Use of MYL4 gene in treatment or prevention of atrial diseases
By expressing the MYL4 gene and its protein, the problem of lack of effective treatment methods for atrial cardiomyopathy is solved, and the effect of improving atrial structure and electrophysiological abnormalities is achieved, and fibrosis and apoptosis is reduced.
Patent Information
- Application Number
- PCT/CN2025/073507
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-13
- Filing Date
- 2025-01-21
- Publication Date
- 2025-06-19
AI Technical Summary
The prior art lacks effective treatment methods for atrial cardiomyopathy, especially atrial fibrillation and atrial tachycardia caused by changes in atrial structure and electrophysiological characteristics.
By expressing the MYL4 gene and its encoded protein, the expression level of MYL4 protein is increased using recombinant plasmids, recombinant viruses or transgenic cells to improve atrial cardiomyopathy and alleviate atrial structural and electrophysiological abnormalities.
By increasing the expression of MYL4 protein, atrial cardiomyopathy caused by various causes can be improved, atrial structure reconstruction and electrical reconstruction can be alleviated, and atrial fibrosis, apoptosis and abnormal electrical conduction can be alleviated.
Smart Images

Figure CN2025073507_19062025_PF_FP_ABST
Abstract
Description
Application of MYL4 gene in treating or preventing atrial disease Technical Field
[0001] The present invention belongs to the technical field of biomedicine and provides use of the MYL4 gene in treating or preventing atrial diseases. Background Art
[0002] Atrial cardiomyopathy is key to the development and progression of most cases of atrial fibrillation. Atrial cardiomyopathy leads to changes in atrial structure, contractility, or electrophysiological characteristics, causing atrial fibrillation and atrial tachycardia. These changes can also lead to atrial remodeling, creating a vicious cycle. In many cases, this pathology is the result of primary or secondary atrial cardiomyopathy. Effective treatments for cardiomyopathy are lacking. Although some studies have shown that cardiac myosin agonists / allosteric agents can treat dilated cardiomyopathy or hypertrophic cardiomyopathy, specific treatments for atrial cardiomyopathy remain unresolved. Summary of the Invention
[0003] In order to solve the above technical problems, the present invention provides a use of the MYL4 gene in the treatment or prevention of atrial disease. The present invention further provides the use of a protein encoded by the MYL4 gene, a recombinant plasmid expressing the MYL4 gene, a recombinant virus expressing the MYL4 gene, or a transgenic cell expressing the MYL4 gene in the preparation of a drug for the treatment or prevention of atrial disease. The MYL4 gene and its expressed protein of the present invention, or its pharmaceutically acceptable adenovirus, adeno-associated virus, or prodrug are expected to become therapeutic small molecule drugs, small nucleic acid drugs, etc. that increase the expression level of the MYL4 protein, thereby increasing the expression of the MYL4 gene and its expressed protein, thereby improving atrial myocardial lesions caused by various causes, reducing atrial structural remodeling and electrical remodeling, and reducing atrial fibrosis, apoptosis, and electrical conduction abnormalities.
[0004] The first aspect of the present invention provides a MYL4 gene, a protein encoded by the gene, a recombinant plasmid expressing the gene, a recombinant virus expressing the gene, or a transgenic cell expressing the gene for use in preparing a drug for treating or preventing atrial disease, wherein the NCBI number of the MYL4 gene is NM_002476.2.
[0005] The MYL4 gene described in the present invention is a gene encoding the essential light chain of atrial myosin.
[0006] In a preferred embodiment, the atrial disease includes myocardial infarction and / or diseases caused by left atrial appendage ligation leading to increased left atrial pressure.
[0007] The myocardial infarction described in the present invention can be understood as the myocardial infarction disease known to those skilled in the art.
[0008] Myocardial infarction described in the present invention can also be defined as a disease characterized by a sharp decrease or interruption of coronary artery blood flow, which causes severe and persistent acute ischemia of the corresponding myocardium and ultimately leads to ischemic necrosis of the myocardium.
[0009] The left atrial appendage ligation causing increased left atrial pressure described in the present invention can be understood as the left atrial appendage ligation causing increased left atrial pressure known to those skilled in the art.
[0010] The left atrial appendage (LAA) described in this invention is a narrow, curved, blind-end structure extending forward and downward along the anterior wall of the left atrium (LA). It has active contraction and secretion functions, playing a significant role in alleviating elevated LA pressure and ensuring left ventricle (LV) filling. Ligating the LAA can increase left atrial pressure.
[0011] In a preferred embodiment, the atrial disease includes abnormal atrial structural remodeling, abnormal electrical remodeling, atrial fibrosis, atrial apoptosis, abnormal electrical conduction and / or atrial cardiomyopathy.
