Compositions and methods related to aptamers and aptamer-based sensors
The in vitro aptamer selection method addresses the limitations of current aptamer isolation techniques by enriching for aptamers with slow off-dissociation kinetics, enhancing specificity and sensitivity for target binding.
Patent Information
- Application Number
- PCT/US2024/058471
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-25
- Filing Date
- 2024-12-04
- Publication Date
- 2025-06-12
AI Technical Summary
Current methods for isolating aptamers with slow off-dissociation kinetics (koff) are limited by the need for immobilization of the target on a solid surface, which can impair binding, and the lack of accessible selection strategies and reagents, particularly for SOMAmers.
An in vitro aptamer selection method that involves obtaining a library of candidate aptamers, hybridizing complementary DNA (cDNA) to form hybridization complexes, exposing these complexes to a target analyte and a nuclease, and identifying the sequences of aptamers bound to the target analyte, thereby enriching for aptamers with slow koff.
This method efficiently isolates aptamers with slow dissociation kinetics, offering improved specificity and sensitivity for target binding, and provides a generalizable approach for generating aptamers with desired binding characteristics.
Smart Images

Figure US2024058471_12062025_PF_FP_ABST
Abstract
Description
[0001]NCSU-2024-034-03 NCSU-42526.601 COMPOSITIONS AND METHODS RELATED TO APTAMERS AND APTAMER-BASED SENSORS GOVERNMENTSUPPORTThis invention was made with government support under grant number 2135005 awarded by the National Science Foundation. The government has certain rights in the invention. CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No.63 / 605,871 filed December 4, 2023, and U.S. Provisional Patent Application No. 63 / 569,530 filed March 25, 2024, both of which are incorporated herein by reference in their entireties and for all purposes. INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 327,693 bytes XML file named “NCSU_42526_601_SequenceListing” created on December 4, 2024. FIELD The present disclosure provides compositions and methods related to aptamers and aptamer-based sensors. In particular, the present disclosure provides methods for isolating high-affinity aptamers with slow off dissociation kinetics (koff), aptamer-based sensors, and related detection assays, that are capable of binding a target analyte (and derivatives and analogs thereof) in a manner that is rapid, specific, and sensitive. BACKGROUND Bioreceptors such as antibodies and aptamers have revolutionized fields ranging from medicine and forensics to biomedical engineering and materials science by enabling the selective identification, sequestration, or functional modulation of specific molecular targets. Such bioreceptors are often characterized based on their affinity for ligands, which is typically measured thermodynamically in terms of the equilibrium dissociation constant (KD). However, there is also a growing recognition of the importance of receptor binding kinetics. For instance, in the context of therapeutics, given a set of drugs with similar KD, those with slow drug- receptor dissociation kinetics (koff) are more efficacious and potent than drugs with more rapid NCSU-2024-034-03 NCSU-42526.601 off-rates. Bioreceptors with slow koffcould also prove useful for other applications such as molecular imaging, which can improve signal-to-noise ratio, or drug delivery applications, where the timing of drug release needs to be gradual rather than immediate. Although antibodies are well-established and have relatively slow off-rates, they have several disadvantages that limit their utility in these specific contexts. For instance, for in vivo imaging, the prolonged half-lives of antibodies lead to large background signals, thereby reducing signal-to-noise ratio. For drug delivery, antibodies have low tissue penetration, potentially limiting diseased sites to sufficient drug exposure. Another issue is that because antibody generation is performed entirely in vivo, there are no means to select for antibodies with a specific off-rate value. Resultingly, the desired antibodies need to be screened individually, typically with low-throughput methods such as surface plasmon resonance (SPR). Aptamers are a promising category of nucleic acid-based bioreceptors that can be isolated from randomized libraries through an in vitro process termed systematic evolution of ligands by exponential enrichment (SELEX). They have several advantageous properties compared to antibodies, such as low production costs, ease of chemical modification, low batch variability, non-immunogenicity, and high tissue penetration. One key advantage of aptamers relative to antibodies is that selection is performed entirely in vitro, such that various facets of the selection process can be manipulated to obtain aptamers with a desired set of binding characteristics. Efforts have been undertaken to isolate aptamers with slow koffusing a combination of strategies including the volume dilution effect, non-specific competitors, and chemically-modified nucleic acid libraries, as has been demonstrated with the bioreceptors known as SOMAmers. Although such strategies have proven successful, they have two drawbacks. First, they require the immobilization of the target on a solid surface such as a microbead, which can impair binding due to the masking of target functional groups and steric hindrance. Second, the selection strategies and reagents associated with SOMAmer generation, which are currently the only known means of obtaining slow koff aptamers, are not currently accessible to the public, limiting their broad utilization. SUMMARY Embodiments of the present disclosure include an in vitro aptamer selection method. In accordance with these embodiments, the method includes obtaining a library comprising a plurality of candidate aptamers for binding a target analyte; hybridizing a complementary DNA (cDNA) to at least a portion of each of the candidate aptamers in the library, thereby forming a plurality of hybridization complexes; exposing the plurality of hybridization complexes to NCSU-2024-034-03 NCSU-42526.601 the target analyte and a nuclease for a defined period of time, wherein binding of the target analyte to a candidate aptamer displaces the cDNA and prevents the nuclease from cleaving a portion of the candidate aptamer; and identifying the sequence of the candidate aptamer bound to the target analyte. In some embodiments, each of the plurality of candidate aptamers comprises a stem- loop structure comprising a double-stranded stem portion, at least two primer binding sites, and a variable loop region. In some embodiments, the double-stranded stem portion is from about 4 nucleotides to about 15 nucleotides in length. In some embodiments, the at least two primer binding sites comprise a 5’ primer binding site extending from a single-stranded overhang on the stem portion. In some embodiments, the at least two primer binding sites comprise a 3’ primer binding site extending from the stem portion. In some embodiments, the portion of the candidate aptamer that is complementary to the cDNA comprises the stem portion containing the 5’ primer binding site, such that hybridization of the cDNA to the candidate aptamer disrupts the double-stranded stem portion. In some embodiments, the variable loop region is from about 4 nucleotides to about 200 nucleotides in length. In some embodiments, the variable loop region binds the target analyte and comprises one or more of DNA, RNA, 2F-RNA, 2-O-Methyl RNA, or a combination thereof. In some embodiments, the cDNA comprises a stem-loop structure comprising a double-stranded portion and a single-stranded portion. In some embodiments, the double-stranded portion is from about 6 nucleotides to about 20 nucleotides in length. In some embodiments, hybridization of the cDNA to the candidate aptamers disrupts the double-stranded stem portion of the candidate aptamer and produces a single-stranded 5’ flap that comprises a primer binding site, and a single-nucleotide 3’ overhang. In some embodiments, the endonuclease cleaves the single-stranded 5’ flap in the absence of the target analyte, in the presence of a non-binding target analyte, or if the library sequence does not bind the analyte. In some embodiments, the defined period of time for the cleavage reaction or the digestion reaction is from about 1 second to about 1 week. NCSU-2024-034-03 NCSU-42526.601 In some embodiments, the endonuclease is a flap endonuclease 1 (FEN1) endonuclease. In some embodiments, the FEN1 endonuclease is from a prokaryotic or eukaryotic organism. In some embodiments, the target analyte is cocaine or a derivative or analog thereof. In some embodiments, identifying the sequence of the candidate aptamer comprises performing PCR and / or nucleotide sequencing. In some embodiments, the method is repeated to enrich the plurality of candidate aptamers capable of binding the target analyte. In some embodiments, the method further comprises quantitatively assessing the binding kinetics of the plurality of candidate aptamers using surface plasmon resonance and / or biolayer interferometry. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.005 s-1. In some embodiments, the plurality of candidate aptamers comprise one or more of DNA, RNA, 2F-RNA, 2-O-Methyl RNA, or a combination thereof. Embodiments of the present disclosure also include a kit comprising the library of candidate aptamers and the cDNAs for performing any of the methods described herein. In some embodiments, the kit further comprises an endonuclease and / or primers. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: TAGGTGTGGGTCGGC-(X10)-GGGTA; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; and X10 is A, T, C, or G (SEQ ID NO: 1). In some embodiments, X1is T or C; X2is C or A; X3is C or T; X4is T or G; X5is T or G; X6is A, T or G; X7 is A, T, or G; X8 is G or T; X9 is G or T; and X10 is T or G (SEQ ID NO: 2). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 3-12 (FIG.54A). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 621 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-7)- GTTGGTTCTAGGG-(X8)-TAGGATGGC; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, NCSU-2024-034-03 NCSU-42526.601 or G; and X8is A, T, C, or G (SEQ ID NO: 13). In some embodiments, X1is G; X2is T or G; X3 is G; X4 is T or G; X5 is G or T; X6 is C or T; X7 is T or C; and X8 is G or T (SEQ ID NO: 14). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 15-22 (FIG.54B). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 1420 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-2)-GGGATGT-(X3)- TAGTTAGTG-(X4)-GTCGG-(X5-10); wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8 is A, T, C, or G, X9 is A, T, C, or G, and X10 is A, T, C, or G (SEQ ID NO: 23). In some embodiments, X1is G or A; X2is A or T; X3is G or T; X4is G; X5is A or T; X6is G or T; X7is C; X8 is A or C; X9 is T or G and X10 is A, G or T (SEQ ID NO: 24). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 25-40 (FIG. 54C). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 2650 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1)-CAGGGGG-(X2)- GGCTAGGGTGCGCGG-(X3)-AGCTG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G (SEQ ID NO: 41). In some embodiments, X1is A or T; X2is G or A; and X3is G or A (SEQ ID NO: 42). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 43-47 (FIG. 54D). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 282 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: TAGTTC-(X1-5)- AGGGGTAGG-(X6)-GTGGTTGTG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; and X6is A, T, C, or G (SEQ ID NO: 48). In some embodiments, X1 is C or G; X2 is G; X3 is A or G; X4 is G or T; X5 is A or T; and X6is T or C (SEQ ID NO: 49). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 50-52 (FIG. NCSU-2024-034-03 NCSU-42526.601 54E). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 201 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-5)- TCTGAGGGTCAAC-(X6-9)-TGGTGTAGT-(X10-11); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; and X11is A, T, C, or G (SEQ ID NO: 53). In some embodiments, X1 is C or T; X2 is T or G; X3 is G; X4 is T or G; X5is T; X6is T or G; X7is T or C; X8is T or G; X9is T or G; X10is T or C; and X11is G (SEQ ID NO: 54). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 55-63 (FIG.54F). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 245 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-5)-TTTTGGGT-(X6- 7)-TCTGG-(X8)-TGGG-(X9-15); wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G; and X15 is A, T, C, or G (SEQ ID NO: 64). In some embodiments, X1is G or A; X2is G or T; X3is A or T; X4is C; X5is C; X6is G; X7is T or C; X8 is G or T; X9 is A; X10 is G; X11 is G or T; X12 is T or G; X13 is G or T; X14 is G or T; and X15is C or T (SEQ ID NO: 65). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 66-77 (FIG. 54G). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 405 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: ACA-(X1)-GG-(X2)- GTGGA-(X3-7)-TGGGC-(X8-15); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G ; and X15 is A, T, C, or G (SEQ ID NO: 78). In some embodiments, X1is C or G; X2is T or C; X3is G or T; X4is G, T, or C; X5is G or A; X6 NCSU-2024-034-03 NCSU-42526.601 is G; X7is G or C; X8is G; X9is T; X10is A, or T; X11is T, G, or A; X12is A or G; X13is G; X14 is G; and X15 is G (SEQ ID NO: 79). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 80- 83 (FIG. 54H). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 476 nM. Embodiments of the present disclosure also include a single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 84-107 (Table 2). In some embodiments, the nucleic acid molecule comprises a detection moiety. In some embodiments, the nucleic acid molecule is in solution or attached to a substrate. Embodiments of the present disclosure also include a vector comprising any of the nucleic acid sequences described herein. Embodiments of the present disclosure also include a method of detecting cocaine, or a derivative or analog thereof. In accordance with these embodiments, the method includes combining any of the nucleic acid molecules described herein comprising a fluorescent moiety with a quencher-labeled nucleic acid molecule that is at least partially complementary to the nucleic acid molecules to form a quenched composition; and exposing the quenched composition to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof. In some embodiments, presence of the cocaine, or a derivative or analog thereof, in the sample displaces the quencher-labeled nucleic acid molecule, thereby producing a fluorescent signal proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample. Embodiments of the present disclosure also include a method of detecting cocaine, or a derivative or analog thereof. In accordance with these embodiments, the method includes combining any of the nucleic acid molecules described herein with a reporter compound that binds to the nucleic acid molecules non-covalently to form a complexed composition; and exposing the complexed composition to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof. In some embodiments, presence of the cocaine, or a derivative or analog thereof, in the sample displaces the reporter compound, thereby allowing the reporter compound to form detectable aggregates proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample. NCSU-2024-034-03 NCSU-42526.601 Embodiments of the present disclosure also include a method of detecting cocaine, or a derivative or analog thereof. In accordance with these embodiments, the method includes immobilizing any of the nucleic acid molecules described herein to an electrically conductive substrate, wherein the nucleic acid molecules comprise a redox tag, to form a detection sensor; and exposing the detection sensor to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof. In some embodiments, presence of the cocaine, or a derivative or analog thereof, in the sample binds the nucleic acid molecules, thereby producing an electrochemical signal proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample. In some embodiments, the sample is a biological sample from a human subject. In some embodiments, the biological sample is a saliva sample, a urine sample, a blood sample, a serum sample, a plasma sample, a fecal sample, a CSF sample, or a tissue sample. Embodiments of the present disclosure also include methods for identifying aptamers that bind thrombin, or a derivative or analog thereof. Embodiments of the present disclosure include a single-stranded nucleic acid molecule capable of specifically binding thrombin or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: TAGG-(X1-13)-TGG-(X14)-TAGG-(X15)-TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G; or X15is A, T, C, or G (SEQ ID NO: 307). In some embodiments, X1is A, T, C, or G; X2is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14 is G or T; or X15 is G or T (SEQ ID NO: 308). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 270-273 or SEQ ID NO: 282. Embodiments of the present disclosure include a single-stranded nucleic acid molecule capable of specifically binding thrombin or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: CG(X1)A(N2)TGG(X3-5)GGTTGG(X6-9)GG; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; or X9is A, T, C, or G (SEQ ID NO: 309). In some embodiments, X1is T, G, or A; X2is A or T; X3 is G or T; X4 is G or T; X5 is G or T; X6 is G, T, or A; X7 is G, T, or A; X8 is G, A, or T; or X9is G, A, or T (SEQ ID NO: 310). In some embodiments, the nucleic acid molecule NCSU-2024-034-03 NCSU-42526.601 comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 274-276. Embodiments of the present disclosure include a single-stranded nucleic acid molecule capable of specifically binding thrombin or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: AGG(X1)TGG(X2)TAGG(X3-13)TGGT; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; or X13 is A, T, C, or G (SEQ ID NO: 311). In some embodiments, X1 is G or T; X2 is G or T; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is T or G; X12 is T or G; or X13is G or T (SEQ ID NO: 312). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 280-283. BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-1C: Utilizing NA-SELEX to isolate aptamers with slow off-rates (koff). (A) The 73-nt library molecule and 40-nt NA-cDNA used for the selection process. (B) The library and NA-cDNA are hybridized, forming a complex containing downstream and upstream double-stranded DNA regions as well as an 8-nt 5’ flap and single-nucleotide 3’ overhang (middle). In the absence of target, the 5’ flap is rapidly cleaved by FEN1 (left), but in the presence of target, the library strand dissociates from the cDNA and reverts to a stem- loop structure that is unrecognizable by FEN1 (right). (C) Library-cDNA complexes are digested with FEN1 in the presence of target for several hours. Over time, sequences unable to bind the target are digested, while those that stay bound to the target for long durations survive. These binders are PCR amplified, and the process is iterated again several times, after which slow koff aptamers are identified through high throughput sequencing (HTS). FIGS.2A-2B: Library-immobilized (LI)-SELEX to pre-enrich aptamers for cocaine. (A) Scheme of the LI-SELEX workflow. (B) Percentage of the pool eluted by cocaine in LI- SELEX Rounds 1–8. The concentration of cocaine used each round is listed in the plot above the bars. FIGS. 3A-3F: A detailed schematic of the NA-SELEX workflow. NA-SELEX entails (A-B) immobilization of DNA library on agarose beads, removal of (C) low cDNA affinity sequences via negative selection and (D) interferent binders through counter-SELEX. NCSU-2024-034-03 NCSU-42526.601 (E) The remaining sequences are eluted from the agarose beads by disrupting cDNA-library duplex with sodium hydroxide. (F) This library is hybridized with NA-cDNA to form library- NA-cDNA complexes with double-flap structure, (G) Target binding and FEN1 digestion, (H) separation of target binders (intact sequences) from non-target binders (cleaved sequences) using PAGE, and (I) PCR amplification of the intact target binding sequences. FIG. 4: Polyacrylamide gel electrophoresis (PAGE) analysis of the negative selection and counter-SELEX for each round of NA-SELEX. ‘Lib’ represents the library before immobilization on the streptavidin-coated agarose resin. ‘Ulib’ represents the library that could not be immobilized on the resin, most likely due to the inability of the library to hybridize with LI-cDNA-bio. ‘Wbefore’ represents elution of library from the immobilized pool by 30 washes with 250 µL selection buffer. ‘TWJ1’ represents elution of the pool by three 250 µL washes with a mixture of 300 µM each of lidocaine, diphenhydramine, and nicotine. ‘TWJ2’ represents elution of the pool by three 250 µL washes with a mixture of 300 µM each of procaine, levamisole, and benzocaine. ‘FENT’ represents elution of the pool by three 250 µL washes with 300 µM fentanyl. ‘Wafter’ represents elution of the pool after 30 washes with 250 µL selection buffer following counter-SELEX. ‘WNo Mg2+’ represents elution of the pool from the column after 5 washes with 250 µL selection buffer without MgCl2. These were performed to wash away Mg2+, which interferes with subsequent elution with sodium hydroxide. ‘NaOH’ represents the pool that was eluted from the column after incubating with 300 µL 0.2 M NaOH for 10 min. The recovered pool is indicated by the red box. Typically, 60 – 70% of input library was recovered. ‘Beads’ represent oligonucleotides left on the agarose resin after incubation with sodium hydroxide. Percentages at bottom indicate the overall proportion of total DNA recovered at each step. FIGS.5A-5C: PAGE analysis of the digestion of the NA-SELEX library hybridized with NA-cDNA in the (A) absence or (B) presence of 50 µM cocaine. (C) The proportion of the library remaining at each time-point was determined based on the intensity of the highest- weight band of the full-length library (shown in the red boxes in A and B). Error bars represent the standard deviation of three independent experiments. FIGS. 6A-6G: NA-SELEX isolates slow off-rate aptamers for cocaine. (A) PAGE analysis of the R9–11 NA-SELEX pools and the native library undergoing digestion in the presence or absence of cocaine. (B) The proportion of the pool retained in the gel from A. (C) Percent of the R1–11 LI-SELEX pools eluted by target. (D) Retention factor (RF) for sequences with abundance of > 0.08% in the R11 round of NA-SELEX. Sequences are listed in order of abundance; aptamers deemed preferentially enriched by NA-SELEX are boxed. (E) FEN1 NCSU-2024-034-03 NCSU-42526.601 digestion of individual aptamers obtained with conventional NA-SELEX (top) or LI-SELEX (bottom) in the presence or absence of cocaine. BLI data depicting binding kinetic traces for (F) NA-SELEX-derived sequences NC13 and NC21 and (G) LI-SELEX-derived sequences NC1 and NC2 at various concentrations of cocaine. FIG.7: HTS analysis of unique sequences in Round 8 to Round 11 of LI-SELEX or room temperature NA-SELEX without cocaine or with cocaine. FIGS.8A-8D: The abundance of sequences in (A) Round 11 of NA-SELEX at room temperature (RT) and (B) LI-SELEX. Sequences are numbered based on their relative abundance among the 1,000 most highly represented sequences in round 8. (C) Overlay of these two plots. (D) A zoomed-in version of C showing the difference in abundance of the top 100 sequences in RT NA-SELEX relative to LI-SELEX. FIGS. 9A-9B: HTS analysis of sequences with > 0.08% abundance in round 11 of RT NA-SELEX. Sequences are ordered by most to least abundant on the x-axis, with abundance values indicated at top. (A) Enrichment of sequences between rounds 9–11 of RT NA-SELEX relative to round 8 of LI-SELEX. Sequences in the red-shaded region were negatively enriched. (B) The ratio of abundance for the sequences shown in A in round 11 of RT NA-SELEX relative to round 11 of LI-SELEX. Sequences in the red-shaded region were more popular in LI-SELEX relative to NA-SELEX. FIG. 10: HTS analysis of Round 11 LI-SELEX. Sequences are listed in order from most to least abundant in this selection round; those with abundance > 0.08% are included. The y-axis represents the enrichment of each sequence in round 11 relative to round 8. Sequences in the blue shaded region exhibited enrichment-fold > 2; sequences in the red shaded region were negatively enriched. FIG.11: Isothermal titration calorimetry (ITC) measurements of the binding affinity of aptamers preferentially enriched by RT NA-SELEX for cocaine. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 12: ITC measurements of the binding affinity of aptamers preferentially enriched by RT NA-SELEX for cocaine. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. NCSU-2024-034-03 NCSU-42526.601 FIG.13: ITC measurements of the binding affinity of aptamer NC236, preferentially enriched by RT NA-SELEX, for cocaine. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 14: ITC measurements of the binding affinity of aptamers preferentially enriched via LI-SELEX for cocaine. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 15: ITC measurements of the binding affinity of aptamers preferentially enriched via LI-SELEX for cocaine. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 16: ITC measurements of the binding affinity of various selected LI- and NA- SELEX full-length aptamers for cocaine. