Compositions and methods for treating a heart disease

By using a vector encoding a PKG1 polypeptide delivered via an AAV vector with cardiac-specific promoters, the challenges of treating cardiomyopathy with current therapies are addressed, achieving improved cardiac function and reduced risk of sudden death with minimized side effects.

WO2025122739A1PCT designated stage expired Publication Date: 2025-06-12UNIV OF PITTSBURGH OF THE COMMONWEALTH SYST OF HIGHER EDUCATION
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/058655
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-05
Filing Date
2024-12-05
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Current treatments for cardiomyopathy, including small molecule agents, often lead to progression to end-stage disease and are limited by systemic side effects such as hypotension. Additionally, there is a lack of effective pharmacological therapies to prevent sudden death in patients with cardiomyopathy.

Method used

Administration of a therapeutically effective amount of a vector encoding a protein kinase G1 (PKG1) polypeptide, specifically targeting heart cells, including cardiomyocytes, smooth muscle cells, and endothelial cells, using an adeno-associated viral (AAV) vector with cardiac-specific promoters to enhance expression and minimize systemic side effects.

Benefits of technology

The increased expression of PKG1 in heart cells improves cardiac function, reduces disease progression, and decreases the risk of sudden death in patients with cardiomyopathy, while minimizing systemic side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000041_0001
    Figure IMGF000041_0001
  • Figure 00000045_0000
    Figure 00000045_0000
  • Figure 00000046_0000
    Figure 00000046_0000
Patent Text Reader

Abstract

Provided herein are methods and compositions for treating a heart disease in a subject. The methods comprise administering a therapeutically effective amount of a vector encoding a polynucleotide encoding a protein kinase G1 (PKG1) to the subject and the compositions comprise a polynucleotide encoding a protein kinase G1 (PKG1).
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR TREATING A HEART DISEASE CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This PCT application claims priority to, and the benefit of, U.S. Provisional Patent Application No.63 / 606,347, filed December 05, 2023, which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING

[0002] The sequence listing submitted on December 5, 2024, as an .XML file entitled “10504-094WO1_ST26” created on December 4, 2024, and having a file size of 50,199 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). FIELD

[0003] Disclosed herein are methods and compositions for treating heart diseases using a protein kinase G1 encoding vector. BACKGROUND OF THE INVENTION

[0004] In the last 30 years there has been a dramatic increase in our understanding of the genetic and non-genetic mechanisms that contribute to the development of cardiomyopathy in humans. Despite this increased mechanistic understanding, the risk of heart failure and sudden death remains high in this patient population. While multiple small molecule agents reduce the morbidity and mortality of patients with cardiomyopathy, many patients still progress to end stage disease. In addition, these small molecule agents act in a non-cell type specific manner and their utilization is often limited by hypotension and other systemic side effects. Likewise, pharmacological therapy to prevent sudden death in individuals with cardiomyopathy remains lacking, and many patients still require an implantable cardiac defibrillator (ICD). Therefore, new strategies are required to reduce disease progression and sudden death in patients with cardiomyopathy.

[0005] Preventing the degradation of circulating natriuretic peptides by the chemical inhibition of neprilysin has proven to be very beneficial in patients with dilated cardiomyopathy. The combination of the neprilysin inhibitor, sacubitril, and the angiotensin receptor blocker, valsartan, not only reduced mortality secondary to heartfailure but also significantly reduced sudden death in the dilated cardiomyopathy population. In chronic heart failure myocardial cGMP levels are reduced despite elevated circulating levels of cardiac natriuretic peptides. Methods to overcome this functional NP deficiency using neprilysin inhibition are limited by non-myocardial side effects such as hypotension or renal dysfunction which occur in up to 20% of treated patients.

[0006] Accordingly, what are needed are improved compositions and methods for treating a heart disease. SUMMARY

[0007] The present disclosure relates generally to compositions and methods for the treatment of a heart disease (e.g. cardiomyopathy). In one aspect, the present disclosure provides vectors comprising a promoter, optionally a cardiac-specific promoter, operably linked to a polynucleotide encoding a therapeutic gene product for the treatment of heart disease, e.g., cardiomyopathy. The vector may be an adeno-associated viral (AAV) vector.

[0008] Provided herein is a method of treating a heart disease in a subject in need thereof comprising administering a therapeutically effective amount of a vector encoding a protein kinase G1 (PKG1) polypeptide and the PKG1 polypeptide is expressed in a cell in the subject. In some embodiments, the cell is a heart cell. In some embodiments, the cell is a cardiomyocyte. In some embodiments, the cell is a smooth muscle cell. In some embodiments, the cell is a heart smooth muscle cell. In some embodiments, the cell is an endothelial cell. In some embodiments, the cell is a heart endothelial cell.

[0009] In some embodiments, the PKG1 is a protein kinase G1 beta polypeptide (PKG1^). In some embodiments, the PKG1^ polypeptide has at least 85% identity to SEQ ID NO:3. In some embodiments, the PKG1^ comprises SEQ ID NO:3. In some embodiments, the PKG1 is a protein kinase G1 alpha polypeptide (PKG1^). In some embodiments, the PKG1^ polypeptide has at least 85% identity to SEQ ID NO:1. In some embodiments, the PKG1^ polypeptide comprises SEQ ID NO:1.

[0010] In some embodiments, the vector further comprises a cardiomyocyte specific promoter polynucleotide and the cell is a cardiomyocye. In some embodiments, the cardiomyocyte specific promoter is a cardiac troponin T promoter (cTnT). In someembodiments, the cTnT polynucleotide has at least 85% identity to SEQ ID NO:8. In some embodiments, the cTnT polynucleotide comprises SEQ ID NO:8.

[0011] In other embodiments, the vector further comprises a smooth muscle cell specific promoter polynucleotide and the cell is a smooth muscle cell. Examples of smooth muscle cell specific promoters are an actin alpha 2 smooth muscle promoter (ACTA2), a Transgelin (TAGLN) promoter, and a myosin heavy chain 11 (MYH11) promoter. In some embodiments, the ACTA2 polynucleotide has at least 85% identity to SEQ ID NO:9. In other embodiments, the TAGLN polynucleotide has at least 85% identity to SEQ ID NO:10. In still other embodiments, the MYH11 polynucleotide has at least 85% identity to SEQ ID NO:11.

[0012] In some embodiments, the smooth muscle cell specific promoter comprises an actin alpha 2 smooth muscle promoter (ACTA2) of SEQ ID NO:9, a Transgelin (TAGLN) promoter of SEQ ID NO: 10, or a myosin heavy chain 11 (MYH11) promoter of SEQ ID NO: 11.

[0013] In other aspects, the vector further comprises an endothelial cell specific promoter polynucleotide and the cell is an endothelial cell. Examples of endothelial cell specific promoters are a TEK receptor tyrosine kinase (TEK) promoter, a tyrosine kinase with immunoglobulin like and EGF like domains 1 (TIE1) promoter, FMS related receptor tyrosine kinase 1 (FLT1) promoter, nitric oxide synthase (NOS3) promoter, Von Willebrand Factor (VWF) promoter, and a kinase insert domain receptor (KDR) promoter. In some embodiments, the TEK polynucleotide has at least 85% identity to SEQ ID NO: 12, the TIE1 polynucleotide has at least 85% identity to SEQ ID NO: 13, the FLT1 polynucleotide has at least 85% identity to SEQ ID NO: 14, and the NOS3 polynucleotide has at least 85% identity to SEQ ID NO: 15.

[0014] In certain aspects, the vector comprises a recombinant adenovirus associated vector (rAAV). In some embodiments, the rAAV vector is an rAAV1, rAAV2, rAAV6,rAAV7, rAAV9 or rAAV10. In some embodiments, the AAV is an rAAV9. In some embodiments, the AAV is an rAAV6.

[0015] In certain aspects, the vector is administered at a dosage of about 2 X 10¹¹ to 2 X 1014viral genomes per subject. In some embodiments, the vector is administered at a dose of 2×10¹¹ viral genomes per subject.

[0016] In some embodiments, the heart disease comprises cardiac arrhythmia, dilated cardiomyopathy, heart failure, or hypertrophic cardiomyopathy. In some embodiments, the heart disease comprises heart failure.

[0017] In some embodiments, the vector is delivered to the subject by direct administration to heart tissue, intracoronary, intravenously, intra-arterially, or intraperitoneally. In some embodiments, the vector is delivered by direct administration to heart tissue.

[0018] In certain aspects, the expression of PKG1 is selectively increased in cardiomyocytes of the subject. In some embodiments, the subject is a human.

[0019] Also provided herein is a recombinant viral vector for treating a heart disease in a subject, comprising a nucleic acid sequence of a PKG1 polynucleotide operably linked to a cardiomyocyte specific promoter.

[0020] In some embodiments, the cardiomyocyte specific promoter is a cardiac troponin T promoter. In some embodiment the cardiomyocyte specific promoter is a cardiac troponin T minimal promoter.

[0021] In some embodiments, the PKG1 is a protein kinase G1 beta polypeptide (PKG1^). In some embodiments, the PKG1^ polypeptide has at least 85% identity to SEQ ID NO:3. In some embodiments, the PKG1^ comprises SEQ ID NO:3. In some embodiments, the PKG1 is a protein kinase G1 alpha polypeptide (PKG1^). In some embodiments, the PKG1^ polypeptide has at least 85% identity to SEQ ID NO:1. In some embodiments, the PKG1^ polypeptide comprises SEQ ID NO:1.

[0022] In some embodiments, the recombinant viral vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is an AAV1, AAV2, AAV6, AAV7, AAV9 or AAV10. In some embodiments, the AAV is an AAV9. In some embodiments, the AAV is an AAV6.

[0023] In certain aspects, the heart disease comprises a cardiomyopathy. In some embodiments the heart disease comprises a cardiac arrhythmia, dilated cardiomyopathy,heart failure, or hypertrophic cardiomyopathy. In some embodiments, the subject is a human. BRIEF DESCRIPTION OF FIGURES

[0024] Figure 1 is a schematic of a vector that encodes for human PRKG1 with a Myc tag.

[0025] Figure 2 shows that ANP rapidly induces the binding of virally encoded PKG1 to endogenous target proteins in human cardiomyocytes. Human iPS cell derived cardiomyocytes were transduced with a AAV serotype 6 vector that contains a troponin T minimal promoter driving the expression of a N-terminal Myc tagged human PKG1 (AAV6-cTnT-MycPRKG1). All groups of cardiomyocytes were transduced with 105 v.g. / cell. Seven days after transduction the cardiomyocytes were exposed to vehicle or 0.5 nM of ANP for 2 hours. An in-situ proximity ligation assay (PLA) was then performed using primary antibodies against Myc and PIAS1. Protein-protein interactions are indicated by small grey dots (immunofluorescence) in the cardiomyocyte cytoplasm. Mean + / - SEM. Scale bar=10 µm.