[0012] Atrial electrical remodeling is the entire pathophysiological process in which atrial fibrillation develops from paroxysmal to persistent and then to permanent, during which the electrophysiological and ion channel characteristics of atrial muscle change, mainly including prolonged action potential duration and shortened effective refractory period, slowed intra-atrial conduction velocity, physiological maladaptation of the effective refractory period to heart rate changes, and spatial heterogeneity.
[0013] Atrial structural remodeling refers to the entire pathophysiological process of atrial fibrillation from paroxysmal to persistent and then to permanent, with the occurrence of atrial dilatation, fibrosis, and changes in cardiac ultrastructure, such as collagen deposition and increased degree of fibrosis.
[0014] Atrial fibrosis refers to the excessive proliferation of atrial fibroblasts, secretion of collagen fibers and other cellular mechanisms, excessive deposition and abnormal distribution of cardiac interstitial reconstruction, accompanied by myocardial cell necrosis, apoptosis and changes in the quality and quantity of myocardial cells.
[0015] Atrial myocyte apoptosis refers to the cell death process caused by the triggering of pre-existing death programs in atrial myocytes by internal and external factors.
[0016] Cardiac electrical conduction abnormalities are persistent or temporary impulse conduction abnormalities caused by anatomical or functional disorders. The main manifestation is conduction block, which is manifested by prolonged conduction time and partial or complete conduction interruption.
[0017] Atrial cardiomyopathy is defined as a disease that affects atrial structure, contraction, or electrophysiological characteristics, leading to clinical manifestations such as atrial remodeling and conduction abnormalities. This includes atrial fibrillation and atrial tachycardia caused by changes in atrial structure, contraction, or electrophysiological characteristics.
[0018] In a preferred embodiment, the recombinant plasmid backbone is GV138, and its element sequence is CMV-MCS-3FLAG.
[0019] In a preferred embodiment, the recombinant virus is a recombinant AAV virus or a recombinant adenovirus.
[0020] AAV, or adeno-associated virus, is the simplest non-enveloped single-stranded DNA virus discovered to date. Its genome is approximately 4.7 kilobases long and it belongs to the parvovirus family. AAV cannot replicate on its own and must rely on other viruses, such as adenoviruses, herpes viruses, and baculoviruses, for replication. Over 80% of the population carries AAV, and no AAV has been linked to any disease.
[0021] Recombinant AAV virus, also known as recombinant adeno-associated virus (Recombinant AAV), is an engineered AAV vector that has had all the Rep or Cap gene sequences encoded in the AAV genome removed, leaving only the trans-acting DNA sequences (i.e., ITRs) at both ends that serve as packaging signals.
[0022] Adenovirus is a non-enveloped particle with a diameter of 70 to 90 nm. It is composed of 252 capsomers arranged in an icosahedron. Each capsomer is 7 to 9 nm in diameter. The capsid contains a linear double-stranded DNA molecule containing approximately 30 to 47 kb, with inverted repeat sequences of approximately 100 bp at each end. Since the 5' end of each DNA chain has a relative molecular mass of 55×10 3 The protein molecules of Da are covalently bound to form a double-stranded DNA circular structure.
[0023] Recombinant adenovirus is a replication-defective adenovirus vector system widely used in gene therapy, basic life science research, and other fields. Currently, the most commonly used adenovirus vector is based on human adenovirus type 5 (Ad5), whose genome is a 36kb linear double-stranded DNA. Adenoviruses are internalized into cells by binding to receptors on the cell surface through their fibers. Adenoviruses then migrate from endosomes into the cytoplasm and nucleus, where they initiate viral replication and assembly with the help of the cell's transcription and translation machinery. A complete viral life cycle triggers cell death, releasing viral particles.
[0024] In a preferred embodiment, the recombinant adenovirus is obtained by co-transfecting an adenovirus shuttle plasmid containing the MYL4 gene and an adenovirus auxiliary packaging plasmid into HEK293 cells for packaging.
[0025] In a preferred embodiment, the auxiliary packaging plasmid is pBHG loxΔE1,3Cre.
[0026] In a preferred embodiment, the transgenic cell is a cardiomyocyte containing the recombinant plasmid or the recombinant virus.
[0027] The second aspect of the present invention protects the use of a MYL4 gene, its encoded protein, a recombinant plasmid expressing the protein, a recombinant virus expressing the protein, or a transgenic cell expressing the protein, in the preparation of a product for inhibiting arrhythmia, inhibiting increase in left atrial area, inhibiting left atrial systolic dysfunction, inhibiting Caspase-3 protein expression, inhibiting abnormal localization of myocardial gap junction protein Cx43, and / or inhibiting expression of myocardial gap junction protein Cx43, wherein the NCBI number of the MYL4 gene is NM_002476.2.
[0028] In a preferred embodiment, the atrial disease includes myocardial infarction and / or diseases caused by left atrial appendage ligation leading to increased left atrial pressure.
