Novel primer and use thereof

Abstract

A novel primer and a use thereof, relating to the technical field of nucleic acid sequence replication. The novel primer comprises: a 3p arm, a loop domain, and a 5p arm; the 3p arm comprises a 3' end and a 5' end; the 5p arm comprises a 3' end and a 5' end; the loop domain is connected to the 5' end of the 3p arm and to the 3' end of the 5p arm; the 3p arm is configured to hybridize to a DNA template, and the 5p arm is configured to hybridize to the DNA template; and when the 3p arm and the 5p arm hybridize to the DNA template, the 3' end of the 3p arm is adjacent to the 5' end of the 5p arm.

Description

A new type of primer and its application

[0001] This application claims priority to Chinese patent application No. 202311708632.9 filed on December 11, 2023, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present application relates to the field of nucleic acid sequence replication technology, and in particular to a novel primer and its application. Background Art

[0003] Single-base variations include single nucleotide polymorphisms (SNPs) and single-nucleotide variants (SNVs). SNPs are the most common and simplest form of genomic variation, with a probability of occurrence generally greater than 1% (relative to a population). On average, a SNP may occur for approximately every 1,000 nucleotides in the human genome. Some SNPs may be associated with disease, but most are not. Single nucleotide variants (SNVs) generally occur very rarely within an individual and are variations in a single nucleotide within the DNA sequence. SNVs occur in three common patterns: substitution, deletion, and insertion, and their occurrence is closely associated with diseases, such as cancer.

[0004] Currently, there are multiple methods for detecting single-base variants, including sequencing, fluorescent quantitative TaqMan probes, allele-specific amplification (AS-PCR), molecular beacon (MB), high-resolution melting (HRM), cleaved amplified polymorphic sequence (CAPS), SNaPshot, kompetitive allele-specific PCR (KASP), gene chips, and mass spectrometry. While sequencing can directly obtain nucleic acid information, other methods are designed based on known single-base variant sites. High-throughput detection of single-base variants is primarily based on next-generation sequencing (NGS), which can obtain information on a large number of SNPs in a single experiment. However, the process is complex and expensive, making it unsuitable for use with a small number of sites. Low-throughput methods, such as fluorescent quantitative TaqMan probes, AS-PCR, molecular beacons, high-resolution melting, CAPS, SNaPshot, KASP, and mass spectrometry, all have limitations in detection specificity. Technical issues

[0005] The main purpose of this application is to provide a new type of primer and its application, aiming to solve the problem of low detection specificity of current single-base variation detection technology. Technical Solutions

[0006] To achieve the above object, the present application provides a novel primer, which comprises: a 3p arm, a loop domain and a 5p arm;

[0007] The 3p arm includes a 3' end and a 5' end;

[0008] The 5p arm includes a 3' end and a 5' end;

[0009] The Loop domain connects the 5' end of the 3p arm and the 3' end of the 5p arm;

[0010] The 3p arm is used for hybridizing with the DNA template, and the 5p arm is used for hybridizing with the DNA template;

[0011] When hybridized to the DNA template, the 3' end of the 3p arm is adjacent to the 5' end of the 5p arm.

[0012] In one embodiment, the 5' end of the 5p arm further comprises a free base.

[0013] In one embodiment, after the novel primer hybridizes to the wild-type DNA template, the free base and the wild-type DNA template complement each other.

[0014] In one embodiment, a blocking modifier is introduced into the Loop domain at one end close to the 3p arm.

[0015] In one embodiment, the free base is bound to a locked nucleic acid modifier.

[0016] In one embodiment, the blocking modifier comprises C3-Spacer, Inverted dA, ddC or NH2C6.

[0017] In one embodiment, the sequence length of the 3p arm is 6-10 nucleotides.

[0018] In one embodiment, the sequence length of the 5p arm is 12-18 nucleotides.

[0019] In one embodiment, the sequence length of the Loop domain is 10-30 nucleotides in length.