[0026] Figure 3(A, B) shows that AAV transduction of PKG1 into human cardiomyocytes amplifies ANP induced SERCA2a SUMOylation. Human iPS cell derived cardiomyocytes were transduced with 105v.g. / cell of AAV vector that contained a troponin T minimal promoter driving the expression of either GFP (AAV6-cTnT-GFP) or Myc tagged human PKG1 (AAV6-cTnT-Myc / hPRKG1).72 hours after viral transduction the cardiomyocytes were exposed to vehicle, 0.5 nM ANP, or 10nM ANP for 48 hours. An in-situ proximity ligation assay (PLA) was then performed using primary antibodies against SERCA2a and SUMO1. SUMO1 post-translational modification of SERCA2a was indicated by small grey dots (immunofluorescence) in the cardiomyocyte. Mean + / - SEM. Scale bar=10 µm.

[0027] Figure 4 shows an in vivo validation of AAV9 vectors and troponin T minimal promoter (cTNT) to selectively express GFP or PKG1 in cardiomyocytes. Representative pictures of C57BL / 6J mice that were injected with AAV9-cTNT-GFP or AAV9-cTNT- Myc / hPRKG1 virus (2x1011v.g. / per mouse) at 60 days of age and then euthanized at 90 days of age. IHC was performed on left ventricle tissue using an anti-cMyc antibody followed by an Alexa-Fluor 488 secondary ab and then stained with a wheat germagglutinin (WGA) Texas conjugate. Scale bar 100 µm. Picture on the left indicates no expression of PKG1 and picture on the right demonstrates c-Myc expression using anti-c- Myc antibody.

[0028] Figure 5 shows that in vivo injection of AAV9-cTnT-mycPKG1^ leads to robust binding of virally encoded mycPKG1 to endogenous PIAS1. Mybpc3- / - mice were injected with either AAV9-cTnT-GFP or AAV9-cTnT-Myc / hPRKG1. Thirty days later the left ventricular tissue from these mice underwent in situ proximity ligation assay (PLA) to measure virally encoded mycPKG1^ and endogenous PIAS1 interactions using cMyc and PIAS1 antibodies. Scale bar 20 µm

[0029] Figure 6 shows that an in vivo injection of AAV9-cTNT-myc / hPRKG1 improves left ventricular systolic function 30 days after injection in a murine nonischemic dilated cardiomyopathy model. 30-day old (Pre) Mybpc3- / -mice had baseline echocardiograms performed and then were injected with either AAV9-cTnT-GFP or AAV9-cTnT- Myc / hPRKG1 virus (2x1011v.g. / per mouse). At 60 days of age (Post) the mice had repeated echocardiograms performed. N=4-5 / group. Mean + / - SEM.

[0030] Figure 7(A-D) shows that in vivo injection of AAV9-cTnT-Myc / hPRKG1 improves left ventricular diastolic function in a murine model of hypertrophic cardiomyopathy. 60-day old wild type (WT) or Myh6WT / R404Q mice had baseline echocardiograms performed and then were injected with AAV9-cTnT-Myc / PRKG1 virus (2x1011 v.g. / per mouse). At 90 days of age the mice had repeat echocardiograms performed. (A) Ratio of peak mitral inflow velocity from left ventricular relaxation in early diastole (E wave) to peak mitral inflow velocity in late diastole caused by atrial contraction (A wave). (B) Ratio of peak mitral inflow velocity from left ventricular relaxation in early diastole (E wave) to mitral annular early diastolic velocity measured by tissue doppler (e’ wave). (C) Isovolumic relaxation time (IVRT). (D) Left ventricular systolic fractional shortening (FS). N=4-5 / group. Mean + / - SEM. DETAILED DESCRIPTION

[0031] Provided herein are methods of treating a heart disease in a subject that include administering to the subject a therapeutically effective amount of a vector comprising a polynucleotide encoding a protein kinase G1 polypeptide (PKG1). It is a surprising finding disclosed herein that administration of a vector encoding a PKG1 polypeptide, andthereby increasing expression of the PKG1 results in improved cardiac function in subjects with a heart disease.

[0032] Terms used throughout this application are to be construed with ordinary and typical meaning to those of ordinary skill in the art. However, Applicant desires that the following terms be given the particular definition as defined below.

[0033] Terminology

[0034] As used in the specification and claims, the singular form "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof.

[0035] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1%.

[0036] The term "administering" refers to introducing into or applying onto a subject a vector of the present disclosure such that target cells which are present in the subject are eventually contacted by the agent. In some embodiments, the target cells are cardiomyocytes, smooth muscle cells, or endothelial cells. Administration can be oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra- joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra-articular, intra- synovial, intrasternal, intrathecal, intrahepatic, intralesional, intracranial injection or infusion.

[0037] As used herein, the term "cardiomyopathy" refers to the deterioration of the function of the myocardium (i.e., the actual heart muscle) for any reason. Subjects with cardiomyopathy are often at risk of arrhythmia or sudden cardiac death or both. As used herein, the term "hypertrophic cardiomyopathy" or “HCM” refers to a disease of the heart and myocardium in which a portion of the myocardium is hypertrophied. Myh6 WT / R404Q mice can be used a model for hypertrophic cardiomyopathy caused by genetic mutations. As used herein, the term "familial hypertrophic cardiomyopathy"refers to a genetic disorder characterized by increased growth (i.e., hypertrophy) in thickness of the wall of the left ventricle. The term “dilated cardiomyopathy” refers to a condition where the heart becomes enlarged and weakened, causing reduced ability to pump blood effectively during systole. In this application, Mybpc3- / - mice are used as a model for non-ischemic dilated cardiomyopathy.

[0038] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but not excluding others. "Consisting essentially of" when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of" shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions of this invention. Embodiments defined by each of these transition terms are within the scope of this invention.

[0039] A "control" is an alternative subject or sample used in an experiment for comparison purpose. A control can be "positive" or "negative."

[0040] As used herein, the terms “decrease,” “decreased” and “decreasing” mean to decrease by a statistically significant amount. In some embodiments, the decrease is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70, about 80%, about 90%, or about 95%.

[0041] As used herein, “E / A ratio” refers to a ratio of early diastolic (E wave) to late diastolic (A wave) mitral inflow velocity wherein higher values indicate better diastolic relaxation, “E / e’ ratio” is the ratio of early diastolic mitral inflow velocity (E wave) to early mitral annular velocity (e’ wave) wherein lower values suggest better diastolic function, “isovolumic relaxation time” (IVRT) refers to shorter IVRT which indicates quicker relaxation of the heart after contraction and “fractional shortening” refers to measure of systolic function wherein higher values indicate improved contraction.

[0042] As used herein, the term “expression” refers to either or both “gene expression” and “protein expression.” “Gene expression” refers to the process by which polynucleotides are transcribed into mRNA and “protein expression” refers to the process by which mRNA is translated into peptides, polypeptides, or proteins. If thepolynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. “Gene overexpression” refers to the overproduction of the mRNA transcribed from the gene, at a level that is at least about 2.5 times higher, at least about 5 times higher, or at least about 10 times higher than the expression level detected in a control sample. “Protein overexpression” includes the overproduction of the protein product encoded by a gene at a level that is at least about 2.5 times higher, at least about 5 times higher, or at least about 10 times higher than the expression level detected in a control sample. In some embodiments, PKG1 expression is selectively increased in cardiomyocytes, smooth muscle cells or endothelial cells of the subject. The term “selectively increased” refers to a statistically significant increase in expression in a limited cell type, e.g., cardiomyocytes, smooth muscle cells or endothelial cells, without a same increase in other cell types. In some embodiments, there is an about 0% increase in PKG1 expression in non-endothelial transfected cells. In some embodiments, there is an about 1%, about 2%, about 3%, about 4%, or an about 5% increase in PKG1 expression in non-transfected cells.

[0043] An "expression cassette" or "expression construct" refers to a DNA polynucleotide sequence operably linked to a promoter.

[0044] The term "gene" or "recombinant gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences.

[0045] As used herein, the terms “increase,” “increased” and “increasing” mean to increase by a statistically significant amount. In some embodiments, the increase is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70, about 80%, about 90%, or about 95%.

[0046] "Operably linked" or "operatively linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of the polynucleotide sequence.

[0047] The terms “pharmaceutically effective amount”, “therapeutically effective amount” and “therapeutically effective dose” refer to the amount of a compound such as a vector encoding a PKG1 polypeptide that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought by the researcher, veterinarian,medical doctor or other clinician. In some embodiments, a desired response is a heart function improvement. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years. The terms “pharmaceutically effective amount”, “therapeutically effective amount” or “therapeutically effective dose” include that amount of a compound such as a vector encoding a PKG1 polypeptide that, when administered, is sufficient to prevent development of (preventive treatment), or alleviate to some extent (remedial treatment), one or more of the symptoms of the condition or disorder being treated. The therapeutically effective amount will vary depending on the compound such as a vector encoding a PKG1 polypeptide, the disorder or conditions and its severity, the route of administration, time of administration, rate of excretion, drug combination, judgment of the treating physician, dosage form, and the age, weight, general health, sex and / or diet of the subject to be treated. In the context of the present method, a pharmaceutically or therapeutically effective amount or dose of a vector encoding a PKG1 polypeptide includes an amount that is sufficient to improve a heart function or reduce an amount or severity of a cardiomyopathy.

[0048] The terms "polynucleotide" and "nucleic acid," used interchangeably herein, refer to a polymeric form of nucleotides of more than about 100 nucleotides, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. "Oligonucleotide" generally refers to polynucleotides of between about 5 and about 100 nucleotides of single- or double-stranded DNA. However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as "oligomers" or "oligos" and may be isolated from genes, or chemically synthesized by methods known in the art. The terms "polynucleotide" and "nucleic acid" should be understood to include, as applicable to the embodiments being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.

[0049] The term "promoter" as used herein refers to a polynucleotide sequence that has one or more recognition site(s) to which an RNA polymerase binds, such that in a host or target cell, an RNA polymerase may initiate and transcribe a polynucleotide sequence"downstream" of the promoter into an RNA. Similarly stated, a "promoter" is operably linked or operatively linked to a polynucleotide sequence if in a host or target cell in which the promoter is active, an RNA polymerase initiates transcription of the polynucleotide at a transcription state site. Promoters operative in mammalian cells generally comprise an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated and / or another sequence found 70 to 80 bases upstream from the start of transcription, a CNCAAT region where N may be any nucleotide.

[0050] The terms "upstream" and "upstream end" refer to a portion of a polynucleotide that is, with reference to a transcription start site (TSS), 5' to the TSS on the sense strand (or coding strand) of the polynucleotide; and 3' to the TSS on the antisense strand of the polynucleotide. The terms "downstream" and "downstream end" refer to a portion of a polynucleotide that is, with reference to a TSS, 3' to TSS on the sense strand (or coding strand) of the polynucleotide; and 5' to the TSS on the antisense strand of the polynucleotide. Thus, a deletion from the upstream end of a promoter is a deletion of one or more base pairs in the non-transcribed region of the polynucleotide, 5' to the TSS on the sense strand (or equivalently, 3' to the TSS on the antisense strand). A deletion from the downstream end of a promoter is a deletion of one or more base pairs in the transcribed region of the polynucleotide, 3' to the TSS on the sense strand (or equivalently, 5' to the TSS on the antisense strand).