[0029] In a preferred embodiment, the atrial disease includes abnormal atrial structural remodeling, abnormal electrical remodeling, atrial fibrosis, atrial apoptosis, abnormal electrical conduction and / or atrial cardiomyopathy.
[0030] In a preferred embodiment, the recombinant plasmid backbone is GV138, and its element sequence is CMV-MCS-3FLAG.
[0031] In a preferred embodiment, the recombinant virus is a recombinant AAV virus or a recombinant adenovirus.
[0032] In a preferred embodiment, the recombinant adenovirus is obtained by co-transfecting an adenovirus shuttle plasmid containing the MYL4 gene and an adenovirus auxiliary packaging plasmid into HEK293 cells for packaging.
[0033] In a preferred embodiment, the auxiliary packaging plasmid is pBHG loxΔE1,3Cre.
[0034] In a preferred embodiment, the sequences shown in SEQ ID NOs: 1 and 2 are used as primers and the recombinant plasmid containing the MYL4 gene is used as a template to amplify the MYL4 gene by PCR.
[0035] In a preferred embodiment, primers as shown in SEQ ID NO: 3 and 4 are used for PCR identification and amplification of positive clones, one of the primers is located in the target gene and the other is located on the vector.
[0036] In a preferred embodiment, the AdMax adenovirus packaging system is used to construct a non-replicating recombinant adenovirus carrying the MYL4 gene by co-transfecting HEK293 cells with the adenovirus shuttle plasmid GV138 carrying the exogenous gene and the auxiliary packaging plasmid carrying most of the adenovirus genome (E1 / E3 deleted) using the Cre-loxP recombinase cutting system.
[0037] In a preferred embodiment, the transgenic cell is a cardiomyocyte containing the recombinant plasmid or the recombinant virus.
[0038] The third aspect of the present invention provides a method for inhibiting arrhythmia, inhibiting increase in left atrial area, inhibiting left atrial systolic dysfunction, inhibiting Caspase-3 protein expression, inhibiting abnormal localization of myocardial gap junction protein Cx43 and / or inhibiting decreased expression of myocardial gap junction protein Cx43 for non-therapeutic purposes, comprising the following steps: overexpressing the MYL4 gene in a cell, an animal or a human body, wherein the NCBI number of the MYL4 gene is NM_002476.2.
[0039] In a preferred embodiment, the method comprises transfecting a recombinant adenovirus or recombinant AAV virus containing the MYL4 gene into cells, or injecting a recombinant adenovirus or recombinant AAV virus containing the MYL4 gene to achieve the transfection.
[0040] A fourth aspect of the present invention provides a drug, the only active ingredient of which is a recombinant virus expressing the MYL4 gene.
[0041] Preferably, the recombinant virus is a recombinant adenovirus or a recombinant AAV virus.
[0042] More preferably, the recombinant adenovirus is obtained by co-transfecting an adenovirus shuttle plasmid containing the MYL4 gene and an adenovirus auxiliary packaging plasmid into HEK293 cells for packaging.
[0043] The present invention proposes the use of the MYL4 gene and its expressed protein in the preparation of a drug for treating or preventing atrial diseases. MYL4 and its expressed protein refer to the gene and protein encoding the essential light chain of atrial myosin.
[0044] The drug for preventing or treating atrial disease uses the MYL4 gene and its expressed protein as the sole active ingredient or therapeutic target, or further includes pharmaceutically acceptable excipients.
[0045] Among them, the dosage form of the drug for preventing or treating atrial disease includes but is not limited to oral preparations, pulmonary inhalation preparations, mucosal administration preparations, ophthalmic preparations or injections; the oral preparations are one or more of granules, powders, pills, tablets, capsules, and oral liquids.
[0046] The present invention also provides a preparation of the recombinant virus containing the MYL4 gene.
[0047] In a preferred embodiment, the recombinant virus is a recombinant AAV virus or a recombinant adenovirus.
[0048] In a preferred embodiment, the preparation further contains a pharmaceutically acceptable excipient.
[0049] The present invention also provides the use of the preparation in preparing medicines for treating or preventing atrial diseases.
[0050] The present invention also provides a pharmaceutical composition of a preparation of a recombinant virus containing the MYL4 gene.
[0051] In a preferred embodiment, one of the active ingredients of the pharmaceutical composition is a preparation of a recombinant virus containing the MYL4 gene.
[0052] In a preferred embodiment, the pharmaceutical composition further contains other drugs that have therapeutic or preventive effects on neonatal diseases.
[0053] The present invention also provides use of the pharmaceutical composition in preparing medicines for treating or preventing atrial diseases.
