target genes were negatively enriched in transcriptomes from SIRT1-knocked chondrosarcoma cells (Fig. 1f). SIRT1 expression levels showed a moderate positive correlation with HIF-2α levels in chondrosarcoma biopsies (Fig. 1g). Interestingly, in situ proximity ligation assay (PLA) and co-immunoprecipitation analysis revealed a protein-protein interaction between endogenous SIRT1 and HIF-2α in chondrosarcoma cells (Fig. 1h, i). Surprisingly, PLA signals were barely observed in both the growth plate and articular cartilage. In contrast, PLA signal was elevated in SW1353 orthotopic chondrosarcoma tumors grown within the tibial bone marrow cavity, suggesting that HIF-2α and SIRT1 frequently interact in the chondrosarcoma tumor microenvironment.

[0380] [Table 3]

[0381]

[0382] [Table 4]

[0383]

[0384]

[0385] 2. Experimental Example 2. SIRT1 enhances HIF-2α activity and promotes chondrosarcoma tumor growth in a xenograft model.

[0386] SW1353 chondrosarcoma cells transfected with SIRT1 overexpression vector showed a marked increase in the protein level of endogenous HIF-2α (Fig. 2a). In contrast, enzymatically inactive SIRT1 mutant (SIRT1 H363Y ) did not result in a similar increase in HIF-2α in SW1353 cells. SIRT1 overexpression significantly increased the transcriptional activity of HIF-2α in chondrosarcoma cells (Figs. 2b and 2c), whereas overexpression of an enzymatically inactive mutant suppressed HIF-2α transcriptional activity, functioning as a dominant-negative mutant of SIRT1. SIRT1 knockdown suppressed both the protein level and activity of HIF-2α and its target gene expression in three chondrosarcoma cell lines, SW1353, JJ012, and OUMS-27 (Figs. 2c, 2d, and 6b). Similarly, HIF-2α stability, transcriptional activity, and target gene expression were attenuated by treatment with nicotinamide or the selective SIRT1 inhibitor EX527 (Figs. 2e and 6c-6e). HIF-2α mutated at the acetylation site (K385R, K685R, and K741R; HIF-2α K3R The protein levels and transcriptional activity of HIF-2α (as indicated) were not affected by the inhibition of SIRT1 (Fig. 2f, Fig. 7a). K3R The mutants consistently exhibited higher transcriptional activity than their wild-type (WT) counterparts, regardless of the presence of EX527 (Fig. 2f). SIRT1, an enzymatically inactive mutant H363YCompared to overexpression of WT SIRT1, overexpression of WT SIRT1 significantly reduced the level of HIF-2α acetylation, confirming that the deacetylase activity of SIRT1 is essential for removing acetyl groups from HIF-2α (Fig. 2g). Interestingly, we observed that HIF-2α regulation through SIRT1 was dependent on the hydroxylation site of the oxygen-dependent degradation domain of HIF-2α (Fig. 2h, Fig. 7a). Consistent with these results, HIF-2α K3R The mutation alters the interaction of HIF-2α with the HIF prolyl hydroxylase (PHD) enzyme, which is involved in the proteasomal degradation pathway of HIF-2α. K3R We observed that SIRT1 was lost in the mutant (Fig. 2i). Meanwhile, in chondrosarcoma cell lines, SIRT1 did not affect the stability or transcriptional activity of HIF-1a, highlighting that SIRT1 is specific for regulating the function of HIF-2α in these tumor cells.