[0020] In addition, to achieve the above objectives, the present application also provides a novel primer for use in single-base variation detection, and the novel primer is as described above. Beneficial effects

[0021] The novel primer provided in this application comprises a 3p arm, a loop domain and a 5p arm; the 3p arm comprises a 3' end and a 5' end; the 5p arm comprises a 3' end and a 5' end; the loop domain connects the 5' end of the 3p arm and the 3' end of the 5p arm; the 3p arm is used to hybridize with a DNA template, and the 5p arm is used to hybridize with a DNA template; when hybridized with the DNA template, the 3' end of the 3p arm is adjacent to the 5' end of the 5p arm. The 3p arm checks the correctness of the priming site and initiates the polymerase extension reaction. The 5p arm serves as an anchor for binding to the DNA template. Both the 3p arm and the 5p arm hybridize with the DNA template. The loop domain does not hybridize with the DNA template and connects the 5' end of the 3p arm and the 3' end of the 5p arm. This can increase the tension between the 3p arm and the 5p arm and the DNA template, reduce the binding force between the 3p arm and the 5p arm and the DNA template, and increase the difficulty of binding between the primer sequence after the mutation site and the DNA template, thereby increasing the specificity of the novel primer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] FIG1 is a schematic diagram of the primer morphology of the first embodiment of the novel primer of the present application binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT);

[0023] FIG2 is a graph showing a conventional PCR amplification test using the novel primers and conventional primers of the present application;

[0024] FIG3 is a graph showing the specificity test results of the first embodiment of the novel primer of the present application binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT);

[0025] FIG4 is a graph showing the specificity test results of the AS-PCR primers of the control example binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT);

[0026] FIG5 is a schematic diagram of the primer morphology of the second embodiment of the novel primer of the present application binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT);

[0027] FIG6 is a graph showing the specificity test results of the second embodiment of the novel primer of the present application binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT);

[0028] FIG7 is a schematic diagram of the primer morphology of the third embodiment of the novel primer of the present application binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT);

[0029] FIG8 is a graph showing the specificity test results of the third embodiment of the novel primer of the present application binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT);

[0030] FIG9 is a schematic diagram of the primer morphology of the fourth embodiment of the novel primer of the present application binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT);

[0031] FIG10 is a graph showing the specificity test results of the fourth embodiment of the novel primer of the present application binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT);

[0032] FIG11 is a graph showing the sensitivity test results of the single-base mutation recognition of the novel primers in the examples of the present application.

[0033] The realization of the objectives, functional features and advantages of this application will be further explained in conjunction with embodiments and with reference to the accompanying drawings. Modes for Carrying Out the Invention

[0034] It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application.

[0035] The polymerase chain reaction (PCR), a commonly used molecular diagnostic technique, has become one of the most valuable technologies in the biological sciences, diagnostics, and forensic medicine. It was first described by Kleppe and Khorana in 1971 and demonstrated in practice by Cary Mullis in 1983. The PCR method, using Taq polymerase, was first described in Science in 1985, and the first FDA-approved PCR kit was commercially available in 1993. Since then, PCR has been steadily and systematically improved, becoming a groundbreaking scientific innovation in applications ranging from forensic evidence analysis and diagnosis to disease surveillance and genetic engineering. It is undoubtedly considered one of the most important scientific advances of the 20th century.

[0036] Single-base variations include single nucleotide polymorphisms (SNPs) and single nucleotide variants (SNVs). Single nucleotide polymorphisms (SNPs) are the most common and simplest form of genomic variation, with a probability of occurrence generally greater than 1% (in a population). On average, a SNP may occur for approximately one SNP per 1,000 nucleotides in the human genome. Some SNPs may be associated with disease, but most are unlikely to be. Single nucleotide variants (SNVs) generally occur very rarely within an individual and are variations in a single nucleotide in the DNA sequence. SNPs occur in three common patterns: substitution, deletion, and insertion, and their occurrence is closely associated with diseases, such as cancer.

[0037] Currently, there are multiple methods for detecting single-base variants, including sequencing, fluorescent quantitative TaqMan probes, allele-specific amplification (AS-PCR), molecular beacon (MB), high-resolution melting (HRM), cleaved amplified polymorphic sequence (CAPS), SNaPshot, kompetitive allele-specific PCR (KASP), gene chips, and mass spectrometry. While sequencing can directly obtain nucleic acid information, other methods are designed based on known single-base variant sites. High-throughput detection of single-base variants is primarily based on next-generation sequencing (NGS), which can obtain information on a large number of SNPs in a single experiment. However, the process is complex and expensive, making it unsuitable for use with a small number of sites. Low-throughput methods, such as fluorescent quantitative TaqMan probes, AS-PCR, molecular beacons, high-resolution melting, CAPS, SNaPshot, KASP, and mass spectrometry, all have limitations in detection specificity.