[0051] As used herein, the term "transgene" refers to a nucleic acid sequence encoding a protein or RNA (e.g., a therapeutic protein), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid. In the current disclosure “PRKG1” or “PKG1” transgene refers to protein kinase cGMP- dependent type 1 gene which encodes a protein kinase.

[0052] The terms "sequence identity" and “percent identity” shall be construed to mean the percentage of nucleotide bases or amino acid residues in the candidate sequence thatare identical with the bases or residues of a corresponding sequence to which it is compared, after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent identity for the entire sequence, and not considering any conservative substitutions as part of the sequence identity. Neither N- nor C-terminal extensions nor insertions shall be construed as reducing identity. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) that has a certain percentage (for example, 80%, 85%, 90%, or 95%) of "sequence identity" to another sequence means that, when aligned over their full lengths, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent sequence identity can be determined using software programs known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the homology alignment algorithm of Needleman and Wunsch, by the search for similarity method of Pearson and Lipman, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madi- son, Wis.), by manual alignment and visual inspection, or by use of algorithms know in the art including the BLAST and BLAST 2.0 algorithms. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0053] The term "modified" refers to a substance or compound (e.g., a cell, a polynucleotide sequence, and / or a polypeptide sequence) that has been altered or changed as compared to the corresponding unmodified substance or compound.

[0054] The term “recombinant adeno-associated virus (rAAV) vector” refers to an adeno- associated virus that has been modified to include a heterologous polynucleotide such a polynucleotide encoding PKG1. As used herein, a "heterologous" polynucleotide or nucleic acid refers to a polynucleotide or portion of a polynucleotide derived from a source other than the host organism or, for a viral vector, the native, non-recombinant virus.

[0055] The term "sample" refers to a biological composition (e.g., a cell or a portion of a tissue) that is subjected to analysis and / or genetic modification. In some embodiments, a sample is a "primary sample" in that it is obtained directly from a subject; in someembodiments, a "sample" is the result of processing of a primary sample, for example to remove certain components and / or to isolate or purify certain components of interest.

[0056] The term "subject" includes animals, such as e.g. mammals. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; or domesticated animals such as dogs and cats. In some embodiments (e.g., particularly in research contexts) subjects are rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like. The terms "subject" and "patient" are used interchangeably herein.

[0057] The term "transfection" refers to foreign DNA entering a cell. A cell has been "transfected" when exogenous DNA has been introduced inside the cell membrane. The term captures chemical and electrical transfection procedures.

[0058] The terms “treat,” “treating,” “treatment,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating or impeding one or more causes of a disorder or condition. Treatments according to the invention may be applied preventively, prophylactically, pallatively or remedially. Accordingly, included herein are methods of remedial treating. Also included herein are methods of preventive treating. Treatments are administered to a subject prior to onset (e.g., before obvious signs of cardiomyopathy), during early onset (e.g., upon initial signs and symptoms of cardiomyopathy), or after an established development of cardiomyopathy. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of cardiomyopathy. In some embodiments, the cardiomyopathy is a hypertrophic cardiomyopathy. In some instances, the terms “treat”, “treating”, “treatment” and grammatical variations thereof, include partially or completely reducing or decreasing hypertrophic or dilated cardiomyopathy as compared with prior to treatment of the subject or as compared with the incidence of such symptom in a general or study population. The terms “treat”, “treating”, “treatment” and grammatical variations thereof, can also include partially or completely decreasing or reducing heart failure as compared with prior to treatment of the subject or as compared with the incidence of such symptom in a general or study population. The heart failure can be heart failure with reduced ejection fraction (HFrEF) or heart failure with preservedejection fraction (HFpEF). In some instances, the terms “treat”, “treating”, “treatment” and grammatical variations thereof, include partially or completely reducing or decreasing left ventricular diastolic and systolic dysfunction. In some instances, the terms “treat”, “treating”, “treatment” and grammatical variations thereof, include partially or completely reducing or decreasing left ventricular hypertrophy.

[0059] The term "variant" refers to a protein or nucleic acid having one or more genetic changes (e.g. insertions, deletions, substitutions, or the like) that returns all or substantially all of the functions of the reference protein or nucleic acid. For example, a variant of a therapeutic protein retains the same or substantially the same activity and / or provides the same or substantially the same therapeutic benefit to a subject in need thereof. A variant of a promoter sequence retains the ability to initiate transcription at the same or substantially the same level as the reference promoter and retains the same or substantially the same cell type specificity. In particular embodiments, polynucleotides variants have at least or about 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a reference sequence. In particular embodiments, protein variants have at least or about 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a reference sequence.

[0060] The term "wild type" refers to the naturally occurring polynucleotide sequence encoding a protein, or a portion thereof, or protein sequence, or portion thereof, respectively, as it normally exists in vivo in a normal or healthy subject.

[0061] Polynucleotides

[0062] In some embodiments, the present disclosure provides polynucleotide sequences for the treatment of heart disease (e.g., cardiomyopathy). In some embodiments, the polynucleotide sequences comprise a cardiac-specific promoter operatively linked to a polynucleotide encoding a protein kinase G1 (PKG1 or PRKG1) for the treatment of cardiomyopathy. In some embodiments, the polynucleotide encoding a protein kinase G1 is comprised within a vector.

[0063] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (alpha, beta, and II). These PKG isoforms act as mediators of the nitric oxide / cGMPsignaling pathway. When expressed naturally in humans, the the PRKG1 gene encodes the alpha and beta soluble isoforms that are achieved through alternative transcript splicing, whereasPRKG2 encodes the membrane-bound PRKG isoform II. Naturally occurring soforms alpha and beta have largely identical cGMP-binding and catalytic domains but differ in their leucine / isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity.

[0064] Accordingly, in some aspects of the present disclosure, the PKG1 is a PKG1^ polypeptide. In some embodiments, the PKG1^ polypeptide is that identified in one or more publicly available databases as follows: HGNC: 9414, Entrez Gene: 5592, Ensembl: ENSG00000185532, OMIM: 176894, and UniProtKB: Q13976. In some embodiments, the PKG1^ polypeptide comprises SEQ ID NO:1. In some embodiments, the PKG1^ polypeptide comprises a polypeptide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:1, or a polypeptide comprising a portion of SEQ ID NO:1 while retaining an ability to treat a heart disease. In certain aspects, the PKG1^ polynucleotide comprises SEQ ID NO:2. In some embodiments, the PKG1^ polynucleotide comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:2, or a polynucleotide comprising a portion of SEQ ID NO:2 and encoding a PKG1^ polypeptide that retains an ability to treat a heart disease. In some embodiments, the PKG1^ polypeptide comprises SEQ ID NO:19. In some embodiments, the PKG1^ polypeptide comprises a polypeptide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:19, or a polypeptide comprising a portion of SEQ ID NO:19 while retaining an ability to treat a heart disease. In some embodiments, the PKG1^ polynucleotide comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:20, or a polynucleotide comprising a portion of SEQ ID NO:20 and encoding a PKG1^ polypeptide that retains an ability to treat a heart disease.

[0065] In other or further embodiments, the PKG1 polypeptide is a PKG1^ polypeptide. In some embodiments, the PKG1^ polypeptide is that identified in one or more publicly available databases as follows: HGNC: 9414, Entrez Gene: 5592, Ensembl: ENSG00000185532, OMIM: 176894, and UniProtKB: Q13976. In some embodiments, the PKG1^ polypeptide comprises SEQ ID NO:3. In some embodiments, the PKG1^polypeptide comprises a polypeptide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:3, or a polypeptide comprising a portion of SEQ ID NO:3 while retaining an ability to treat a heart disease. In certain aspects, the PKG1^ polynucleotide comprises SEQ ID NO:4 or SEQ ID NO:5. In some embodiments, the PKG1^ polynucleotide comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:4 or SEQ ID NO:5, or a polynucleotide comprising a portion of SEQ ID NO:4 or SEQ ID NO:5 and encoding a PKG1^ polypeptide that retains an ability to treat a heart disease. In other embodiments, the PKG1^ polypeptide comprises SEQ ID NO:17. In some embodiments, the PKG1^ polypeptide comprises a polypeptide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:17, or a polypeptide comprising a portion of SEQ ID NO:17 while retaining an ability to treat a heart disease. In certain aspects, the PKG1^ polynucleotide comprises SEQ ID NO:18. In some embodiments, the PKG1^ polynucleotide comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:18, or a polynucleotide comprising a portion of SEQ ID NO:18 and encoding a PKG1^ polypeptide that retains an ability to treat a heart disease.

[0066] In other or further embodiments, the PKG1 polypeptide is a PKG1 variant 3 polypeptide. In some embodiments, the PKG1 variant 3 polypeptide is that identified in one or more publicly available databases as follows: HGNC: 9414, Entrez Gene: 5592, Ensembl: ENSG00000185532, OMIM: 176894, and UniProtKB: Q13976. In some embodiments, the PKG1 variant 3 polypeptide comprises SEQ ID NO:6. In some embodiments, the PKG1 variant 3 polypeptide comprises a polypeptide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:6, or a polypeptide comprising a portion of SEQ ID NO:6 while retaining an ability to treat a heart disease.

[0067] In some embodiments, the PKG1 polynucleotide or polypeptide is mutated or altered to provide for improved expression of the polypeptide. In other or further embodiments, the PKG1 polypeptide is mutated or altered to provide for improved activation. In some embodiments, the mutation or alteration provides for constitutiveactivation of the PKG1 polypeptide. In some embodiments, the mutation or alteration provides for increased PKG1 signaling.

[0068] In some embodiments, the PKG1 polynucleotide is modified, e.g., by the deletion, insertion, or substitution of one or more polynucleotides while still retaining an ability to treat a heart disease. For example, in some embodiments, the PKG1 polynucleotide is modified by the deletion of polynucleotides. A modification can include one, two, three or more internal deletions. Each deletion may be a deletion of 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 10 base pairs, 15 base pairs, 20 base pairs, 25 base pairs, 30 base pairs, 40 base pairs, 50 base pairs, 60 base pairs, 70 base pairs, 80 base pairs, 90 base pairs, 100 base pairs, 125 base pairs, 150 base pairs, 175 base pairs, 200 base pairs, 225 base pairs, 250 base pairs, 275 base pairs, or 300 base pairs with respect to a reference PKG1 polynucleotide (SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO:5 or SEQ ID NO:7). In other embodiments, additions can be made to a PKG1 polynucleotide of SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO:5 or SEQ ID NO:7. For example, a PKG1 polynucleotide of SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO:5 or SEQ ID NO:7 can be modified by the insertion of 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 10 base pairs, 15 base pairs, 20 base pairs, 25 base pairs, 30 base pairs, 35 base pairs, 40 base pairs, 45 base pairs, 50 base pairs, 55 base pairs, 60 base pairs, 65 base pairs, 70 base pairs, 75 base pairs, 80 base pairs, 85 base pairs, 90 base pairs, 100 base pairs, 125 base pairs, 150 base pairs, 175 base pairs, 200 base pairs, 225 base pairs, 250 base pairs, 275 base pairs, or 300 base pairs while still retaining an ability to treat a heart disease.