[0054] Among the drugs for preventing or treating atrial diseases, the MYL4 gene and its expressed protein, or its pharmaceutically acceptable adenovirus, adeno-associated virus, or prodrug are expected to become therapeutic small molecule drugs, small nucleic acid drugs, etc. that increase the expression level of the MYL4 protein, thereby increasing the expression of the MYL4 gene and its expressed protein, thereby improving atrial myocardial lesions caused by various causes, reducing atrial structural remodeling and electrical remodeling, and reducing atrial fibrosis, apoptosis and electrical conduction abnormalities.
[0055] The present invention also provides a drug for preventing or treating atrial cardiomyopathy and atrial fibrillation.
[0056] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.
[0057] The reagents and raw materials used in the present invention are commercially available.
[0058] The positive and progressive effects of the present invention are that overexpression of the MYL4 gene and its protein can improve atrial cardiomyopathy secondary to myocardial infarction and / or caused by increased left atrial pressure, reduce atrial structural and electrical remodeling, and alleviate atrial fibrosis, apoptosis, and electrical conduction abnormalities. Therefore, the MYL4 gene and its expressed protein, or a pharmaceutically acceptable adenovirus, adeno-associated virus, or prodrug thereof, have the potential to become therapeutic small molecule drugs, small nucleic acid drugs, etc. that increase MYL4 protein expression levels, thereby increasing the expression of the MYL4 gene and its expressed protein, thereby improving atrial cardiomyopathy caused by various etiologies, reducing atrial structural and electrical remodeling, and alleviating atrial fibrosis, apoptosis, and electrical conduction abnormalities. BRIEF DESCRIPTION OF THE DRAWINGS
[0059] Figure 1 shows the electrocardiogram changes after myocardial infarction in rats: the P wave and PR interval are prominent, the R wave and T wave merge into a single tall wave, and there is no distinct ST segment between the R and T waves. Based on this electrocardiogram, the myocardial infarction model was successfully established in the rats.
[0060] Figure 2 shows a photograph of a rat undergoing left atrial appendage ligation. A 4-0 non-absorbable suture was placed around the junction of the left atrial appendage and the atrium. Success was considered successful if the appendage shrank significantly and the ligature did not loosen or fall off. LAA denotes left atrial appendage, LA, left atrium, and LV, left ventricle.
[0061] Figure 3 shows transthoracic echocardiographic images of rats; Upper left: Atrial and ventricular function were measured separately in the long axis plane of the rat heart. The left ventricle, left atrium, aorta, and part of the right atrium are visible in this plane, with the apex of the heart parallel to the detection plane and pointing toward the nine o'clock direction. Ventricular function was measured at the left ventricular outflow tract, and left atrial function was measured at the mitral valve orifice, with the blood flow spectrum recorded under Doppler ultrasound; Upper right: 10 cardiac cycles were recorded under B-ultrasound, and the maximum atrial area (A) was measured at the end of maximum atrial diastole; Lower left: The probe line was placed at the mitral valve orifice to measure left atrial function, and the left atrial ejection fraction was calculated as (L1-L2) / L1*100; Lower right: The blood flow spectrum and E and A peaks were recorded at the mitral valve orifice.
[0062] Figure 4 (left): MYL4 overexpression adenoviral vector; (right): MYL4 protein level in atrial muscle tissue was significantly increased, indicating successful MYL4 delivery.
[0063] Figure 5 shows the surface electrocardiograms (ECGs) of rats in each group. Panel A shows atrial flutter with absent P waves in rats with myocardial infarction, but after MYL4 treatment, the heart rhythm returned to sinus rhythm. Panel B shows premature atrial contractions in rats with left atrial appendage constriction, but the MYL4-treated group maintained sinus rhythm with no arrhythmias. Panel C shows the ECGs of MYL4p.E11K rats, which exhibit flattened, wide, and deformed P waves and a prolonged PR interval. After MYL4 treatment, the P wave morphology of MYL4p.E11K rats was restored, showing regular, uniform P waves. These ECGs suggest that MYL4 may play a role in preventing arrhythmias and maintaining sinus rhythm in various atrial cardiomyopathies.
[0064] Figure 6 shows that MYL4 treatment improves atrial structural remodeling in various atrial cardiomyopathies. Panel A: Left atrial area significantly increased in rats with myocardial infarction. MYL4 treatment alleviated the left atrial structural changes caused by myocardial infarction. Panel B: Left atrial ejection fraction decreased and systolic dysfunction occurred in rats with myocardial infarction. MYL4 treatment improved left atrial systolic function. Panel C: MYL4 reduced the increase in atrial area caused by increased left atrial pressure. Panel D: Mitral valve Doppler ultrasound showed a loss of the A peak in rats after left atrial appendage constriction surgery, indicating loss of atrial systolic function. Left atrial mechanical function was preserved in the MYL4-treated rats. Statistical analysis was performed using a two-sided t-test. *, p < 0.05, **, p < 0.001.