[0038] The embodiments of the present application provide a novel primer. Referring to FIG1 , FIG1 is a schematic diagram of the primer morphology of the first embodiment of the novel primer of the present application binding to a mutant DNA template (KRAS c.35G>A) and a wild-type DNA template (KRAS-WT).

[0039] In Figure 1, the novel primer includes a 3p arm, a loop domain, and a 5p arm. The 3p arm includes a 3' end and a 5' end. The 3p arm can be considered the initiator of the polymerase extension reaction. The 5p arm includes a 3' end and a 5' end. The 5p arm can be considered the anchor that binds to the DNA template, anchoring the novel primer and the DNA template together. The loop domain connects the 5' end of the 3p arm and the 3' end of the 5p arm and can be used to design universal primers. The 3p arm is used to hybridize with the DNA template, and the 5p arm is used to hybridize with the DNA template, providing sequence specificity for polymerase extension in the polymerase extension reaction. The loop domain does not hybridize with the DNA template. Both the 3p arm and the 5p arm bind to the DNA template, significantly increasing the specificity of the novel primer compared to traditional primers. When hybridized with the DNA template, the 3' end of the 3p arm is adjacent to the 5' end of the 5p arm, and the Loop domain does not bind to the DNA template, which increases the tension of the 3p arm and the 5p arm binding to the DNA template, reduces the binding force between the 3p arm and the 5p arm and the DNA template, and increases the difficulty of binding between the primer sequence after the mutation site and the DNA template, thereby increasing the specificity of the new primer.

[0040] The specificity of the new primers can be determined by comparing them with mutant and wild-type templates. The wild-type template serves as a control, and the test results are compared with those of the mutant template to determine the specificity of the new primers. In this example, the 3p arm and 5p arm utilize a blocked base design. After binding to a mutant template (using the KRAS c.35G>A template as an example) and a wild-type template (using the KRAS-WT template as an example), the 3' end of the 3p arm exhibits different states. In the absence of hybridization with a DNA template, the 3' end of the 3p arm and the 5' end of the 5p arm exhibit a random, free state.

[0041] The sequence length of the 3p arm can be 6-10 nucleotides in length, for example, 6 nucleotides in length, 7 nucleotides in length, 8 nucleotides in length, 9 nucleotides in length, or 10 nucleotides in length. The sequence length of the 5p arm can be 12-18 nucleotides in length, for example, 12 nucleotides in length, 13 nucleotides in length, 14 nucleotides in length, 15 nucleotides in length, 16 nucleotides in length, 17 nucleotides in length, or 18 nucleotides in length. The sequence length of the loop domain is 10-30 nucleotides in length, for example, 10 nucleotides in length, 11 nucleotides in length, 12 nucleotides in length, 13 nucleotides in length, 14 nucleotides in length, 15 nucleotides in length, 16 nucleotides in length, 17 nucleotides in length, 18 nucleotides in length, 19 nucleotides in length, 20 nucleotides in length, 21 nucleotides in length, 22 nucleotides in length, 23 nucleotides in length, 24 nucleotides in length, 25 nucleotides in length, 26 nucleotides in length, 27 nucleotides in length, 28 nucleotides in length, 29 nucleotides in length, and 30 nucleotides in length.

[0042] Figure 2 shows a typical PCR amplification test using the novel primers and conventional primers. Nr represents a conventional primer, and Mr represents a mushroom primer provided in the examples of this application. As can be seen from Figure 2, the Mr primer exhibits better amplification specificity than the conventional primer.

[0043] Figure 3 shows the specificity test results of the novel primers of this example binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT). In Figure 3, the abscissa represents the cycle number, and the ordinate represents the fluorescence value. As can be seen, the Ct value for binding to the mutant KRAS c.35G>A template was 23.99, while the Ct value for binding to the wild-type KRAS-WT template was 36, with a difference of 12.01 between the two.