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 17: FEN1 digestion assays of aptamers preferentially enriched by RT NA- SELEX. For each aptamer, PAGE gels show digestion of the aptamer over 4 h in the absence (top) or presence (bottom) of cocaine. Plots depict retention of full-length aptamer over the course of the digestion period. The percentage of retained aptamer was determined based on the intensity of the full-length aptamer on the gel (indicated by ‘aptamer’ with a black arrow) at each time point. FIG. 18: FEN1 digestion assays of individual aptamers preferentially enriched by RT NA-SELEX. Data are presented as shown in FIG.17. FIG. 19: FEN1 digestion assays of individual aptamers preferentially enriched by RT NA-SELEX. Data are presented as shown in FIG.17. FIG. 20: FEN1 digestion assays of individual aptamers preferentially enriched by LI-SELEX. Data are presented as shown in FIG.17. FIG. 21: FEN1 digestion assays of individual aptamers preferentially enriched by LI-SELEX. Data are presented as shown in FIG.17. NCSU-2024-034-03 NCSU-42526.601 FIGS. 22A-22E BLI data for RT NA-SELEX-derived aptamers (A) NC52, (B) NC76, and (C) NC73 and LI-SELEX-derived aptamers (D) NC15 and (E) NC48. FIGS. 23A-23B: Digestion of the native random library at 37 ºC with FEN1. (A) PAGE analysis of the digestion of the NA-SELEX library hybridized with NA-cDNA by FEN1 at 37 ºC in the absence (top) or presence (bottom) of 50 µM cocaine. (B) The proportion of library remaining based on the intensity of the bands of the full-length aptamer on the gel (boxed in red). Error bars represent the standard deviation of three independent experiments. FIG.24: PAGE analysis of DNA elution and retention at each round of NA-SELEX with digestion performed at 37 ºC. The steps shown here were performed at RT, except for the final series of washes with buffer. ‘Lib’ represents the library before immobilization. ‘Ulib’ represents the library that could not be immobilized on the resin. ‘Wbefore’ represents elution after 30 washes with 250 µL selection buffer. ‘TWJ1’ represents elution after three 250 µL washes with a mixture of 300 µM each of lidocaine, diphenhydramine, and nicotine. ‘TWJ2’ represents elution by three 250 µL washes with a mixture of 300 µM each of procaine, levamisole, and benzocaine. ‘FENT’ represents elution by three 250 µL washes with 300 µM fentanyl. ‘Wafter @37 ºC’ represents elution after 30 washes with 250 µL selection buffer pre- warmed to 37 ºC (pH 7.4 at this temperature) following counter-SELEX. ‘WNo Mg2+’ represents elution after five washes with 250 µL pre-warmed selection buffer without MgCl2. ‘NaOH’ represents the pool eluted after incubating with 300 µL 0.2 M NaOH for 10 min; this recovered pool is indicated by the red box. ‘Beads’ represents oligonucleotides remaining on the agarose resin after incubation with NaOH. Numbers at bottom show the percent of total DNA accounted for by elution at each stage. FIGS. 25A-25F: Performing NA-SELEX at 37 ºC to isolate slow-off rate aptamers that bind cocaine under physiological conditions. (A) PAGE analysis of the digestion of various selection pools and the native library with or without cocaine. (B) The proportion of R9-11 pools retained after 2 h in the gel shown in FIG.38A and FIG.39. (C) RFs for sequences with abundance of > 0.08% in the final round of NA-SELEX. Sequences are listed in order of abundance. Aptamers deemed to be preferentially enriched by NA-SELEX are boxed. (D) FEN1 digestion of individual aptamers preferentially enriched by NA-SELEX (red) or LI- SELEX (blue) in the absence or presence of cocaine. (E, F) BLI binding kinetics traces for (E) NC1947 and (F) NCA at various concentrations of cocaine. FIG. 26: PAGE analysis of the digestion of R10 NA-SELEX pool and the native library with or without cocaine at 37 ºC. NCSU-2024-034-03 NCSU-42526.601 FIG. 27: HTS analysis depicting the proportion of unique sequences in the round 8 LI-SELEX starting pool and rounds 9–11 of NA-SELEX performed at 37 ºC in absence or presence of cocaine. FIG. 28: Round-by-round HTS analysis of the enrichment of sequences with > 0.08% abundance in round 11 of NA-SELEX performed at 37 ºC. Sequences are ordered by most to least abundant, with abundance values provided above. Y-axis shows enrichment of these sequences in rounds 9, 10, or 11 of NA-SELEX relative to round 8. Sequences in the red- shaded region were negatively enriched. The red star indicates a sequence that was not detected in round 8; as such, the minimum reads per million value was used to calculate enrichment. FIGS. 29A-29B: Sequence enrichment of aptamers in the final pool from NA- SELEX performed at 37 ºC. (A) The ratio of the abundance of sequences in round 11 of NA- SELEX performed at 37 ºC versus round 11 of LI-SELEX. Datapoints marked with a red star indicate sequences not detected in HTS data from round 11 of LI-SELEX; here, the minimum reads per million value was used to calculate enrichment. (B) The ratio of the abundance of sequences in round 11 of NA-SELEX performed at 37 ºC versus RT NA-SELEX. For both panels, sequences above the red-shaded region were more favorably enriched at 37 ºC. FIG. 30: ITC measurements of the binding affinity of aptamers preferentially enriched by NA-SELEX performed at 37 ºC for cocaine. Affinity was determined at 37 ºC. Top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 31: ITC measurements of the binding affinity of aptamers preferentially enriched by NA-SELEX performed at 37 ºC for cocaine. Affinity was determined at 37 ºC. Top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 32: ITC measurement of the binding affinity of the original cocaine aptamer 38-GC for cocaine at 37 ºC in selection buffer. The top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. [Cocaine] = 2.5 mM, [38-GC]: 0.1 mM). FIG. 33: ITC measurements of the binding affinity of aptamers preferentially enriched by NA-SELEX performed at 37 ºC for cocaine. Affinity was determined at RT. Top panels present the raw data showing heat generated from each titration of target into the NCSU-2024-034-03 NCSU-42526.601 aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. Data were fitted with a single-site binding model. FIG. 34: Specificity of aptamers preferentially enriched by NA-SELEX performed at 37 ºC for various interferents as determined using the T5 Exo / Exo I fluorescence assay. Data are presented as heat maps, with each square representing one aptamer and color intensity corresponding to normalized resistance value. Increasing color intensity indicates higher resistance values, and hence tighter aptamer-ligand binding. FIG. 35: FEN1 digestion assays of individual aptamers enriched by NA-SELEX performed at 37 ºC. PAGE gels show digestion of the aptamer over 2 h in the absence (top) or presence (bottom) of cocaine. Plots depict retention of full-length aptamer over the course of the digestion period. Percentages of retained aptamer were determined based on the intensity of the full-length aptamer (indicated by arrow on the gel) at each time point. FIG. 36: FEN1 digestion assays of individual aptamers preferentially enriched by NA-SELEX performed at 37 ºC. Data are presented as in FIG.46. FIG. 37: FEN1 digestion assays of individual aptamers preferentially enriched by NA-SELEX performed at 37 ºC. Data are presented as in FIG.46. FIG. 38: FEN1 digestion assays of individual aptamers preferentially enriched by LI-SELEX performed at 37 ºC. Data are presented as in FIG.46. FIG.39: BLI analysis of the binding kinetics of NCB. FIGS.40A-40E: Shown is the isolation and characterization of new DNA aptamers binding cocaine with exceptional affinity and specificity using library-immobilized SELEX. (A) The proportion of the pool eluted by cocaine (bars) in rounds 8–11 of the low- and high- stringency SELEX trials. Target concentrations are shown and indicated by the color gradient. The individual data points and line indicate pool elution divided by the target concentration. (B) High-throughput sequencing data for the high- (left) and low- (right) stringency selection trials. Enrichment fold between round 8 and round 11 is plotted against the abundance of each sequence in round 11. Red lines indicate quality thresholds for high-affinity aptamer candidates. These candidates and three control sequences are color-coded and labeled in the lefthand panel. (C) Sequence logo of the newly isolated high-affinity cocaine aptamer family. (D) Secondary structures of high affinity aptamers NC423, NC973, NC195, and NC48. (E) Isothermal titration calorimetry data for determining the cocaine-binding affinity of these aptamers and the control sequence NC70. FIG.41: Determining the binding affinity of the round 11 high-stringency selection pool using a gel elution assay. The appearance of the binding curve indicates the presence of NCSU-2024-034-03 NCSU-42526.601 two distinct populations of aptamers with divergent affinities; the data were fitted with a modified two-site Langmuir equation with two KD reported. FIG. 42: Determination of the binding affinity of the Round 11 low-stringency selection pool using a gel elution assay. The appearance of the binding curve indicates the presence of two distinct populations of aptamers with divergent affinities; the data were fitted with a modified two-site Langmuir equation with two KDreported. FIG.43: High-throughput sequencing analysis of unique sequences for the round 8, 910 and 11 pools from the high-stringency library-immobilized SELEX trial. FIGS. 44A-44B: Characterization of cocaine binding affinity of two lower-affinity aptamer candidates with moderate abundance and enrichment from the high-stringency selection using isothermal titration calorimetry (ITC). The top panels display the heat generated from each titration of cocaine into (A) NC74.2 and (B) NC83. Bottom panels show the integrated heat of each titration after correcting for the heat of dilution of the titrant. FIGS.45A-45B: Determination of the binding profiles of aptamer candidates using an exonuclease-based assay. (A) Schematic of the T5 Exo and Exo I digestion fluorescence assay. (B) Calculation of resistance value (R) for determining relative binding strength and specificity of aptamers. FIGS. 46A-46B: Exceptional specificity of new cocaine-binding aptamers determined by an exonuclease digestion fluorescence assay. (A) The chemical structures of ligands (target and interferents) tested in the assay. (B) Heat map indicating the normalized resistance value for each aptamer against ligands. The yellow-to-blue color gradient represents increasing resistance to exonuclease digestion, and hence higher aptamer-ligand binding affinity. Cocaine was employed at concentrations of 5 and 100 µM. The interferents were employed at a concentration of 500 µM, except for THC, AB-FUBINACA, UR-144, alprazolam, and diazepam, for which concentrations of 10 µM were employed due to solubility limitations. FIGS.47A-47D: Detection of clinically relevant concentration of cocaine in human blood with an aptamer-based strand-displacement fluorescence sensor. (A) Shown here is the working principle of the sensor. (B) Calibration curve for cocaine in buffer and 50% human serum. The shaded box indicates the clinically relevant concentration of cocaine in serum. (C) Linear range for the sensor (R2= 0.99). (D) The sensor displays excellent specificity when challenged with 100 µM interferents (certain interferents were tested at 10 µM due to solubility limitations). The dashed red line indicates cross-reactivity of 5% relative to 1 µM cocaine NCSU-2024-034-03 NCSU-42526.601 which, for most of the tested interferents, reflects a 100-fold excess of the interferent over cocaine. Error bars indicate the standard deviation of three independent experiments. FIG.48: Optimization of the concentration of the 13-nt 3’ Iowa Black RQ quencher- modified complementary DNA (cDNA-13Q) to achieve >90% quenching in the presence of 50 nM 5’ Cy5 fluorophore-modified NC195 (NC195-Cy5) in a strand-displacement sensor. The optimal concentration identified was 125 nM. FIGS. 49A-49F: Generation and characterization of a structure-switching cocaine- binding aptamer for adaptation to in vivo EAB sensors. (A) PAGE analysis of the digestion time-course for NC195 by Exo III and Exo I in the absence and presence of cocaine. The exonucleases generate 43-nt and 40-nt major products. Removing the remaining 5’ overhang from the 43-nt product generates (B) the blunt-ended aptamer NC195-40, which were further truncated to generate constructs NC195-38, NC195-36, and NC195-34. (C) Circular dichroism spectra of the truncated aptamers. (D) Determining the relative cocaine-binding affinity of the truncated aptamers at 37ºC using an Exo I-based assay. (E) ITC-based determination of the cocaine-binding affinity of NC195-40, NC195-38, NC195-36, and (F) the truncated version of original cocaine aptamer (MNS4.1-truncated) at 37ºC. FIG. 50: NUPACK-predicted secondary structures of parent aptamers (left) and hypothetical structures of the major 43-nt and 40-nt digestion products (middle and right) are provided. FIGS. 51A-51D: Characterization of the cocaine-binding affinity of NC195 truncation products at room temperature using isothermal titration calorimetry (ITC). The top panels display the heat generated from each titration of cocaine into (A) NC195-40, (B) NC195-38, (C) NC195-36 and (D) NC195-34. Bottom panels show the integrated heat of each titration after correcting for the heat of dilution of the titrant. FIGS.52A-52B: Shown is the real-time, seconds resolved measurement of cocaine plasma pharmacokinetics in situ in the jugular vein of live animals. (A) First, the in vitro EAB sensor was interrogated in undiluted whole bovine blood at 37°C using dual-frequency (20 Hz, 200 Hz) square wave voltammetry to enable kinetic differential measurement (KDM) drift correction. This produced a Langmuir-isotherm binding curve of KD = 8.0 ± 0.6 µM. (B) Upon placement in the jugular veins of two live rats, the sensor exhibited stable baseline with root- mean-squared noise of 0.11 and 0.04 µM for Rat 1 and Rat 2, respectively. Intravenous dosing of 1 mg kga*cocaine produced a biphasic pharmacokinetic response that could be measured with excellent precision in individual animals, easily quantifying distinct differences in the pharmacokinetic of the two animals. NCSU-2024-034-03 NCSU-42526.601 FIG. 53: Representative schematic illustrations of a library aptamer (i.e., candidate aptamers), complementary cDNA, and hybridization complex. FIGS. 54A-54H: Representative consensus sequences for each family of cocaine aptamers. Variable nucleic acids are represented by “X” or “N.” In some embodiments, an “X” or an “N” followed by a numerical range (e.g., X5-9) indicates that there are at least the number of nucleotides present in the nucleic acid molecule represented by the first (lower) integer in the range, and there are at most the number of nucleotides present in the nucleic acid molecule represented by the second (higher) integer in the range. In accordance with this, the number of nucleotides represented by the first number of the range are required to be present in the nucleic acid molecule, but the other numbers in the range are optional (e.g., for X5-9, at least 5 nucleotides are present in the nucleic acid molecule; however, there may be 6, 7, 8, or 9 nucleotides present in the nucleic acid molecule). FIGS. 55A-55F: Characterization of nucleobases in the NCA family of aptamers. (A) Secondary structure of NCA predicted by NUPACK in selection buffer and sequence logo of NCA family derived from clustering similar sequences in the HTS dataset of R11 NA- SELEX pool at 37 ºC. Secondary structures and affinity determination to cocaine via ITC for (B) NCA-mut1, (C) NCA-mut2, (D) NCA-mut3, (E) NCA-mut4, (F) NCA-mut5. Top panels present the raw data showing heat generated from each titration of target into the aptamers, and bottom panels depict the integrated heat of each titration after correcting for dilution heat of titrant. FIG. 56: Specificity of aptamers preferentially enriched by NA-SELEX performed at 37 ºC for various interferents as determined using the T5 Exo / Exo I fluorescence assay. Data are presented as heat maps, with each square representing one aptamer and color intensity corresponding to normalized resistance value. Increasing color intensity indicates higher resistance values, and hence tighter aptamer-ligand binding. FIG.57: BLI analysis of the binding kinetics of MNS4.1. Note that kon was calculated based on koffand the steady state KDdue to the inability of the analysis software to properly determine endpoint binding values (i.e., Rmax). FIGS. 58A-58G: Isolation of thrombin-binding aptamers using NA-SELEX. (A) Pool retention for each round of filter-SELEX to the pre-enrich binders to thrombin. (B) PAGE analysis of the digestion of various NA-SELEX pools and the native library with or without thrombin. (C) The proportion of R6-8 pools retained after digestion in the gel shown in B. (D) Identification of sequence families in the Round 5 filter-SELEX pool (black dots) and the Round 8 NA-SELEX pool (orange dots) using Raptgen. The two-dimensional plot shows the NCSU-2024-034-03 NCSU-42526.601 latent space produced by Raptgen, with each dot representing one unique sequence. Sequences clustered together are related in sequence and contain similar motifs. From this analysis, six sequence families (Family 1 – 6) were identified. The sequence logos for these families (generated by WebLogo) contain several conserved motifs and non-consensus regions. Representative consensus sequences for Family 1 (FIG.58E), Family 2 (FIG.58F), and Family 4 (FIG. 58G) thrombin aptamers are shown. Variable nucleic acids are represented by “X” or “N.” In some embodiments, an “X” or an “N” followed by a numerical range (e.g., X5-9) indicates that there are at least the number of nucleotides present in the nucleic acid molecule represented by the first (lower) integer in the range, and there are at most the number of nucleotides present in the nucleic acid molecule represented by the second (higher) integer in the range. In accordance with this, the number of nucleotides represented by the first number of the range are required to be present in the nucleic acid molecule, but the other numbers in the range are optional (e.g., for X5-9, at least 5 nucleotides are present in the nucleic acid molecule; however, there may be 6, 7, 8, or 9 nucleotides present in the nucleic acid molecule). FIG. 59: Negative selection for thrombin using NA-SELEX.FIG.60: Raptgen-generated two dimensional plots containing each unique sequence in every round of thrombin SELEX, where each sequence is represented by a data point, and those sharing similar sequences and motifs are clustered together in space. Each outgrowth from the center represents a family of related sequences. FIGS.61A-61D: Affinity and kinetic characterization of thrombin-binding aptamers discovered via NA-SELEX. Results for the exonuclease digestion assay are represented as heat maps for thrombin affinity determination at (A) room temperature and (B) 37 Celsius and (C) specificity of aptamers. (D) BLI data to determine the binding kinetics of the Bock aptamer, Tasset aptamer, and the NA-SELEX aptamer T7. FIG.62: BLI data to determine the binding kinetics of the thrombin aptamers isolatedvia NA-SELEX. DETAILEDDESCRIPTIONConventional directed evolution methods offer the ability to select bioreceptors with high binding affinity for a specific target in terms of thermodynamic properties. However, there is a lack of analogous approaches for kinetic selection, which could yield affinity reagents that exhibit slow off-rates and thus remain tightly bound to targets for extended periods. As described further herein, embodiments of the present disclosure include an in vitro directed evolution methodology that employs the nuclease flap endonuclease 1 to achieve the efficient NCSU-2024-034-03 NCSU-42526.601 discovery of aptamers that have slow dissociation rates. The nuclease-assisted selection strategy yields high-affinity, highly specific aptamers with off-rates that are an order of magnitude slower relative to those obtained with conventional selection methods while still retaining excellent overall target affinity in terms of thermodynamics. This new methodology provides a generalizable approach for generating slow-off rate aptamers for diverse targets, which could in turn prove valuable for applications including molecular device design, bioimaging, and therapy. Embodiments of the present disclosure include a new method to discover nucleic-acid-based bioreceptors (i.e., aptamers) that have slow ligand dissociation kinetics, offering a potentially powerful tool for biomedical and nanotechnology applications that require long receptor-ligand complexation times. The ability to quantify cocaine in biological fluids is crucial for both the diagnosis of intoxication and overdose in the clinic as well as investigation of the drug’s pharmacological and toxicological effects in the laboratory. To this end, high-stringency in vitro selection was performed to generate DNA aptamers that bind cocaine with nanomolar affinity and clinically relevant specificity, thus representing a dramatic improvement over the current-generation, micromolar-affinity, low-specificity cocaine aptamers. Using these novel aptamers, two sensors for cocaine detection were developed. The first, an in vitro fluorescent sensor, successfully detects cocaine at clinically relevant levels in 50% human serum without responding significantly to other drugs of abuse, endogenous substances, or diverse range of therapeutic agents. The second, an electrochemical aptamer-based sensor, supports the real- time, seconds-resolved measurement of cocaine concentrations in vivo in the circulation of live animals. The aptamers and sensors described herein could prove valuable for both point-of- care and on-site clinical cocaine detection as well as fundamental studies of cocaine neuropharmacology. Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.1. DefinitionsUnless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in NCSU-2024-034-03 NCSU-42526.601 their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting. The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not. For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6- 9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated. “Correlated to” as used herein refers to compared to. The term “aptamer” generally refers to either an oligonucleotide of a single defined sequence or a mixture of said oligonucleotides, wherein the mixture retains the properties of binding specifically to a target molecule. Thus, as used herein “aptamer” denotes both singular and plural sequences of oligonucleotides. The term “aptamer” generally refers to a single- stranded oligonucleotide that is capable of binding to a protein or other molecule, and thereby modulating function. Variable nucleic acids in an aptamer sequence are represented by “X” or “N.” In some embodiments, an “X” or an “N” followed by a numerical range (e.g., X5-9) indicates that there are at least the number of nucleotides present in the nucleic acid molecule represented by the first (lower) integer in the range, and there are at most the number of nucleotides present in the nucleic acid molecule represented by the second (higher) integer in the range. In accordance with this, the number of nucleotides represented by the first number of the range are required to be present in the nucleic acid molecule, but the other numbers in the range are optional (e.g., for X5-9, at least 5 nucleotides are present in the nucleic acid molecule; however, there may be 6, 7, 8, or 9 nucleotides present in the nucleic acid molecule). The term “single-stranded” oligonucleotides generally refers to those oligonucleotides that contain a single covalently linked series of nucleotide residues. The terms “oligomers” or “oligonucleotides” include RNA or DNA sequences of more than one nucleotide in either single chain or duplex form and specifically includes short sequences such as dimers and trimers, in either single chain or duplex form, which can be intermediates in the production of the specifically binding oligonucleotides. “Modified” forms NCSU-2024-034-03 NCSU-42526.601 used in candidate pools contain at least one non-native residue. “Oligonucleotide” or]OLIGOMER^ IS GENERIC TO POLYDEOXYRIBONUCLEOTIDES #CONTAINING +c'DEOXY'5'RIBOSE OR MODIFIEDforms thereof), such as DNA, to polyribonucleotides (containing D-ribose or modified forms thereof), such as RNA, and to any other type of polynucleotide which is an N-glycoside or C- glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base or abasic nucleotides. “Oligonucleotide” or “oligomer” can also be used to describe artificially synthesized polymers that are similar to RNA and DNA, including, but not limited to, oligos of peptide nucleic acids (PNA). The terms “binding activity” and “binding affinity” generally refer to the tendency of a ligand molecule to bind or not to bind to a target. The energetics of these interactions are significant in “binding activity” and “binding affinity” because they can include definitions of the concentrations of interacting partners, the rates at which these partners are capable of associating, and the relative concentrations of bound and free molecules in a solution. “Complementary” refers to the characteristic of two or more structural elements (e.g., peptide, polypeptide, nucleic acid, small molecule, etc.) of being able to hybridize, dimerize, or otherwise form a complex with each other. For example, a “complementary peptide and polypeptide” are capable of coming together to form a complex. Complementary elements need assistance to form a complex (e.g., from interaction elements), for example, to place the elements in the proper conformation for complementarity, to co-localize complementary elements, to lower interaction energy for complementation, etc. As used herein, the terms “nucleotide sequence identity” or “nucleic acid sequence identity” refers to the presence of identical nucleotides at corresponding positions of two polynucleotides. Polynucleotides have “identical” sequences if the sequence of nucleotides in the two polynucleotides is the same when aligned for maximum correspondence (e.g., in a comparison window). Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window is generally from about 20 to 200 contiguous nucleotides. The “percentage of sequence identity” for polynucleotides, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99 or 100 percent sequence identity, can be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can include additions or deletions (i.e., gaps) as compared to the reference sequence for optimal alignment of the two sequences. In some embodiments, the percentage is calculated by: (a) determining the number of positions at NCSU-2024-034-03 NCSU-42526.601 which the identical nucleic acid base occurs in both sequences; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100. Optimal alignment of sequences for comparison can also be conducted by computerized implementations of known algorithms, or by visual inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) and ClustalW / ClustalW2 / Clustal Omega programs available on the Internet (e.g., the website of the EMBL-EBI). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG Package available from Accelrys, Inc. of San Diego, Calif., United States of America. See also Smith & Waterman, 1981; Needleman & Wunsch, 1970; Pearson & Lipman, 1988; Ausubel et al., 1988; and Sambrook & Russell, 2001.2. Selection MethodsEmbodiments of the present disclosure include an in vitro aptamer selection method. In accordance with these embodiments, the method includes obtaining a library comprising a plurality of candidate aptamers for binding a target analyte. The method also includes hybridizing a complementary DNA (cDNA) to at least a portion of each of the candidate aptamers in the library, thereby forming a plurality of hybridization complexes. The method also includes exposing the plurality of hybridization complexes to the target analyte and a nuclease for a defined period of time, wherein binding of the target analyte to a candidate aptamer displaces the cDNA and prevents the endonuclease from cleaving a portion of the candidate aptamer. The method also includes identifying the sequence of the candidate aptamer bound to the target analyte. In some embodiments, the target analyte is cocaine or a derivative or analog thereof. In some embodiments, the plurality of candidate aptamers are comprised of a modified nucleic acid. In some embodiments, the plurality of candidate aptamers are comprised of one or more of DNA, RNA, 2F-RNA, 2-O-Methyl RNA, or a combination thereof. In some embodiments, at least a portion of the plurality of candidate aptamers is comprised of DNA. In some embodiments, at least a portion of the plurality of candidate aptamers is comprised of RNA. In some embodiments, at least a portion of the plurality of candidate aptamers is comprised of a modified nucleic acid. In some embodiments, each of the plurality of candidate aptamers comprises a stem- loop structure comprising a double-stranded stem portion, at least two primer binding sites, and NCSU-2024-034-03 NCSU-42526.601 a variable loop region. In some embodiments, the double-stranded stem portion is from about 4 nucleotides to about 15 nucleotides in length. In some embodiments, the double-stranded stem portion is from about 6 nucleotides to about 12 nucleotides in length. In some embodiments, the double-stranded stem portion is from about 8 nucleotides to about 10 nucleotides in length. In some embodiments, the double-stranded stem portion is from about 4 nucleotides to about 10 nucleotides in length. In some embodiments, the double-stranded stem portion is from about 7 nucleotides to about 12 nucleotides in length. In some embodiments, the double-stranded stem portion is from about 9 nucleotides to about 13 nucleotides in length. In some embodiments, the at least two primer binding sites comprise a 5’ primer binding site extending from a single-stranded overhang on the stem portion. In some embodiments, the at least two primer binding sites comprise a 3’ primer binding site extending from the stem portion. In some embodiments, the portion of the candidate aptamer that is complementary to the cDNA comprises the stem portion containing the 5’ primer binding site, such that hybridization of the cDNA to the candidate aptamer disrupts the double-stranded stem portion. In some embodiments, the variable loop region is from about 4 nucleotides to about 200 nucleotides in length. In some embodiments, the variable loop region is from about 25 nucleotides to about 150 nucleotides in length. In some embodiments, the variable loop region is from about 50 nucleotides to about 100 nucleotides in length. In some embodiments, the variable loop region is from about 75 nucleotides to about 125 nucleotides in length. In some embodiments, the variable loop region is from about 10 nucleotides to about 50 nucleotides in length. In some embodiments, the variable loop region is from about 20 nucleotides to about 60 nucleotides in length. In some embodiments, the variable loop region is from about 30 nucleotides to about 90 nucleotides in length. In some embodiments, the variable loop region is from about 8 nucleotides to about 20 nucleotides in length. In some embodiments, the variable loop region is from about 10 nucleotides to about 30 nucleotides in length. In some embodiments, the variable loop region binds the target analyte. In some embodiments, the variable loop region is comprised of a modified nucleic acid. In some embodiments, the variable loop regions comprises one or more of DNA, RNA, 2F-RNA, 2-O- Methyl RNA, or a combination thereof. In some embodiments, the cDNA comprises a stem-loop structure comprising a double-stranded portion and a single-stranded portion. In some embodiments, the double- stranded portion is from about 6 nucleotides to about 20 nucleotides in length. In some embodiments, the double-stranded portion is from about 8 nucleotides to about 16 nucleotides NCSU-2024-034-03 NCSU-42526.601 in length. In some embodiments, the double-stranded portion is from about 10 nucleotides to about 15 nucleotides in length. In some embodiments, the double-stranded portion is from about 7 nucleotides to about 14 nucleotides in length. In some embodiments, the double- stranded portion is from about 12 nucleotides to about 18 nucleotides in length. In some embodiments, the double-stranded portion is from about 9 nucleotides to about 12 nucleotides in length. In some embodiments, hybridization of the cDNA to the candidate aptamers disrupts the double-stranded stem portion of the candidate aptamer and produces a single-stranded 5’ flap that comprises a primer binding site, and a single-nucleotide 3’ overhang. In some embodiments, the endonuclease cleaves the single-stranded 5’ flap in the absence of the target analyte, in the presence of a non-binding target analyte, or if the library sequence does not bind the analyte. In some embodiments, the library sequence will not be cleaved by FEN1 if the library sequence binds to the analyte and dissociates from the cDNA. The method also includes exposing the plurality of hybridization complexes to the target analyte for a defined period of time, wherein binding of the target analyte to a candidate aptamer displaces the cDNA and prevents the endonuclease from cleaving a portion of the candidate aptamer. In some embodiments, the defined period of time is from about 1 second to about 1 week. In some embodiments, the defined period of time is from about 1 hour to about 1 week. In some embodiments, the defined period of time is from about 1 hour to about 8 hours. In some embodiments, the defined period of time is from about 2 hours to about 6 hours. In some embodiments, the defined period of time is from about 8 hours to about 24 hours. In some embodiments, the defined period of time is from about 1 day to about 2 days. In some embodiments, the defined period of time is from about 2 days to about 4 days. The method also includes exposing the plurality of hybridization complexes to a nuclease for a defined period of time, wherein binding of the target analyte to a candidate aptamer displaces the cDNA and prevents the endonuclease from cleaving a portion of the candidate aptamer. In some embodiments, the defined period of time is from about 1 second to about 1 week. In some embodiments, the defined period of time is from about 1 hour to about 1 week. In some embodiments, the defined period of time is from about 1 hour to about 8 hours. In some embodiments, the defined period of time is from about 2 hours to about 6 hours. In some embodiments, the defined period of time is from about 8 hours to about 24 hours. In some embodiments, the defined period of time is from about 1 day to about 2 days. In some embodiments, the defined period of time is from about 2 days to about 4 days. NCSU-2024-034-03 NCSU-42526.601 In some embodiments, the endonuclease is a FEN1 endonuclease. In some embodiments, the FEN1 endonuclease is an engineered FEN1 nuclease. In some embodiments, the FEN1 endonuclease is a naturally-occurring FEN1 nuclease. In some embodiments, the FEN1 endonuclease is from a prokaryotic organism. In some embodiments, the FEN1 endonuclease is from a eukaryotic organism. In some embodiments, identifying the sequence of the candidate aptamer comprises performing PCR and / or nucleotide sequencing. In some embodiments, the method is repeated to enrich the plurality of candidate aptamers capable of binding the target analyte. In some embodiments, the method further comprises quantitatively assessing the plurality of candidate aptamers for their binding kinetics using surface plasmon resonance and / or biolayer interferometry. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.02 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.015 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.010 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.005 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.004 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koffthat is less than or equal to about 0.003 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koffthat is less than or equal to about 0.002 s-1. In some embodiments, at least one of the plurality of candidate aptamers generated by the method comprises a koffthat is less than or equal to about 0.001 s-1. Embodiments of the present disclosure also include a kit comprising the library of candidate aptamers and the cDNAs for performing any of the methods described herein. In some embodiments, the kit further comprises an endonuclease and / or primers. In some embodiments, the kit further comprises a buffer suitable for forming the hybridization complexes described herein. In some embodiments, the kit further comprises a buffer suitable for allowing binding of a target analyte to the variable loop region of the plurality of aptamers. In some embodiments, the kit further comprises a buffer suitable for allowing an endonuclease to function. NCSU-2024-034-03 NCSU-42526.6013. AptamersIn accordance with the various embodiments of the present disclosure, described herein are methods and compositions pertaining to aptamer-based sensors. In particular, the present disclosure provides aptamer-based sensors, and related detection assays, that are capable of binding cocaine (and derivatives and analogs thereof) in a manner that is rapid, specific, and sensitive. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: TAGGTGTGGGTCGGC-(X10)- GGGTA; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; and X10is A, T, C, or G (SEQ ID NO: 1). In some embodiments, X1is T or C; X2is C or A; X3 is C or T; X4 is T or G; X5 is T or G; X6 is A, T or G; X7 is A, T, or G; X8 is G or T; X9is G or T; and X10is T or G (SEQ ID NO: 2). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 3-12 (FIG.54A). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 621 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: (X1-7)-GTTGGTTCTAGGG-(X8)- TAGGATGGC; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; and X8 is A, T, C, or G (SEQ ID NO: 13). In some embodiments, X1is G; X2is T or G; X3is G; X4is T or G; X5is G or T; X6 is C or T; X7 is T or C; and X8 is G or T (SEQ ID NO: 14). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 15-22 (FIG.54B). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 1420 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprises a nucleic acid NCSU-2024-034-03 NCSU-42526.601 sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: (X1-2)-GGGATGT-(X3)-TAGTTAGTG- (X4)-GTCGG-(X5-10); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G, X9 is A, T, C, or G, and X10 is A, T, C, or G (SEQ ID NO: 23). In some embodiments, X1 is G or A; X2is A or T; X3is G or T; X4is G; X5is A or T; X6is G or T; X7is C; X8is A or C;X9 is T or G and X10 is A, G or T (SEQ ID NO: 24). In some embodiments, the nucleic acidmolecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 25-40 (FIG.54C). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 2650 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: (X1)-CAGGGGG-(X2)- GGCTAGGGTGCGCGG-(X3)-AGCTG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G (SEQ ID NO: 41).In some embodiments, X1 is A or T; X2 is G or A; and X3 is G or A (SEQ ID NO: 42). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 43-47 (FIG. 54D). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 282 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: TAGTTC-(X1-5)-AGGGGTAGG-(X6)- GTGGTTGTG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5is A, T, C, or G; and X6is A, T, C, or G (SEQ ID NO: 48). In some embodiments, X1 is C or G; X2 is G; X3 is A or G; X4 is G or T; X5 is A or T; and X6 is T or C (SEQ ID NO: 49). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 50-52 (FIG. 54E). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 201 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprises a nucleic acid NCSU-2024-034-03 NCSU-42526.601 sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: (X1-5)-TCTGAGGGTCAAC-(X6-9)- TGGTGTAGT-(X10-11); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; and X11 is A, T, C, or G (SEQ ID NO: 53). In some embodiments, X1is C or T; X2is T or G; X3is G; X4is T or G; X5is T; X6is T or G; X7is T or C; X8 is T or G; X9 is T or G; X10 is T or C; and X11 is G (SEQ ID NO: 54). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 55-63 (FIG. 54F). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 245 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: (X1-5)-TTTTGGGT-(X6-7)-TCTGG-(X8)- TGGG-(X9-15); wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14is A, T, C, or G; and X15is A, T, C, or G (SEQ ID NO: 64). In some embodiments, X1 is G or A; X2 is G or T; X3 is A or T; X4 is C; X5 is C; X6 is G; X7 is T or C; X8 is G or T; X9is A; X10is G; X11is G or T; X12is T or G; X13is G or T; X14is G or T; and X15is C or T (SEQ ID NO: 65). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 66-77 (FIG. 54G). In some embodiments, the nucleic acid molecule comprises a KDthat is less than about 405 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: ACA-(X1)-GG-(X2)-GTGGA-(X3-7)- TGGGC-(X8-15); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; X13is A, T, C, or G; X14 is A, T, C, or G ; and X15 is A, T, C, or G (SEQ ID NO: 78). In some embodiments, X1is C or G; X2is T or C; X3is G or T; X4is G, T, or C; X5is G or A; X6is G; X7is G or C; NCSU-2024-034-03 NCSU-42526.601 X8is G; X9is T; X10is A, or T; X11is T, G, or A; X12is A or G; X13is G; X14is G; and X15isG (SEQ ID NO: 79). In some embodiments, the nucleic acid molecule comprises a nucleic acidsequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 80-83 (FIG. 54H). In some embodiments, the nucleic acid molecule comprises a KD that is less than about 476 nM. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 84-107 (Table 2). In accordance with these embodiments, the nucleic acid molecules identified using the methods of the present disclosure (e.g., candidate aptamers) can comprise a KD for cocaine, or a derivative or analog thereof, that is less than about 500 nM. In some embodiments, the nucleic acid molecules comprise a KD for cocaine, or a derivative or analog thereof, that is less than about 400 nM. In some embodiments, the nucleic acid molecules comprise a KD for cocaine, or a derivative or analog thereof, that is less than about 300 nM. In some embodiments, the nucleic acid molecules comprise a KD for cocaine, or a derivative or analog thereof, that is less than about 200 nM. In some embodiments, the nucleic acid molecules comprise a KD for cocaine, or a derivative or analog thereof, that is less than about 100 nM. In some embodiments, the nucleic acid molecules comprise a KDfor cocaine, or a derivative or analog thereof, that is less than about 50 nM. In some embodiments, the nucleic acid molecules comprise a KD for cocaine, or a derivative or analog thereof, that is less than about 25 nM. In some embodiments, the nucleic acid molecule comprises a detection moiety. In some embodiments, the nucleic acid molecule is in solution or attached to a substrate. In accordance with the above embodiments, the nucleic acid molecule is capable of binding cocaine, or a derivative or analog thereof, under physiological conditions. Additionally, described herein are methods and compositions pertaining to aptamer- based sensors. In particular, the present disclosure provides aptamer-based sensors, and related detection assays, that are capable of binding thrombin (and derivatives and analogs thereof) in a manner that is rapid, specific, and sensitive. In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding thrombin, or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: TAGG- (X1-13)-TGG-(X14)-TAGG-(X15)-TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or NCSU-2024-034-03 NCSU-42526.601 G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G; or X15 is A, T, C, or G (SEQ ID NO: 307). In some embodiments, X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14is G or T; or X15is G or T (SEQ ID NO: 308). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 270-273 or SEQ ID NO: 282 (see, e.g., FIGS.58A-58G and Table 25). In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding thrombin, or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: CG(X1)A(N2)TGG(X3-5)GGTTGG(X6- 9)GG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; or X9 is A, T, C, or G (SEQ ID NO: 309). In some embodiments, X1 is T, G, or A; X2 is A or T; X3 is G or T; X4 is G or T; X5 is G or T; X6 is G, T, or A; X7 is G, T, or A; X8 is G, A, or T; or X9 is G, A, or T (SEQ ID NO: 310). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to any one of SEQ ID NOs: 274-276 (see, e.g., FIGS.58A-58G and Table 25). In some embodiments, the single-stranded nucleic acid molecule capable of specifically binding thrombin, or a derivative or analog thereof, comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, or 100% identical) to the following: AGG(X1)TGG(X2)TAGG(X3-13)TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; or X13 is A, T, C, or G (SEQ ID NO: 311). In some embodiments, X1 is G or T; X2 is G or T; X3 is A, T, C, or G; X4 is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10 is A, T, C, or G; X11 is T or G; X12 is T or G; or X13 is G or T (SEQ ID NO: 312). In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical (e.g., at least 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, 95%, NCSU-2024-034-03 NCSU-42526.601 or 100% identical) to any one of SEQ ID NOs: 280-283 (see, e.g., FIGS.58A-58G and Table 25). In accordance with these embodiments, the nucleic acid molecules identified using the methods of the present disclosure (e.g., candidate aptamers) can comprise a KDfor thrombin, or a derivative or analog thereof, that is less than about 500 nM. In some embodiments, the nucleic acid molecules comprise a KDfor thrombin, or a derivative or analog thereof, that is less than about 400 nM. In some embodiments, the nucleic acid molecules comprise a KDfor thrombin, or a derivative or analog thereof, that is less than about 300 nM. In some embodiments, the nucleic acid molecules comprise a KD for thrombin, or a derivative or analog thereof, that is less than about 200 nM. In some embodiments, the nucleic acid molecules comprise a KD for thrombin, or a derivative or analog thereof, that is less than about 100 nM. In some embodiments, the nucleic acid molecules comprise a KDfor thrombin, or a derivative or analog thereof, that is less than about 50 nM. In some embodiments, the nucleic acid molecules comprise a KD for thrombin, or a derivative or analog thereof, that is less than about 25 nM. In some embodiments, the nucleic acid molecule comprises a detection moiety. In some embodiments, the nucleic acid molecule is in solution or attached to a substrate. In accordance with the above embodiments, the nucleic acid molecule is capable of binding thrombin, or a derivative or analog thereof, under physiological conditions. Embodiments of the present disclosure also include a vector comprising any of the nucleic acid sequences described herein.4. Methods of UseEmbodiments of the present disclosure also include a method of detecting cocaine, or a derivative or analog thereof. In accordance with these embodiments, the method includes combining any of the nucleic acid molecules described herein comprising a fluorescent moiety with a quencher-labeled nucleic acid molecule that is at least partially complementary to the nucleic acid molecules to form a quenched composition. The method also includes exposing the quenched composition to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof. In some embodiments, presence of the cocaine, or a derivative or analog thereof, in the sample displaces the quencher-labeled nucleic acid molecule, thereby producing a fluorescent signal proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample. NCSU-2024-034-03 NCSU-42526.601 Embodiments of the present disclosure also include a method of detecting cocaine, or a derivative or analog thereof. In accordance with these embodiments, the method includes combining any of the nucleic acid molecules described herein with a reporter compound that binds to the nucleic acid molecules to form a complexed composition. The method also includes exposing the complexed composition to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof. In some embodiments, presence of the cocaine, or a derivative or analog thereof, in the sample displaces the reporter compound, thereby allowing the reporter compound to form detectable aggregates proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample. Embodiments of the present disclosure also include a method of detecting cocaine, or a derivative or analog thereof. In accordance with these embodiments, the method includes immobilizing any of the nucleic acid molecules described herein to an electrically conductive substrate, wherein the nucleic acid molecules comprise a redox tag, to form a detection sensor. The method also includes exposing the detection sensor to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof. In some embodiments, presence of the cocaine, or a derivative or analog thereof, in the sample binds the nucleic acid molecules, thereby producing an electrochemical signal proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample. In accordance with these embodiments, the sample is a biological sample from a human subject. In some embodiments, the biological sample is a saliva sample, a urine sample, a blood sample, a serum sample, a plasma sample, a fecal sample, a CSF sample, or a tissue sample. In some embodiments, the method further comprises sequencing the plurality of high-affinity candidate aptamers. In some embodiments, the method further comprises characterizing the plurality of high-affinity candidate aptamers using isothermal titration calorimetry (ITC). In some embodiments, the method further comprises assessing binding specificity of the plurality of high-affinity candidate aptamers using an exonuclease-based fluorescence assay. Embodiments of the present disclosure also include a method of detecting thrombin, or a derivative or analog thereof. In accordance with these embodiments, the method includes combining any of the nucleic acid molecules described herein comprising a fluorescent moiety with a quencher-labeled nucleic acid molecule that is at least partially complementary to the nucleic acid molecules to form a quenched composition. The method also includes exposing the quenched composition to a sample comprising or suspected of comprising thrombin, or a NCSU-2024-034-03 NCSU-42526.601 derivative or analog thereof. In some embodiments, presence of the thrombin, or a derivative or analog thereof, in the sample displaces the quencher-labeled nucleic acid molecule, thereby producing a fluorescent signal proportional to the concentration of the thrombin, or a derivative or analog thereof, in the sample. Embodiments of the present disclosure also include a method of detecting thrombin, or a derivative or analog thereof. In accordance with these embodiments, the method includes combining any of the nucleic acid molecules described herein with a reporter compound that binds to the nucleic acid molecules to form a complexed composition. The method also includes exposing the complexed composition to a sample comprising or suspected of comprising thrombin, or a derivative or analog thereof. In some embodiments, presence of the thrombin, or a derivative or analog thereof, in the sample displaces the reporter compound, thereby allowing the reporter compound to form detectable aggregates proportional to the concentration of the thrombin, or a derivative or analog thereof, in the sample. Embodiments of the present disclosure also include a method of detecting thrombin, or a derivative or analog thereof. In accordance with these embodiments, the method includes immobilizing any of the nucleic acid molecules described herein to an electrically conductive substrate, wherein the nucleic acid molecules comprise a redox tag, to form a detection sensor. The method also includes exposing the detection sensor to a sample comprising or suspected of comprising thrombin, or a derivative or analog thereof. In some embodiments, presence of the thrombin, or a derivative or analog thereof, in the sample binds the nucleic acid molecules, thereby producing an electrochemical signal proportional to the concentration of the thrombin, or a derivative or analog thereof, in the sample. In accordance with these embodiments, the sample is a biological sample from a human subject. In some embodiments, the biological sample is a saliva sample, a urine sample, a blood sample, a serum sample, a plasma sample, a fecal sample, a CSF sample, or a tissue sample. In some embodiments, the method further comprises sequencing the plurality of high-affinity candidate aptamers. In some embodiments, the method further comprises characterizing the plurality of high-affinity candidate aptamers using isothermal titration calorimetry (ITC). In some embodiments, the method further comprises assessing binding specificity of the plurality of high-affinity candidate aptamers using an exonuclease-based fluorescence assay. NCSU-2024-034-03 NCSU-42526.6015. Materials and MethodsOligonucleotides. All DNA oligonucleotides were purchased from Integrated DNATechnologies (Table 1). The DNA used for SELEX and fluorescent sensors was purchased as HPLC-purified. All other oligonucleotides were purchased as standard desalt quality. Thiol- and-methylene-blue-modified DNA sequences were dual-HPLC-purified by the manufacturer. All oligonucleotides were dissolved in molecular biology-grade water and their concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The library, complementary DNA (NA-cDNA), and high-throughput sequencing (HTS) primers were purified by the manufacturer via polyacrylamide gel electrophoresis (PAGE). Primers for in vitro selection and biotinylated oligonucleotides were purchased as HPLC purified. All other oligonucleotides were acquired as standard desalt quality. Table 1. DNA sequences. D N D c F p B r p H H N N N N N N N N N N N N N N N N NC195-Cy5 GTTGTCGTAAG 130 NCSU-2024-034-03 NCSU-42526.601 cDNA13Q GTCGTAAGTTCTG / 3IAbRQSp / 131 N ’ M 3 M tr Materials and reagents. Molecular biology-grade water and black 384-well flat bottom microplates were purchased from Corning. Exonuclease I (E. coli), Exonuclease III (E. coli), and T5 Exonuclease (E. coli) were purchased from New England Biolabs. Bovine serum albumin, Tris base, Tris HCl, 5 M NaCl solution, 1 M MgCl2solution, potassium chloride, sodium hydroxide, sulfuric acid, 6-mercapto-1-hexanol, tris(2-carboxyethyl) phosphine, Triton X-100, lidocaine HCl, diphenhydramine HCl, procaine HCl, benzocaine, ibuprofen sodium, acetaminophen, caffeine, quinine hemisulfate hydrate, serotonin HCl, xylene cyanol, acrylamide, bis-acrylamide, and 10 kDa molecular weight cutoff filters (0.5 mL capacity) were purchased from Sigma Aldrich. Levamisole HCl was purchased from MP Biomedicals. Scopolamine hydrobromide trihydrate was purchased from Acros Organics. Recombinant human flap endonuclease 1 (FEN1), cocaine HCl, (–)-nicotine, mephedrone HCl, methylenedioxypyrovalerone (MDPV) HCl, methylphenidate HCl, fentanyl HCl, (+)- methamphetamine HCl, methylenedioxymethamphetamine (MDMA) HCl, morphine sulfate, oxycodone HCl, fluoxetine HCl, and methadone HCl were purchased from Cayman Chemicals. Cocaine HCl was purchased from Cayman Chemicals and Sigma Aldrich. Formamide and human serum (normal pool) were purchased from Fisher Scientific. Gravity columns (500 µL) were purchased from Bio-Rad. Streptavidin-coated agarose resin (capacity: 1–3 mg biotinylated BSA / ml resin) and SYBR Gold were purchased from Thermo Fisher Scientific. GoTaq Hot Start Colorless Master Mix was purchased from Promega. PCR purification kits were purchased from Qiagen. 