[0069] It should be noted that as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode a polypeptide, or fragment of variant thereof, as described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nonetheless, polynucleotides that vary due to differences in codon usage are specifically contemplated in particular embodiments, for example polynucleotides that are optimized for human and / or primate codon selection. Further, alleles of the genes comprising the polynucleotide sequences provided herein may also beused. Alleles are endogenous genes that are altered as a result of one or more mutations, such as deletions, additions and / or substitutions of nucleotides.

[0070] The polynucleotides contemplated herein, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters and / or enhancers, untranslated regions (UTRs), signal sequences, Kozak sequences, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, internal ribosomal entry sites (IRES), recombinase recognition sites (e.g., LoxP, FRT, and Att sites), termination codons, transcriptional termination signals, and polynucleotides encoding self-cleaving polypeptides, epitope tags, as disclosed elsewhere herein or as known in the art. Polynucleotides can be prepared, manipulated and / or expressed using any of a variety of well-established techniques known and available in the art.

[0071] Also provided herein are polynucleotide sequences of cardiac-specific promoters, cardiomyocyte-specific promoters, smooth muscle cell-specific promoters and endothelial cell-specific promoters. As used herein, "cardiac-specific promoter" refers to a promoter whose activity in cardiac cells is at least 2-fold higher than in any other non-cardiac cell type. Preferably, a cardiac-specific promoter suitable for being used in the vector described herein has an activity in cardiac cells which is at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, or at least 50-fold higher compared to its activity in a non-cardiac cell type. A “cardiomyocyte-specific promoter", as used herein, specifies a promoter whose activity in cardiomyocytes is at least 2-fold higher than in a non-cardiomyocyte. Preferably, a cardiomyocyte-specific promoter suitable for being used in the vector of the present disclosure has an activity in cardiomyocytes which is at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, or at least 50-fold higher compared to its activity in a non-cardiomyocyte. A “smooth muscle cell specific promoter” refers to a promoter whose activity in smooth muscle cells is at least 2-fold higher than in a non-smooth muscle cell. Preferably, a smooth muscle cell-specific promoter suitable for being used in the vector of the present disclosure has an activity in smooth muscle cells which is at least 5-fold, at least 10-fold, at least 15-fold, at least 20- fold, at least 25-fold, or at least 50-fold higher compared to its activity in a non-smooth muscle cell. An “endothelial cell specific promoter” refers to a promoter whose activity in endothelial cells is at least 2-fold higher than in a non-nonendothelial cell. Preferably, an endothelial cell-specific promoter suitable for being used in the vector of the presentdisclosure has an activity in endothelial cells which is at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, or at least 50-fold higher compared to its activity in a non-endothelial cell.

[0072] In some embodiments, the cardiac-specific or cardiomyocyte-specific promoter is a human promoter. Examples of cardiac-specific or cardiomyocyte-specific promoters include, but are not limited to, the cardiac troponin T promoter, alpha myosin heavy chain promoter, the myosin light chain 2v promoter, the alpha myosin heavy chain promoter, the alpha-cardiac actin promoter, the alpha-tropomyosin promoter, the cardiac troponin C promoter, the cardiac myosin-binding protein C promoter, and the sarco / endoplasmic reticulum Ca2+ATPase (SERCA) promoter (e.g. isoform 2 of SERCA2).

[0073] In some embodiments, the cardiomyocyte specific promoter is a cardiac troponin T promoter. In some embodiments, the cardiomyocyte specific promoter is a cardiac troponin T minimal promoter. In some embodiments, the cardiac troponin T minimal promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:8, or a polypeptide comprising a portion of SEQ ID NO:8 while retaining promoter functionality.

[0074] In some embodiments, the smooth muscle cell-specific promoter is an actin alpha 2 smooth muscle (ACTA2) promoter. In some embodiments, the ACTA2 promoter comprises SEQ ID NO:9. In some embodiments, the ACTA2 promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:9, or a polypeptide comprising a portion of SEQ ID NO:9 while retaining promoter functionality.

[0075] In some embodiments, the smooth muscle cell-specific promoter is a Transgelin (TAGLN) promoter. In some embodiments, the Transgelin promoter comprises SEQ ID NO:10. In some embodiments, the Transgelin promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:10, or a polynucleotide comprising a portion of SEQ ID NO:10 while retaining promoter functionality.

[0076] In some embodiments, the smooth muscle cell-specific promoter is a myosin heavy chain 11 (MYH11) promoter. In some embodiments, the MYH11 promoter comprises SEQ ID NO:11. In some embodiments, the MYH11 promoter comprises apolynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:11, or a polynucleotide comprising a portion of SEQ ID NO:11 while retaining promoter functionality.

[0077] In some embodiments, the endothelial cell-specific promoter is a TEK receptor tyrosine kinase (TEK) promoter. In some embodiments, the TEK promoter comprises SEQ ID NO:12. In some embodiments, the TEK promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:12, or a polynucleotide comprising a portion of SEQ ID NO:12 while retaining promoter functionality.

[0078] In some embodiments, the endothelial cell-specific promoter is a tyrosine kinase with immunoglobulin like and EGF like domains 1 (TIE1) promoter. In some embodiments, the TIE1 promoter comprises SEQ ID NO:13. In some embodiments, the TIE1 promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:13, or a polynucleotide comprising a portion of SEQ ID NO:13 while retaining promoter functionality.

[0079] In some embodiments, the endothelial cell-specific promoter is a FMS related receptor tyrosine kinase 1 (FLT1) promoter. In some embodiments, the FLT1 promoter comprises SEQ ID NO:14. In some embodiments, the FLT1 promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:14, or a polynucleotide comprising a portion of SEQ ID NO:14 while retaining promoter functionality.

[0080] In some embodiments, the endothelial cell-specific promoter is a nitric oxide synthase (NOS3) promoter. In some embodiments, the NOS3 promoter comprises SEQ ID NO:15. In some embodiments, the NOS3 promoter comprises a polynucleotide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% identity with SEQ ID NO:15, or a polynucleotide comprising a portion of SEQ ID NO:15 while retaining promoter functionality.

[0081] In some embodiments, the endothelial cell-specific promoter is a Von Willebrand Factor (VWF) promoter. In some embodiments, the endothelial cell-specific promoter is a kinase insert domain receptor (KDR) promoter

[0082] As used herein, the term “Myc tag” refers to a short peptide sequence (EQKLISEEDL) derived from the C-terminal region of the human c-Myc protein. In molecular biology, it is commonly fused to proteins of interest to facilitate their detection, purification, and analysis. Accordingly, included herein are embodiments wherein a Myc tag is not included in a vector.

[0083] Vectors

[0084] Included herein are vectors for the in vivo delivery of a PKG1 encoding polynucleotide. Methods of introducing polynucleotides into a host cell in vivo are known in the art. Suitable methods include e.g., gene delivery systems for germline (nuclei, egg cells, embryonic stem cells, pronuclear, microinjection, sperm cells) and somatic cells by viral (retroviral, adenoviral, adeno association, helper-dependent adenoviral systems, hybrid adenoviral systems, herpes simplex, pox virus, lentivirus, Epstein–Barr virus) and nonviral systems (physical: Naked DNA, DNA bombardant, electroporation, hydrodynamic, ultrasound, magnetofection) and (chemical: Cationic lipids, different cationic polymers, lipid polymers).

[0085] In some embodiments, the polynucleotides described herein are delivered to a cell in a non-viral vector, such as a transposon, a nanoparticle (e.g., a lipid nanoparticle), a liposome, an exosome, an attenuated bacterium, or a virus-like particle. In some embodiments, the non-viral vector is a mammalian virus-like particle. For example, mammalian virus-like particle can be generated (e.g., by purification of the "empty" mammalian virus-like particle followed by ex vivo assembly of the mammalian virus like particle with the desired cargo). The non-viral vector can also be engineered to incorporate targeting ligands to alter target tissue specificity.

[0086] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adenoviral vector. The genetic organization of adenovirus includes an approximate 36 kb, linear, double-stranded DNA virus, which generally allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kb.

[0087] In certain aspects of the disclosure, the vector is an adenovirus associated vector (AAV). There are multiple AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2 / 9n, AAVrh10 and AAV helper. In some embodiments, the AAV vector is selected from the group consisting of AAV1, AAV2, AAV7 and AAVrh10. In some embodiments, the AAV vector is an AAV1vector. In some embodiments, the AAV vector is an AAV2 / 6 vector. In some embodiments, the AAV vector is an AAV7 vector. In some embodiments, the AAV vector is an AAV2 / 9n vector (RepCap Addgene 112865). In some embodiments, the AAV vector is an AAVrh10 vector. In some embodiments, the AAV vector is selected from the group consisting of AAV6, AAV8 and AAV9. In some embodiments, the AAV vector is an AAV6 vector (RepCap, Addgene 110770). In some embodiments, the AAV vector is an AAV9 vector. In some embodiments the AAV vector further comprises one or more elements shown in Figure 1. In some embodiments, an AAV helper vector is also administered the cell. In some embodiments, the AAV helper vector is an AAV helper (Addgene 112867).

[0088] In some embodiments, the AAV expression vector is pseudotyped to enhance targeting. A pseudotyping strategy can promote gene transfer and sustain expression in a target cell type. For example, the AAV2 genome can be packaged into the capsid of another AAV serotype such as AAV5, AAV6, AAV7, or AAV8, producing pseudotyped vectors such as AAV2 / 5, AAV2 / 6, AAV2 / 7, and AAV2 / 8, respectively. In some embodiments, an AAV9 may be used to target expression in myofibroblast-like lineages. In some embodiments, AAVl, AAV6, or AAV9 is used, and in some embodiments, the AAV is engineered, as described in US20160340393Al to Schaffer et al. In some embodiments, the viral vector is AAV engineered to increase target cell infectivity as described in US20180066285Al.

[0089] In some embodiments, the vector comprises a polynucleotide sequence having a size of at most about 4.0 kilobases, at most about 4.5 kilobases, at most about 5 kilobases, at most about 5.1 kilobases, at most about 5.2 kilobases, at most about 5.3 kilobases, at most about 5.4 kilobases, or at most about 5.5 kilobases. In some embodiments, the vector comprises a polynucleotide sequence having a size of at most about 4.5 kilobases. In some embodiments, the vector comprises a polynucleotide sequence having a size of at most about 5 kilobases. In some embodiments, the vector comprises a polynucleotide sequence having a size of at most about 5.5 kilobases. In some embodiments, the vector comprises a polynucleotide sequence having a size of at most about 6 kilobases.