[0044] Figure 4 shows the specificity test results of AS-PCR primers binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT). As can be seen in Figure 4, the difference in Ct values ​​between the two is 8.08. In specificity testing, the greater the difference in Ct values ​​obtained when binding to mutant and wild-type templates, the higher the specificity of the primer. In practical applications, a Ct value difference of 8 between the two types cannot be used to detect low-frequency single-base variants. However, the novel primers proposed in this example achieve a Ct value difference of approximately 12 between the two types, significantly improving specificity and enabling their use in detecting low-frequency single-base variants.

[0045] In this embodiment, the novel primer includes a 3p arm, a loop domain and a 5p arm; the 3p arm includes a 3' end and a 5' end; the 5p arm includes a 3' end and a 5' end; the loop domain connects the 5' end of the 3p arm and the 3' end of the 5p arm; the 3p arm is used to hybridize with a DNA template, and the 5p arm is used to hybridize with a DNA template; when hybridizing with the DNA template, the 3' end of the 3p arm is adjacent to the 5' end of the 5p arm. The 3p arm checks the correctness of the priming site and starts the polymerase extension reaction. The 5p arm is used as an anchor for binding to the DNA template. Both the 3p arm and the 5p arm hybridize with the DNA template, increasing the specificity of the new primer to a certain extent. The Loop domain does not hybridize with the DNA template. Connecting the 5' end of the 3p arm and the 3' end of the 5p arm can increase the tension of the 3p arm and the 5p arm binding to the DNA template, reduce the binding force between the 3p arm and the 5p arm and the DNA template, and increase the difficulty of binding between the primer sequence after the mutation site and the DNA template, thereby increasing the specificity of the new primer.

[0046] In the second embodiment of the novel primer of the present application (refer to FIG5 ), FIG5 is a schematic diagram of the primer morphology of the second embodiment of the novel primer of the present application binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT).

[0047] As shown in Figure 5, based on the primer structure shown in the first embodiment, a free base G is added to the 5' end of the 5p arm. This free base can also be other bases, for example, A, C or T, which is not specifically limited in this embodiment. It binds to the KRAS c.35G>A template and the KRAS-WT template respectively.

[0048] In one embodiment, after hybridization of the novel primer with the wild-type DNA template, the free base and the wild-type DNA template complement each other. When the free base and the wild-type template complement each other, the last base of the 3p arm is released, which can inhibit amplification after mismatches and improve detection specificity. Because different genes detect different mutant bases, the specific type of free base should follow the above principles, but there are no specific limitations.

[0049] Figure 6 shows the specificity test results of the novel primers of this example binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT). In Figure 6, the abscissa represents the cycle number, and the ordinate represents the fluorescence value. It can be seen that the Ct value for binding to the mutant KRAS c.35G>A template is 24.12, while the Ct value for binding to the wild-type KRAS-WT template is 38, with a difference of 13.88. Compared to the first example described above, the specificity is further improved.

[0050] In the third embodiment of the novel primer of the present application (refer to FIG7 ), FIG7 is a schematic diagram of the primer morphology of the third embodiment of the novel primer of the present application binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT).

[0051] As shown in Figure 7, based on the primer structure shown in the second embodiment, a blocking modifier C3-Spacer is introduced into the loop domain near one end of the 3p arm. The blocking modifier can be regarded as a substance that hinders further amplification of the sequence. C3-Spacer can be used to mimic the three-carbon spacer between the 3' and 5' hydroxyl groups of ribose, or to replace an unknown base in a sequence. In addition, inverted dA, ddC (dideoxycytosine) or NH2C6 can also be introduced into the loop domain as a blocking modifier, playing a similar role as C3-Spacer. The introduction position of the blocking modifier can be 3-10 nucleotides away from the 3p arm.

[0052] Figure 8 shows the specificity test results of the novel primers of this example binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT). In Figure 8, the abscissa represents cycle number, and the ordinate represents fluorescence value. As can be seen, the Ct value for binding to the mutant KRAS c.35G>A template was 23.99, while the Ct value for binding to the wild-type KRAS-WT template was 39, a difference of 15.01. Compared to the second example described above, specificity is further improved.

[0053] In the fourth embodiment of the novel primer of the present application (refer to FIG9 ), FIG9 is a schematic diagram of the primer morphology of the fourth embodiment of the novel primer of the present application binding to the mutant template (KRAS c.35G>A) and the wild-type template (KRAS-WT).