20× PBS was purchased from Santa Cruz Biotechnologies. Bovine blood was purchased from Hemostat Laboratory. Gold wire (75 µm diameter, 64 µm insulation thickness) was purchased from A-M systems. PTFE tubing (HS Sub-Lite-Wall, 0.02 in, black opaque) was purchased from Zeus. A 60 / 40 lead-selenium solder was purchased from Digikey. Platinum counter electrodes, Ag / AgCl (3 M KCl) reference electrodes and gold-plated pin connectors were obtained from CH Instruments. For in vivo sensor fabrication, gold wire (0.2 mm diameter × 10 cm in length; 99.9% purity), platinum wire (0.125 mm diameter × 10 cm in length; 99.95% purity), and silver wire (0.125 mm diameter × 10 cm in length; 99.99% purity) were purchased from A-M systems. Tris-EDTA solution (pH 8.0, 1×), formamide, and dithiothreitol (Roche) were purchased from Fisher Scientific. Microgravity columns (800 µL) NCSU-2024-034-03 NCSU-42526.601 were purchased from Bio-Rad. Streptavidin-coated agarose resin (capacity: 1–3 mg biotinylated BSA / ml resin) and SYBR Gold were purchased from Thermo Fisher Scientific. GoTaq Hot Start Colorless Master Mix was purchased from Promega. PCR purification kits were purchased from Qiagen. Octet Super Streptavidin biosensors for biolayer interferometry (BLI) experiments were purchased from Sartorius. Buffers. The following buffers where employed in this work: 1) Selection buffer: 20mM Tris-HCl (pH 7.4), 140 mM NaCl, 4 mM KCl, 5 mM MgCl2 and 2) Physiological buffer: 20 mM Tris-HCl (pH 7.4), 140 mM NaCl, 4 mM KCl, 2 mM MgCl2.For experiments involving FEN1 digestion, 0.008% (v / v) Triton X-100 and 1 mM dithiothreitol was included in the buffer. Loading buffer (1×) for PAGE analysis contains 75% formamide (v / v), 10% glycerol (v / v), 0.125% SDS (w / v), 10 mM EDTA, and 0.02% (w / v) xylene cyanol. PAGE purification buffer (prepared as 2×) contains 7 M urea, 40% glycerol (v / v), and 0.02% (w / v) xylene cyanol. For the selection of cocaine aptamer, the buffer consisted of 20 mM Tris (pH 7.4), 140 mM NaCl, 4 mM KCl, and 5 mM MgCl2. For cocaine NA-SELEX, the buffer for FEN1 digestion also included 0.008% (v / v) Triton X-100 and 1 mM dithiothreitol. For the selection of thrombin aptamers, the buffer consisted of 20 mM Tris (pH 7.4), 140 mM NaCl, 4 mM KCl, and 1 mM MgCl2. For thrombin NA-SELEX, the buffer for FEN1 digestion also included 0.01% (v / v) Triton X-100. Biolayer interferometry experiments for thrombin aptamers included 7.5 µM BSA in the buffer. Loading buffer (1×) for PAGE analysis contains 75% formamide (v / v), 10% glycerol (v / v), 0.125% SDS (w / v), 10 mM EDTA, and 0.02% (w / v) xylene cyanol. PAGE purification buffer (prepared as 2×) contains 7 M urea, 40% glycerol (v / v), and 0.02% (w / v) xylene cyanol. Sequences. The various embodiments of the present disclosure include polynucleotides having the following nucleic acid sequences. Variable nucleic acids are represented by “X” or “N.” In some embodiments, an “X” or an “N” followed by a numerical range (e.g., X5-9) indicates that there are at least the number of nucleotides present in the nucleic acid molecule represented by the first (lower) integer in the range, and there are at most the number of nucleotides present in the nucleic acid molecule represented by the second (higher) integer in the range. In accordance with this, the number of nucleotides represented by the first number of the range are required to be present in the nucleic acid molecule, but the other numbers in the range are optional (e.g., for X5-9, at least 5 nucleotides are present in the nucleic acid molecule; however, there may be 6, 7, 8, or 9 nucleotides present in the nucleic acid molecule). NCSU-2024-034-03 NCSU-42526.601 Family 1 consensus sequence: TAGGTGTGGGTCGGC-(X10)-GGGTA; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; and X10is A, T, C, or G (SEQ ID NO: 1). Family 1 consensus sequence: TAGGTGTGGGTCGGC- (X10)-GGGTA; wherein X1 is T or C; X2 is C or A; X3 is C or T; X4 is T or G; X5 is T or G; X6 is A, T or G; X7is A, T, or G; X8is G or T; X9is G or T; and X10is T or G (SEQ ID NO: 2). Exemplary sequences from Family 1 (see also FIG.54A): TAGGTGTGGGTCGGC TGCTTTCGCAGGGTA (SEQ ID NO: 3); TAGGTGTGGGTCGGCTTTTTTTTAAGGGTA (SEQ ID NO: 4); TAGGTGTGGGTCGGCGCTAGGGGCAGGGTA (SEQ ID NO: 5); TAGGCGGGGGTCGGCCACCGAGGTGGGGTA (SEQ ID NO: 6); TAGGTGGGGGTCGGCCATGGGAGTGGGGTA (SEQ ID NO: 7); TAGGTGTGGGTCGGCTCCGGATGGAGGGTA (SEQ ID NO: 8); TAGGTGTGGGTCGGCTCAATTCGGAGGGTA (SEQ ID NO: 9); TAGGTGTGGGTCGGCCATTAGTGGAGGGTA (SEQ ID NO: 10); TAGGTGGGGGTCGGCGCCGTAGGTGGGGTA (SEQ ID NO: 11); TAGGTGTGGGTCGGCTCCGAATGGAGGGTA (SEQ ID NO: 12). Family 2 consensus sequence: (X1-7)-GTTGGTTCTAGGG-(X8)-TAGGATGGC; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; and X8is A, T, C, or G (SEQ ID NO: 13). Family 2 consensus sequence: (X1-7)-GTTGGTTCTAGGG-(X8)-TAGGATGGC; wherein X1is G; X2is T or G; X3is G; X4is T or G; X5is G or T; X6is C or T; X7is T or C; and X8 is G or T (SEQ ID NO: 14). Exemplary sequences from Family 2 (see also FIG. 54B): GTG TGCTGTTGGTTCTAGGGGTAGGATGGC (SEQ ID NO: 15); GGGCGGTTGGTTGTTCT GGGGTAGGATGGC (SEQ ID NO: 16); GGGTGCCGTTGGTTCTAGGGTTAGGATGGC (SEQ ID NO: 17); GTGTGCTGTTGGTTCTAGGGTTAGGATGGC (SEQ ID NO: 18); GGGTGCTGTTGGTTCTAGGGGTAGGATGGC (SEQ ID NO: 19); GGGTGCTGTTGGTTCTAGGGTTAGGATGGC (SEQ ID NO: 20); GGGTGCCGTTGGTTCTAGGGGTAGGATGGC (SEQ ID NO: 21); GTGTGCTGTTGGTTCTAGGGTAGGATGGC (SEQ ID NO: 22). Family 3 consensus sequence: (X1-2)-GGGATGT-(X3)-TAGTTAGTG-(X4)- GTCGG-(X5-10); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G, X9 is A, T, C, or G, and X10is A, T, C, or G (SEQ ID NO: 23). Family 3 consensus sequence: NCSU-2024-034-03 NCSU-42526.601 (X1-2)-GGGATGT-(X3)-TAGTTAGTG-(X4)-GTCGG-(X5-10); wherein X1is G or A; X2is A or T; X3 is G or T; X4 is G; X5 is A or T; X6 is G or T; X7 is C; X8 is A or C; X9 is T or G and X10is A, G or T (SEQ ID NO: 24). Exemplary sequences from Family 3 (see also FIG. 54C): ATGGGATGTTTGTTAGTGTGTCGGTGCATT (SEQ ID NO: 25); ATGGGATGTGTAGTTAGTGGTCGGATCCGA (SEQ ID NO: 26); ATGGGATGTGTAG TTAGTGGTCGGATCCGG (SEQ ID NO: 27); ATGGGATGTAAGTTAGTGGGTCGGATCCGG (SEQ ID NO: 28); AAGGGATGTTTGTTAGTGTGTCGGATCTAT (SEQ ID NO: 29); ATGGGATGTAAGTTAGTGGGTCGGATCCGA (SEQ ID NO: 30); AAGGGATGTTTGTTAGTGTGTCGGTGCATT (SEQ ID NO: 31); AAGGGATGTGAGTTAGTGTGTCGGATCTAT (SEQ ID NO: 32); AAGGGAGGTTTGTTAGTGTGTCGGTGCATT (SEQ ID NO: 33); AAGGGATGTGTAGTTAGTGGTCGGATCCGA (SEQ ID NO: 34); GTGGGAAGTGTGG TTTGTGATCGGATCCGT (SEQ ID NO: 35); GTGGGATGTGTAGTTAGTGGTCGGATCCGA (SEQ ID NO: 36); GTGGTATGTGAATTAGTGTGTCGGGCCCGG (SEQ ID NO: 37); TGGGATGTGTTGTTAGTGCTGTCGGATCCG (SEQ ID NO: 38); AAGGGATGTGAGTTAGTGTGTCGGTGCATT (SEQ ID NO: 39); AAGGGATGTCTGTTAGTGTGTCGGTGCATT (SEQ ID NO: 40). Family 4 consensus sequence: (X1)-CAGGGGG-(X2)-GGCTAGGGTGCGCGG- (X3)-AGCTG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G (SEQ ID NO: 41). Family 4 consensus sequence: (X1)-CAGGGGG-(X2)-GGCTAGGGTGCGCGG- (X3)-AGCTG; wherein X1 is A or T; X2 is G or A; and X3 is G or A (SEQ ID NO: 42). Exemplary sequences from Family 4 (see also FIG. 54D): ACAGGGGGGGGCTAGGGTGCGCGGGAGCTG (SEQ ID NO: 43); TCAGGGGGAGGCTAGGGTGCGCGGAAGCTG (SEQ ID NO: 44); ACAGGGGGGGGGCTAGGGTGCGCGGGAGCTG (SEQ ID NO: 45); ACAGGGGGGGGCTAGGGTGCGCGGAAGCTG (SEQ ID NO: 46); ACAGGGGGTGGCTAGGGTGCGCGG GAGCTG (SEQ ID NO: 47). Family 5 consensus sequence: TAGTTC-(X1-5)-AGGGGTAGG-(X6)- GTGGTTGTG; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; and X6 is A, T, C, or G (SEQ ID NO: 48). Family 5 consensus NCSU-2024-034-03 NCSU-42526.601 sequence: TAGTTC-(X1-5)-AGGGGTAGG-(X6)-GTGGTTGTG; wherein X1is C or G; X2is G; X3 is A or G; X4 is G or T; X5 is A or T; and X6 is T or C (SEQ ID NO: 49). Exemplary sequences from Family 5 (see also FIG. 54E): TAGTTCCGGGTAGGGGTAGGCGTGGTTGTG (SEQ ID NO: 50); TAGTTCGGATAAGGGGTAGGTGTGGTTGTG (SEQ ID NO: 51); TAGTTCCGGGTAGGGGTAGGTGTGGTTGTG (SEQ ID NO: 52). Family 6 consensus sequence: (X1-5)-TCTGAGGGTCAAC-(X6-9)-TGGTGTAGT- (X10-11); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10is A, T, C, or G; and X11is A, T, C, or G (SEQ ID NO: 53). Family 6 consensus sequence: (X1-5)-TCTGAGGGTCAAC-(X6-9)-TGGTGTAGT-(X10-11); wherein X1 is C or T; or G; X10 is T or C; and X11 is G (SEQ ID NO: 54). Exemplary sequences from Family 6 (see also FIG. 54F): CTGTTCTGAGGGTCAACCTTTGGTGTAGTG (SEQ ID NO: 55); CTGTTCTGAGGGTCAACGGTGGTGTAGTCG (SEQ ID NO: 56); TAGTTCTGAGGAA TCAACGTCGGTGTAGTT (SEQ ID NO: 57); CTGTTCTGAGGGTCAACCTTTTGTGTAGTG (SEQ ID NO: 58); AGGTTCTGAGGAATCAACGTCGGTGTAGTT (SEQ ID NO: 59); CTGCTCTGAGGGTCAACGGTGGTGTAGTCG (SEQ ID NO: 60); GGGGTTCAGAGGGTCAACGGTGGTGTTGTC (SEQ ID NO: 61); TTGTTCTGAGGGTCAACGGTGGTGTAGTTA (SEQ ID NO: 62); CGGGTTCAGAGGGTCAACGGTGGTGTTGTC (SEQ ID NO: 63). Family 7 consensus sequence: (X1-5)-TTTTGGGT-(X6-7)-TCTGG-(X8)-TGGG-(X9-15); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; X13is A, T, C, or G; X14is A, T, C, or G; and X15 is A, T, C, or G (SEQ ID NO: 64). Family 7 consensus sequence: (X1- 5)-TTTTGGGT-(X6-7)-TCTGG-(X8)-TGGG-(X9-15); wherein X1 is G or A; X2 is G or T; X3 is A or T; X4is C; X5is C; X6is G; X7is T or C; X8is G or T; X9is A; X10is G; X11is G or T; X12 is T or G; X13 is G or T; X14 is G or T; and X15 is C or T (SEQ ID NO: 65). Exemplary sequences from Family 7 (see also FIG. 54G): TTTTGGGTGTCTGGGTGGGAG (SEQ ID NO: 66); TTACTTTTGGGTTGTCTGGGTGGGAGGTAT (SEQ ID NO: 67); NCSU-2024-034-03 NCSU-42526.601 AAACTTTTGGGTATCTGGTTGGGAGGTTCT (SEQ ID NO: 68); ACATTTGGGTATTCTGGGTGAGCTGT (SEQ ID NO: 69); GGTCTTTTGGGTGTTCTGGGTGGGAGGAGC (SEQ ID NO: 70); CGACTTTTGGGTGTTCTGGGTGGGATGTGG (SEQ ID NO: 71); GTAGCTTCGGGTGT TCTGGGTGAGCTCTGC (SEQ ID NO: 72); GGACTTTTGGGTGCTCTGGGTGGGAGGGGC (SEQ ID NO: 73); TTCCCTTCGGGTGTTCTGGGTGGGATGGAG (SEQ ID NO: 74); GGCCTTTTGGGTTG TCTGGGTGGGAGGGGG (SEQ ID NO: 75); TTACTTTTGGGTATCTGGTTGGGAGGTAGA (SEQ ID NO: 76); AATCTTTTGGGTGT TCTGGGTGAGGTGTTT (SEQ ID NO: 77). Family 8 consensus sequence ACA-(X1)-GG-(X2)-GTGGA-(X3-7)-TGGGC-(X8-15); wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G ; and X15 is A, T, C, or G (SEQ ID NO: 78). Family 8 consensus sequence: ACA- (X1)-GG-(X2)-GTGGA-(X3-7)-TGGGC-(X8-15); wherein X1 is C or G; X2 is T or C; X3 is G or T; X4 is G, T, or C; X5 is G or A; X6 is G; X7 is G or C; X8 is G; X9 is T; X10 is A, or T; X11 is T, G, or A; X12 is A or G; X13 is G; X14 is G; and X15 is G (SEQ ID NO: 79). Exemplary sequences from Family 8 (see also FIG. 54H): ACAGGGCGTGGA GTGGCTGGGCTTCAAGGG (SEQ ID NO: 80); ACACGGTGTGGATGAGGTGGGCTAATAGGG (SEQ ID NO: 81); ACAGGGCGTGGAGGAGCTGGGCTATTAGGG (SEQ ID NO: 82); TACACGGTGTGGA GCGGGTGGGCGTAGGGG (SEQ ID NO: 83). Table 2: Aptamer sequences. : NC56 GGGCGGTTGGTTGTTCTGGGGTAGGATGGC 16 NCSU-2024-034-03 NCSU-42526.601 NC76 GGGTGCCGTTGGTTCT AGGGTTAGGATGGC 17 NC20 GGACTTTTGGGTGCTCTGGGTGGGAGGGGC 73 NCSU-2024-034-03 NCSU-42526.601 NC22 TTCCCTTCGGGTGTTCTGGGTGGGATGGAG 74 6. ExamplesThe accompanying Examples are offered as illustrative as a partial scope and particular embodiments of the disclosure and are not meant to be limiting of the scope of the disclosure. Example 1 Here presented is a rational in vitro selection method that applied kinetic selection pressure via the use of nucleases to directly isolate aptamers with slow kofffrom randomized oligonucleotide libraries in solution. The nuclease-assisted SELEX (NA-SELEX) method utilized a structured 73-nucleotide (nt) DNA library featuring an 8-base-pair (bp) stem and a NCSU-2024-034-03 NCSU-42526.601 30-nt randomized loop that served as the putative target binding domain, flanked by constant regions containing PCR primer-binding sites (FIG. 1A, library). The nuclease utilized here, flap endonuclease 1 (FEN1), was a high fidelity structure-specific enzyme that rapidly cleaved 5’ overhanging flaps on DNA substrates containing upstream and downstream double-stranded regions. To enable FEN1-based separation of binding sequences, the library was hybridized with a 40-nt complementary DNA (NA-cDNA) (FIG.1A, NA-cDNA), which formed a 15-bp double-stranded region near the 5’ terminus of the library molecule. The resulting complex offered an ideal substrate of FEN1, containing upstream and downstream duplex DNA regions with a protruding 8-nt 5’ library flap and a 3’ single-nucleotide cDNA overhang (FIG. 1B, library-cDNA complex). Library oligonucleotides that did not bind the target retained their double-flap structure and were efficiently cleaved by FEN1, which trimmed away 9 nt from the 5’ end (FIG. 1B, non-target binders). In contrast, aptamers that bound the target and underwent concomitant displacement from NA-cDNA converted from a double-flap to a stem- loop structure that was unrecognizable by FEN1 and thus remained intact (FIG. 1B, aptamer- target complex). To select for aptamers with slow koff, the library was digested with FEN1 for an extended duration. Aptamers that remained bound to their target for long periods of time due to a slow koff were able to survive the digestion trial, whereas library sequences with a more rapid koff released the target and readily rebound the cDNA to form a double-flap structure, which was rapidly cleaved by FEN1(FIG. 1C). Following digestion, the intact and cleaved library strands were separated by polyacrylamide gel electrophoresis (PAGE), and the intact binders were then PCR amplified to generate an enriched pool that was subjected to another round of selection. Once the pool demonstrated a notably increased level of resistance to FEN1 digestion, it was subjected to high-throughput sequencing (HTS) to identify the enriched aptamers (FIG.1C). Cocaine was used as a demonstration selection target for NA-SELEX, given that the existing aptamer had mediocre affinity (KD ~ 5 µM) and poor specificity, hence the need for an aptamer with improved binding properties. Initial attempts with NA-SELEX proved unsuccessful, as after several rounds of selection, it was observed that enriched pools resisted FEN1 digestion regardless of whether the target was absent or present. HTS analysis of these pools revealed that non-target-binding sequences were being enriched that resisted FEN1 digestion via various mechanisms such as mutations in the cDNA hybridization site and structural misfolding. To overcome these issues, conventional library-immobilized SELEX (LI-SELEX) to pre-enrich target binding aptamers was performed and then NA-SELEX with the enriched pool was employed to specifically select aptamers with slow koff. LI-SELEX NCSU-2024-034-03 NCSU-42526.601 entailed hybridizing the library with a 15-nt biotinylated cDNA (LI-cDNA) and immobilizing the library-cDNA complex onto streptavidin-coupled agarose resin (see Table 14 for sequences). Library strands that underwent displacement from the cDNA upon the addition of target were eluted, captured, and PCR amplified, and the resulting amplicons were used for another round of selection. Eight rounds of LI-SELEX were performed to pre-enrich cocaine-binding sequences (detailed selection conditions in Table 15 and FIG. 2). In the first round, 1 nmol of library (~1014unique sequences) and 100 µM cocaine was used, and 0.5% pool elution was observed. In the second round, target concentration was reduced to 50 µM and counter-SELEX was initiated to remove binders to interferents, including molecules known to bind three-way- junction structured aptamers (which typically have poor specificity) and structurally-similar interferents relevant to drug screening (see Table 15 for list of interferents). For rounds two through seven, ~0.8% of the library was eluted by the target on average. In the eighth round, target-induced pool elution tripled (2.4%) (FIG. 2), indicating enrichment of target-binding sequences, and therefore this enriched pool was used to perform NA-SELEX. Three rounds of NA-SELEX were performed to enrich slow koff aptamers (see Table 16 for conditions). The overall scheme of NA-SELEX is shown in FIG. 3. Specifically, the round 8 enriched pool was combined with LI-cDNA and immobilized onto streptavidin beads (FIGS. 3A-3B) and washed repeatedly with buffer to remove library strands that were unable to bind strongly to LI-cDNA (referred to as negative selection) (FIG. 3C). This was useful as sequences incapable of cDNA hybridization could resist FEN1 digestion without being able to bind the target, thereby carrying over to subsequent rounds. Then an abbreviated counter- SELEX procedure was performed to remove interferent-binding sequences (FIG. 3D). The remaining library was released from the agarose resin using sodium hydroxide, and the solution was neutralized and desalted (FIG.3E). In general, it was observed that approximately 60–70% of the pool was recovered after negative selection and counter-SELEX in each round (FIG.4, red box). The recovered pool was then hybridized with NA-cDNA to form a flap substrate complex (FIG. 3F) and subsequently challenged with 50 µM cocaine or buffer as a negative control. The pools were digested with FEN1 for an extended period to specifically isolate slow koffaptamers (FIG. 3G). After digestion, the intact target binders were separated from the cleaved sequences using PAGE and PCR amplified for use in the next round of NA-SELEX (FIGS. 3H-3I). Based on preliminary testing with the native random library (FIG. 5), the selection pools were digested for 4 hr—a duration that was sufficient to achieve the lowest level of library retention. For the first round of NA-SELEX, 15% of the pool was retained in NCSU-2024-034-03 NCSU-42526.601 the absence of cocaine after digestion relative to 21% in the presence of cocaine. As a control, it was determined that ~10% of the random library was retained in the same amount of time, regardless of the absence or presence of target (FIGS. 6A-6B). Elevated resistance to FEN1 digestion in the presence of cocaine indicated that the pool indeed contained target-binding aptamers. After isolating and amplifying the selected library strands, two more rounds of NA- SELEX were performed as described above. Target-specific resistance to FEN1 digestion rose in rounds 10 and 11 to 30% and 59%, respectively, while pool retention in the absence of cocaine was 13% and 23%, respectively (FIGS.6A-6B). These results indicate that sequences were being enriched that could survive FEN1 digestion for prolonged periods of time. As a comparison, LI-SELEX was carried out for the additional three rounds in parallel, with the anticipation that this method does not select for slow koff. During the selection, increasing target elution by cocaine was observed over Rounds 9 – 11, rising from 9.5% in Round 9 to 33% in Round 11 (FIG. 6C), indicating that the final pool was highly enriched with cocaine-binding sequences. The round 8–11 LI-SELEX pools and the round 9–11 NA-SELEX pools were then subjected to HTS to identify enriched aptamer sequences (see Table 18 for summary of HTS data). The number of unique sequences exponentially declined in the LI-SELEX pools from Rounds 8–11, whereas a linear decrease in the NA-SELEX pools was observed (FIG.7). This suggested that different subpopulations of aptamers were enriched through differing selection forces in each strategy. Since both the NA- and LI-SELEX pools originated from the same round 8 LI-SELEX pool, high similarity (90%) among those sequences with an abundance > 0.01% in each set of pools was observed (FIG. 8). The main differences between these pools could be observed in the relative abundances and growth pattern of particular sequences (FIGS. 7-10). To identify those aptamer candidates that were preferentially enriched during NA- SELEX, these pools were analyzed based on their retention factor (RF). RF was calculated based on the equation AT – AC / AC, where AT and AC are the abundance of a particular sequence in a given NA-SELEX round after digestion with or without target, respectively (FIG. 6D). Taking AC into account minimized the effects of PCR bias and eliminated non-binding sequences that inherently resist FEN1 digestion. Sequences with RF > 0 were presumably able to survive FEN1 digestion to a greater extent in the presence of cocaine relative to othersequences; sequences with relatively high RF had slow koff( 9N CONTRAST& SEQUENCES WITH >6 Z )were incapable of surviving FEN1 digestion even when the target was present, indicating they did not bind cocaine or exhibit a rapid koff. Promising aptamer candidates were selected that exhibited > 0.08% abundance in the final round of selection and RF > 0 for all three NA- NCSU-2024-034-03 NCSU-42526.601 SELEX rounds. These 25 candidates are indicated by boxes in FIG. 6D. Notably, these aptamers also displayed the greatest growth in abundance between round 8 and round 11 of NA-SELEX (FIG. 9A) and were much more abundant (10–30-fold) in the round 11 NA- SELEX pool relative to the round 11 LI-SELEX pool (FIG.9B). Contrary to the evolution that occurred during NA-SELEX, very little changed between rounds 8 through 11 of LI-SELEX. Specifically, the most abundant sequences remained the same throughout these three rounds, and only very few experienced >4-fold enrichment (FIG. 10). As a control, 18 aptamers were also selected from LI-SELEX that were either most abundant or which exhibited enrichment fold > 2 and abundance > 0.08% in round 11. These various aptamer candidates were synthesized containing their random loop and the 8-bp constant stem (Table 3 & Table 4) and isothermal titration calorimetry (ITC) was used to determine their binding affinity. No meaningful difference in average KDvalues was found between the two sets of aptamers (380 nM for both) and in the overall range of values (22–2,650 nM for LI-SELEX, 70–1,100 nM for NA-SELEX) (FIGS. 11-15), which suggested that NA-SELEX—at least under the conditions performed in this trial—did not necessarily enrich higher affinity aptamers. To demonstrate that the exclusion of primer sites did not affect aptamer affinity, certain full-length sequences containing their primer sites were synthesized (Table 5 & Table 6) and no significant difference in affinity with or without primer sites was confirmed (FIG.16). Table 3. Sequence of room-temperature (RT) NA-SELEX aptamers selected for further characterization. NC59 CTTACGACTAGGTGTGGGTCGGCGCTAGGGGCAGGGTAGTCGTAAG 149 NCSU-2024-034-03 NCSU-42526.601 NC66 CTTACGACGTGGGAAGTGTGGTTTGTGATCGGATCCGTGTCGTAAG 150 Table 4. Sequences of LI-SELEX aptamers selected for further characterization. SEQ ID N N N N M . Table 5 Sequence of full-length NA-SELEX aptamers selected at room temperature. D C 8- u 8 GAAGCTGGTCGTAAGGATGCTGCAATC NCSU-2024-034-03 NCSU-42526.601 CGAGCATAGGCAGAACTTACGACTAGTTCGGATAAGGGGTAGGTGT NC21-Full 183 GCGCATCGTCGTAAGGATGCTGCAATC Tbl 6 S f f lll th LISELEX t C- u 05 GTGTAGTGGTCGTAAGGATGCTGCAATC NCSU-2024-034-03 NCSU-42526.601 CGAGCATAGGCAGAACTTACGACATGGGATGTGTAGTTAGTGGTC NC2-Full 206 To better understand the differential enrichment of sequences in each selection strategy, full-length aptamers hybridized with NA-cDNA were digested in the absence or presence of cocaine (FIG. 6E, top panel and FIGS. 17-19). In general, all sequences were digested to 10% within 90 min in the absence of cocaine. However, when cocaine was present, NA-SELEX-derived sequences such as NC76, NC13, and NC52 greatly resisted FEN1 digestion even after four hours (FIG.6E, top panel). In contrast, nearly all LI-SELEX-derived sequences, such as NC1, NC2, and NC15, were completely digested after four hours, regardless of whether cocaine was present (FIG. 6E, bottom panel and FIGS.20-21). Although NA- and LI-SELEX preferred aptamers had similar cocaine-binding affinities, the resistance of NA- SELEX preferred aptamers to FEN1 digestion in the presence of cocaine indicated that NA- SELEX preferentially promotes the enrichment of aptamers with slower koff. To further understand the binding characteristics