[0387] Next, we explored the genetic interaction between SIRT1 and HIF-2α in chondrosarcoma cell growth using a colony formation assay. SW1353 cells overexpressing SIRT1 exhibited a significant increase in colony formation compared to controls. This effect was completely abrogated by HIF-2α knockdown, resulting in smaller, less defined colonies (Fig. 2j). These results establish HIF-2α as a downstream transcription factor mediating the effects of SIRT1 on chondrosarcoma tumor growth. To explore the potential role of SIRT1 in the pathogenesis of chondrosarcoma, we used murine orthotopic xenograft models, in which SW1353 cells stably transfected with SIRT1 short hairpin RNA (shRNA) or control shRNA were transplanted into the tibias of athymic mice. SIRT1 knockdown effectively suppressed tumor growth and osteolytic expansion, limiting extraosseous growth (Figs. 2k-2m and 7b). Consistent with these observations, SIRT1 knockdown reduced proliferation and increased apoptosis within transplanted tumors (Figures 2n and 2o). We further investigated the role of SIRT1 in chondrosarcoma tumor growth using an alternative tumor xenograft model. Subcutaneous injection of JJ012 resulted in reliable tumor growth in nude mice. Stable transduction of shSIRT1 into JJ012 cells significantly inhibited chondrosarcoma tumor growth, resulting in smaller tumor sizes and weights compared to the control group (Figures 2p and 2q).

[0388]

[0389] 3. Experimental Example 3. Chondrosarcoma cells tolerate glucose deprivation through activation of the SIRT1-HIF-2α axis.

[0390] Having established a critical role for SIRT1 in promoting the survival and growth of chondrosarcoma tumors, we further questioned whether the SIRT1-mediated pathway is utilized for chondrosarcoma cell survival in the harsh tumor microenvironment, which presents a significant metabolic challenge. For example, chondrosarcoma tumors are often characterized by poor vascularity and a dense stromal network, which significantly limit the supply of nutrients and oxygen to tumor cells. Glucose deprivation has been described as a critical factor in SIRT1 activation, which is required for NAD+ activation. +It was shown that the relative abundance of NADH was significantly increased (Fig. 3a). Glucose deprivation significantly promoted the stabilization of HIF-2α (Fig. 3b); this effect was abolished by knockdown of SIRT1 (Fig. 3c). Notably, while glucose deprivation alone did not induce apoptosis in chondrosarcoma cells, knockdown of SIRT1 significantly induced apoptosis in glucose-deprived SW1353 and JJ012 cells (Fig. 3d), as evidenced by the detection of cleaved PARP and decreased Bcl-2 expression (Fig. 3e). Inhibition of SIRT1 activity with EX527 abolished glucose deprivation-induced HIF-2α stabilization, making chondrosarcoma cells more susceptible to apoptosis (Figs. 3f, 3g, and 8). In particular, the expression levels of antiapoptotic genes harboring multiple consensus HIF binding sites (-RCGTG-) in their proximal promoter regions (Fig. 9b), particularly BCL2 and BCL2L1, were upregulated in response to glucose deprivation (Fig. 3h). This upregulation occurred concurrently with the stabilization of HIF-2α, likely promoting the survival of chondrosarcoma cells. However, after treatment with EX527, the expression of both BCL2 and BCL2L1 was suppressed (Fig. 3h). This is similar to the apoptotic response observed in chondrosarcoma cells exposed to glucose deprivation and SIRT1 inhibition (Figs. 3f, 3g, and 8). Similarly, knockdown of HIF-2α led to apoptosis in glucose-deprived chondrosarcoma cells, accompanied by decreased expression of BCL2 and BCL2L1 (Figs. 3i to 3k).

[0391] To further confirm the validity of the SIRT1-HIF-2α axis, WT HIF-2α and HIF-2α rescued the apoptotic effects induced by glucose deprivation and EX527. K3RThe efficacy of the mutants was comparatively evaluated. Both SW1353 and JJ012 cells overexpressing HIF-2α showed a significant reduction in EX527-induced cell death in the absence of glucose compared to cells transduced with the empty vector (Fig. 3l). Surprisingly, HIF-2α K3R Mutations further attenuated apoptosis, suggesting that fully deacetylated HIF-2α can more efficiently rescue the apoptotic effects of EX527 under glucose deprivation conditions. Consistently, HIF-2α K3R Expression of the mutant restored the expression of BCL2 and BCL2L1 while inhibiting the production of cleaved PARP in chondrosarcoma cell lines. Furthermore, the colony forming ability was impaired in SW1353 cells treated with EX527 under glucose-limited conditions, and HIF-2α was detected. K3R When the mutation was introduced, it was recovered (Fig. 3m).