[0090] The disclosure provides a vector comprising an expression cassette encoding a PKG1 polypeptide. The PKG1 polynucleotide sequence in an expression cassette can be, for example, an open reading frame encoding PKG1. The expression cassette may comprise, optionally, a promoter operatively linked to the transgene, optionally an intronregion, optionally a polyadenylation (poly A) signal, optionally a woodchuck hepatitis virus post-transcriptional element (WPRE), and optionally a transcription termination signal. The expression cassette may be flanked by one or more inverted terminal repeats (ITRs). An expression cassette flanked by one or more ITRs is herein referred to as a "viral genome." The ITRs in an expression cassette serve as markers used for viral packaging of the expression cassette. The polynucleotide encoding the expression cassette provides the function of expressing the transgene within a host cell. The expression cassette can be integrated into the host cell genome by, for example, infecting the host cell with an AAV virion comprising capsid protein and a viral genome comprising an expression cassette.

[0091] The promoter sequence of the expression cassette, when present in the vector, controls expression of the polynucleotide encoding the PKG1 or functional variant thereof. In some embodiments, the vector comprises a constitutive promoter. Examples of constitutive promoters are the cytomegalovirus enhancer fused to the chicken-actin promoter (CAG), simian virus 40 (SV40) promoter, and the herpes simplex virus thymidine kinase (HSV-TK) promoter.

[0092] In some embodiments, the vector comprises a cardiac cell specific promoter. As discussed above, examples of cardiac-specific or cardiomyocyte-specific promoters include, but are not limited to, an alpha myosin heavy chain promoter, a myosin light chain 2v promoter, an alpha myosin heavy chain promoter, an alpha-cardiac actin promoter, an alpha-tropomyosin promoter, a cardiac troponin C promoter, a cardiac troponin T promoter, a cardiac myosin-binding protein C promoter, and the sarco / endoplasmic reticulum Ca2+ ATPase (SERCA) promoter (e.g. isoform 2 of SERCA2 ). In some embodiments, the vector comprises a cardiac troponin T promoter as described herein.

[0093] In some embodiments, the vector comprises a smooth muscle cell-specific promoter. Examples of smooth muscle cell-specific promoters are an actin alpha 2 smooth muscle (ACTA2) promoter, a Transgelin (TAGLN) promoter, a myosin heavy chain 11 (MYH11) promoter, a TEK receptor tyrosine kinase (TEK) promoter, a tyrosine kinase with immunoglobulin like and EGF like domains 1 (TIE1) promoter, a FMS related receptor tyrosine kinase 1 (FLT1) promoter, or a nitric oxide synthase (NOS3) promoter, each as described herein.

[0094] In some aspects, the disclosure provides promoters have been optimized for cardiac cell-specific expression and length to accommodate transgenes of specified size.In one embodiment, the promoter of an AAV vector genome described herein is a polynucleotide having between 300 bp and 500 bp.

[0095] In some embodiments, the present disclosure provides AAV vectors that are optimized for carrying larger non-AAV sequences, by for example, reducing the length of AAV sequences. In one embodiment, the 5' segment and 3' segment of an expression cassette together comprise at most 0.8 kbp or at most 0.9 kbp. In another embodiment, the 5' ITR, the 5' segment, the 3' segment, and 3' ITR together comprise 1.2 kbp or at most comprise 1.3 kbp. In one embodiment, the 5' segment comprises at most 500 bp or at most 480 bp. In one embodiment, the 3' segment comprises at most 200 bp or at most 150 bp. In another embodiment, the vector genome comprises at most 4.7 kbp. 4.8 kbp, 4.9 kbp, or 5.0 kbp. In some embodiments, the polynucleotide encoding the gene product comprises between 3 kb and 11 kb, between 3 kbp and 5 kbp, between 3.5 kbp and 4.5 kbp, or between 3.7 kbp and 4 kbp. In some embodiments, the polynucleotide encoding the gene product comprises 3.7 kbp to 3.9 kbp. In some embodiments, the polynucleotide encoding the gene product comprises 2 kbp.

[0096] In some embodiments, the rAAV (AAV containing an expression cassette or PKG1 encoding polynucleotide as described herein) is replication defective, in that the rAAV virion cannot independently further replicate and package its genome. For example, when a cardiac cell is targeted with rAAV virions, the transgene is expressed in the targeted cardiac cell, however, due to the fact that the targeted cardiac cell lacks AAV rep and cap genes and accessory function genes, the rAAV is not able to replicate. In some embodiments, rAAV virions of the present dis- closure encapsulating the expression cassettes as described herein, can be produced using helper-free production. rAAVs are replication-deficient viruses and normally require components from a live helper virus, such as adenovirus, in a host cell for packaging of infectious rAAV virions. rAAV helper- free production systems allow the production of infectious rAAV virions without the use of a live helper virus. In the helper-free system, a host packaging cell line is co-transfected with three plasmids. A first plasmid may contain adenovirus gene products (e.g. E2A, E4, and VA RNA genes) needed for the packaging of rAAV virions. A second plasmid may contain required AAV genes (e.g., REP and CAP genes). A third plasmid contains the polynucleotide sequence encoding the transgene of interest and a promoter flanked by ITRs. A host packaging cell line can be, for example, AAV-293 host cells. Suitable hostcells contain additional components required for packaging infectious rAAV virions that are not supplied by the plasmids. In some embodiments, the CAP genes can encode, for example, AAV capsid proteins as described herein.

[0097] In some embodiments, the viral vector is a retroviral vector. As used herein, the term "retrovirus" or "retroviral" refers to an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded DNA copy and subsequently covalently integrates its genomic DNA into a host genome. In some embodiments, a retroviral vector is altered so that it does not integrate into the host cell genome. Illustrative retroviruses (family Retroviridae) include, but are not limited to:genus gammaretrovirus, such as, Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), and feline leukemia virus (FLY), genus spumavirus, such as, simian foamy virus, genus lentivirus, such as, human immunodeficiency virus-I and simian immunodeficiency virus.

[0098] Regulatory Elements

[0099] In some embodiments, the disclosure provides a vector comprising one or more regulatory elements operatively linked to a polynucleotide encoding a PKG1 polypeptide. As used herein, the term "regulatory element" refers to those non-translated regions of the vector (e.g., origin of replication, selection cassettes, promoters, enhancers, translation initiation signals (Shine Dalgarno sequence or Kozak sequence) introns, a polyadenylation sequence, 5' and 3' untranslated regions) which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. The transcriptional regulatory element may be functional in either a eukaryotic cell (e.g., a mammalian cell) or a prokaryotic cell (e.g., bacterial or archaeal cell). In some embodiments, a polynucleotide sequence encoding the therapeutic gene products (e.g., a therapeutic protein or nucleic acid) described herein is operably linked to multiple control elements that allow expression of the polynucleotide in both prokaryotic and eukaryotic cells

[0100] As used herein, the term "transcription start site" or "TSS" refers to the first base pair transcribed by an RNA polymerase when the RNA polymerase initiates transcription. A TSS is different from the start codon (canonically, ATG), which must be downstream of the TSS in the transcribed region of the polynucleotide. The location of a transcriptionstart site can be determined experimentally or by prediction using any of various prediction algorithms.

[0101] A promoter is capable of promoting initiation of transcription by an RNA polymerase in a host or target cell at or near a TSS within the promoter (i.e. at or near the TTS of cTnT as defined herein) or, if the endogenous TSS is not present then at a heterologous TSS at most 100 base pairs downstream (3' on the sense strand) to the downstream (3') end of the promoter. The length of a promoter (e.g., a modified cardiac cTnT promoter), a promoter "having" so many base pairs, as used herein, is defined according to the number of base pairs in the polynucleotide sequence of the promoter from its 5' end to its 3' end, inclusive of the endpoints, and inclusive of any intervening sequences that do not align to a reference promoter sequence (e.g., the endogenous cardiac cTnT promoter of a human or other organism). The 5' end and the 3' end of the promoter are defined as the last base pair in either direction to match a corresponding sequence in a reference promoter sequence when the sequence is aligned by the BLAST algorithm or the equivalent. Thus, the length of a promoter in a vector can be determined by searching for a nucleotide database containing a genome of a reference organism using the polynucleotide sequence of the vector and identifying one or more aligned regions that encompass or are within about 1-5 kb of an endogenous gene, or by aligning the vector to a predetermined reference promoter. If the promoter aligns the reference genome or reference promoter sequence as a continuous segment, then the length of promoter is the length alignment reported (the 3' end position minus the 5' end position, +1 unless the TSS is included). If the promoter aligns in multiple segments (e.g., 2, 3, 4, or 5 segments), then the length of the promoter can be calculated by the 3' end position of the 3'-most segment of the reference genome or reference promoter sequence, minus the 5' end position of the 5'-most segment of reference genome or reference promoter sequence, plus 1 unless the TSS is included (such that the calculated length includes both end points). For example, the length of a promoter that extends from a base pair 100 bp before the TSS (-100 bp) to 5 bp before the TSS (-5 bp) is -5-(-100)+1=100-5+ 1=96 bp. The TSS is numbered +1 bp. Therefore, the length of a promoter that extends from a base pair 100 bp before the TSS (-100 bp) to 5 bp after the TSS (+5 bp) is +5-(-100)=100+5=105 bp.

[0102] In addition to or instead of a cardiac-specific promoter, some embodiments employ other eukaryotic promoters, including but not limited to: cytomegalovirus (CMV)immediate early, herpes simplex virus (HSY) thymidine kinase, a viral simian virus 40 (SV40) (e.g., early and late SV40), a spleen focus forming virus (SFFV) promoter, long terminal repeats (LTRs) from retrovirus (e.g., a Moloney murine leukemia virus (MoMLV) LTR promoter or a Rous sarcoma virus (RSV) LTR), a herpes simplex virus (HSY) (thymidine kinase) promoter, H5, P7.5, and Pll promoters from vaccinia virus, an elongation factor I-alpha (EFla) promoter, early growth response 1 (EGRl) promoter, a ferritin H (FerH) promoter, a ferritin L (FerL) promoter, a Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, a eukaryotic translation initiation factor 4Al (EIF4Al) promoter, a heat shock 70 kDa protein 5 (HSPA5) promoter, a heat shock protein 90 kDa beta, member 1 (HSP90B1) promoter, a heat shock protein 70 kDa (HSP70) promoter, a ^-kinesin ( ^-KIN) promoter, the human ROSA 26, a Ubiquitin C (UBC) promoter, a phosphoglycerate kinase- I (PGK) promoter, a cytomegalovirus enhancer / chicken -actin (CAG) promoter, a ^-actin promoter and a myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND) promoter, and mouse metallothionein-1. The vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The vector may also include polynucleotide sequences for amplifying expression.