[0065] Figure 7 shows that MYL4 treatment reduces atrial fibrosis in various atrial cardiomyopathy models. Panel A shows fibrotic lesions in rat atrial tissue after myocardial infarction, and MYL4 significantly reduces the occurrence of atrial fibrosis induced by myocardial infarction. Panel B shows extensive collagen deposition in rat atrial tissue after left atrial appendage constriction, and MYL4 treatment significantly improves fibrotic lesions in this disease model. Panel C shows that rats harboring the MYL4 p.E11K point mutation spontaneously develop fibrotic atrial cardiomyopathy, and this phenotype is significantly alleviated after MYL4 treatment. Statistical analysis was performed using a two-sided t-test. *, p < 0.05, **, p < 0.001.
[0066] Figure 8 shows that MYL4 treatment reduces atrial apoptosis in a model of atrial cardiomyopathy. Panel A shows a significant increase in atrial apoptosis-related protein levels in rats with myocardial infarction, and MYL4 treatment effectively inhibits atrial apoptosis. Panel B shows that MYL4p.E11K rats exhibit spontaneous atrial apoptosis, and MYL4 treatment significantly reduces apoptosis. Statistical analysis was performed using a two-sided t-test. *, p < 0.05, **, p < 0.001.
[0067] Figure 9 shows that MYL4 can treat the mislocalization of atrial ion channels and restore their protein levels in an atrial cardiomyopathy model; A: the localization of Cx43 in the atrium of rats with myocardial infarction changes from the intercalated disc to both sides of the cell membrane, and the localization of Cx43 is restored after MYL4 treatment; B: the protein level of Cx43 in the atrium of rats with myocardial infarction decreases, and the protein level increases after MYL4 treatment; C: a large amount of Cx43 is retained around the cell nucleus and in the cytoplasm after left atrial appendage constriction, and Cx43 can be correctly transported to the myocardial cells after MYL4 treatment; D: the expression level of Cx43 in the atrium is significantly reduced after left atrial appendage constriction, and MYL4 treatment can increase the expression level of Cx43 protein; E: Cx43 is localized to both sides of the cell membrane in the atrial tissue of MYL4p.E11K rats, and the localization of Cx43 is restored after MYL4 treatment; F: the expression level of Cx43 in the atrial tissue of MYL4p.E11K rats is significantly reduced compared with the protein level of wild-type rats, and the expression of Cx43 protein is partially restored after MYL4 treatment.
[0068] FIG10 is a schematic diagram of disease modeling. DETAILED DESCRIPTION
[0069] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0070] The following examples and research results can be summarized as follows:
[0071] 1. Experimental study on overexpression of MYL4 gene and its protein to improve atrial structural and electrical remodeling caused by MYL4 p.E11K, and to alleviate atrial fibrosis, apoptosis and electrical conduction abnormalities.
[0072] 2. Experimental study on how overexpression of MYL4 gene and its protein improves atrial structural and electrical remodeling secondary to myocardial infarction, and reduces atrial fibrosis, apoptosis and electrical conduction abnormalities.
[0073] 3. Experiments to show that overexpression of MYL4 gene and its protein can improve atrial structural remodeling and electrical remodeling caused by increased left atrial pressure, and reduce atrial fibrosis, apoptosis and electrical conduction abnormalities.
[0074] 1. The materials used in the following tests are as follows:
[0075] 1. Experimental subjects
[0076] SPF-qualified Sprague-Dawley rats were housed at the Tongji University Animal Center. Experiments were conducted in compliance with the Ethics Committee of the Tenth People's Hospital Affiliated to Tongji University and the Shanghai Animal Experiment Management Standards (Animal Experiment Ethics Review Number: SHDSYY-0098).
[0077] 2. Table 1 Instruments
[0078] 3. Drugs and reagents
[0079] MYL4 overexpression adenovirus (AD-MYL4 1E+10 10 μl intraatrial injection).
[0080] Negative control adenovirus (AD-Vector 1E+10 10 μl injected intraatrially).
[0081] 2. Experimental Methods and Process
[0082] The present invention has validated the therapeutic effects of MYL4 on various animal models of atrial cardiomyopathy. In vivo experiments assessed atrial electrical and mechanical function, the degree of atrial fibrosis, and apoptosis in the disease model animals. In vitro experiments evaluated improvements in electrical and mechanical function in atrial myocytes derived from the disease model animals, comprehensively evaluating the therapeutic effects of MYL4 in atrial cardiomyopathy. The specific process is shown in Figure 10.
[0083] Example 1: Construction of an animal model of atrial cardiomyopathy
[0084] 1. The specific method for constructing myocardial infarction rats is as follows:
[0085] (1) Administer analgesics once 6-8 hours before surgery. Anesthetize the rat with a mixture of 2 ml / min oxygen and 2% isoflurane. After the rat's pain reflex disappears, insert an endotracheal tube through the mouth and connect it to a small animal ventilator, providing respiratory support at a rate of 80 breaths / minute.