[0392] Overall, our findings highlight the central role of the SIRT1-HIF-2α axis in enhancing chondrosarcoma cell survival and suggest that targeting this axis may be a viable therapeutic strategy to sensitize chondrosarcoma cells to apoptosis.

[0393]

[0394] 4. Experimental Example 4. Inhibition of SIRT1 exposes chondrosarcoma cells to NAD+-dependent vulnerability.

[0395] Doxorubicin is generally recommended as a first-line chemotherapy option for the treatment of chondrosarcoma. However, chondrosarcoma cells often exhibit significant resistance to doxorubicin-induced apoptosis. Therefore, we investigated the potential synergistic effect of doxorubicin and the SIRT1 inhibitor EX527 to enhance apoptosis induction in chondrosarcoma cells.

[0396] The combination of the two drugs showed synergistic cytotoxic effects in a 4 X 3 dose matrix for Loewe additivity models in SW1353 and JJ012 cells (Fig. 4a and b). Interestingly, doxorubicin treatment induced NAD+ in chondrosarcoma cells. + / NADH ratio was significantly reduced, whereas SIRT1 inhibition was suppressed by doxorubicin treatment. + / NADH ratio was partially restored (Fig. 4c).

[0397] To investigate the potential therapeutic utility of SIRT1 inhibition in vivo, EX527 was administered together with the conventional antitumor agent doxorubicin to a subcutaneous tumor model of JJ012 cells. Two weeks after tumor implantation, mice were divided into four groups and administered vehicle, doxorubicin, EX527, or a combination of doxorubicin and EX527. These treatments did not significantly affect mouse body weight (Figures 4d and 4e). Tumors in the groups treated with EX527 or doxorubicin showed delayed tumor growth and lower tumor weights than the control group (Figures 4f and 4g). Meanwhile, co-administration of doxorubicin and EX527 further inhibited JJ012 tumor growth, and the tumor size and weight were the smallest among the experimental groups (Figures 4f and 4g). The potential in vivo therapeutic efficacy of SIRT1 inhibitors in combination with doxorubicin was further evaluated in an orthotopic mouse model of SW1353 chondrosarcoma (Figures 4h and 9). Combination therapy with doxorubicin and EX527 virtually abolished osteolytic tumor expansion within the tibial marrow cavity and invasive tumor growth into the periarticular muscle tissue (Figures 4i and 4j). These findings comprehensively demonstrate the efficacy of SIRT1-targeted therapy in combination with conventional chemotherapy in the treatment of chondrosarcoma.

[0398]

[0399] 5. Experimental Example 5. A subgroup of high-risk chondrosarcoma patients is characterized by upregulation of NAD+ biosynthetic genes.