of the aptamers enriched by both selection methods, their binding kinetics were determined using biolayer interferometry (BLI). This method monitored the binding of ligands to receptors immobilized on a biosensor surface in real time, based on NCSU-2024-034-03 NCSU-42526.601 changes in the interference pattern of white light that occurred due to the interaction between reflected light from the sensor surface and an internal reference surface. The kinetics of aptamers that were either highly abundant or had a high RF in NA-SELEX or enrichment fold in LI-SELEX were characterized. Aptamers were labeled with biotin at their 5’ terminus and immobilized onto streptavidin-coated biosensors (see Table 7 for sequences). Aptamers that were preferentially enriched by NA-SELEX, such as NC13 and NC21 (FIG.6F and FIG.22), had an average koff of ~6.2 × 10-3s-1(residence time = 160 s) with kon on the order of ~104M-1s-1. In contrast, highly-abundant aptamers isolated via LI-SELEX, including NC1 and NC2, generally displayed kon of ~105M-1s-1and average koff of 1.8 ×10-2s-1(residence time = 56 s) (FIG. 6G and FIG. 22). The binding rate constants of these LI-SELEX preferred sequences were similar to those of other small-molecule aptamers isolated through conventional SELEX methodologies. These results together indicate that nuclease-based selection selectively enriched aptamers that had modestly (~3-fold) slower off-rates and longer residence times. The fact that the KD values obtained via BLI and ITC were highly concordant (Table 8 and Table 9) indicated that the determined kinetic parameters are robust. Table 7. Sequences of biotinylated aptamers used for biolayer interferometry (BLI) experiments. C- -5b o 30 TCGTAAG NCSU-2024-034-03 NCSU-42526.601 / 5BiotinTEG / CTTACGACACAGGGCGTGGAGTGGCTGGGCTTCAAGGGG NC1947-5bio 231 Table 8. Summary of affinity and kinetic binding constants for LI-SELEX sequences. A t m r ITC KD Steady-state KD Kinetic KD kon koff Table 9. Summary of affinity and kinetic binding constants for NA-SELEX preferred sequences enriched at room temperature. - - - - * For NC21 and NC73, konand koffwere determined based on fitting of sensorgrams. For NC13, NC52, and NC76, kon was calculated using steady state KD and fitted koff. Based on these results, it was hypothesized that increasing the stringency of NA- SELEX could lead to aptamers with even slower off-rates and perhaps higher affinity. To this end, NA-SELEX was performed at physiological temperature (37 ºC) rather than room temperature, which increased the catalytic activity and digestion rate of FEN1, making it more difficult for low-affinity or rapid-koffaptamers to survive selection. This selection approach can NCSU-2024-034-03 NCSU-42526.601 also yield aptamers that bind with high affinity to targets at physiological temperature, which is valuable for applications such as in vivo bioimaging, therapeutics, drug delivery, and in vivo real-time sensing. To test this, the round 8 LI-SELEX pool was subjected to FEN1 digestion at 37 ºC in presence of 50 µM cocaine or buffer. Based on a preliminary experiment with the native library, the FEN1 digestion rate was much more rapid at this elevated temperature (FIG. 23), and the digestion time was therefore reduced during selection to 1.5 h. As in the previous trial of NA-SELEX, negative- and counter-selection was performed at the beginning of each round to remove sequences incapable of binding the cDNA and those that bound to interferents, respectively (FIG.24). Full conditions for this NA-SELEX experiment are shown in Table 10. Table 10. Selection conditions for NA-SELEX performed at 37 °C. In ut for Pool Retained % % % The round 9 pool displayed only marginally higher resistance to FEN1 digestion in the presence of cocaine (7%) versus the absence (6%) (FIG. 25A). In the following round, target-specific pool retention increased (6.6% versus 4%) (FIG. 26), and by round 11, more than twice as much DNA was retained in the presence of cocaine (7.8% vs 3.5% without) (FIGS. 25A-25B), demonstrating that target-binding sequences were being enriched that increasingly resisted FEN1 digestion. The resulting NA-SELEX pools were subjected to sequencing and the resulting dataset was analyzed. Pool diversity decreased from 20% unique sequences in the round 8 starting pool to < 10% after three rounds of NA-SELEX (FIG. 27). The sequence diversity of the final pool was greater than for the room-temperature trial. Several highly enriched sequences from the first NA-SELEX trial were also abundant in the final round NCSU-2024-034-03 NCSU-42526.601 of 37 ºC NA-SELEX, such as NC76. However, nine newly identified sequences were also highly enriched, including NC1947, NC314, NC1174, NC29264, NCA, NCB, NC950, NC21357, and NC358 (FIG.25B). In fact, NC29264 was not detected at all in the Round 8 LI- SELEX pool. All of these sequences had an abundance greater than 0.08% and displayed relatively high RF values ranging from 1 to 10—much greater than the RF range of aptamers identified from room temperature NA-SELEX (0.2–3). Notably, NC1947 was enriched by more than 1,000-fold between the first and final round of NA-SELEX, while NC29264 and NCA were enriched by 500-fold (FIG.28). In addition, certain aptamers in this round 11 pool were far more abundant relative to selection at room temperature with LI- and NA-SELEX, such as NC1947 and NCA, which were at least 100-300-fold more abundant (FIG. 29). This indicated that only certain aptamers could survive prolonged FEN1 digestion at elevated temperatures. The target-binding affinity of 19 different primer-truncated aptamers were synthesized and characterized based on an abundance > 0.08% and RF > 1 for all three selection rounds at 37 ºC using ITC (FIGS. 30-31 and Table 11). Of these aptamers, ten were already identified in the room temperature NA-SELEX trial and the other nine were newly identified in NA-SELEX performed at 37 ºC. Several aptamers exhibited KD values (at 37 ºC) in the range of 170–2,500 nM, with a median KD of 581 nM. Most small-molecule binding aptamers typically display much weaker affinities at physiological temperature. For instance, the previously reported cocaine aptamer had a KD of 75 µM at 37 ºC under the same buffer conditions (FIG. 32), which was 440-fold poorer than the highest-affinity aptamer, NC1947 (KD = 170 nM). The new aptamers identified here would therefore be well suited to detect cocaine under physiologically relevant conditions. It was hypothesized that the affinity of these aptamers would be even higher at room temperature. ITC confirmed that these aptamers generally had 2- to 5-fold greater affinity (FIG.33) with the exception of NCB and NC21357, for which cocaine binding is entropy-driven at both room temperature and 37 ºC. The sequence requirements of NCA and related sequences, which includes NC1947, NCB, and NC29264, were examined since they displayed such large preferential enrichment during NA-SELEX at 37 ºC. Using fastaptamer and WebLogo, conserved motifs were identified for this family of sequences (FIG.55). Members of this family are relatively G-rich; 50% of the nucleobases in NCA for instance are G. Conserved regions in this family include G-repeats interspersed with either other conserved elements (i.e., ‘ACA’ at the 5’ end) or regions of low sequence conservation. To assess the importance of these G nucleobases, five different point-mutants of NCA were designed where G was converted to T and (Table 12) NCSU-2024-034-03 NCSU-42526.601 their affinity for cocaine was characterized with ITC. None of these mutants bound to cocaine (FIG.55), indicating that these G bases are highly important for target binding. The specificity of these nine aptamers to a variety of other small molecules was also assessed using an exonuclease-based digestion assay. Highly enriched aptamers including NCA, NCB, NC1947, NC29264, and NC21357 demonstrated excellent specificity, with <10% cross-reactivity to 34 different interferents at 100-fold higher concentrations relative to cocaine (for THC, AB-FUBINCA, UR-144, 5 µM. For alprazolam and diazepam 50 µM. Quinine 250 µM) (FIG. 34). This is in stark contrast to MNS4.1, which cross-reacted to several other unrelated molecules including mephedrone, MDPV, MDMA, methadone, benzocaine, lidocaine, diphenhydramine, procaine, caffeine, serotonin, dopamine, and quinine (FIG.56). FEN1 digestion was performed at 37 ºC with full-length versions of these aptamer constructs (sequences shown in Table 13) in the presence of cDNA-NA with or without cocaine (FIG. 25C). All aptamers were rapidly digested by FEN1 in the absence of cocaine, but such digestion was inhibited to varying degrees when cocaine was present (FIG.25D; FIGS.35-37). NCA, NC1947, NC314, NC29264, and NC1174 resisted FEN1 digestion to the greatest extent when cocaine was present, while aptamers such as NCB, NC21357, NC358, NC32, NC16, NC35, and NC950 displayed only moderate inhibition. As a control, FEN1 digestion was also performed at 37 ºC with NC1, NC2, NC3, and NC195 which were highly abundant or enriched in the LI-SELEX round 11 pool. These sequences were rapidly digested regardless of whether cocaine was present (FIG. 25D; FIG. 38), which explains why they were not enriched during NA-SELEX. Finally, the binding kinetics of the NA-SELEX-enriched aptamers was assessed using BLI (FIGS.5E, 5F; FIG.39). The highly enriched aptamers NC1947 and NCA exhibited a koffof 1.2 × 10-3s-1and 2.5 × 10-3s-1and a konof 1.3 × 104M-1s-1and 5.0 × 104M-1s-1, respectively. These off-rates were 10-fold lower than those of the highly-abundant sequences obtained with LI-SELEX and 5-fold lower than the aptamers enriched in the room temperature NA-SELEX trial (Table 14). As a head-to-head comparison, the binding kinetics of original cocaine aptamer MNS4.1 was determined using BLI and it was found that it had a koff 2 × 10-2s-1(FIG. 57) which is approximately 10-fold faster than the koff of NC1947. In comparison to the binding kinetics of previously reported in vitro selected small molecule aptamers, which have an average koff of 3 × 10-2s-1with a median of 2 × 10-2s-1(Table 15), the disclosed cocaine aptamers have at least 10-fold slower dissociation kinetics. Additionally, the dissociation kinetics of the disclosed aptamers are still 5-fold slower than that of one the highest affinity in vitro selected small molecule aptamers reported to date (koff= 5 × 10-3s-1, KD= 2.4 nM). The NCSU-2024-034-03 NCSU-42526.601 disclosed cocaine aptamers have koffon par with high-affinity riboswitches, or naturally occurring RNA aptamers, with only the lengthier, informationally complex thiamine pyrophosphate riboswitch (koff= 2 × 10-4s-1) and cyclic di-GMP riboswitch (koff= 2 × 10-5s-1) having slower kofffor their target than NC1947 does for cocaine. At least for aptamers binding to small molecules, NA-SELEX can yield aptamers with koff similar to oligonucleotide receptors optimized by nature. The capability to identify slow off-rate aptamers may stem from performing NA-SELEX at 37 ºC, which increases the catalytic activity of FEN1, and thus the threshold residence time (and hence off-rate) required to survive digestion, such that aptamers with slow off-rates were enriched. Performing NA-SELEX at 37 ºC increased the threshold off-rate needed to survive digestion due to the increased FEN1 digestion rate, such that only aptamers with very slow off- rates were enriched. Despite their relatively slow on-rates, NC1947 and NCA were both successfully enriched through NA-SELEX; this is most likely because of the 30 min library- target incubation period, such that these aptamers were completely bound just prior to the start of digestion. In future iterations of NA-SELEX, decreasing this incubation time could perhaps promote the enrichment of slow off-rate aptamers with more rapid on-rates, leading to even higher affinity aptamers than those found here. These BLI data also explain why NC1947 and NCA were not enriched through conventional selection—in LI-SELEX, aptamers were eluted under non-equilibrium conditions within no more than 10 min, while these aptamers needed 30–60 min to reach target-binding equilibrium. Table 11. Sequences of NA-SELEX aptamers isolated at 37 ºC. NC29264 CTTACGACTACACGGTGTGGAGCGGGTGGGCGTAGGGGGTCGTAAG 243 Table 12. Sequences of NCA mutants. NCSU-2024-034-03 NCSU-42526.601 Seq. ID Sequence (5’ to 3’)SEQ ID NO NNNNN Table 13. Sequences of full-length NA-SELEX aptamers isolated at 37 ºC. Se ID Se uence (5’ to 3’)SEQ ID N N N N N N N N N N N Table 14. Summary of affinity and kinetic binding constants for NA-SELEX preferred sequences enriched at 37 ºC. NC358 581 185 - - - NCSU-2024-034-03 NCSU-42526.601 Table 15. Binding kinetics of in vitro selected small molecule-binding aptamers. Target kon(M-1s-1) koff(s-1) Kinetic KD(nM) In conclusion, a rational nuclease-based selection strategy was developed for isolating aptamers with high affinity and specificity as well as slow off-rates. The method is straightforward and accessible to those with the capabilities to perform conventional SELEX. NA-SELEX also provides a new route to aptamers that function at physiological temperatures, which is currently difficult—especially for small-molecule targets. Here, the capabilities of NA-SELEX were demonstrated with the small-molecule drug cocaine. However, the same methodology is broadly applicable. Indeed, one application of NA-SELEX is for the isolation of slow off-rate aptamers for protein and cell targets. Such aptamers can be of great use for the development of nanotechnological devices, molecular imaging, drug delivery, and therapy, wherein long ligand-receptor residence times are crucial for successful outcomes. Finally, because only peripheral scaffold regions of library molecules and cDNA need to consist of natural nucleic acids, NA-SELEX can also be adapted for use with chemically modified libraries, to isolate aptamers with improved binding properties as well as nuclease resistance, which can be crucial for biological applications. Example 2 Library-immobilized (LI)-SELEX. LI-SELEX was performed. Each library strand was 73 nucleotides in length and contained an 8-bp stem, a 30-nt randomized domain, and was NCSU-2024-034-03 NCSU-42526.601 flanked with PCR primer sites. The library contained a docking sequence for hybridization with a 15-nt complementary DNA strand. The sequences used for SELEX are listed in Table 16 and detailed selection conditions are provided in Table 17. The DNA library was first hybridized to a 15-nt biotinylated complementary DNA strand (LI-cDNA15-bio) by dissolving both in selection buffer at a molar ratio of 1:5, incubating at ~95 ºC for 5 min in a boiling water bath, and subsequently cooling in a room temperature water bath for 20 min. In the meantime, 250 µL of streptavidin agarose resin was loaded into a microgravity column and the resin was washed five times with 250 µL of selection buffer. The library-cDNA solution was then added to the column to immobilize the library. The immobilized library was washed several times with 250 µL aliquots of selection buffer to remove non-hybridized library molecules. Counter- SELEX was performed at this point to remove sequences that bound to interferents. The column was then washed again several times with 250 µL of buffer. Cocaine dissolved in selection buffer was then added to the column in three 250 µL aliquots, and the eluent was collected and subjected to purification with a 3 kDa ultracentrifugation filter to remove the target and salts. Library molecules in the purified eluent were amplified by performing PCRWITH * M: OF 7O@AQ 8OT ?TART 4OLORLESS =4> ;ASTER ;IX& * d; FORWARD PRIMER #6=$& AND *d; BIOTINYLATED REVERSE PRIMER #>='BIO$ WITH A 3IO>AD 4*))) THERMAL CYCLER USING THEfollowing protocol: 2 min at 95 °C; 11 cycles of 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 45 s, followed by 5 min at 72 °C. The optimal number of amplification cycles was determined via PAGE analysis of PCR samples. Single-stranded DNA was generated from the resulting double-stranded PCR amplicons as reported previously and finally purified with a 3 kDa filter with water. The concentration of DNA in the pool was determined using a NanoDrop2000 spectrometer. Table 16. DNA sequences used for SELEX in this work. N: HTS-RP GATTGCAGCATCCTTACGAC 268 NCSU-2024-034-03 NCSU-42526.601 Table 17. Selection conditions for library-immobilized (LI)-SELEX. Nuclease-Assisted (NA)-SELEX. Each round of NA-SELEX consists of four parts and is described in detail below. Part 1. Negative- and counter-selection. NA-SELEX was initiated using the pool from the eighth round of LI-SELEX. Washing (negative selection) and counter-SELEX were first performed to remove library sequences incapable of stable hybridization with the cDNA and those that bound to interferents, respectively. Detailed conditions for each round are provided in Table 18 and Table 19. The library pool was first hybridized with a five-fold excess of LI-cDNA15-bio in selection buffer by heating the solution in a boiling water bath for 5 minAND COOLING IN A ROOM TEMPERATURE WATER BATH FOR +) MIN( 9N THE MEANTIME& +.) d: OFstreptavidin agarose resin was loaded in a microgravity column and washed five times with+.) d: OF SELECTION BUFFER( @HE LIBRARY'C5<2 SOLUTION WAS THEN ADDED TO THE COLUMN TO NCSU-2024-034-03 NCSU-42526.601 immobilize the library. The column was washed 30 times with selection buffer to remove weakly-bound library strands, and then an abbreviated counter-SELEX procedure was performed against a variety of interferents. These include group TWJ1 (300 µM each of procaine, diphenhydramine, and nicotine), group TWJ2 (300 µM each of procaine, levamisole, and benzocaine), and 300 µM fentanyl. To perform counter-SELEX, 250 µL of interferents were added to the column and the eluents were discarded. Afterwards, the column was washed 30 times with 250 µL aliquots of selection buffer. When NA-SELEX was performed at 37 ºC, these washes were performed with selection buffer pre-warmed to 37 ºC in a water bath; the pH of the buffer was 7.4 at 37 ºC. To increase the recovery of library from the beads, the column was washed five times with 250 µL of selection buffer without MgCl2. This was done because the efficiency of elution with sodium hydroxide is lower when Mg2+is present. The column was then capped and 300 µL of 0.2 M NaOH was added to disrupt library-cDNA interaction. After 10 min incubation at room temperature, the column was uncapped and the eluent was collected, neutralized with 1 M HCl, and subsequently purified with a 3 kDa filter to remove salts. The concentration of DNA in this purified solution was determined using a NanoDrop2000 spectrometer. Table 18. Specific conditions used for NA-SELEX performed at room temperature. R : : : c (+): 59% Table 19. Summary of affinity and kinetic binding constants for LI-SELEX sequences. NCSU-2024-034-03 NCSU-42526.601 Aptamer ITC KD Steady-state KD Kinetic KD kon koff (nM) (nM) (nM) (M-1 -1) (-1) Part 2. FEN1 Digestion. After negative- and counter-selection, the resulting pool was then subjected to positive selection using FEN1. The reaction volume for this step is 100 µL. Two samples were prepared: the library-cDNA complex plus target, and a ‘background’ sample containing library-cDNA complex but no target as a control. First, the pool was hybridized with five-fold excess of NA-cDNA in selection buffer using the heating and cooling procedure described above. Then, Triton X-100 and dithiothreitol were added to reach a final concentration of 0.008% (v / v) and 1 mM, respectively. Afterwards, either buffer or cocaine (final concentration 50 µM) was added to the library-cDNA mixture, which was then incubated at 25 ºC or 37 ºC for 30 min to allow the target to bind. Prior to digestion, a 1 µL aliquot of each reaction solution was taken and mixed with loading buffer for analysis with PAGE. To initiate digestion, FEN1 was added (final concentration: 0.35 U / mL) in buffer containing 20 mM Tris, 0.008% (v / v) Triton X-100, and 1 mM DTT to the samples. The digestion was allowed to proceed for 4 h at 25 ºC or 1.5 h at 37 ºC. Prior to termination of digestion, a 1 µL aliquot was collected and added to loading buffer for PAGE analysis. To halt digestion, EDTA was added (final concentration 100 mM) and the samples were heated for 10 min at 75 ºC to denature FEN1. The samples were subsequently purified using a 3 kDa filter to remove EDTA, salts, and the target. The final volume of samples after purification was typically 50–100 µL Part 3. PAGE Purification. PAGE was performed to separate intact library strands from cleaved library products and NA-cDNA. Digestion samples were concentrated using a vacuum centrifuge to approximately 5 µl and mixed with an equivalent volume of 2× PAGE purification buffer. The samples were subsequently loaded in a urea-denatured 12% polyacrylamide gel. Electrophoresis was performed initially at 100 V (5 V / cm) for 30 min followed by 400 V (20 V / cm) for 90 min. The gel was consistently kept warm throughout the separation process with 0.5× TBE warmed to 65 ºC to maintain the DNA in a denatured state. NCSU-2024-034-03 NCSU-42526.601 Afterwards, the gel was removed from the apparatus and illuminated with a 284-nm UV lamp to locate DNA bands. The intact library was excised from the gel; in cases where the intact library could not be visually identified, a rectangular incision was made above the cleaved library band. The incised gel was then crushed with a 1 mL syringe plunger and soaked in 1× TE buffer for 3 h at 60 ºC in a shaking incubator to elute aptamers from the gel. Afterwards, the crushed gel solution was centrifuged at 7,000 rcf for 15 min and the supernatant containing DNA was removed and purified with a 0.45-µm filter. The DNA was then concentrated and purified using a 15 mL 10 kDa molecular weight cutoff filter. The final volume of the DNA solution was approximately 100 µL. Part 4. PCR and single-strand generation. Finally, the purified DNA was PCRAMPLIFIED WITH * M: OF 7O@AQ 8OT ?TART 4OLORLESS ;ASTER ;IX& * d; FORWARD PRIMER #6=$& AND* d; REVERSE PRIMER #>='BIO$ WITH A 3IO>AD 4*))) THERMAL CYCLER USING THE FOLLOWINGprotocol: 2 min at 95 °C; 11 cycles of 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 45 s, followed by 5 min at 72 °C. Single-stranded DNA was generated from the resulting double- stranded PCR amplicons as reported previously and finally purified with a 3 kDa filter with water. The concentration of single-stranded DNA in the pool was determined using a NanoDrop2000 spectrometer. This pool was used for subsequent rounds of NA-SELEX. DNA Sequencing. Enriched oligonucleotide pools from in vitro selection were submitted to Genewiz for Illumina-based HTS. To prepare the samples, pools were PCR amplified using primers containing partial Illumina adapters (HTS-FP and HTS-RP) with the PCR protocol described above. PAGE was performed to confirm successful amplification. Afterwards, the amplicons were purified using a PCR purification kit (Qiagen) and dissolved in 10 mM Tris buffer (pH 7.4) at a concentration of 20 ng / µL. These samples were then directly submitted to Genewiz. Bioinformatic Analysis. HTS data was received from Genewiz as fastq files of forward and reverse reads. The number of reads and unique sequences in each file can be found in Table 20. To analyze the HTS data, the reverse reads were first converted to their complement using the fastx toolkit and were then combined with the forward reads. Subsequently, cutadapt was used to trim 5’ and 3’ constant regions with an allowed error of 20%. Any sequences containing an ‘N’ read or possessing a variable region shorter than 10 nt or longer than 33 nt were removed. FASTAptamer was used to count sequences and determine sequence abundance in each pool. Enrichment fold between rounds or retention factor (RF) between negative and positive NA-SELEX samples was determined using these abundance values. RF was determined using the equation AT– AC / AC, where ATand ACare the abundance of a particular NCSU-2024-034-03 NCSU-42526.601 sequence from an NA-SELEX round digested with or without target, respectively. Certain sequences that were absent in a pool were assigned the minimum reads per million value for that pool to facilitate calculation of enrichment fold or RF. For analysis of the initial failed trials of NA-SELEX, clustal omega was used to align sequences and identify motifs. HTS data has been uploaded to the NCBI Sequencing Read Archive. Table 20. Summary statistics for HTS datasets. Total Unique Unique ) , , . Isothermal Titration Calorimetry (ITC). These experiments were performed using a Malvern Microcal iTC200 or Microcal PEAQ ITC at either 23 ºC or 37 ºC. First, the aptamer (final concentration: 15 µM) was dissolved in 20 mM Tris buffer (pH 7.4), heated for 5 min at 95 °C in a dry bath incubator, and cooled immediately on ice for 3 min. Then, salts were added to reach the final concentrations of the selection buffer. Approximately 300 µL of aptamer solution was loaded in the cell, and cocaine (final concentration 150 µM) was loaded in the titration pipet. After a 60-second initial delay, a 0.4 µL injection was performed followed by 19 consecutive 2 µL injections with spacing of 150 s; spacing was adjusted for some NCSU-2024-034-03 NCSU-42526.601 titrations for up to 300 s due to slow equilibration. Data was analyzed using the MicroCal analysis kit integrated into Origin 7 software with a one-site binding model. FEN1 Digestion Experiments. These experiments were conducted in a dry bath incubator at either 25 °C or 37 °C with a total volume of 50 µL. First, an aptamer and NA- cDNA1 (final concentrations: 1 µM and 5 µM, respectively) was dissolved in selection buffer, heated in a boiling water bath for 5 min, and subsequently cooled in a room temperature water bath for 20 min. Afterwards, Triton X-100 and dithiothreitol were added (final concentrations: 0.008% v / v and 1 mM, respectively), followed by brief mixing.50 µM cocaine or buffer (as a control) was then added to the aptamer solution and allowed to incubate for 30 min to permit binding. A 1 µL sample was taken prior to the start of the digestion and mixed with loading buffer to determine initial aptamer concentration via PAGE. Thereafter, FEN1 (final concentration: 0.35 U / mL) dissolved in buffer containing 20 mM Tris with 0.008% (v / v) Triton X-100 and 1 mM dithiothreitol was added to the aptamer solution to initiate digestion. Aliquots (1 µL) were taken periodically and mixed with 32 µL loading buffer to quench the reaction. Samples dissolved in loading buffer were subjected to PAGE using a Bio-Rad Mini-Protean gel system. Specifically, samples were run in warm 0.5× TBE (65 °C) first at 50 V for 10 min and then 200 V for 30 – 45 min. Gels were then stained with 1× SYBR Gold for 15 min and subsequently imaged using a Bio-Rad Gel Imaging System. The relative quantity of library retained during digestion was determined by comparing the intensity of the intact aptamer band prior to digestion relative to the intensity of intact aptamer bands from samples taken during the digestion process. Aptamer retention was plotted against time to create a digestion time- course plot, which was fitted using Origin 2021b software with a bi-exponential decay equation. Exonuclease fluorescence digestion assay. These experiments were performed to assess the specificity of the cocaine-binding aptamers. Each aptamer was initially diluted in Tris buffer (final concentration: 20 mM) and heated to 95 ºC for 10 min, after which they were immediately cooled on ice. Then, bovine serum albumin and salts were added to reach appropriate final concentrations (NaCl: 140 mM, KCl: 4 mM, MgCl2: 5 mM, albumin: 0.1 mg / mL). Subsequently, either buffer (negative control), cocaine (final concentration 5 or 100 uM), or an interferent (final concentration: 500 µM, except for THC, AB-FUBINACA, and UR-144 which was 5 µM; alprazolam, diazepam which was 50 µM; and quinine, which was 250 µM). For samples containing THC, AB-FUBINACA, UR-144, alprazolam, or diazepam, 5% DMSO (v / v) was included in the buffer. Samples were incubated for 1 hr at 25 ºC to allow aptamer-ligand binding to reach equilibrium. Then, 25 µL of a mixture of T5 Exonuclease (final NCSU-2024-034-03 NCSU-42526.601 concentration: 0.2 U / µL) and Exonuclease I (final concentration: 0.015 U / µL) dissolved in buffer containing bovine serum albumin was added to the sample to initiate digestion. Time points were collected by taking 5 µL of the sample and adding to a 30 µL quenching solution (final concentration: 10 mM Tris, pH 7.4, 1× SYBR Gold, 21 mM EDTA, and 12.5% formamide) loaded in a black 384-well flat bottom microplate. The fluorescence of the samples was measured using a Tecan M1000 Pro microplate reader with excitation wavelength of 495 nm and emission of 537 nm. Each sample was measured ten times and the average of these measurements was used for analysis. Resistance values were calculated using the formula(AUCL / AUC0) – 1, where AUCL and AUC0 are the area under the curve of the fluorescencetime course plots with and without ligand, respectively. Cross-reactivity was calculated using 100 µM cocaine as 100%. Biolayer Interferometry (BLI). The binding kinetics of the cocaine aptamers weredetermined using BLI with a Sartorius Octet R4 instrument at 23 °C. First, Super Streptavidin biosensors (Sartorius) were immersed in selection buffer for at least 15 min to hydrate the sensors. In parallel, a 100 nM solution of 5’ biotinylated aptamer was prepared in Tris buffer (final concentration 20 mM, pH 7.4), heated to 95 °C for 5 min, and cooled immediately; NaCl, KCl, and MgCl2 were then added to reach the final concentrations of the selection buffer. Various concentrations of cocaine (50–5,000 nM) and a sample of 50 µM biocytin were prepared in selection buffer. 