[0086] (2) Remove the hair on the left chest of the rat and disinfect the skin three times with skin disinfectant. Cut the chest skin horizontally along the level of one finger below the rat's armpit, bluntly separate the pectoralis major and serratus anterior muscles, expose the external intercostal muscles, and make a small incision along the upper edge of the next rib at the most obvious cardiac beat. Observe the rat for any discomfort such as shortness of breath, and insert a chest brace to prop up the ribs.
[0087] (3) Gently separate the thymus and pericardium to expose the heart. Visually observe the intersection of the left atrial appendage and the conus arteriosus, and insert the needle 2 mm below the left atrial appendage. Ligate the left anterior descending coronary artery with 6-0 non-absorbable suture. After ligation, observe that the local myocardium turns white, the apex becomes lighter, and the electrocardiogram shows ST elevation or R wave voltage decrease, which means that the ligation is successful (Figure 1).
[0088] (4) Close the chest cavity with 6-0 absorbable sutures. Gently insert a 1 ml syringe into the chest cavity and aspirate the chest cavity to negative pressure. After observing that the rat's breathing is stable and there is no bleeding in the chest cavity, suture the skin.
[0089] (5) Continue ventilation for 5-10 minutes, then remove the ventilator and place the rat on a 37°C warming blanket for 1 hour. Once the rat can move independently, return the cage to the cage rack. Administer analgesics once daily for three consecutive days after surgery.
[0090] (6) Observe the survival of rats every other day and record the results. If any rats die, perform a thoracotomy to examine the cause of death and record the cause.
[0091] 2. The specific method for constructing the left atrial appendage stenosis rat model is as follows:
[0092] (1) Administer analgesics once 6-8 hours before surgery. Anesthetize the rat with a mixture of 2 ml / min oxygen and 2% isoflurane. After the rat's pain reflex disappears, insert an endotracheal tube through the mouth and connect it to a small animal ventilator, providing respiratory support at a rate of 80 breaths / minute.
[0093] (2) Remove the hair on the left chest of the rat and disinfect the skin three times with skin disinfectant. Cut the chest skin horizontally along the level of one finger below the rat's armpit, bluntly separate the pectoralis major and serratus anterior muscles, expose the external intercostal muscles, and make a small incision along the upper edge of the next rib at the most obvious cardiac beat. Observe the rat for any discomfort such as shortness of breath, and insert a chest brace to prop up the ribs.
[0094] (3) Gently separate the thymus and pericardium to expose the heart. Push the left thymus upward to reveal the left atrial appendage. Wrap the base of the left atrial appendage with 4-0 non-absorbable sutures and completely ligate the atrial appendage opening. If the atrial appendage pulsation is reduced and the ligature does not fall off or loosen, the ligation is successful (Figure 2).
[0095] (4) Close the chest cavity with 6-0 absorbable sutures. Gently insert a 1 ml syringe into the chest cavity and aspirate the chest cavity to negative pressure. After observing that the rat's breathing is stable and there is no bleeding in the chest cavity, suture the skin.
[0096] (5) Continue ventilation for 5-10 minutes, then remove the ventilator and place the rat on a 37°C warming blanket for 1 hour. Once the rat can move independently, return the cage to the cage rack. Administer analgesics once daily for three consecutive days after surgery.
[0097] (6) Observe the survival of rats every other day and record the results. If any rats die, perform a thoracotomy to examine the cause of death and record the cause.
[0098] 3. The method for constructing MYL4 point mutation rats can be found in the invention patent "Construction of MYL4 gene editing-related atrial fibrillation and atrial cardiomyopathy rat animal model", patent number: 202010479394.9.
[0099] Example 2: Confirmation of Successful Construction of Atrial Cardiomyopathy Animal Model
[0100] The inventors evaluated the success of the model according to the definition of atrial cardiomyopathy published in ESH in 2016. This definition states: "Atrial cardiomyopathy refers to atrial electrophysiological abnormalities, mechanical contractile dysfunction, and / or structural remodeling caused by various factors." The inventors evaluated cardiac mechanical function in model rats through transthoracic echocardiography, electrical activity through surface electrocardiography, fibrosis by Masson staining of atrial tissue, and atrial apoptosis by qPCR and western blot. The specific experimental procedures are as follows:
[0101] (1) Transthoracic echocardiography in rats: Rats were anesthetized with a mixture of 2 ml / min oxygen and 2% isoflurane. After the pain reflex disappeared, the chest hair was shaved. The left ventricular ejection fraction, left atrial area, and ejection fraction were measured on the long axis of the heart. The blood flow waveform and velocity at the mitral valve were recorded (Figure 3).