[0400] Next, the SIRT1-HIF-2α axis and NAD + Noting the significant association of accumulation, we used transcriptome data from a cohort of patients with cartilage tumors (n = 164; E-MTAB-7264) to identify “NAD + Unsupervised clustering analysis was performed on the "biosynthetic process" gene ontology (GO) gene set. The unsupervised clustering analysis used a publicly available chondrosarcoma transcriptome dataset obtained through a French hospital network (see [Reference] 33). First, k-means clustering was performed and the number of clusters was determined using the silhouette score. Specifically, Z-score normalization was performed on the transcriptome profiling data of carcinomas, and then -k-means clustering was performed based on the transcript expression levels of the dataset of candidate metabolic pathways. The optimal number of clusters was determined using the silhouette method. The analysis results showed that patients with cartilage tumors had higher levels of NAD + Based on the gene expression patterns of the pathway genes, the clusters were best classified into two clusters (Fig. 5a and 5b). In the heatmap visualizing the gene expression levels of each cluster, clusters with high expression of key genes that play a rate-limiting role in each synthetic pathway were judged to be clusters in which the candidate metabolic pathway was upregulated. The second subtype, cluster 2 (n = 32), was characterized by NAD +It was characterized by increased expression of biosynthetic genes, particularly those with rate-limiting effects in each synthetic pathway. Specifically, NAMPT, nicotinic acid phospho-ribose transferase (NAPRT), and indoleamine 2,3-dioxygenase (IDO) were upregulated in the salvage pathway, pre-handler pathway, and de novo pathway, respectively (Fig. 5c). The association of cluster 2 with dedifferentiated chondrosarcoma, the subtype with the highest mortality rate, was very striking (Fig. 5c). Pinieux and colleagues ([Reference] 33) classified this patient population into two groups (E1 and E2) based on patterns of the whole transcriptome, designating the E2 group as a subtype characterized by high levels of cell cycle progression genes, loss of cartilage marker genes, and high chromosomal instability. This was associated with a poorer prognosis overall compared to that observed in the E1 group (log-rank test p = 2.05X10 -4 ). A higher prevalence of E2 patients was observed in cluster 2, suggesting that cluster 2 is likely to exhibit the molecular phenotype of highly aggressive chondrosarcoma (Fig. 5c). The genes marked in red in Fig. 5c are core genes of the corresponding metabolic pathways, and the expression levels of these core genes were high in cluster 2, suggesting that cluster 2 is a cluster with high expression of candidate metabolic pathways. To evaluate the difference in survival rates between clusters, the Kaplan-Meier survival estimation method and the log-rank test were used. If a significant difference in survival rates was observed between clusters, the candidate metabolic pathway was judged to be a metabolic mechanism that affects the survival of cancer depending on its expression level. In fact, chondrosarcoma patients classified into cluster 2 had a significantly lower overall survival rate, which was significantly different in the log-rank test (p = 4X10 -12; Figures 5d and 10a show the overall survival of patients with cartilage tumors, including both benign and malignant cases.). On the other hand, cluster 1 (n = 132) showed a significant increase in NAD, including NAMPT, NAPRT, and IDO. + It is characterized by relatively low expression of biosynthetic genes (Fig. 5c). This cluster shows a significant prevalence in E1 patients, suggesting a closer association with the molecular characteristics of benign tumors. Consistent with this, Cluster 1 primarily includes patients diagnosed with low-grade chondrosarcomas and generally showed a better prognosis (Fig. 5d and Fig. 10a). These observations suggest that NAD + Collectively, we demonstrate that a group of chondrosarcoma patients characterized by an upregulated expression profile of biosynthetic genes is associated with the aggressiveness of chondrosarcoma tumors.

[0401] NAD + To investigate potential mechanistic links between the biosynthetic pathway and HIF-2α signaling, three NAD + We established SW1353 cell lines stably overexpressing NAMPT, NAPRT, or IDO1, which encode rate-limiting enzymes in the biosynthetic pathway. Overexpression of NAMPT or NAPRT induces NAD + / NADH ratio significantly increased, and at the same time, the transcriptional activity of HIF-2α was increased (Fig. 5e). Interestingly, overexpression of IDO1 increased NAD + / NADH ratio was slightly increased, but the difference was not statistically significant. However, the transcriptional activity of HIF-2α was significantly increased (Fig. 5e).

[0402] Next, NAD is used to determine patient prognosis. +To quantitatively assess the relative importance of each gene involved in the biosynthetic pathway, we evaluated the robustness of the classification after excluding each individual gene listed in Figure 5f from the same patient cohort (Figure 5f; Figures 11aa to 11b). Specifically, to evaluate the individual contribution of each gene included in the metabolic pathway datasets mined in Figures 5a to 5d to cancer patient survival, we repeated the previously described procedure (i.e., k-means clustering based on expression levels of the metabolic pathway dataset excluding the specific gene, Kaplan-Meier survival estimation for each cluster, and log-rank test between clusters) after excluding the transcriptional information of the specific gene. If the statistical significance of the survival rate difference between two clusters decreased after excluding the specific gene, the expression level of the gene was interpreted as having a significant impact on chondrosarcoma survival, and the gene was determined to be a targetable target for cancer therapy. Surprisingly, clustering could not classify patients according to overall survival only when the transcriptional information of NAMPT or NAPRT was removed (log-rank test p > 0.05; Fig. 5f). This confirmed that NAMPT or NAPRT is a significant prognostic factor. Pharmacological inhibitors of NAMPT and NAPRT, FK866 and 2-hydroxynicotinic acid (2-HNA), respectively, inhibited the stabilization of HIF-2α, especially at high doses (Figs. 5g and 5h). Importantly, the amplification of HIF-2α transcriptional activity by NAMPT or NAPRT was effectively suppressed by SIRT1 inhibition in SW1353, JJ012, and OUMS-27 chondrosarcoma cell lines (Figs. 5i and 5j). This suggests that NAD+ is a key factor in chondrosarcoma. + - This is a result of strengthening the role of the SIRT1-HIF-2α axis.