200 µL of these solutions was loaded into the wells of a 96-well black flat bottom plate (Greiner). To begin the experiment, the biosensors were first immersed in buffer to obtain a baseline reading for 120 s and then immersed in 100 nM aptamer solution for 300 s, followed by quenching in biocytin solution for 60 s. The biosensors were then immersed in buffer to establish a stable baseline for 360 s, and then challenged with cocaine solutions for 300–2,400 s, depending on their association kinetics. Finally, the sensors were immersed in buffer to measure dissociation kinetics for various amounts of time (300–2,400 s). Control experiments were performed by immersing aptamer-modified biosensors in buffer during the association step rather than cocaine. Control data from reference sensors were used to remove biosensor drift and other artifacts from sample measurements. Data processing and analysis was performed using the Sartorius Analysis Kit 13. To obtain binding kinetic parameters, the data were fitted using a global fitting model available in the analysis software. ‘Kinetic KD’ was obtained via global fitting of sensorgrams. ‘Steady state KD’ was determined by fitting the plot of sensor response at equilibrium against target concentration with the Langmuir-Hill equation. The reported error values represent the error of fit. NCSU-2024-034-03 NCSU-42526.601 Example 3 Given the ubiquity of cocaine abuse and its enormous impact on public health, the ability to detect this drug rapidly, conveniently, and sensitively in biological matrices would be extremely valuable. Such a capability would improve the speed and accuracy with which cocaine overdose is detected in clinical contexts, and cocaine intoxication is detected in roadside settings. Similarly, the ability to monitor cocaine concentrations with high frequency and in real time could revolutionize laboratory investigations of the drug’s pharmacokinetics, including improved understanding of molecular transport between body compartments, and pharmacodynamics by enabling concentration-based (as opposed to conventional dose response) understanding of neurochemical and behavioral responses. Unfortunately, however, existing approaches for detecting cocaine in clinical and laboratory settings are ill-suited for these tasks. Rapid clinical detection, for example, relies on immunoassays, which generally produce qualitative readouts that reduce their value in formally diagnosing cocaine overdose (which is a quantitative phenomenon), or cumbersome laboratory-based assays that struggle to return an answer in a clinically relevant timeframe. And in biomedical research, cocaine pharmacokinetics in humans has historically been monitored using periodic sampling (via blood draws or microdialysis) followed by post-facto analysis using mass spectrometry. The time resolution of these approaches—other than one rather heroic effort that pushed microdialysis sampling to two minutes—is in the tens of minutes resolution—which is far slower than the tens-of-seconds timescales relevant to the absorption, distribution, metabolism of cocaine, and the onset of its physiological effects. Motivated by the unmet need for improved methods of cocaine measurement, new high-performance, cocaine-binding DNA aptamers were isolated and used to develop sensors for the rapid highly sensitive and specific detection of this drug in vitro as well as its high- temporal resolution measurement in vivo. Aptamers are short nucleic acid receptors isolated from randomized oligonucleotide libraries via the systematic evolution of ligands by exponential enrichment (SELEX) procedure to bind specific targets with high affinity. They have several favorable attributes in the context of sensor development, including low cost of production, low batch variability, and amenability to chemical modification with signaling tags. Aptamers have been adapted into a number of sensing platforms able to detect analytes directly in complex sampling milieus with minimal or no preparation. For example, aptamer strand-displacement fluorescence sensors can detect analytes with high sensitivity in biological samples, such as pharmaceuticals and metabolites, with just a single mix-and-read step. Likewise, electrochemical aptamer-based (EAB) sensors can enable high-frequency, real-time NCSU-2024-034-03 NCSU-42526.601 measurement of analytes in the bloodstream, subcutaneous space, and brains of live animals. The sensitivity and specificity of these sensors, however, is limited by the binding properties of the aptamers they employ. For example, the single existing (and widely employed) DNA aptamer against cocaine has a modest, ~5 µM dissociation constant (KD),and is thus insufficient for monitoring cocaine at clinically relevant concentrations in biological fluids (relevant concentration range: 10 – 1000 nM). In response, a high-stringency, library-immobilized SELEX workflow incorporating a rigorous counter-SELEX component was utilized to isolate high-affinity DNA aptamers specific against this important target. One of the high-performance aptamers was adapted into a fluorescent sensor that demonstrated successful detection of cocaine in serum at clinically relevant concentrations in biological fluids in vitro. In parallel, an EAB sensor was developed supporting the high-frequency, real-time monitoring of cocaine in situ in the bodies of live rats. The cocaine aptamers and sensors developed here should prove useful for detecting this drug in a wide range of settings and applications. The selection of new, high-performance DNA aptamers against cocaine. In the course of developing a new SELEX methodology, 11 rounds of library-immobilized SELEX were performed to pre-enrich an oligonucleotide pool that binds to cocaine. The pool was derived from a 73-nucleotide (nt) stem-loop structured library containing a randomized 30-nt putative binding domain and flanking constant regions for PCR amplification. For the first three rounds, 100 µM of cocaine was used, and lowered cocaine concentrations of 50 µM were used for the remaining selection rounds. Counter-SELEX was also performed to remove oligonucleotides that bind to a variety of interferents, including other illicit drugs, common street-drug adulterants, and endogenous compounds (Table 21). After sequencing and affinity characterization of aptamers from this pool, it was determined that the aptamers had KDs in the sub-micromolar regime. Hereafter, this is referred to as the “low-stringency trial” of SELEX. Although this represents a clear improvement in affinity relative to the MNS4.1 cocaine- binding aptamer, it remains insufficient for detecting cocaine at physiologically relevant concentrations in biological matrices, which can be as low as 10 nM. To obtain aptamers with higher affinity, three rounds of selection were performed starting from the round 8 pool of the low-stringency trial using a higher-stringency selection strategy. This entailed decreasing the concentration of cocaine 1,000-fold over the course of three rounds of selection, such that only aptamers with low nanomolar affinity would survive this high-stringency trial of SELEX (FIG. 40A, top). To ascertain the degree of aptamer enrichment, in each round, the quantity of pool eluted by buffer alone (i.e., background elution level) was monitored and compared to that eluted by cocaine. In the ninth round, pool elution NCSU-2024-034-03 NCSU-42526.601 by cocaine was 4-fold above background levels, indicating enrichment of target binding sequences, despite using 1 µM cocaine, which represented a 50-fold reduction in target concentration relative to round 8 (Table 21). In the next round, the concentration of cocaine was reduced to 0.2 µM. Despite this, pool elution by the target remained 2–3-fold above background levels, indicating that high-affinity aptamers continued to be enriched. The final round of selection was performed using 50 nM cocaine, the lowest target concentration utilized for library-immobilized SELEX. Nevertheless, the cocaine-eluted pool remained 2–3-fold above background levels. Following the completion of this selection, the affinity of theresulting pool was measured using a gel elution assay. This produced a slightly biphasicbinding curve with KDof 1 µM and 98 µM (FIG. 41). This contrasts noticeably with the low- stringency trial (FIG. 40A, bottom), the Round 11 pool of which exhibited biphasic binding with KDof 4 µM and >1,000 µM (FIG.42). The high-stringency selection strategy successfully removed most weak binders and enriched high affinity aptamers. The initial round 8 pool and the round 9–11 pools from the high-stringency trial were subjected to high-throughput sequencing, obtaining 100,000– 200,000 reads for each pool. The proportion of unique sequences in the round 8 pool was ~35%. This dropped to 13% in round 9 but then increased to 14% in round 10 and 18% in round 11 (FIG.43). The increase in the proportion of unique sequences in the pools as rounds progressed was unusual, as pool diversity tends to decrease as more rounds are performed. One possible explanation for this trend is that as target concentration was lowered every round, fewer binding sequences were being eluted by target relative to the large variety of non-functional background sequences that spontaneously fell off during elution, thereby artificially increasing pool diversity. The high-throughput sequencing data highlight the importance of increasing selection stringency only during later rounds, in which the population of high-affinity binders is sufficiently abundant such that the pool avoids being over competed by non-binding sequences during SELEX. To identify aptamer candidates for further characterization, the change in population abundance (e.g., enrichment fold) between rounds 8 and 11 was assessed, with the assumption that sequences with high growth rates were preferentially enriched by the high-stringency selection process. Aptamer candidates were chosen that exhibited an enrichment fold > 50 as well as an overall abundance > 0.05% among sequences in the final round 11 pool. In the high- stringency trial, four sequences—NC48, NC423, NC195, and NC973—were identified which exhibited abundance of 0.2–2% and enrichment of 90–700-fold (FIG.40B, left); however, none of these sequences was identified in the low-stringency trial using these metrics (FIG. 40B, NCSU-2024-034-03 NCSU-42526.601 right). NC48, NC423, NC195, and NC973 are highly related, as clustering analysis revealed they originate from a family containing two primary motifs: a 13-nt motif and a 9-nt GT-rich motif connected via a 3–4-nt linker (FIG. 40C). NUPACK analysis revealed these aptamers contain a stem-bulge-stem structure (FIG. 40D). When comparing the high-throughput sequencing data between both trials, these four candidate sequences were essentially indistinguishable from other sequences in the low-stringency trial in terms of their abundance and enrichment fold (FIG. 40B, right). However, in the high-stringency trial, these sequences are clearly distinguishable from the rest of the population, with both high abundance and enrichment fold. (FIG. 40B, left). This demonstrated that higher-stringency conditions were required to effectively enrich and identify these high-affinity sequences. Characterization of cocaine-binding aptamers. The high-stringency selection strategy and metrics used to identify high-affinity aptamer candidates from the high-throughput sequencing data were effective. Using isothermal titration calorimetry (ITC) it was determined that the binding affinity of the aptamer candidates NC48, NC195, NC423, and NC973 were 65 ± 9 nM, 22 ± 4 nM, 22 ± 4 nM, 49 ± 4 nM, respectively (FIG. 40E). This represents an orderof magnitude improvement over the aptamers isolated in the low-stringency trial, and a morethan 200-fold improvement over the widely used MNS4.1 aptamer. As a control, the affinities of three aptamers (NC70, NC74.2, NC83) of similar abundance to the selected candidates but of much lower enrichment fold were determined. Such aptamers had 10-fold poorer affinity (KD = 300–400 nM) (FIG.40E and FIG.44). The specificity of the new cocaine-binding aptamers is excellent. To demonstrate this a previously described exonuclease digestion fluorescence assay employing T5 Exonuclease (T5 Exo) and Exonuclease I (Exo I) was used. Here, unbound aptamers were completely digested into mononucleotides by the exonuclease mixture, but ligand-bound aptamers resisted digestion to an extent that is dependent on ligand affinity. The digestion process was monitored over time by collecting samples and staining with SYBR Gold to quantify the remaining aptamer concentration. After plotting fluorescence as a function of time, the areas under the curve for a target-free aptamer digestion experiment and aptamer digestion experiments containing a given ligand were used to determine the “resistance value.” Resistance value is a quantitative measurement of aptamer-ligand binding strength (FIG. 45). The specificity of the candidate aptamers was assessed by challenging them with a number of structurally-related molecules (benzoylecgonine and scopolamine), drugs of abuse (mephedrone, methylenedioxypyrovalerone, fentanyl, methamphetamine, methylenedioxymetham-phetamine, morphine, oxycodone, nicotine, methadone, heroin, NCSU-2024-034-03 NCSU-42526.601 amphetamine, methylphenidate, tetrahydrocannabinol, UR-144, AB-FUBINACA, alprazolam, and diazepam), adulterants / cutting agents (benzocaine, lactose, mannitol, lidocaine, diphenhydramine, procaine, levamisole, pseudoephedrine), commonly-used pharmaceuticals (acetaminophen, ibuprofen, quinine, caffeine, fluoxetine), and endogenous compounds (serotonin, dopamine) (FIG. 46A). All four of the aptamers achieved excellent specificity in these tests, with identical response (100% cross-reactivity) to 5 and 100 µM cocaine, and minimal cross-reactivity (< 10%) to all tested interferents, even at 500 µM. Indeed, even the most cross reactive interferant, the cocaine metabolite benzoylecgonine, exhibited only 50% cross reactivity at a concentration 100-fold higher than that of cocaine (FIG. 46B), which is above its clinically relevant concentration. This level of specificity is superior to that of a variant of the original MNS4.1 cocaine-binding aptamer (38-GC), which responds to cocaineONLY AT A CONCENTRATION OF *)) \; AND EXHIBITS [ .)" CROSS'REACTIVITY TO AT LEAST *, DIFFERENTligands, many of which are quite structurally distinct from cocaine (FIG.46B, 38-GC). A fluorescent sensor for detecting cocaine in human serum. Using aptamer NC195 a fluorescent strand-displacement sensor able to quantify cocaine rapidly and conveniently in human blood serum was developed. Here, a fluorophore-labeled aptamer was hybridized with a quencher-labeled complementary DNA (cDNA) sequence; in the absence of target, this hybridization quenches the fluorophore. In the presence of target, aptamer-target binding releases the cDNA, thereby separating the fluorophore from the quencher and enhancing fluorescence in a target concentration-dependent manner (FIG. 47A). Such strand- displacement assays have been shown to support the sensitive and specific detection of various analytes in complex biological samples. NC195 was modified with a 5’ Cy5 fluorophore (NC195-Cy5) and combined with a 13-nt cDNA labeled with a 3’ Iowa Black RQ quencher (cDNA-13Q). After optimizing the concentration of cDNA13-Q, (FIG. 48), the aptamer-cDNA complex was challenged with cocaine at a concentration range of 0 to 10 µM and the change in Cy5 fluorescence as a function of target concentration was assessed. The sensor achieved a limit of detection (LOD) of 5 nM#THE LOWEST TARGET CONCENTRATION GIVING A SIGNAL GREATER THAN BLANK % ,b$& A DYNAMIC RANGE OF10–1,000 nM (reflecting 10–90% of the maximal signal) which spans the 10 - 1000 nM clinical range of this drug (FIGS. 47B-47C). This represents orders of magnitude improvement over previous aptamer-based cocaine sensors. For example, the first fluorescence aptamer-beacon cocaine sensor had an LOD of 10 µM, essentially 2000-fold inferior sensitivity. The sensor also works well in biological samples such as serum. To illustrate this, the sensor was challenged with 0–10 µM cocaine spiked into 50% human serum, and concentrations were NCSU-2024-034-03 NCSU-42526.601 detected as low as 10 nM (FIGS. 47B-47C). This again demonstrates an improvement over previously reported cocaine sensors, such as the fluorescent aptamer-based dye-displacementsensor, which, in just 2.5% serum, achieved only a 900 nM LOD. Finally, assessing thespecificity of this sensor against the above-mentioned interferents, no cross-reactivities greater than 5% at concentrations 100-fold higher than cocaine were observed (FIG.47D). Exonuclease-guided truncation to generate structure-switching aptamers. The analytical performance of the NC195-based strand-displacement sensor provided the motivation to adapt it into an EAB sensor format, a versatile platform able to performcontinuous, real-time molecular monitoring in situ in the living body. This sensor architecture,in which aptamer-ligand binding events generate an electrochemical readout by altering the proximity of a redox reporter relative to a gold electrode, requires an aptamer that undergoes a conformational change upon target binding. To achieve this, the exonuclease-guided truncation method was used, which employs the enzymes Exonuclease III and Exo I to remove non- essential nucleotides from the termini of a ligand-bound aptamer. This digestion process results in a truncated, thermodynamically destabilized product that undergoes binding-inducedfolding. NC195 was digested with a mixture of Exo III and Exo I in the absence or presence of5 µM cocaine, periodically collecting samples and subjecting them to polyacrylamide gel electrophoresis (PAGE) analysis to identify the length of the truncated products (FIG.49A and FIG. 50). In the absence of cocaine, the 46-nt aptamer was completely digested after 40 min. In contrast, products of 40–43-nt persisted in the presence of cocaine, suggesting that the aptamer could be truncated by up to 6 nt while retaining its affinity. The blunt-ended truncated NC195 derivative NC195-40 was subsequently synthesized, as well as additional variants from which 3, 4, or 5 base-pairs were removed, respectively yielding constructs NC195-38, -36, and -34 (FIG. 49B). Such blunt-ended variants were used as it has been observed that aptamerswith overhangs often exhibit impaired affinity relative to those without. ITC analysis confirmedthat the truncated variants retained good binding affinity, with KD of 46 ± 5, 83 ± 8, 127 ± 10, and 620 ± 42 nM for NC195-40, -38, -36, and -34, respectively (FIG. 51). To confirm if the truncated aptamers have structure-switching functionality, circular dichroism (CD) spectroscopy was next used to monitor the aptamers for binding-induced conformationalchanges. The spectra of the truncated aptamers all contained positive peaks at 280 and 218 nmand a negative peak at 248 nm. When cocaine was added, the positive peak at 280 nm shifted to 275 nm and grew in magnitude, the negative peak shifted to 240 nm, and the positive peak at 218 nm shifted to 210 nm. These changes indicated that the truncated aptamers undergo a conformational change upon binding to cocaine (FIG.49C). NCSU-2024-034-03 NCSU-42526.601 The truncated aptamers retained high cocaine-binding affinity under physiological condition, which is useful for their deployment in vivo. Whether the truncated aptamers could bind cocaine in a physiological buffer at 37 ºC using an Exo I-based assay was assessed. In the absence of cocaine, these aptamers are presumably single-stranded and thus rapidly digested by Exo I into mononucleotides, whereas cocaine-bound aptamers are fully folded and resist digestion. Digestion was monitored over time by using SYBR Gold to quantify the remaining intact aptamer molecules. It was found that NC195-40, NC195-38, and NC195-36 all resisted digestion in the presence of either 2 µM or 10 µM cocaine, whereas NC195-34 did not (FIG. 49D). ITC was next performed to determine the binding affinity of NC195-40, NC195-38, and NC195-36 at 37 ºC in physiological buffer, and it was found that these aptamers bound cocaine with KDs of 546, 658, and 3,134 nM, respectively (FIG.49E). These affinity values contrasted with the orders of magnitude poorer affinity (KD~ 240,000 nM) of a truncated version of MNS4.1 under the same conditions (FIG. 49F). Based on the binding profile of NC195-36, it was adapted to the EAB sensor platform. To do so, a methylene blue redox reporter was attached to the 3’ end of the aptamer, and modified the other end with 6-carbon thiol group, which was in turn attached to a gold electrode via thiol-gold bonding. The resulting sensor wasTITRATED AGAINST COCAINE IN , / `4 UNDILUTED BOVINE BLOOD USING SQUARE WAVE VOLTAMMETRYinterrogation at 20 and 200 Hz. These two frequencies were then used to compensate for the drift invariably seen under these conditions using kinetic differential measurement (KDM) drift correction, finding that the KDM signal increased monotonically with increasing target concentration (FIG. 52A). The useful dynamic range of the sensor spanned from high nanomolar to low micromolar, thus matching the circulating concentrations associated with this drug’s psychoactive effects in rats. Real-time cocaine monitoring in live rats. The EAB sensor supports the continuous, real-time measurement of cocaine in the bloodstream of live animals, providing a high-resolution view of the drug’s pharmacokinetics. To achieve this, EAB sensors were emplaced into the jugular veins of two live rats (FIG. 52B). It was observed that the EAB sensors exhibited stable, low-noise baselines (prior to drug challenge, the root-mean-square variance was 0.11 and 0.04 mM for Rat 1 and Rat 2, respectively) and sensitively responded to a behaviorally relevant dose of cocaine administered intravenously (1 mg / kg). The sensor could continuously monitor cocaine over 2 h with a resolution of ~14 s, which amounts to 10-fold higher resolution than conventional pharmacokinetic measurements. The pharmacokinetic profiles obtained from the EAB experiments, such as maximum concentration (Cmax), time to reach this concentration (Tmax), and time to eliminate 90% of the drug, closely match the values NCSU-2024-034-03 NCSU-42526.601 seen in previous studies using conventional approaches to measure cocaine pharmacokinetics. Moreover, the EAB sensor was able to ascertain full pharmacokinetic curves in each individual subject across the lifetime of the cocaine challenge, and reveal inter-individual differences in pharmacokinetics (see table in FIG.52B). Using high-stringency library-immobilized SELEX a set of new aptamers exhibiting exceptional affinity and specificity for the drug of abuse cocaine have been isolated. These aptamers