[0102] (2) Rat surface electrocardiogram: Rats were anesthetized with a mixture of 2 ml / min oxygen and 2% isoflurane, and fixed on a small animal electric blanket to prevent muscle tremors caused by cold from affecting the recording. The left upper limb of the rat (on the side of the heart) was connected to the red electrode (positive electrode) of the bioelectric instrument, the right upper limb was connected to the green electrode (negative electrode), and the left lower limb was connected to the black electrode (reference electrode). When connecting the electrodes, it was necessary to avoid piercing the muscles or hair, which would interfere with the bioelectric acquisition. After the electrodes were confirmed to be correctly connected, the multi-channel physiological signal acquisition processor BL-420S biofunction experimental system was turned on, the electrocardiogram measurement parameters were set, and the rat electrocardiogram was recorded for 5 minutes after the waveform stabilized. The rat's heart rate and PR interval were measured, and the rat's heart rhythm, whether there was arrhythmia, the type of arrhythmia and the duration were recorded.
[0103] (3) Masson staining of rat atrial tissue: Paraffin sections are gradually dewaxed into distilled water, and hematoxylin is added to the sections to stain the nuclei for 5-10 minutes. The sections are placed in hydrochloric acid alcohol for differentiation for 30 seconds, and then quickly placed in running water to wash off the hydrochloric acid alcohol. Stain in Ponceau acid fuchsin solution for 5-8 minutes, and wash off the dye with distilled water. Stain in 1% phosphomolybdic acid for 1-3 minutes, and place the sections directly in aniline blue solution for 5 minutes. Observe the degree of staining under white light. If the staining effect is not good, decolorize in glacial acetic acid and then stain again. After satisfactory staining, wash off the dye with running water immediately. The stained sections are placed in a 60°C oven to dry, transparentized with xylene, and sealed.
[0104] (4) Rat atrial tissue WB: Take 20mg of rat left atrial tissue and add it to 200ul of tissue protein extract. Grind it on ice with a tissue grinder, centrifuge it at 4℃ and 12000rpm for 15min, take the supernatant and put it into a new EP tube, centrifuge it again at 4℃ and 12000rpm for 10min, and keep the supernatant. BCA protein quantification: Prepare BCA working solution according to the required amount and add it to the colorimetric plate. Use the standard protein solution in wells 1 to 6 to make a standard curve. Add 1-fold diluted protein samples to the subsequent wells, shake for 30 seconds to mix, incubate at 37℃ for 30 minutes, and measure the absorbance of each well at 562nm. Draw a standard curve with protein content (μg) as the horizontal axis and absorbance as the vertical axis to calculate the protein concentration of each sample. Prepare protein electrophoresis samples at 1μg / μl, add protein electrophoresis loading buffer, and mix thoroughly. Denature the protein in a 100℃ metal bath for 5 minutes. Collect the sample at the bottom of the EP tube by centrifugation at 4℃. Load 30 μg of protein sample into each well of a 12% SDS-PAGE gel and run electrophoresis at 80 V for 30 minutes, followed by 1.5 hours at 100 V. After 1.5 hours of constant current transfer at 200 mA, remove the PVDF membrane and block with 5% milk for 30 minutes at room temperature. Incubate with primary antibody overnight at 4°C. The next day, remove the PVDF membrane and wash three times with PBST for 10 minutes each. Incubate with secondary antibody at room temperature for 1 hour, then wash again three times with PBST for 10 minutes each. Expose the membrane to the ECL assay.
[0105] (5) Rat atrial tissue qPCR: Extraction of rat atrial tissue RNA: 30 mg of rat atrial tissue was thoroughly ground in liquid nitrogen, 1 ml of Trizol was added and pipetted, and then ground again with a tissue grinder to a homogenous solution. 200 μl of chloroform was added, and the mixture was shaken vigorously for 15 seconds and then placed at room temperature for 3 minutes to allow the RNA to be fully extracted. Centrifuge at 4°C and 12000 g for 15 minutes, and the upper transparent aqueous phase liquid was transferred to a new EP tube. Isopropanol was added in a 1:1 volume ratio of the remaining liquid, and the tube was mixed by inversion and placed at room temperature for 10 minutes. Centrifuge at 4°C and 12000 g for 10 minutes, and the liquid was gently poured off. A white precipitate was observed at the bottom or side of the tube, which was RNA. 1 ml of anhydrous ethanol was gently pipetted on the white precipitate, and centrifuged at 4°C and 7500 g for 5 minutes. The supernatant was removed and the anhydrous ethanol washing step was repeated once. The tube was opened and placed at room temperature for 15 minutes until the white precipitate was dry. 20 μl of RNase-free water was added and dissolved in a metal bath at 55°C for 10 minutes. The RNA concentration was measured by Nanodrop. RNA was reverse transcribed and then subjected to qPCR.
[0106] Example 3: Adenovirus Construction and Packaging
[0107] (1) The target gene is retrieved from the plasmid containing the target gene using PCR. The target vector is then digested with enzymes. The digestion products are recovered by electrophoresis and exchanged. The products are then transformed into competent bacterial cells. The clones that grow are first identified by colony PCR. The clones that are positive for PCR are then sequenced and analyzed for alignment. The ones that are correctly aligned are the successfully constructed target plasmids.