[0403] Next, the effects of SIRT1 inhibition and NAMPT or NAPRT inhibition were compared when combined with doxorubicin treatment to induce cell death. NAMPT inhibition was shown to induce NAD+ in SW1353 and JJ012 cells. + / NADH ratio. However, SIRT1 inhibition most significantly increased doxorubicin-induced cell death, suggesting that NAD is required for survival in chondrosarcoma cells. + It is effective in disrupting metabolic dependence (Fig. 10b). Simultaneous introduction of NAMPT and NAPRT overexpression vectors into SW1353 and JJ012 cells significantly enhanced resistance to doxorubicin compared to cells transfected with the empty vector (Fig. 10c). This suggests that NAD+ is essential for establishing resistance to chemotherapy in chondrosarcoma cells. + We emphasize that upregulation plays a crucial role. However, co-treatment with doxorubicin and EX527 effectively abolished the survival advantage gained by chondrosarcoma cells overexpressing NAMPT and NAPRT (Fig. 10c).

[0404] Finally, NAD + We tested whether co-targeting SIRT1 with the synthetase could synergistically sensitize these NAMPT and NAPRT-overexpressing cells to doxorubicin-induced apoptosis. However, while each inhibitor effectively suppressed HIF-2α expression at high concentrations of EX527, FK866, and 2-HNA (Figs. 2e, 5g, and 5h), co-administration of all three drugs did not further enhance the synergistic effect compared to EX527 (Fig. 10d).

[0405] Next, NAD +Recognizing the potential toxicity and side effects associated with NAD depletion, we explored their combined effects at low doses. FK866 and 2-HNA did not induce additional cytotoxicity in the presence of doxorubicin at 1 nM and 0.5 mM, respectively, and EX527 did not induce additional cytotoxicity at 25 μM either (Figs. 5k and 5l). Nevertheless, when all three inhibitors were co-administered at relatively low doses, a marked synergistic effect was observed, inducing marked apoptosis of NAMPT and NAPRT-overexpressing chondrosarcoma cells (Figs. 5k and 5l). Collectively, these findings suggest that NAD depletion is a key factor in the development of NAD + A combination therapeutic strategy that simultaneously targets NAD synthesis enzyme and SIRT1 enzyme activity + This suggests that it may be a promising therapeutic approach for effectively treating chondrosarcoma cells with increased expression of synthetic enzymes.

[0406]

[0407] 6. Experimental Example 6. Development of a survival prognosis prediction model for cancer patients based on transcriptome expression levels of metabolic pathways.

[0408] We developed a prognostic prediction model for chondrosarcoma patients based on support vector machines (SVM). Methods for classifying prognostic groups include: i) dividing patients into those who survived (good prognosis group) and those who died (poor prognosis group) after a specific follow-up period (e.g., 6 months or 1 year); or ii) dividing patients into those who survived without disease progression (good prognosis group) and those who experienced recurrence or metastasis (poor prognosis group). In cases where survival data are unavailable, good and poor prognosis groups can be classified based on cancer grade or stage.