[0103] In some embodiments, the vectors described herein comprise a transcription termination signal. Elements directing the efficient termination and polyadenylation of the heterologous nucleic acid transcripts increase heterologous gene expression. Transcription termination signals are generally found downstream of the polyadenylation signal. In some embodiments, vectors comprise a polyadenylation sequence 3' of a polynucleotide encoding a polypeptide to be expressed. The term "polyA site" or "polyA sequence" as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript by RNA polymerase II. Polyadenylation sequences can promote mRNA stability by addition of a polyA tail to the 3' end of the coding sequence and thus, contribute to increased translational efficiency. Cleavage and polyadenylation are directed by a poly(A) sequence in the RNA. The core poly(A) sequence for mammalian pre-mRNAs has two recognition elements flanking a cleavage- polyadenylation site. Typically, an almost invariant AAUAAA hexamer lies 20-50 nucleotides upstream of a more variable element rich in U or GU residues. Cleavage of the nascent transcript occurs between these two elements and is coupled to the addition ofup to 250 adenosines to the 5' cleavage product. In some embodiments, the core poly(A) sequence is an ideal polyA sequence (e.g., AATAAA, ATTAAA, AGTAAA). In particular embodiments, the poly(A) sequence is an SV40 polyA sequence, a bovine growth hormone polyA sequence (BGHpA), a rabbit ^-globin polyA sequence (r^gpA), variants thereof, or another suitable heterologous or endogenous polyA sequence known in the art.

[0104] Methods of Treatment

[0105] The present disclosure also provides a method of treating a heart disease in a subject, comprising administering to the subject a therapeutically effective amount of a vector, wherein the vector comprises a polynucleotide encoding a protein kinase G1 (PKG1) polypeptide and wherein the PKG1 polypeptide is expressed in a cell in the subject. In some embodiments, the cell is a heart cell. In some embodiments, the cell is a cardiomyocyte. In some embodiments, the cell is a smooth muscle cell. In some embodiments, the cell is a heart smooth muscle cell. In some embodiments, the cell is an endothelial cell. In some embodiments, the cell is a heart endothelial cell. In the disclosed method of treatment, the PKG1 can be any as described herein, the polynucleotide encoding a PKG1 can be any as described herein, and the vector can be any as described herein. The vector can be comprised within any vector genome, virion and or pharmaceutical composition described herein.

[0106] In particular embodiments, a pharmaceutical composition administered in the disclosed methods comprises an rAAV vector genome or rAAV virion as described herein, comprising a polynucleotide sequence that encodes a PKG1 polypeptide, operatively linked to a cardiac-specific promoter (e.g., a modified cTnT promoter). For example, in some embodiments, the pharmaceutical composition is an AAV9 vector comprising the modified cardiac cTnT promoter (SEQ ID NO:9) operatively linked to a polynucleotide encoding PKG1. The method may comprise, for example, transducing a target cell with a vector, an rAAV virion, or an rAAV vector genome. A target cell can be, for example and without limitation, a cardiac cell, a muscle cell, an induced pluripotent stem cell-derived cardiomyocyte (iPSC-CM), a cardiomyocyte, or a Mybpc3- / - iPSC-CM. In one aspect, the cells comprise iPSC-CMs.

[0107] As used herein, the term “heart disease” refers to a range of conditions that affect the heart including blood vessel disease, irregular heartbeats (arrythmia), congenital heart defects, diseases of the heart muscle (cardiomyopathy) and heart valve disease. In someembodiments, the heart disease is a cardiomyopathy. In other embodiments, the heart disease is a blood vessel disease. In other embodiments, the heart disease is an irregular heartbeats or an arrythmia. In other embodiments, the heart disease is a heart valve disease. In some embodiments, the heart disease includes heart failure.

[0108] As discussed above, the term "cardiomyopathy" refers to the deterioration of the function of the myocardium (i.e., the actual heart muscle) for any reason. Subjects with cardiomyopathy are often at risk of arrhythmia or sudden cardiac death or both. In some embodiments, the cardiomyopathy is a hypertrophic cardiomyopathy, a myocardial hypertrophy, a dilated cardiomyopathy, a hypertensive heart disease, or an aortic stenosis. When the cardiomyopathy is a dilated cardiomyopathy, it can include reduced LV systolic function and / or increased left ventricular dilation.

[0109] As used herein, the term "hypertrophic cardiomyopathy" or “HCM” refers to a disease of the heart and myocardium in which a portion of the myocardium is hypertrophied. As used herein, the term "familial hypertrophic cardiomyopathy" refers to a genetic disorder characterized by increased growth (i.e., hypertrophy) in thickness of the wall of the left ventricle. The term “dilated cardiomyopathy” refers to a condition where the heart becomes enlarged and weakened, causing reduced ability to pump blood effectively during systole.

[0110] Accordingly, subjects in need of treatment using the compositions and methods of the present disclosure include, but are not limited to, individuals having a congenital heart defect, individuals suffering from a degenerative muscle disease, and individuals suffering from a condition that results in ischemic heart tissue (e.g., individuals with coronary artery disease). In some examples, a method is useful to treat a degenerative muscle disease or condition (e.g., familial cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, or coronary artery disease with resultant ischemic cardiomyopathy). In some examples, a subject method is useful to treat individuals having a cardiac or cardiovascular disease or disorder, for example, cardiovascular disease, aneurysm, angina, arrhythmia, atherosclerosis, cerebrovascular accident (stroke), cerebrovascular disease, congenital heart disease, congestive heart failure, myocarditis, valve disease coronary, artery disease dilated, diastolic dysfunction, endocarditis, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF), hypertension, pulmonary hypertension,cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, coronary artery disease with resultant ischemic cardiomyopathy, mitral valve prolapse, myocardial infarction (heart attack), or venous thromboembolism. In some examples, the subject is suffering from or at risk for a cardiomyopathy.

[0111] In some embodiments, the compositions and methods disclosed herein can be used for the treatment of a cardiomyopathy in a subject. In some embodiments, the compositions and methods described herein can be used to treat a cardiomyopathy affiliated with mutations in hPKGl such as hypertrophic cardiomyopathy and familial hypertrophic cardiomyopathy. The cardiomyopathy treated by the compositions and methods described herein can be associated with a pulmonary embolus, a venous thrombosis, a myocardial infarction, a transient ischemic attack, a peripheral vascular disorder, atherosclerosis, ischemic cardiac disease and / or other myocardial injury or vascular disease. In certain embodiments, the cardiomyopathy treated by the compositions and methods described herein can include cardiac diseases associated with myocardial tissue hypercontractility, such as heart failure related to left ventricular hypercontractility.

[0112] In various embodiments, the compositions described herein contain the vectors described herein and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients can include vehicles (e.g., carriers, diluents and excipients) that are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially fieeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. Pharmaceutical forms suitable for injectable use include, e.g., sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.

[0113] In some embodiments, the pharmaceutical compositions of the disclosure are administered in a total volume of about 1 mL, 5 mL, 10 mL, about 20 mL, about 25 mL, about 30 mL, about 35 mL, about 40 mL, about 45 mL, about 50 mL, about 55 mL, about 60 mL, 65 mL, about 70 mL, about 75 mL, about 80 mL, about 85 mL, about 90 mL, about 95 mL, about 100 mL, about 105 mL, about 110 mL, about 115 mL, about 120 mL,about 125 mL, about 130 mL, about 135 mL, about 140 mL, about 145 mL, about 150 mL, about 155 mL, about 160 mL, about 165 mL, about 170 mL, about 175 mL, about 180 mL, about 185 mL, about 190 mL, about 200 mL, about 205 mL, about 210 mL, about 215 mL, or about 220 mL.

[0114] In some embodiments, the methods of the disclosure comprise administering a viral vector encoding PKG1 comprised within a virion at a dose of about lxl08viral genomes per milliliter (vg / mL), about 5xl08vg / mL, about lxl09vg / mL, about 5xl09vg / mL, about lxl010vg / mL, about 5xl010vg / mL, about lxl011vg / mL, about 2xl011vg / mL about 5xl011vg / mL, about lxl012vg / mL, about 5xl012vg / mL, about 5xl013vg / mL, about lxl014vg / mL, or about 5xl014vg / mL of the virion. Accordingly, included herein are pharmaceutical compositions that comprise about lxl08viral genomes per milliliter (vg / mL), about 5xl08vg / mL, about lxl09vg / mL, about 5xl09vg / mL, about lxl010vg / mL, about 5xl010vg / mL, about lxl011vg / mL, about 2xl011vg / mL about 5xl011vg / mL, about lxl012vg / mL, about 5xl012vg / mL, about 5xl013vg / mL, about lxl014vg / mL, or about 5xl014vg / mL of a virion comprising a viral vector encoding a PKG1 polypeptide.

[0115] Viral genome copies per milliliter can be determined by quantitative polymerase change reaction (qPCR) using a standard curve generated with a reference sample having a known concentration of the polynucleotide genome of the virus. For AAV, the reference sample used is often the transfer plasmid used in generation of the rAAV virion, but other reference samples may be used.

[0116] The vectors of the present disclosure can be administered to a subject in need thereof by systemic application, e.g., by intravenous, intra-arterial or intraperitoneal delivery of a vector. In some embodiments, a vector disclosed herein is administered systemically for treatment of hypertrophic cardiomyopathy. In some embodiments, a virion comprising a vector of the present disclosure can be delivered by direct administration to the heart tissue, e.g. by intracoronary administration, direct injection into the heart or cardiac catheterization. When direct injection is used, it may be performed either by open-heart surgery or by minimally invasive surgery. In some cases, the vector is delivered to the pericardial space by injection or infusion. All methods of administrationdisclosed herein include a vector of the present disclosure comprised within, for example, a virion.

[0117] The disclosed methods can be performed any time prior to and / or after the onset of a heart disease. In some aspects, the disclosed methods can be employed 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9,8, 7, 6, 5, 4, 3, 2, or 1 years; 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 months; 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 days; 60, 48, 36, 30, 24, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, or 2 hours prior to the onset of a heart disease; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 75, 90, 105, 120 minutes; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18, 24, 30, 36, 48, 60 hours; 3, 4, 5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 45, 60, 90 or more days; 4, 5, 6, 7, 8, 9, 10, 11, 12 or more months; 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 years after the onset of a heart disease.