bind to cocaine with nanomolar affinity and did not respond to a wide range of interfering substances, including other drugs of abuse, endogenous compounds, and commonly used pharmaceutical drugs. Using one of these aptamers, NC195, a fluorescence strand- displacement sensor able to detect cocaine in 50% serum with a LOD of 10 nM was developed. This represented a 1,000-fold improvement over the performance of the widely used, previously reported cocaine aptamer. Structure-switching functionality was next introduced into use of an exonuclease-based strategy. Truncated variants of NC195 displayed sub- micromolar-to-micromolar KDs even at 37 ºC, a remarkably high affinity for a small-molecule- binding, structure-switching aptamer under physiological conditions that is ~100-fold betterthan previously-reported constructs. The resulting aptamer was then used to develop an EABsensor, achieving a detection limit 50-fold lower (~200 nM at 37ºC in blood) than that of an EAB sensor fabricated using the previously reported cocaine aptamer (~10 µM at roomtemperature in blood). Implanting this sensor into the jugular veins of live rats, the seconds-resolved, real-time measurement of the drug in the living body was demonstrated. The resulting data allowed clear identification of heterogeneities in peak cocaine concentrations and drug half-life between individual animals. The aptamers and sensors established here could be of great value for detecting cocaine rapidly and conveniently in clinical settings as well as for studying the neuropharmacology of this drug in live animals. Example 4 EAB sensor fabrication and calibration. The in vitro EAB sensor electrodes were fabricated as follows. Briefly, 4.5 cm segments of gold wire were cut, one end was soldered to a gold-plated pin connector with 60 / 40 lead-selenium solder, and gold wire was insulated the with heat-shrinkable PTFE tubing, leaving approximately 3 mm wire exposed as the working electrode. The gold surface was converted into an EAB sensor using established protocols. Briefly, the bare gold wire was exposed to 0.5 M NaOH and electrochemical cleaning was then performed using external reference and counter electrodes and a CHI 1040C Electrochemical Workstation from CH Instruments, cycling the potential 300 times between -1 and -1.6 V (all NCSU-2024-034-03 NCSU-42526.601 potentials versus Ag / AgCl) at 1 V / s to remove any residual contaminants on the electrode surface. Following this, the electrode was rinsed and pulsing was performed between 0 and 2 V for 16,000 cycles with a pulse length of 0.02 s in 0.5 M H2SO4to increase the microscopic surface area of the electrodes. The electrodes were then immersed the in 0.5 M H2SO4and cycled the potential two times between 1.50 and -0.35 V at 100 mV / s. Finally, the freshly cleaned electrodes were rinsed with deionized water. Following this, 6-mercapto-1-hexanol (MCH) solution and freshly reduced DNA solution for deposition were prepared. The manufacturer provided the DNA constructs in a disulfide form, which were reduced before deposition by combining 6 µL of 10 mM Tris (2-carboxyethyl) phosphine (TCEP) per microliter of 100 µM aptamer and incubating for 1 h in the dark at room temperature.10 mM MCH was then prepared by dissolving 4.05 µL pure MCH in 3 mL PBS buffer. The sensors were then prepared by immersing clean electrodes in 500 nM reduced DNA solution for 1 h and then in 10 mM MCH solution for 2 h. All sensors were rinsed with deionized water prior to measurements. EAB sensors were interrogated using square-wave voltammetry (SWV) on a CHI 1040C Electrochemical Workstation over the potential range -0.20 to -0.45 V (all potentials relative to Ag / AgCl) and an amplitude of 25 mV. A standard three-electrode set up was used, employing a platinum counter electrode and an Ag / AgCl (3 M KCl) reference electrode. WholeBOVINE BLOOD #*) M:$ WAS PUT INTO A SHOT GLASS AND THE TEMPERATURE WAS KEPT AT , / e WITH Awater bath; in parallel, stocks of cocaine dissolved in whole blood to final concentrations of 10 mM, 1 mM, 100 µM, 10 µM and 1 µM were prepared. The first measurement was performed with the cocaine-free blood in the shot glass. Then, 100 µL blood was taken out of the blood in the shot glass, 100 µL of whole blood containing 1 µM cocaine was added in and three minutes were waited for the whole blood to be fully mixed to a final concentration of 100 nM cocaine. Afterwards, SWV measurement was performed again. 101, 204, and 625 µL blood were sequentially taken out of the shot glass, and the same amount of whole blood containing 1 µM cocaine was added in to get whole blood containing 200 nM, 400 nM and 1 µM. Electrochemical measurements were done after at least three minutes to get corresponding signal. The same procedures were repeated using whole bovine blood samples containing 10 mM, 1 mM, 100 µM, 10 µM. To produce calibration curves, the voltametric peak current was extracted at each target concentration. These were converted into “normalized signal change” by determining the percentage difference between the peak current seen at a given target concentration to the corresponding peak height measured in a whole blood blank: NCSU-2024-034-03 NCSU-42526.601 Normalized Signal (%) =(L@JCBL'(=F@HE(=F@HE × 100% Equation (1)Kinetic differential measurements (KDM) were calculated by taking the difference between the normalized signals seen at 20 Hz and 200 Hz: KDM = )341*0 / 6,+ 5 / .2*0;:: >M')341*0 / 6,+ 5 / .2*0;: >M × Equation (2)These the dissociation constants: #($) =[9]"8[9]&7NEquation (3) where S(T) is the EAB sensor derived KDM signal at a given concentration of target, [T] is the target concentration, and "# is the change in signal associated with binding event. In vivo EAB sensors. To fabricate the electrodes for intravenous sensors, gold (0.2 mm diameter × 10 cm long; 99.9% purity, A-M systems), platinum (0.125 mm diameter × 10 cm long; 99.95% purity; A-M Systems), and silver wire (0.125 mm diameter × 10 cm long; 99.99% purity, A-M Systems) were cut and insulated with polytetrafluoroethylene heat-shrink (Zeus Inc., HS Sub-Lite-Wall) and bundled with 1 cm of exposed silver and 0.6 mm of exposed platinum. These wires were bundled offset such that 1 mm gaps separated the bare metal on each wire. The bare gold electrode was trimmed to 3 mm. After electrode assembly, the silver wire was converted to a reference electrode by forming a stable silver chloride film via incubating in 7.5% sodium hypochlorite (Clorox) overnight. The sensors were rinsed in deionized water and the gold electrode was cleaned as follows. First, the potential was cycled 1,000 times between -1.0 and -2 V versus Ag / AgCl in a solution of 0.5 M NaOH (1 V / s) to remove residual organic or thiol contaminants on the surface. Second, between 0 and 2 V was pulsed by applying 32,00020-ms pulses with a pulse length of 0.02 seconds in 0.5 M H2SO4 to increase the surface area of the electrodes. The electrodes were then cleaned by cycling the potential between 1.5 and -0.35 V at 1 V / s four times in H2SO4. The gold electrode was then rinsed in deionized water, fed through a 20-gauge catheter (Becton Dickinson & Company), and immersed in 500 nM reduced DNA dissolved in PBS for 1 h. To reduce the disulfide bond in the methylene-blue modified DNA, 2 mL of 100 mM DNA was incubated in 14 mL of 10 mM tris (2-carboxyethyl) phosphine for 1 h in the dark. This electrode was then transferred to a 10 mM solution of MCH in PBS overnight at room temperature to complete formation of the self-assembled monolayers. Prior to use in vivo, the probe catheters were filled with 1× PBS. The in vivo experiments were performed in two adult male Sprague-Dawley rats (4 months old; Charles River Laboratories, Wilmington, MA, USA). The rats were same-sex pair- NCSU-2024-034-03 NCSU-42526.601 housed in a temperature and humidity-controlled vivarium on a 12 h light-dark cycle and provided ad libitum access to food and water. All animal procedures were consistent with the guidelines of the NIH Guide for Care and Use of Laboratory Animals (8thedition, National Academy Press, 2011) and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California Santa Barbara. Prior to sensor insertion, anesthesia was induced under 4% isoflurane gas in a Plexiglas anesthesia chamber, and maintained at 2-3% isoflurane gas / oxygen via nose cone for the experiment’s duration. A pulse oximeter (Nonin Medical) was used to measure heart rate and %SpO2 during the experiment. The rat was shaved and the skin above the jugular vein was disinfected with 70% ethanol and betadine. A small incision above the left and right jugular vein was made and both veins were isolated. A small incision in the jugular vein was made using spring loaded microscissors. A silastic catheter (composed of a bent steel cannula and silastic tubing) was inserted into the left jugular vein for drug infusion and the EAB sensor into the right jugular vein. These were stabilized with sterile 6-0 silk sutures (Fine Science Tools). Following this, 30 units of heparin were infused through the indwelling infusion line. The sensors were then interrogated electrochemically using square wave voltammetry on a CH1040C multipotentiostat at frequencies of 20 (signal off) and 200 Hz (signal on). KDM correction was performed using this equation: Prior to drug challenge, a 20-min baseline was collected. The animal was then dosed at 1 mg / kg cocaine HCl (5 mM) over 3 min using a 3 mL syringe connected to the catheter and placed into a motorized syringe pump (KDS 200, KD Scientific). SELEX procedure. Library-immobilized SELEX was performed on a previously enriched pool selected from a 73-nucleotide (nt) stem-loop structured randomized DNA library using cocaine as a target. Specific selection conditions are provided in Table 21. First, the oligonucleotide pool was hybridized with a 15-nt biotinylated cDNA (cDNA-bio) in selection buffer by heating at 95ºC for 10 min and then gradually cooling over 25 min in a room temperature water bath. After this, the library-cDNA complex was loaded into a microgravity column containing 250 µL streptavidin-agarose resin pre-washed with selection buffer. Following library immobilization, the resin was washed several times with 250 µL aliquots of selection buffer to remove sequences that failed to hybridize strongly to the cDNA. Thereafter, counter-SELEX was performed as described in Table 21. Finally, the library was challenged NCSU-2024-034-03 NCSU-42526.601 with three aliquots of 250 µL cocaine, and the eluent was collected and purified with molecular biology-grade water using a 10 kDa molecular weight cut-off filter. The resulting sequencesWERE =4> AMPLIFIED USING THE 7O@AQ 8OT ?TART 4OLORLESS ;ASTER ;IX WITH * d; FORWARDPRIMER #6=$ AND * d; BIOTINYLATED REVERSE PRIMER #>='BIO$ USING A 3IO>AD 4*))) THERMALcycler with the following conditions: 2 min at 95°C; 11 cycles of 95°C for 15 s, 58°C for 30 s, and 72°C for 45 s; 5 min at 72°C. The amplicons were converted to single-stranded DNA using streptavidin-agarose resin and 0.2 M NaOH as a denaturant. The affinity of the final-round SELEX pool for cocaine was determined using a gel elution assay. Table 21. High-stringency selection conditions for isolation of cocaine aptamers. High-throughput sequencing (HTS) and bioinformatic analysis. SELEX pools were sequenced by Azenta Life Sciences using an Illumina sequencing platform. Prior to sample submission, the pools were PCR amplified with forward and reverse primers containing partial Illumina adapters (HTS-FP and HTS-RP). The amplicons were purified using a PCR purification kit (Qiagen) and then with 10 mM Tris buffer (pH 7.4) using a 10 kDa filter. Amplicons were submitted as 20 µL samples containing 25 ng / ml double-stranded DNA. HTS NCSU-2024-034-03 NCSU-42526.601 data were received from Azenta as fastq files and processed using cutadapt to trim primers and then FASTAptamer to align, count, and cluster sequences. Exonuclease digestion assays. Digestion experiments were performed at 25 or 37ºC using a dry bath incubator with sample volumes of 50 µL. First, aptamers (final concentration 0.5 µM) were diluted in Tris buffer (pH 7.4 at the respective reaction temperature, final concentration 20 mM), heated to 95ºC for 5 min, and immediately cooled on ice for 3 min to promote intramolecular hybridization. Next, 1 µL salt solution (final concentration for selection buffer: 140 mM NaCl, 4 mM KCl, 5 mM MgCl2; final concentration for physiological buffer; 140 mM NaCl, 4 mM KCl, 2 mM MgCl2) and 0.5 µL bovine serum albumin (BSA; final concentration 0.1 mg / mL) was added into 3.5 µL aptamer solution. Then, 20 µL of either buffer or cocaine was added, and the solution was incubated at the appropriate reaction temperature for 1 hr. Afterwards, exonuclease solutions were prepared in buffer containing BSA (final concentration: 0.1 mg / mL). Binding profile determination experiments (which used T5 Exo and Exo I or Exo III and Exo I) were performed in selection buffer, while Exo I-only assays were performed in physiological buffer. Depending on the experiment, final concentrations were 0.2 U / µL T5 Exo and 0.015 U / µL Exo I; 0.025 U / µL Exo III and 0.05 U / µL Exo I; or 0.05 U / µL Exo I alone.25 µL of exonuclease solution was added to the aptamer solution to initiate digestion. For microplate assays, a 5 µL aliquot of the sample was taken at various time-points and mixed with 30 µL quenching solution (final concentration: 10 mM Tris, pH 7.4, 1× SYBR Gold, 21 mM EDTA, and 12.5% formamide) loaded in a black 384- well flat bottom microplate. Fluorescence was measured using a Tecan M1000 Pro microplate reader with excitation wavelength of 495 nm and emission of 537 nm. Each sample was measured ten times, and the average of these measurements was used for analysis. Resistance values were calculated as described previously. For PAGE analysis, 5 µL aliquots of the samples were diluted in 10 µL loading buffer (final concentration: 0.125% (w / v) xylene cyanol FF, 10% glycerol (v / v), 0.125% (w / v) SDS, 10 mM EDTA, 75% formamide). The samples were run using 15% acrylamide gels in 0.5× TBE initially at 6 V / cm for 0.5 hr and then at 25 V / cm for 4 hr. Gels were subsequently stained with 1× SYBR Gold and imaged using a BioRad Gel Imaging Station. Isothermal titration calorimetry (ITC) experiments. All ITC experiments wereperformed in selection buffer or physiological buffer with a MicroCal ITC200 instrument (Malvern) at either 23 or 37ºC. Refer to Table 22 for specific conditions for each experiment. In general, aptamers were prepared in Tris buffer, heated at 95°C for 5 min, and immediately cooled on ice for 3 min. Salts were then added to reach the appropriate final concentrations, NCSU-2024-034-03 NCSU-42526.601AND THEN ,)) d: OF APTAMER SOLUTION WAS LOADED INTO THE CELL( @HE SYRINGE WAS LOADED WITHcocaine dissolved in the same buffer. Each ITC experiment consisted of an initial purgeINJECTION OF )(- d: AND *1 SUCCESSIVE INJECTIONS OF + d: WITH A SPACING OF *0) S BETWEENinjections. The raw data was first corrected for the dilution heat of the ligand and then analyzed with the MicroCal analysis kit integrated into Origin 7 software and fitted with a single-site binding model. Table 22. Aptamer dissociation constants (KD), and ITC experiment conditions. Cocaine Aptamer K M $" $# ) In vitro cocaine measurements using the strand-displacement fluorescence sensor. This experiment was performed at room temperature with a sample volume of 80 µL. The sensor utilizes NC195 labeled with 5’ Cy5 (NC195-Cy5) and a 3’ Iowa Black RQ-labeled 13-nt cDNA (cDNA13Q). First, using a fixed concentration of 50 nM NC195-Cy5, the concentration of cDNA13Q was optimized to achieve >90% quenching by mixing the aptamer with various concentrations of cDNA. To do so, 39 µL of aptamer and 39 µL of cDNA dissolved in selection buffer were mixed together and subsequently heated to 95ºC for 5 min and then cooled to room temperature gradually using a water bath over 25 min. Thereafter, 2 µL of Triton-X100 was added to the samples (final concentration: 0.005% by volume). Finally, NCSU-2024-034-03 NCSU-42526.601 75 µL of each sample was loaded into a black 384-well flat bottom microplate and their fluorescence was measured using a Tecan microplate reader with excitation at 650 nm and emission at 670 nm. The optimal concentration of cDNA13Q was 125 nM. To detect cocaine, NC195-Cy5 and cDNA13Q (final concentrations: 50 and 125 nM, respectively) were dissolved in selection buffer, heated to 95ºC for 5 min, and cooled in a water bath for 25 min. Then, 40 µL of aptamer-cDNA solution was mixed with 40 µL of various concentrations of cocaine in buffer or human serum. After 30 min of incubation to allow the aptamer and target to bind, 75 µL of the sample was loaded into a black 384-well flat bottom microplate and fluorescence was measured using the same excitation and emission wavelengths. Fluorescence recovery was calculated using the equation F / F0, where F and F0are the fluorescence of the solution in the absence and presence of cocaine, respectively. To construct calibration curves, fluorescence recovery of each sample was plotted against the concentration of cocaine. To evaluate sensor specificity, the same procedure was followed, except the 40 µL aptamer-cDNA solution was mixed with 40 µL of either cocaine (final concentration: 0.1 or 1 µM) or interferent (final concentration: 100 µM, except for THC, AB-FUBINACA, and UR-144, which were 5 µM in selection buffer containing 5% (v / v) DMSO). In vitro cocaine measurements using EAB sensors. A detailed protocol of EABsensor preparation using NC195-36 and the determination of its calibration curve in whole bovine blood is provided herein. In brief, EAB sensors were fabricated using established protocols that include depositing 5’ thiol-modified, 3’ methylene-blue-modified NC195-36 (NC195-36-MB) onto a gold wire working electrode. The aptamer-modified working electrode, platinum counter electrode, and an Ag / AgCl (3 M KCl) reference electrode were used in a standard three-electrode set up. The sensors were interrogated using square-wavevoltammetry (SWV) and the kinetic-drift measurement (KDM) signal was calculated using a200 Hz and 20 Hz frequency pair. For calibration, the sensor was placed into undiluted wholeBOVINE BLOOD IN A SHOT GLASS& WHICH WAS MAINTAINED AT , / e WITH A WATER BATH( @HIS WAS TITRATEDwith cocaine and SWV measurements were performed after 3 min of incubation. KDM signals were plotted against cocaine concentration to obtain a Langmuir isotherm calibration curve, which was used for in vivo studies to determine cocaine concentrations based on observed KDM signal. In vivo cocaine measurements using EAB sensors. The in vivo protocols are described in detail herein. In brief, an intravenous sensor was fabricated using previouslyestablished methods. NC195-36-MB was attached to a gold working electrode, which wasbundled with a platinum wire counter electrode and a silver wire reference electrode, fed NCSU-2024-034-03 NCSU-42526.601 through a 20-gauge catheter, and then emplaced into the right jugular vein of an anesthetized rat. A silastic catheter was placed into the left jugular vein for drug delivery. The sensor was then interrogated using SWV using frequencies of 200 Hz and 20 Hz. A >20 min baseline was collected before challenging the animal with intravenous cocaine HCl (5 mM, 1 mg / kg IV over a period of 3 min) using a motorized syringe pump. The resulting output was drift correctedusing KDM and converted into concentration using the calibration curve described herein.Example 5 Demonstrating generality of NA-SELEX with a protein target. NA-SELEX was performed to isolate DNA aptamers that bind to the serine protease thrombin. A variety of thrombin aptamers have been previously reported in the literature, facilitating comparison and determination of whether NA-SELEX could produce aptamers with better affinity and binding kinetics. First, five rounds of conventional filtration-based SELEX with nitrocellulose membranes were performed to pre-enrich pools binding to thrombin. The retention of pool in the presence of thrombin consistently increased from 1% in Round 1 to 14% in Round 5, indicating enrichment of thrombin-binding aptamers (FIG. 58A). Then, three rounds of NA- SELEX at 37 ºC were performed using similar protocols as established previously (FIG.58B). Refer to Table 23 for selection conditions. In the first rounds, after performing an initial negative selection step (FIG.59), the resulting pool hybridized to NA-cDNA was digested with FEN1 without or with 1 µM thrombin at 37 ºC for 1.5 h. Pool retention in the presence of thrombin was 30%, roughly double of that in the absence of target (16%) (FIG. 58C). In contrast, no difference in pool retention was observed regardless of whether the native library was digested without or with thrombin. Then, in the next round, the pool was digested for a longer period of time (2 h) to select specifically for slow-off rate aptamers on the assumption that they could survive prolonged digestion, observing 25% pool retention with thrombin relative to 14% without. In the final round, selection stringency was increased even further by performing digestion for 3 h, obtaining pool retention of 23% with thrombin, similar as the previous round, but with a reduced background of 7% without thrombin. The selection was terminated at this round. All SELEX pools (Round 1 to Round 8) were subjected to HTS to identify aptamer sequences. The number of reads obtained for each pool is shown in Table 24. Remarkably, unlike NA-SELEX for cocaine, no particular aptamer dominated the final round pool in termsof abundance (e.g., the highest-ranking aptamer had a population of 0.0037%). Indeed, thesequence diversity of the pools had barely fallen from the first to the seventh round, with an NCSU-2024-034-03 NCSU-42526.601 average of 40±2% unique sequences for these rounds. Unexpectedly however, the proportion of unique sequences rose in Round 8 to 75%, which indicates a change in the composition of sequences in the pool (Table 24). Thus, the pools did not converge to a handful of highly abundant sequences, as is usually observed for SELEX. Therefore, to identify aptamer candidates for further characterization, the population dynamics of aptamer families were analyzed instead. The software RaptGen, a bioinformatic tool that utilizes variational autoencoders to ‘map’ aptamers sequences in two-dimensional space, where sequences with similar motifs form clusters in the latent space, was used. The Round 8 pool was used as a training set to build an encoder and decoder pair. After this initial training, the model was applied to sort sequences in every SELEX round to visualize the evolution of sequences (FIG. 60). In the Round 8 pool, several different clusters of sequences were observed. To determine the representative motif of each cluster, clustal omega was used to align sequences and then WebLogo to visualize each motif. There were six unique motif families (FIG. 58D). Notably, all families contained relatively short (10 to 20-nt in length) G-rich motifs, suggesting that they most likely contain G-quadruplex structures, similar to previously reported thrombin aptamers. For instance, sequences in Family 1 all contained a highly conserved 4-base motif ‘TAGG’ at the 5’ end with another 13-base motif at the 3’ end containing three sets of ‘GG’, both motifs linked by a 13-base region in the middle of the random domain with almost no consensus.290 sequences in the Round 8 pool were identified containing the original 15-nt thrombin aptamer sequence reported by Bock et al. (Nature 355, 564–566 (1992)), but none of them were members of any of the six families. In contrast, the thrombin aptamer reported by Tasset et al (J. Mol. Biol. 1997, 272(5), 688–698). was not found in the SELEX pools. Having identified these different aptamer families, their enrichment throughout SELEX was assessed. In the filter-SELEX rounds (Round 1 – 5), Family 6 experienced the largest growth, with Family 3 and Family 5 undergoing modest growth (FIG.60). From the initiation of NA-SELEX in Round 6 until the final round of NA-SELEX, Family 1, Family 2, and Family 4 began to gain significantly more members (FIG.60). Interestingly, by overlapping the sequence space in the final round of filter SELEX and NA-SELEX (Rounds 5 and 8) (FIG.58D), it was shown that Family 1, Family 2, and Family 4 were preferentially enriched by NA-SELEX, and that Family 6, which was enriched during filter-SELEX, primarily remained static in population. Characterization of thrombin aptamers. Based on the analysis of the HTS data, several aptamer candidates from each family (25 in total) (Table 25; FIGS. 58A-58G) were chosen for further affinity characterization. First, T5 / Exo I exonuclease digestion assay was used to determine the relative affinity of each aptamer for thrombin. As a point of comparison, NCSU-2024-034-03 NCSU-42526.601 the high-affinity DNA aptamer for thrombin isolated by Tasset et al. (KD= 0.5 nM) was also included in this screening assay. The aptamers were digested without or with 0.1 or 0.5 µM thrombin at room temperature and most aptamers displayed target-specific resistance to digestion, with 90% of sequences having similar resistance values as the Tasset aptamer (Figure 6A). Underperforming aptamers included those from Family 3 (T9) and Family 6 (T20, T21, T22). The same assay was performed with a subset of these aptamers to assess thrombin affinity at 37 ºC, and several of them, including the Tasset aptamer, displayed lower resistance values relative to those obtained at 25 ºC, indicating that target affinity significantly weakens at increased temperatures (Figure 6B). Of these aptamers, two were found to have significantly diminished affinity (T15 and T23). To evaluate the specificity of the new thrombin aptamers, the exonuclease digestion assay was performed with the subset with the aptamers having the greatest relative affinity for thrombin. Impressively, all of the thrombin aptamers did not display any meaningful cross-reactivity to 0.5 µM human serum albumin, streptavidin, or human factor Xa, another serine protease (Figure 6C). These data demonstrated preliminary success for NA-SELEX in terms of the capability to identify specific binders to a protein target. The binding affinity and