[0409] Specifically, an artificial intelligence model for predicting the prognosis of cancer patients based on the transcript expression level of the target metabolic pathway discovered in Experimental Example 5 above was developed as follows. NAD of Figures 11aa to 11bc + Gene expression profiles of synthetic pathway genes were used as input data. NAD + Transcript expression levels of synthetic pathway genes were normalized across samples using methods such as Z-score normalization, and then dimensionality was reduced using principal component analysis. The number of principal components to be extracted was determined by identifying the inflection point in the scree plot, and the information from that number of principal components was used as input data for an artificial intelligence model that predicts the survival of cancer patients up to a specific time point. The optimal algorithm for the artificial intelligence model, including support vector machines, deep neural networks, and XGBoost, was selected based on the characteristics of the data. Hyperparameter tuning based on grid search cross-validation was performed for model optimization. The predictive model was trained and validated using stratified cross-validation. The performance of the generated model was evaluated using a test set obtained from an independent cohort of the same cancer type. The transcript expression levels in the test set were normalized using the normalization parameters (mean and standard deviation per gene) used during training and then evaluated. Model performance was evaluated using the area under the receiver operating characteristic (ROC) curve (AUROC), the area under the pre-recorded curve (AUPRC), the F1 score, and accuracy. If the number of samples is sufficiently large to enable regression prediction as well as classification for prognosis prediction, the development of a model that predicts a patient's specific survival period, rather than survival at a specific time point (yes / no), is also possible using the above method.

[0410] The model performed prediction of patients with poor prognosis (death within 5 years) with high accuracy, and the area under the ROC curve was 100% in a five-fold cross-validation test (number of samples = 58, E-MTAB-7264), and the area under the PR curve was also 100% (left graph in Figure 12). In addition, in an independent patient cohort validation set (number of samples = 15, GSE12475), it showed an AUROC of 85.0% and an AUPR of 78.3% (right graph in Figure 12). These results are consistent with those of NAD. + We demonstrate the robustness and accuracy of a prognostic prediction model built based on gene expression patterns in the synthetic pathway.

[0411]

[0412] 1. SIRT1 shRNA sequence: TTCTGGTGAACTTGAGTCT (SEQ ID NO: 1)

[0413] 2. Cloning primers

[0414] (1) NAMPT primer (forward / reverse): CAGATATCGATGAATCCTGCGGCA (SEQ ID NO: 2) / TGGATCCCTAATGATGTGCTGCTTC (SEQ ID NO: 3)

[0415] (2) NAPRT primer (forward / reverse): GGGAGCAGGATGGCGG (SEQ ID NO: 4) / CCCGCTCCGAGTCTCAGG (SEQ ID NO: 5)

[0416] 3. Primers for RT-qPCR

[0417] (1) HPRT primer (forward / reverse): CCTGGCGTCGTGATTAGTG (SEQ ID NO: 6) / CTTGCGACCTTGACCATCTTT (SEQ ID NO: 7)

[0418] (2) SIRT1 primer (forward / reverse): TAGTAGGCGTTGATGGTAAT (SEQ ID NO: 8) / CCTTTCTGGTTTCCTTGCTCT (SEQ ID NO: 9)

[0419] (3) DEPP1 primer (forward / reverse): GGTCTCTGAAAGGGAAATGCT (SEQ ID NO: 10) / GAGCGAACGGGATTGGTAA (SEQ ID NO: 11)

[0420] (4) DTNA primer (forward / reverse): CCTGTAACCAGCATGAACGAC (SEQ ID NO: 12) / GAGGTGGCTGAGACGAAGAG (SEQ ID NO: 13)

[0421] (5) PLOD2 primer (forward / reverse): CAACCAACCCCTTTTCTACC (SEQ ID NO: 14) / CCATACTCCTACTCTATTCCCT (SEQ ID NO: 15)

[0422] (6) NAMPT primer (forward / reverse): CCGACTCCTACAAGGTTACT (SEQ ID NO: 16) / CCTGGATTTTCTCTTTGGTTACTAC (SEQ ID NO: 17)

[0423] (7) NAPRT primer (forward / reverse): GTGGTCTCCCCAACTTCCTA (SEQ ID NO: 18) / ATTCACCTCACTGCCCTCC (SEQ ID NO: 19)