[0054] As shown in Figure 9, based on the primer structure shown in the third embodiment, the free base G is further combined with a locked nucleic acid modifier iXNA. The locked nucleic acid modifier can increase the melting temperature of the primer or probe and enhance the stability of the substance.

[0055] Figure 10 shows the specificity test results of the novel primers of this example binding to a mutant template (KRAS c.35G>A) and a wild-type template (KRAS-WT). In Figure 10 , the abscissa represents cycle number, and the ordinate represents fluorescence value. As can be seen, the Ct value for binding to the mutant KRAS c.35G>A template was 22.95, while the Ct value for binding to the wild-type KRAS-WT template was 39, with a difference of 16.05. Compared to the third example described above, specificity is further improved.

[0056] The present application also provides an application of a novel primer in single-base mutation detection, and the novel primer used is as described in the above embodiment. Figure 11 is a graph showing the sensitivity test results of the novel primer for single-base mutation recognition, with the horizontal axis representing the cycle number and the vertical axis representing the fluorescence value. As can be seen from Figure 11, the detection limit of the novel primer reaches 0.01%, which is consistent with the detection of low-frequency single-base mutations. The primer probe sequences used in the test are shown in Table 1 below.

[0057] Table 1

[0058] ARMS-KRAS(G12D)-FATAAACTTGTGGTAGTTGGAGCTGAMr-KRAS(G12D)-F1TGGCGTAGGCAAGAGACAGCTGTCGGTGGACTTGAGGAGCTGAMr-KRAS(G 12D)-F2GTGGCGTAGGCAAGAGACAGCTGTCGGTGGACTTGAGGAGCTGAMr-KRAS(G12D)-F3GTGGCGTAGGCAAGAGACAGCTGTCGGTGGACTTGAGGAGCTGA T: C3-spacerMr-(G12D)-F4 / iXNA_G / TGGCGTAGGCAAGAGACAGCTGTCGGTGGACTTGAGGAGCTGA T: C3-spacerKRAS-RAAGAATGGTCCTGCACCAGTAATaqman Probe5'FAM-TGCCTTGACGATACAGCT-3'MGB

[0059] The experimental system is shown in Table 2 below.

[0060] Table 2

[0061] Reagents (Novozymes) Amount (μL) Buffer 4 dNTP 0.4 Taq Polymerase 0.4 F primer 0.8 R primer 0.8 TaqMan probe 0.5 DNA Template 2 H2O To 20

[0062] The experimental procedures are shown in Table 3 below.

[0063] Table 3

[0064]

[0065] The serial numbers of the above embodiments of the present application are for description only and do not represent the advantages or disadvantages of the embodiments.

[0066] The above are only some embodiments of the present application and are not intended to limit the patent scope of the present application. Any equivalent structure or equivalent process transformation made using the contents of the present application specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present application.

Claims

1. A novel primer, wherein: The novel primer comprises: a 3p arm, a loop domain and a 5p arm; The 3p arm includes a 3' end and a 5' end; The 5p arm includes a 3' end and a 5' end; The Loop domain connects the 5' end of the 3p arm and the 3' end of the 5p arm; The 3p arm is used for hybridization with a DNA template, and the 5p arm is used for hybridization with a DNA template; When hybridized to the DNA template, the 3' end of the 3p arm is adjacent to the 5' end of the 5p arm.

2. The novel primer according to claim 1, wherein The 5' end of the 5p arm also includes a free base.

3. The novel primer according to claim 2, wherein After the novel primer hybridizes with the wild-type DNA template, the free base and the wild-type DNA template complement each other.

4. The novel primer according to claim 2, wherein A blocking modifier is introduced into one end of the Loop domain close to the 3p arm.

5. The novel primer according to claim 3, wherein The free base is bound to the locked nucleic acid modifier.

6. The novel primer according to claim 3, wherein The blocking modifiers include C3-Spacer, Inverted dA, ddC or NH2C6.

7. The novel primer according to claim 1, wherein The sequence length of the 3p arm is 6-10 nucleotides.

8. The novel primer according to claim 1, wherein The sequence length of the 5p arm is 12-18 nucleotides.

9. The novel primer according to claim 1, wherein The sequence length of the Loop domain is 10-30 nucleotides.

10. Application of a novel primer in single base variation detection, wherein: The novel primer is as described in any one of claims 1 to 9.

Images