kinetics of the best performing thrombin aptamers (Table 26) was determined using BLI. In general, the KD of the new thrombin aptamers ranged between 0.7 to 30 nM (FIGS.61D and 62 and Table 27). Notably, NA-SELEX-enriched Family 1 aptamers T3 and T4, Family 2 aptamer T7, and Family 4 aptamer T13, had affinities superior to the Bock and the Tasset thrombin aptamers by one or two orders of magnitude. Specifically, the Bock and Tasset aptamers had KDs of 18.0 nM and 4.7 nM, respectively, while T3, T4, T7, and T13 had KDs of 1.7 nM, 0.9 nM, 0.8 nM, and 1.8 nM at 37 ºC. This indicated that NA- SELEX can produce aptamers with improved affinity relative to those generated through conventional means. This notion is also supported by the fact that the Family 6 aptamers, which were enriched early on during the filter-SELEX rounds and had relatively low resistance values, had the poorest affinity of all aptamers tested (for example, T22 KD = 18 nM). Other aptamers also displayed modest improvement relative to previously reported thrombin aptamers, with KD ranging between 2 and 10 nM. In addition, while the NA-SELEX thrombin aptamers identified here had similar on-rates (kon ~106M-1s-1), they had significantly slower off-rates (Table 27). For instance, T3, T4, T7, and T13 have koffof 3.2 × 10-3s-1, 3.4 × 10-3s-1, 1.6 × 10-3s-1, and 4.2 × 10-3s-1, an order of magnitude lower than the Bock and Tasset aptamers which have koffof 4.0 × 10-2s-1and 1.0 × 10-2s-1, respectively. These aptamers with such slow off-rates were most likely enriched due to the kinetic pressure of NA-SELEX, which selects for sequences that have long residence times, for instance in the case of T7, ~10 min. In NCSU-2024-034-03 NCSU-42526.601 contrast, aptamers with mediocre off-rates, such as T22 (koff= 2.6 × 10-2s-1), did not survive the NA-SELEX process due to their short residence time (~30 sec), which significantly increased their susceptibility to degradation by FEN1. These results therefore definitively demonstrated that NA-SELEX indeed yields slow-off rate aptamers, regardless of target identity. Filter SELEX. Aptamers binding to thrombin were pre-enriched using a previous protocol based on nitrocellulose membrane filtration. To initiate SELEX, the 30-nt stem loop library was first dissolved in 200 µL selection buffer, heated to 95 ºC for 5 min in a boiling water bath, and subsequently cooled to room temperature for 20 min. Afterwards, BSA was added to the library solution at final concentration of 1.5 µM (0.01%). To perform negative selection, the library solution was incubated with a piece of nitrocellulose filter in a 2 mL tube for 15 min and then the filter was discarded. The supernatant was subjected to negative selection once more in the same manner to thoroughly remove filter binders. The library solution was then split into 100 µL portions in two 2 mL tubes and incubated with either selection buffer (negative control) or 1 µM thrombin for 15 min. Thereafter, the solutions were subjected to vacuum filtration using a nitrocellulose membrane and a Millipore vacuum filtration apparatus with a pressure of 20 cm Hg. After initially pre-washing the membrane with 5 mL of selection buffer, the library solution was added to the membrane, which was then washed again with 5 mL of buffer to remove non-binding sequences. Then, the membrane was cut and placed into a 2 mL tube, and incubated at 95 ºC for 5 min in 400 µL urea solution (7 M urea, 3 mM EDTA, 10 mM Tris, pH 7.4) to remove aptamers from the membrane. Afterwards, the supernatant containing aptamers was removed and kept. This extraction procedure was performed once more to maximize aptamer recovery. Then, the aptamer- containing solution was diluted 2-fold with purified water and subjected to phenol-chloroform- isoamyl alcohol extraction to remove proteins. The aqueous layer, containing the aptamers, were kept and further purified with water and a 10 kDa molecular weight cutoff filter. PCR was then performed as described above to amplify aptamers, followed by a single-strand DNA generation step using the resulting amplicons. This selection procedure was performed for six rounds in total. NA-SELEX for thrombin aptamers. NA-SELEX was initiated using the pool from the sixth round of filter-SELEX. Detailed conditions for each round are provided in Table 23. The library was hybridized with five-fold excess of LI-cDNA15-bio in selection buffer and then immobilized on streptavidin-coated agarose resin loaded in a microgravity column as described above. The column was then washed 20 times with selection buffer and then 10 times NCSU-2024-034-03 NCSU-42526.601 with selection buffer warmed to 37 ºC to remove weakly-bound library strands. Then, the column was washed three times with selection buffer without MgCl2. The column was then treated with NaOH as explained above to remove the remaining library off the column, and the solution was subsequently pH neutralized and purified with a 3 kDa filter to remove salts. After negative-selection, the resulting pool was then subjected to positive selection using FEN1. Two samples with a volume of 100 µL were prepared. First, the pool was hybridized with 2.5-fold excess of NA-cDNA in selection buffer. Then, Triton X-100 was added to reach a final concentration of 0.01% (v / v). Afterwards, either buffer or thrombin (final concentration 1 µM) was added to the library-cDNA mixture, which was then incubated at 37 ºC for 15 min to allow the target to bind. To initiate digestion, FEN1 was added (final concentration: 0.35 U / mL) in buffer containing 20 mM Tris and 0.01% (v / v) and Triton X-100 to the samples. The digestion was allowed to proceed for 1.5 h for Round 6, 2 h for Round 7, and 3 h for Round 8 at 37 ºC. To stop digestion, EDTA was added (final concentration 100 mM) and the samples were heated for 10 min at 75 ºC. The samples were subsequently purified using phenol-chloroform-isoamyl alcohol extraction and then with water and a 3 kDa filter to remove EDTA, salts, and the target. PAGE purification was performed as explained above to separate intact library strands from cleaved library products and NA-cDNA. Finally, the purified DNA was PCR amplified and single-stranded DNA was generated from the resulting double-stranded PCR amplicons as described above. This pool was used for another round of NA-SELEX. Bioinformatic Analysis. For thrombin selection pools, Raptgen was used to identify aptamer motifs. The Round 8 NA-SELEX pool was to generate the model using a cutoff of 6 reads. Building of the model converged after 430 iterations. This model was used to represent the latent space of Rounds 1 – 8 to evaluate the evolution of sequence families. Families were identified from clusters of sequences at the extremities of the latent space. Sequence logos for these families were made using WebLogo. HTS data has been uploaded to the NCBI Sequencing Read Archive. Table 23. Selection conditions for thrombin NA-SELEX performed at 37 °C. R 6 Then, 3 × 250 NCSU-2024-034-03 NCSU-42526.601 µL washes with 7 8 Table 24. Statistics for HTS data of Round 1-5 filter SELEX and Round 6-8 NA- SELEX for thrombin. Table 25. Sequences of new thrombin aptamers and Tasset. N D TTTTTTTTTTTTTTTTTTTTT T21 CTTACGACCTGGACATGGGTGGGAGGGTGGTGGTGATGGTCGTAAG 290 NCSU-2024-034-03 NCSU-42526.601 T22 CTTACGACACCACGAATGGTTGGGAGGGTGGTAGGGATGTCGTAAG 291T23 CTTACGACGAGGGTATCGTGATTGGTGTGGTTGGCTCGGTCGTAAG 292T Thrombin Family 1 consensus sequence: TAGG-(X1-13)-TGG-(X14)-TAGG-(X15)- TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14is A, T, C, or G; or X15is A, T, C, or G (SEQ ID NO: 307). Thrombin Family 1 consensus sequence: TAGG-(X1-13)-TGG-(X14)-TAGG-(X15)-TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12is A, T, C, or G; X13is A, T, C, or G; X14is G or T; or X15is G or T (SEQ ID NO: 308). Exemplary sequences from Thrombin Family 1 (see also FIG. 58E): CTTACGACCTAGGCGAGGGGCAGATGGGTAGGGTGGTGGTCGTAAG (SEQ ID NO: 270); CTTACGACTAGGGGGCCGCAGTGCATGGGTAGGGTGGTGTCGTAAG (SEQ ID NO: 271); CTTACGACTAGGGCCACGGGAGTGATGGGTAGGGTGGTGTCGTAAG (SEQ ID NO: 272); CTTACGACCTAGGGAAGGGTGTATTGGGTAGGGTGGTGGTCGTAAG (SEQ ID NO: 273); CTTACGACCTAGGGTGGGTAGGGTGCATTATGTTGGTGGTCGTAAG (SEQ ID NO: 282). Thrombin Family 2 consensus sequence: CG(X1)A(N2)TGG(X3-5)GGTTGG(X6-9)GG; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; or X9 is A, T, C, or G (SEQ ID NO: 309). Thrombin Family 2 consensus sequence: CG(X1)A(N2)TGG(X3- 5)GGTTGG(X6-9)GG; wherein X1 is T, G, or A; X2 is A or T; X3 is G or T; X4 is G or T; X5 is G or T; X6 is G, T, or A; X7 is G, T, or A; X8 is G, A, or T; or X9 is G, A, or T (SEQ ID NO: 310). Exemplary sequences from Thrombin Family 2 (see also FIG. 58F): CTTACGACGGGCGTAATGGTGCGGGTGGTTGGGGCGCGGTCGTAAG (SEQ ID NO: 274); CTTACGACGAAGCGTAATGGATCGGTTGGGGGGGTGACGTCGTAAG (SEQ ID NO: 275); CTTACGACCTTGCGGAATGGTTGGGTTGGGGGGGCAGGGTCGTAAG (SEQ ID NO: 276). NCSU-2024-034-03 NCSU-42526.601 Thrombin Family 4 consensus sequence: AGG(X1)TGG(X2)TAGG(X3-13)TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; or X13is A, T, C, or G (SEQ ID NO: 311). Thrombin Family 4 consensus sequence: AGG(X1)TGG(X2)TAGG(X3-13)TGGT; wherein X1is G or T; X2is G or T; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11is T or G; X12is T or G; or X13is G or T (SEQ ID NO: 312). Exemplary sequences from Thrombin Family 4 (see also FIG. 58G): CTTACGACCTAGGGTGGGTAGGAGGCGTAGTCTTGGTGGTCGTAAG (SEQ ID NO: 280); CTTACGACGATAGGGTGGGTAGGATTCATAGATGGTTCGTCGTAAG (SEQ ID NO: 281); CTTACGACCTAGGGTGGGTAGGGTGCATTATGTTGGTGGTCGTAAG (SEQ ID NO: 282); CTTACGACCTAGGGTGGGTAGGTGATCATGGGTTGGTGGTCGTAAG (SEQ ID NO: 283). Variable nucleic acids are represented by “X” or “N.” In some embodiments, an “X” or an “N” followed by a numerical range (e.g., X5-9) indicates that there are at least the number of nucleotides present in the nucleic acid molecule represented by the first (lower) integer in the range, and there are at most the number of nucleotides present in the nucleic acid molecule represented by the second (higher) integer in the range. In accordance with this, the number of nucleotides represented by the first number of the range are required to be present in the nucleic acid molecule, but the other numbers in the range are optional (e.g., for X5-9, at least 5 nucleotides are present in the nucleic acid molecule; however, there may be 6, 7, 8, or 9 nucleotides present in the nucleic acid molecule). Table 26. Sequences of biotinylated thrombin aptamers used for biolayer interferometry (BLI) experiments. N D TBT T T T7-bio GTCGTAAG 299 NCSU-2024-034-03 NCSU-42526.601 T10-bio / 5BiotinTEG / CTTACGACAATGGGGTTGGGAGGGTAGTTTGTTGGTTTG TCGTAAG 300 T T T T T T Table 27. Summary of BLI data for thrombin aptamers (experiment performed at 37 ºC). At k M-1 -1 k -1 Ki ti KD
Claims
NCSU-2024-034-03 NCSU-42526.601 CLAIMS What is claimed is:
1. An in vitro aptamer selection method, the method comprising: obtaining a library comprising a plurality of candidate aptamers for binding a target analyte; hybridizing a complementary DNA (cDNA) to at least a portion of each of the candidate aptamers in the library, thereby forming a plurality of hybridization complexes; exposing the plurality of hybridization complexes to the target analyte and a nuclease for a defined period of time, wherein binding of the target analyte to a candidate aptamer displaces the cDNA and prevents the endonuclease from cleaving a portion of the candidate aptamer; and identifying the sequence of the candidate aptamer bound to the target analyte.
2. The method of claim 1, wherein each of the plurality of candidate aptamers comprises a stem-loop structure comprising a double-stranded stem portion, at least two primer binding sites, and a variable loop region.
3. The method of claim 2, wherein the double-stranded stem portion is from about 4 nucleotides to about 15 nucleotides in length.
4. The method of claim 2 or claim 3, wherein the at least two primer binding sites comprise a 5’ primer binding site extending from a single-stranded overhang on the stem portion.
5. The method of any one of claims 2 to 4, wherein the at least two primer binding sites comprise a 3’ primer binding site extending from the stem portion.
6. The method of any one of claims 2 to 5, wherein the portion of the candidate aptamer that is complementary to the cDNA comprises the stem portion containing the 5’ primer binding site, such that hybridization of the cDNA to the candidate aptamer disrupts the double-stranded stem portion.NCSU-2024-034-03 NCSU-42526.601 7. The method of any one of claims 2 to 6, wherein the variable loop region is from about 4 nucleotides to about 200 nucleotides in length.
8. The method of any one of claims 2 to 7, wherein the variable loop region binds the target analyte and comprises one or more of DNA, RNA, 2F-RNA, 2-O-Methyl RNA, or a combination thereof.
9. The method of any one of claims 1 to 8, wherein the cDNA comprises a stem-loop structure comprising a double-stranded portion and a single-stranded portion.
10. The method of claim 9, wherein the double-stranded portion is from about 6 nucleotides to about 20 nucleotides in length.
11. The method of any one of claims 1 to 10, wherein hybridization of the cDNA to the candidate aptamers disrupts the double-stranded stem portion of the candidate aptamer and produces a single-stranded 5’ flap that comprises a primer binding site, and a single- nucleotide 3’ overhang.
12. The method of claim 11, wherein the endonuclease cleaves the single-stranded 5’ flap in the absence of the target analyte, in the presence of a non-binding target analyte, or if the library sequence does not bind the analyte.
13. The method of any one of claims 1 to 12, wherein the defined period of time is from about 1 second to about 1 week.
14. The method of any one of claims 1 to 13, wherein the endonuclease is a FEN1 endonuclease.
15. The method of claim 14, wherein the FEN1 endonuclease is from a prokaryotic or eukaryotic organism.
16. The method of any one of claims 1 to 15, wherein the target analyte is cocaine or a derivative or analog thereof.NCSU-2024-034-03 NCSU-42526.601 17. The method of any one of claims 1 to 16, wherein identifying the sequence of the candidate aptamer comprises performing PCR and / or nucleotide sequencing.
18. The method of any one of claims 1 to 17, wherein the method is repeated to enrich the plurality of candidate aptamers capable of binding the target analyte.
19. The method of any one of claims 1 to 18, wherein the method further comprises quantitatively assessing the plurality of candidate aptamers using surface plasmon resonance and / or biolayer interferometry.
20. The method of any one of claims 1 to 19, wherein at least one of the plurality of candidate aptamers generated by the method comprises a koff that is less than or equal to about 0.005 s-1.
21. The method of any one of claims 1 to 20, wherein the plurality of candidate aptamers comprise one or more of DNA, RNA, 2F-RNA, 2-O-Methyl RNA, or a combination thereof.
22. A kit comprising the library of candidate aptamers and the cDNAs for performing the method of any one of claims 1 to 21.
23. The kit of claim 22, further comprising an endonuclease and / or primers.
24. A single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: TAGGTGTGGGTCGGC-(X10)-GGGTA; wherein X1is A, T, C, or G; X2is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; and X10 is A, T, C, or G (SEQ ID NO: 1).
25. The nucleic acid molecule of claim 24, wherein X1is T or C; X2is C or A; X3is C or T; X4 is T or G; X5 is T or G; X6 is A, T or G; X7 is A, T, or G; X8 is G or T; X9 is G or T; and X10is T or G (SEQ ID NO: 2).NCSU-2024-034-03 NCSU-42526.601 26. The nucleic acid molecule of claim 24 or claim 25, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 3- 12.
27. The nucleic acid molecule of any one of claims 24 to 26, wherein the nucleic acid molecule comprises a KDthat is less than about 621 nM.
28. A single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-7)-GTTGGTTCTAGGG-(X8)-TAGGATGGC; wherein X1is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; and X8 is A, T, C, or G (SEQ ID NO: 13).
29. The nucleic acid molecule of claim 28, wherein X1 is G; X2 is T or G; X3 is G; X4 is T or G; X5 is G or T; X6 is C or T; X7 is T or C; and X8 is G or T (SEQ ID NO: 14).
30. The nucleic acid molecule of claim 28 or claim 29, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 15-22.
31. The nucleic acid molecule of any one of claims 28 to 30, wherein the nucleic acid molecule comprises a KD that is less than about 1420 nM.
32. A single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-2)-GGGATGT-(X3)-TAGTTAGTG-(X4)-GTCGG-(X5-10); wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G, X9is A, T, C, or G, and X10is A, T, C, or G (SEQ ID NO: 23).
33. The nucleic acid molecule of claim 32, wherein X1 is G or A; X2 is A or T; X3 is G or T; X4is G; X5is A or T; X6is G or T; X7is C; X8is A or C; X9is T or G and X10is A, G or T (SEQ ID NO: 24).NCSU-2024-034-03 NCSU-42526.601 34. The nucleic acid molecule of claim 32 or claim 33, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 25-40.
35. The nucleic acid molecule of any one of claims 32 to 34, wherein the nucleic acid molecule comprises a KDthat is less than about 2650 nM.
36. A single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1)-CAGGGGG-(X2)-GGCTAGGGTGCGCGG-(X3)-AGCTG; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G (SEQ ID NO: 41).
37. The nucleic acid molecule of claim 36, wherein X1 is A or T; X2 is G or A; and X3 is G or A (SEQ ID NO: 42).
38. The nucleic acid molecule of claim 36 or claim 37, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 43-47.
39. The nucleic acid molecule of any one of claims 36 to 38, wherein the nucleic acid molecule comprises a KDthat is less than about 282 nM.
40. A single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: TAGTTC-(X1-5)-AGGGGTAGG-(X6)-GTGGTTGTG; wherein X1is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; and X6 is A, T, C, or G (SEQ ID NO: 48).
41. The nucleic acid molecule of claim 40, wherein X1 is C or G; X2 is G; X3 is A or G; X4is G or T; X5is A or T; and X6is T or C (SEQ ID NO: 49).
42. The nucleic acid molecule of claim 40 or claim 41, wherein the nucleic acid molecule 50% identical to any one of SEQ ID NOs:NCSU-2024-034-03 NCSU-42526.601 43. The nucleic acid molecule of any one of claims 40 to 42, wherein the nucleic acid molecule comprises a KD that is less than about 201 nM.
44. A single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-5)-TCTGAGGGTCAAC-(X6-9)-TGGTGTAGT-(X10-11); wherein X1 is A, T, C, or G; X2is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; and X11is A, T, C, or G (SEQ ID NO: 53).
45. The nucleic acid molecule of claim 44, wherein X1 is C or T; X2 is T or G; X3 is G; X4 is T or G; X5 is T; X6 is T or G; X7 is T or C; X8 is T or G; X9 is T or G; X10 is T or C; and X11 is G (SEQ ID NO: 54).
46. The nucleic acid molecule of claim 44 or claim 45, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 55-63.
47. The nucleic acid molecule of any one of claims 44 to 46, wherein the nucleic acid molecule comprises a KDthat is less than about 245 nM.
48. A single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: (X1-5)-TTTTGGGT-(X6-7)-TCTGG-(X8)-TGGG-(X9-15); wherein X1is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11is A, T, C, or G; X12is A, T, C, or G; X13is A, T, C, or G; X14is A, T, C, or G; and X15 is A, T, C, or G (SEQ ID NO: 64).
49. The nucleic acid molecule of claim 48, wherein X1 is G or A; X2 is G or T; X3 is A or T; X4is C; X5is C; X6is G; X7is T or C; X8is G or T; X9is A; X10is G; X11is G or T; X12is T or G; X13 is G or T; X14 is G or T; and X15 is C or T (SEQ ID NO: 65).NCSU-2024-034-03 NCSU-42526.601 50. The nucleic acid molecule of claim 48 or claim 49, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 66-77.
51. The nucleic acid molecule of any one of claims 48 to 50, wherein the nucleic acid molecule comprises a KDthat is less than about 405 nM.
52. A single-stranded nucleic acid molecule capable of specifically binding cocaine or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: ACA-(X1)-GG-(X2)-GTGGA-(X3-7)-TGGGC-(X8-15); wherein X1is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G ; and X15 is A, T, C, or G (SEQ ID NO: 78) 53. The nucleic acid molecule of claim 52, wherein X1 is C or G; X2 is T or C; X3 is G or T; X4is G, T, or C; X5is G or A; X6is G; X7is G or C; X8is G; X9is T; X10is A, or T; X11is T, G, or A; X12 is A or G; X13 is G; X14 is G; and X15 is G (SEQ ID NO: 79).
54. The nucleic acid molecule of claim 52 or claim 53, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 80-83.
55. The nucleic acid molecule of any one of claims 52 to 54, wherein the nucleic acid molecule comprises a KDthat is less than about 476 nM.
56. A single-stranded nucleic acid molecule capable of specifically binding cocaine, or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 84-107.
57. The nucleic acid molecule of any one of claims 24 to 56, wherein the nucleic acid molecule comprises a detection moiety.NCSU-2024-034-03 NCSU-42526.601 58. The nucleic acid molecule of any one of claims 24 to 57, wherein the nucleic acid molecule is in solution or attached to a substrate.
59. A vector comprising any of the nucleic acid sequences of claims 24 to 58.
60. A method of detecting cocaine, or a derivative or analog thereof, the method comprising: combining any of the nucleic acid molecules of claims 24-58 comprising a fluorescent moiety with a quencher-labeled nucleic acid molecule that is at least partially complementary to the nucleic acid molecules of claims 24-58 to form a quenched composition; and exposing the quenched composition to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof; wherein presence of the cocaine, or a derivative or analog thereof, in the sample displaces the quencher-labeled nucleic acid molecule, thereby producing a fluorescent signal proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample.
61. A method of detecting cocaine, or a derivative or analog thereof, the method comprising: combining any of the nucleic acid molecules of claims 24-58 with a reporter compound that binds to the nucleic acid molecules of claims 24-58 to form a complexed composition; and exposing the complexed composition to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof; wherein presence of the cocaine, or a derivative or analog thereof, in the sample displaces the reporter compound, thereby allowing the reporter compound to form detectable aggregates proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample.
62. A method of detecting cocaine, or a derivative or analog thereof, the method comprising: immobilizing any of the nucleic acid molecules of claims 24-58 to an electrically conductive substrate, wherein the nucleic acid molecules of claims 24-58 comprise a redox tag, to form a detection sensor; andNCSU-2024-034-03 NCSU-42526.601 exposing the detection sensor to a sample comprising or suspected of comprising cocaine, or a derivative or analog thereof; wherein presence of the cocaine, or a derivative or analog thereof, in the sample binds the nucleic acid molecules of claims 24-58, thereby producing an electrochemical signal proportional to the concentration of the cocaine, or a derivative or analog thereof, in the sample.
63. The method of any one of claims 60 to 62, wherein the sample is a biological sample from a human subject.
64. The method of claim 63, wherein the biological sample is a saliva sample, a urine sample, a blood sample, a serum sample, a plasma sample, a fecal sample, a CSF sample, or a tissue sample.
65. A single-stranded nucleic acid molecule capable of specifically binding thrombin or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: TAGG-(X1-13)-TGG-(X14)-TAGG-(X15)-TGGT; wherein X1is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14 is A, T, C, or G; or X15 is A, T, C, or G (SEQ ID NO: 307).
66. The nucleic acid molecule of claim 65, wherein X1is A, T, C, or G; X2is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is A, T, C, or G; X12 is A, T, C, or G; X13 is A, T, C, or G; X14 is G or T; or X15 is G or T (SEQ ID NO: 308).
67. The nucleic acid molecule of claim 65 or claim 66, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 270-273 or SEQ ID NO:
282.
68. A single-stranded nucleic acid molecule capable of specifically binding thrombin or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: CG(X1)A(N2)TGG(X3-5)GGTTGG(X6-9)GG; wherein X1is A, T, C, or G; X2NCSU-2024-034-03 NCSU-42526.601 is A, T, C, or G; X3is A, T, C, or G; X4is A, T, C, or G; X5is A, T, C, or G; X6is A, T, C, or G; X7is A, T, C, or G; X8is A, T, C, or G; or X9is A, T, C, or G (SEQ ID NO: 309).
69. The nucleic acid molecule of claim 68, wherein X1is T, G, or A; X2is A or T; X3is G or T; X4 is G or T; X5 is G or T; X6 is G, T, or A; X7 is G, T, or A; X8 is G, A, or T; or X9 is G, A, or T (SEQ ID NO: 310).
70. The nucleic acid molecule of claim 68 or claim 69, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 274-276.
71. A single-stranded nucleic acid molecule capable of specifically binding thrombin or a derivative or analog thereof, comprising a nucleic acid sequence that is at least 50% identical to the following: AGG(X1)TGG(X2)TAGG(X3-13)TGGT; wherein X1 is A, T, C, or G; X2 is A, T, C, or G; X3 is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9 is A, T, C, or G; X10 is A, T, C, or G; X11 is A, T, C, or G; X12is A, T, C, or G; or X13is A, T, C, or G (SEQ ID NO: 311).
72. The nucleic acid molecule of claim 71, wherein X1is G or T; X2is G or T; X3is A, T, C, or G; X4 is A, T, C, or G; X5 is A, T, C, or G; X6 is A, T, C, or G; X7 is A, T, C, or G; X8 is A, T, C, or G; X9is A, T, C, or G; X10is A, T, C, or G; X11is T or G; X12is T or G; or X13is G or T (SEQ ID NO: 312).
73. The nucleic acid molecule of claim 71 or claim 72, wherein the nucleic acid molecule comprises a nucleic acid sequence that is at least 50% identical to any one of SEQ ID NOs: 280-283.
Citation Information
Patent Citations
Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of aspartyl-trna synthetases
US20150252349A1
Using the full repertoire of genetic information from bacterial genomes and plasmids for improved genetic resistance tests
US20190144922A1
High throughput multiomics sample analysis
US20190338357A1
Stable pan-genomes and their use
US20190348154A1