[0424] (8) BCL2 primer (forward / reverse): GTGGCCTTCTTTGAGTTCG (SEQ ID NO: 20) / CATCCCAGCCTCCGTTAT (SEQ ID NO: 21)

[0425] (9) BCL2L1 primers (forward / reverse): TGCGTGGAAAGCGTAGAC (SEQ ID NO: 22) / TCCACAAAAGTATCCCAGCC (SEQ ID NO: 23)

[0426] 4. Sequence for cloning scramble shRNA sequence for insertion into pLKO.1 plasmid

[0427] (1) Forward: CCGGAAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTTTTTTTG (SEQ ID NO: 24)

[0428] (2) Reverse: AATTCAAAAAAAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTT (SEQ ID NO: 25)

[0429] 5. Sequence for cloning EPAS1 shRNA sequence for insertion into pLKO.1 plasmid

[0430] (1) Forward: CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTTG (SEQ ID NO: 26)

[0431] (2) Reverse: AATTCAAAAACAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTG (SEQ ID NO: 27)

Claims

1. A pharmaceutical composition for treating or preventing recurrence of chondrosarcoma, comprising a SIRT1 inhibitor.

2. A pharmaceutical composition in claim 1, wherein the SIRT1 inhibitor is EX527, a salt thereof, a hydrate thereof, or a solvate thereof; nicotinamide, a salt thereof, a hydrate thereof, or a solvate thereof; or an shRNA represented by SEQ ID NO:

1.

3. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition is administered in combination with doxorubicin.

4. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition further comprises doxorubicin.

5. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition further comprises at least one of a NAMPT inhibitor or a NAPRT inhibitor.

6. A pharmaceutical composition in claim 5, wherein the NAMPT inhibitor is FK866 and the NAPRT inhibitor is 2-hydroxynicotinic acid.

7. A pharmaceutical composition according to claim 1, which inhibits tumor growth of chondrosarcoma or tumor recurrence of chondrosarcoma.

8. A composition for screening a substance for treating chondrosarcoma, comprising a preparation for measuring the expression level of the SIRT1 gene; or a preparation for measuring the activity of the SIRT1 protein.

9. A composition further comprising, in claim 8, an agent for measuring the expression level of at least one gene among NAMPT or NAPRT; or an agent for measuring the activity of at least one protein among NAMPT or NAPRT.

10. A composition for diagnosing or predicting the prognosis of chondrosarcoma, comprising a preparation for measuring the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT.

11. A composition according to any one of claims 8 to 10, wherein the agent for measuring the expression level of the gene is at least one of an agent for measuring the amount of mRNA of the gene or an agent for measuring the amount of protein expressed from the gene.

12. A composition according to claim 11, wherein the agent for measuring the amount of mRNA of the gene is a primer pair or probe that specifically binds to mRNA or cDNA of the gene.

13. A composition according to claim 11, wherein the agent for measuring the amount of protein expressed from the gene is an antibody or aptamer specific for the protein expressed from the gene.

14. A data storage unit storing expression level data of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT measured from a sample isolated from a patient with chondrosarcoma; and A system for predicting the prognosis of chondrosarcoma, comprising: a data analysis unit for determining that the prognosis of the chondrosarcoma patient is poor if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT stored in the data storage unit is equal to or higher than a predetermined value or higher than that of a normal group.

15. In paragraph 14, the data analysis unit predicts that the chondrosarcoma patient will die within 5 years if the expression level of one or more genes selected from the group consisting of SIRT1, NAMPT and NAPRT stored in the data storage unit is equal to or higher than a predetermined value or higher than that of a normal group.

Citation Information

Patent Citations

  • A chemo-sensitizer composition comprising amurensin g showing potent SIRT1 enzyme inhibitor for treating or preventing cancer disease

    KR1020120088894A

  • Signal receving circuit, semiconductor apparatus and semiconductor system including the same

    KR1020200129866A

  • Methods of treatment using SIRT modulators and compositions containing SIRT1 modulators

    US20100210692A1