[0118] Dosing frequency for vectors encoding a PKG1 polypeptide disclosed herein, includes, but is not limited to, at least once every 12 months, once every 11 months, once every 10 months, once every 9 months, once every 8 months, once every 7 months, once every 6 months, once every 5 months, once every 4 months, once every 3 months, once every two months, once every month; or at least once every three weeks, once every two weeks, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, or daily. In some embodiments, the interval between each administration is less than about 4 months, less than about 3 months, less than about 2 months, less than about a month, less than about 3 weeks, less than about 2 weeks, or less than less than about a week, such as less than about any of 6, 5, 4, 3, 2, or 1 day. In some embodiment, the dosing frequency for the T cells disclosed herein includes, but is not limited to, at least once a day, twice a day, or three times a day. In some embodiments, the interval between each administration is less than about 48 hours, 36 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 9 hours, 8 hours, or 7 hours. In some embodiments, the interval between each administration is less than about 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 9 hours, 8hours, 7 hours, or 6 hours. In some embodiments, the interval between each administration is constant. For example, the administration can be carried out daily, every two days, every three days, every four days, every five days, or weekly. Administration can also be continuous and adjusted to maintaining a level of the compound within any desired and specified range.

[0119] The vector administered to the subject can be traced by a variety of methods. For example, recombinant viruses labeled with or expressing a marker (such as green fluorescent protein, or beta-galactosidase) can readily be detected. The recombinant viruses may be engineered to cause the target cell to express a marker protein, such as a surface expressed protein or a fluorescent protein. Alteratively, the infection of target cells with recombinant viruses can be detected by their expression of a cell marker that is not expressed by the animal employed for testing (for example, a human-specific antigen when injecting cells into an experimental animal). The presence and phenotype of the target cells can be assessed by fluorescence microscopy (e.g., for green fluorescent protein, or beta-galactosidase), by immunohistochemistry (e.g., using an antibody against a human antigen), by ELISA (using an antibody against a human antigen), or by RT-PCR analysis using primers and hybridization conditions that cause amplification to be specific for RNA indicative of a cardiac phenotype.

[0120] In some embodiments, the compositions and methods described herein can induce detectable expression of a therapeutic protein or nucleic acid (e.g., PKG1 protein), or a mutant, variant, or fragment thereof, to modulate contractile function of the myocardial tissue in a subject in need thereof. In some embodiments, the amount, concentration, and volume of the composition that modulates contractile function in myocardial tissue administered to a subject can be controlled and / or optimized to substantially improve the functional parameters of the heart while mitigating adverse side effects.

[0121] The amount of the composition that modulates contractile function administered to myocardial tissue can also be an amount required to result in the detectable expression of a therapeutic protein or nucleic acid (e.g., PKG1) or a mutant, variant, or fragment thereof in the heart; preserve and / or improve contractile function; delay the emergence of cardiomyopathy or reverse the pathological course of the disease; increase myocyte viability; improve myofilament function; inhibit left ventricular hypertrophy; cardiachypertrophy regression, normalize systolic and diastolic function in heart; and restore normal cross-bridge behavior at the myofilament level.

[0122] In some embodiments, the compositions and methods disclosed herein result in detectable expression of PKG1, or a mutant, variant, or fragment thereof, in a cell of the subject being treated. In some embodiments, the cell is a heart cell. In some embodiments, the cell is a cardiomyocyte. In some embodiments, the cell is a smooth muscle cell. In some embodiments, the cell is a heart smooth muscle cell. In some embodiments, the cell is an endothelial cell. In some embodiments, the cell is a heart endothelial cell. In some embodiments, the administration of a vector described herein causes specific expression of PKG1 in the heart of the subject. In some embodiments, administration of a vector described herein causes low or undetectable expression of PKG1 in the skeletal tissue, brain, and / or liver of the subject.

[0123] "Detectable expression" typically refers to expression at least 5%, 10%, 15%, 20% or more compared to a control subject or tissue not treated with the vector. In some embodiments, detectable expression means expression at 1.5-fold, 2-fold, 2.5-fold, or 3- fold greater than a no vector control. Expression can be assessed by Western blot, as described in the example that follows, or enzyme-linked immunosorbent assay (ELISA), or other methods known in the art. In some cases, expressions are measured quantitatively using a standard curve. Standard curves can be generated using purified protein, e.g. purified PKG1, by methods described in the examples or known in the art. Alternatively, expression of the therapeutic gene product can be assessed by quantification of the corresponding mRNA.

[0124] In some embodiments, the detectable expression of the PKG1 polypeptide in a cell in the subject occurs at doses, in vector genomes (vg) per kilogram weight of subject (kg), of 3xl014vg / kg or less, 2xl014vg / kg or less, lxl014vg / kg or less, 9xl013vg / kg or less, 8xl013vg / kg or less, 7xl013vg / kg or less, 6xl013vg / kg or less, 5xl013vg / kg or less, 4xl013vg / kg or less, 3xl013vg / kg or less, 2xl013vg / kg or less, lxl013vg / kg or less, 2xl012vg / kg or less, lxl012vg / kg or less, or 2xl011vg / kg or less, lxl011vg / kg or less.

[0125] It should be understood that the foregoing relates to preferred embodiments of the present invention and that numerous changes may be made therein without departing from the scope of the invention. The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations upon the scope thereof.On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof, which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and / or the scope of the appended claims. All patents, patent applications, and publications referenced herein are incorporated by reference in their entirety for all purposes. EXAMPLES

[0126] Example 1: Methods

[0127] Human cardiomyocyte PKG1 vector validation assay: Human iPS cell derived cardiomyocytes were transduced with a AAV serotype 6 vector that contains a troponin T minimal promoter driving the expression of a N-terminal Myc tagged human PKG1 (AAV6-cTnT-Myc / hPRKG1). All groups of cardiomyocytes were transduced with 105v.g. / cell. Seven days after transduction the cardiomyocytes were exposed to vehicle or ANP. An in-situ proximity ligation assay (PLA) was then performed using primary antibodies against Myc, PIAS1, SERCA2a and SUMO1.

[0128] In vivo PKG1 vector to validate cardiomyocyte transduction: C57BL / 6J mice were injected with AAV9-cTnT-GFP or AAV9-cTnT-Myc / hPRKG1 virus (2x1011v.g. / per mouse) at 60 days of age and then euthanized at 90 days of age. IHC was performed on left ventricle tissue using an anti-cMyc antibody followed by an Alexa-Fluor 488 secondary ab and then stained with a wheat germ agglutinin (WGA) Texas red conjugate.

[0129] In vivo PKG1 vector injection to test if LV systolic function changes in a dilated cardiomyopathy murine model: 30-day old (Pre) Mybpc3- / -mice had baseline echocardiograms performed and then were injected with either AAV9-cTnT-GFP or AAV9-cTnT-Myc / hPRKG1 virus (2x1011v.g. / per mouse). At 60 days of age (Post) the mice had repeat echocardiograms performed.

[0130] In vivo PKG1 vector injection to test if LV diastolic function changes in a hypertrophic cardiomyopathy model: 60-day old wild type (WT) or Myh6WT / R404Qmice had baseline echocardiograms performed and then were injected with AAV9-cTnT- Myc / hPRKG1 virus (2x1011v.g. / per mouse). At 90 days of age the mice had repeat echocardiograms performed. (A) Ratio of peak mitral inflow velocity from left ventricular relaxation in early diastole (E wave) to peak mitral inflow velocity in late diastole causedby atrial contraction (A wave). (B) Ratio of peak mitral inflow velocity from left ventricular relaxation in early diastole (E wave) to mitral annular early diastolic velocity measured by tissue doppler (e’ wave). (C) isovolumic relaxation time (IVRT). (D) left ventricular systolic fractional shortening (FS).

[0131] Example 2: Results

[0132] Results: It has been determined that that selectively increasing cardiomyocyte PKG1 protein levels can counteract functional NP deficiency in cardiomyopathy and improves myocardial function in both heart failure with reduced ejection fraction (HFrEF) and heart failure with preserved ejection fraction (HFpEF).SEQ ID NO:15 (pAAV-cTnT-Myc / hPRKG1 as shown in Figure 1) CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGT CGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGA GAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTCTAGACAACTTTGTA TAGAAAAGTTGGGGATAAAAGCAGTCTGGGCTTTCACATGACAGCATCTGGGGC TGCGGCAGAGGGTCGGGTCCGAAGCGCTGCCTTATCAGCGTCCCCAGCCCTGGG AGGTGACAGCTGGCTGGCTTGTGTCAGCCCCTCGGGCACTCACGTATCTCCGTCC GACGGGTTTAAAATAGCAAAACTCTGAGGCCACACAATAGCTTGGGCTTATATGGG CTCCTGTGGGGGAAGGGGGAGCACGGAGGGGGCCGGGGCCGCTGCTGCCAAA ATAGCAGCTCACAAGTGTTGCATTCCTCTCTGGGCGCCGGGCACATTCCTGCTGG CTCTGCCCGCCCCGGGGTGGGCGCCGGGGGGACCTTAAAGCCTCTGCCCCCCA AGGAGCCCTTCCCAGACAGCCGCCGGCACCCACCGCTCCGTGGGACAAGTTTG TACAAAAAAGCAGGCTgccaccATGGAACAAAAACTCATCTCAGAAGAGGAT CTGGGCACCTTGCGGGATTTACAGTACGCGCTCCAGGAGAAGATCGAGGAGC TGAGGCAGCGGGATGCTCTCATCGACGAGCTGGAGCTGGAGTTGGATCAGAA GGACGAACTGATCCAGAAGCTGCAGAACGAGCTGGACAAGTACCGCTCGGT GATCCGACCAGCCACCCAGCAGGCGCAGAAGCAGAGCGCGAGCACCTTGCA GGGCGAGCCGCGCACCAAGCGGCAGGCGATCTCCGCCGAGCCCACCGCCTT CGACATCCAGGATCTCAGCCATGTGACCCTGCCCTTCTACCCCAAGAGCCCAC AGTCCAAGGATCTTATAAAGGAAGCTATCCTTGACAATGACTTTATGAAGAAC TTGGAGCTGTCGCAGATCCAGGAGATTGTGGATTGTATGTACCCGGTGGAGTA TGGCAAGGACAGTTGCATCATCAAAGAAGGAGACGTGGGGTCACTGGTGTAT GTCATGGAAGATGGTAAGGTTGAAGTTACAAAAGAAGGTGTGAAGTTGTGTA CCATGGGTCCAGGAAAAGTGTTTGGGGAATTGGCTATTCTTTACAACTGTACC CGGACAGCGACCGTCAAGACTCTTGTAAATGTAAAACTCTGGGCCATTGATC GACAATGTTTTCAAACAATAATGATGAGGACAGGACTCATCAAGCATACCGA GTATATGGAATTTTTAAAAAGCGTTCCAACATTCCAGAGCCTTCCTGAAGAGA TCCTCAGCAAGCTTGCTGATGTCCTTGAAGAGACCCACTATGAAAATGGAGA ATATATTATCAGGCAAGGTGCAAGAGGGGACACCTTCTTTATCATCAGCAAAG GAACGGTAAATGTCACTCGTGAAGACTCACCGAGTGAAGACCCAGTCTTTCT TAGAACTTTAGGAAAAGGAGACTGGTTTGGAGAGAAAGCCTTGCAGGGGGA AGATGTGAGAACAGCAAACGTAATTGCTGCAGAAGCTGTAACCTGCCTTGTG ATTGACAGAGACTCTTTTAAACATTTGATTGGAGGGCTGGATGATGTTTCTAAT AAAGCATATGAAGATGCAGAAGCTAAAGCAAAATATGAAGCTGAAGCGGCTT TCTTCGCCAACCTGAAGCTGTCTGATTTCAACATCATTGATACCCTTGGAGTT GGAGGTTTCGGACGAGTAGAACTGGTCCAGTTGAAAAGTGAAGAATCCAAA ACGTTTGCAATGAAGATTCTCAAGAAACGTCACATTGTGGACACAAGACAGC AGGAGCACATCCGCTCAGAGAAGCAGATCATGCAGGGGGCTCATTCCGATTT CATAGTGAGACTGTACAGAACATTTAAGGACAGCAAATATTTGTATATGTTGATGGAAGCTTGTCTAGGTGGAGAGCTCTGGACCATTCTCAGGGATAGAGGTTCG TTTGAAGATTCTACAACCAGATTTTACACAGCATGTGTGGTAGAAGCTTTTGC CTATCTGCATTCCAAAGGAATCATTTACAGGGACCTCAAGCCAGAAAATCTCA TCCTAGATCACCGAGGTTATGCCAAACTGGTTGATTTTGGCTTTGCAAAGAAA ATAGGATTTGGAAAGAAAACATGGACTTTTTGTGGGACTCCAGAGTATGTAGC CCCAGAGATCATCCTGAACAAAGGCCATGACATTTCAGCCGACTACTGGTCA CTGGGAATCCTAATGTATGAACTCCTGACTGGCAGCCCACCTTTCTCAGGCCC AGATCCTATGAAAACCTATAACATCATATTGAGGGGGATTGACATGATAGAATT TCCAAAGAAGATTGCCAAAAATGCTGCTAATTTAATTAAAAAACTATGCAGGG ACAATCCATCAGAAAGATTAGGGAATTTGAAAAATGGAGTAAAAGACATTCA AAAGCACAAATGGTTTGAGGGCTTTAACTGGGAAGGCTTAAGAAAAGGTACC TTGACACCTCCTATAATACCAAGTGTTGCATCACCCACAGACACAAGTAATTT TGACAGTTTCCCTGAGGACAACGATGAACCACCACCTGATGACAACTCAGGA TGGGATATAGACTTCTAAACCCAGCTTTCTTGTACAAAGTGGGAATTCGAGCA TCTTACCGCCATTTATACCCATATTTGTTCTGTTTTTCTTGATTTGGGTATACATTTAA ATGTTAATAAAACAAAATGGTGGGGCAATCATTTACATTTTTAGGGATATGTAATTACT AGTTCAGGTGTATTGCCACAAGACAAACATGTTAAGAAACTTTCCCGTTATTTACGC TCTGTTCCTGTTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGATATTC TTAACTATGTTGCTCCTTTTACGCTGTGTGGATATGCTGCTTTATAGCCTCTGTATCT AGCTATTGCTTCCCGTACGGCTTTCGTTTTCTCCTCCTTGTATAAATCCTGGTTGCT GTCTCTTTTAGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCTCT GTGTTTGCTGACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTCC TTTCTGGGACTTTCGCTTTCCCCCTCCCGATCGCCACGGCAGAACTCATCGCCGC CTGCCTTGCCCGCTGCTGGACAGGGGCTAGGTTGCTGGGCACTGATAATTCCGTG GTGTTGTCGAATTCCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTG CCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGA GTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGA GGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGGGCCGCAGGAACCCCTA GTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCT CAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTAT TTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCAT AGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGGGTGGTGGTTACGCG CAGCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCTCCTTTCGCTTTCT TCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGG GGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAA ACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTT TTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAA ACTGGAACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATT TTGCCGATTTCGGTCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACA ATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGC TGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCT GTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGA AACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTC ATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCG CGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATG AGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAG TATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTT TTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTG CACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTT CGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGC GGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATT CTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGC ATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGC CAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACA ACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGC CATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTG CGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGAC TGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCT GGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGAAGCCGCGGTATCA TTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACG GGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCT CACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATT GATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGAT AATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGA CCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGT TTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA GCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGC CACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAAT CCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGG TTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAA CGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCG AACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGA AGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGG AGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGT CCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCT CGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTA CGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTCCTGCAGGCAGTable 1. Designations shown in the above SEQ ID NO:15.^

Claims

CLAIMS 1. A method of treating a heart disease in a subject, comprising: administering to the subject a therapeutically effective amount of a vector, wherein the vector comprises a polynucleotide encoding a protein kinase G1 (PKG1) polypeptide and the PKG1 polypeptide is expressed in a cell in the subject.

2. The method of claim 1, wherein the PKG1polypeptide is a protein kinase G1 beta polypeptide (PKG1^).

3. The method of claim 2, wherein the PKG1^ polypeptide has at least 85% identity to SEQ ID NO:3, SEQ ID NO:17, or a functional fragment thereof.

4. The method of claim 2, wherein the PKG1^ polypeptide comprises SEQ ID NO:3 or SEQ ID NO:

17.

5. The method of claim 1, wherein the PKG1polypeptide is a protein kinase G1 alpha polypeptide (PKG1^).

6. The method of claim 5, wherein the PKG1^ polypeptide has at least 85% identity to SEQ ID NO:1, SEQ ID NO:19, or a functional fragment thereof.

7. The method of claim 5, wherein the PKG1^ polypeptide comprises SEQ ID NO:1 or SEQ ID NO:

19.

8. The method of any one of claims 1-7, wherein the vector further comprises a cardiomyocyte specific promoter polynucleotide and the cell is a cardiomyocyte.

9. The method of claim 8, wherein the cardiomyocyte specific promoter is a cardiac troponin T promoter (cTnT).

10. The method of claim 9, wherein the cTnT polynucleotide has at least 85% identity to SEQ ID NO:

7.

11. The method of claim 9, wherein the cTnT polynucleotide comprises SEQ ID NO:

7.

12. The method of any one of claims 1-7, wherein the vector further comprises a smooth muscle cell specific promoter polynucleotide and the cell is a smooth muscle cell.

13. The method of claim 12, wherein the smooth muscle cell specific promoter is an actinalpha 2 smooth muscle (ACTA2) promoter, a Transgelin (TAGLN) promoter, or a myosin heavy chain 11 (MYH11) promoter.

14. The method of any one of claims 1-7, wherein the vector further comprises anendothelial cell specific promoter polynucleotide and the cell is an endothelial cell.

15. The method of claim 14, wherein the endothelial cell specific promoter polynucleotidecomprises a TEK receptor tyrosine kinase (TEK) promoter, a tyrosine kinase with immunoglobulin like and EGF like domains 1 (TIE1) promoter, a FMS related receptor tyrosine kinase 1 (FLT1) promoter, a nitric oxide synthase (NOS3) promoter, a Von Willebrand Factor (VWF) promoter, or a kinase insert domain receptor (KDR) promoter.

16. The method of any one of claims 1-15, wherein the vector comprises a recombinantadenovirus associated vector (rAAV).

17. The method of claim 16, wherein the rAAV vector comprises rAAV1, rAAV2, rAAV6,rAAV7, rAAV9 or rAAV10.

18. The method of any one of claims 1-17, wherein the rAAV is an rAAV9.

19. The method of any one of claims 1-17, wherein the rAAV is an rAAV6.

20. The method of any one of claims 1-19, wherein the heart disease comprises acardiomyopathy.

21. The method of claim 20, wherein the cardiomyopathy comprises a cardiac arrhythmia, adilated cardiomyopathy, a heart failure, or a hypertrophic cardiomyopathy.

22. The method of any one of claim 1-21, wherein the heart disease comprises a heartfailure.

23. The method of any one of claims 1-22, wherein the vector is administered to the subjectby direct administration to heart tissue, intracoronary administration, intravenous administration, intraarterial administration, or intraperitoneal administration.

24. The method of any one of claims 1-23, wherein the subject is a human.

25. A recombinant viral vector for treating a heart disease in a subject, comprising:a polynucleotide sequence encoding a PKG1 polypeptide operably linked to a cardiomyocyte specific promoter polynucleotide.

26. The recombinant viral vector of claim 25, wherein the cardiomyocyte specific promoteris a troponin T promoter (cTnT).

27. The recombinant viral vector of claim 25 or claim 26, wherein the PKG1 polypeptide is aprotein kinase G1 beta polypeptide (PKG1^).

28. The recombinant viral vector of claim 27, wherein the PKG1^ polypeptide has at least85% identity to SEQ ID NO:3 or SEQ ID NO:17.

29. The recombinant viral vector of claim 27 or claim 28, wherein the PKG1^polynucleotide comprises SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:18.

30. The recombinant viral vector of claim 26 or claim 27, wherein the PKG1 polypeptide is aprotein kinase G1 alpha polypeptide (PKG1^).

31. The recombinant viral vector of claim 30, wherein the PKG1^ polypeptide has at least85% identity to SEQ ID NO:1 or SEQ ID NO:19.

32. The recombinant viral vector of claim 31, wherein the PKG1^ polypeptide comprisesSEQ ID NO:1 or SEQ ID NO:19.

33. The recombinant viral vector of claim 31 or claim 32, wherein the PKG1^polynucleotide comprises SEQ ID NO:2 or SEQ ID NO:20.

34. The recombinant viral vector of any one of claims 25-33, wherein the recombinant viralvector is an adeno-associated virus (AAV) vector.

35. The recombinant viral vector of claim 34, wherein the AAV vector comprises AAV1,AAV2, AAV6, AAV7, AAV9 or AAV10.

36. The recombinant viral vector of claim 34 or claim 35, wherein the AAV is an AAV9.

37. The recombinant viral vector of claim 34 or claim 35, wherein the AAV is an AAV6.

38. The recombinant viral vector of any one of claims 25-37, wherein the heart disease comprises a cardiomyopathy.

39. The recombinant viral vector of any one of claims 25-37, wherein the heart disease comprises a cardiac arrhythmia, a dilated cardiomyopathy, a heart failure, or a hypertrophic cardiomyopathy.

40. The recombinant viral vector of any one of claims 25-39, wherein the subject is a human.

41. The method of any one of claims 1-24 and the recombinant viral vector of any one of claims 25-40, wherein the treating is remedial.

42. The method of any one of claims 1-24 and the recombinant viral vector of any one of claims 25-40, wherein the treating is preventive.

Citation Information

Patent Citations

  • Gene vector

    US11407996B2

  • Modulating insulin receptor signaling

    WO2002055664A2

  • RNA encoding a therapeutic protein

    WO2017191274A2

  • Methods and compositions for the treatment of vascular disease

    WO2019161364A1

  • Gene therapy vectors for treating heart disease

    WO2021163357A2