[0108] Genetic information
[0109] Gene name: MYL4 (NCBI ID: NM_002476);
[0110] Species: Human.
[0111] Tool carrier
[0112] Adenovirus shuttle plasmid: GV138 (purchased from Genechem). The instructions can be downloaded from the plasmid map at https: / / www.genechem.com.cn / index / supports / zaiti_info.html?id=224. The element sequence is CMV-MCS-3FLAG; the cloning site is Age I / Nhe I.
[0113] Acquisition of target gene fragments
[0114] The target gene was fished using the following primers: MYL4(4303-1)-P1 / MYL4(4303-1)-P2. The primers contain exchange pairing bases, restriction enzyme cleavage sites, and a partial sequence at the 5' end of the target gene:
[0115] MYL4(4303-1)-P1: GAGGATCCCCGGGTACCGGTCGCCACCATGGCCCCTAAGAAGCCTG (SEQ ID NO: 1);
[0116] MYL4(4303-1)-P2: TCATCCTTTGTAGTCGCTCCCAGACATGATGTGCTTC (SEQ ID NO: 2).
[0117] (2) The molar ratio of the target fragment to the vector is (3-9):1. Calculate the amount of the target fragment required, perform a ligation reaction, and exchange the PCR product into the linearized expression vector;
[0118] (3) PCR identification and amplification of positive clones:
[0119] Design primers so that one primer is located in the target gene and the other is located on the vector. Use them for colony PCR to identify transformants. The primer sequences are as follows:
[0120] MYL4(4303-1)-P3:ATGGCCCCTAAGAAGCCTG(SEQ ID NO:3)
[0121] pDC315-R: GTTCTGGATCGTCTAGCATCG (SEQ ID NO: 4)
[0122] (4) Adenovirus packaging
[0123] The inventors used the AdMax adenovirus packaging system to co-transfect HEK293 cells (ATCC, cat#CRL-1573) with the adenoviral shuttle plasmid GV138 carrying the exogenous gene and an auxiliary packaging plasmid carrying the majority of the adenoviral genome (E1 / E3 deleted). Using the Cre-loxP recombinase cleavage system, they constructed a non-replicating recombinant adenovirus carrying the MYL4 gene. This provides an effective experimental tool for in vivo transfection of the MYL4 gene and validation of MYL4's therapeutic effects on atrial cardiomyopathy. The auxiliary packaging plasmid is pBHG loxΔE1,3Cre. The pBHG loxΔE1,3Cre auxiliary packaging plasmid (Microbix, Canada) carries the majority of the adenoviral genome and the recombinase CRE gene.
[0124] Example 4, Dosage Regimen and Procedure
[0125] In the in vivo experiment, the inventors injected MYL4-overexpressing adenovirus into the atrial myocardium using a microinjector.
[0126] The following adenovirus doses were used: MYL4 overexpressing adenovirus (AD-MYL4 1E+10, 10 μl) injected intramuscularly into the atrial muscle; and negative control adenovirus (AD-Vector 1E+10, 10 μl injected intramuscularly into the atrial muscle). The animals were maintained for 21 days after injection. Atrial muscle tissue was then harvested for analysis of MYL4 protein and mRNA levels, and compared with the control group, confirming successful MYL4 overexpression in vivo.
[0127] Dosage process and regimen:
[0128] (1) Administer analgesics once 6-8 hours before surgery. Anesthetize the rat with a mixture of 2 ml / min oxygen and 2% isoflurane. After the rat's pain reflex disappears, insert an endotracheal tube through the mouth and connect it to a small animal ventilator, providing respiratory support at a ventilation rate of 80 breaths / minute.
[0129] (2) Remove the hair on the left chest of the rat and disinfect the skin three times with skin disinfectant. Cut the chest skin flush with the rat's armpit, bluntly separate the pectoralis major and serratus anterior muscles, expose the external intercostal muscles, and make a small incision along the upper edge of the next rib at the most obvious cardiac beat. Observe the rat for any discomfort such as shortness of breath, and then insert a chest brace to prop up the ribs.
[0130] (3) Gently separate the thymus and pericardium, push the left thymus upward, and expose the atrial appendage. Insert the microinjector needle slightly parallel to the atrium and inject 10 μl of MYL4-overexpressing adenovirus intramuscularly. Observe that the tissue at the injection site turns white, indicating successful administration. Retract the injector and gently press with a cotton swab to stop bleeding.
[0131] (4) Close the chest cavity with 6-0 absorbable sutures. Gently insert a 1 ml syringe into the chest cavity and aspirate the chest cavity to negative pressure. After observing that the rat's breathing is stable and there is no bleeding in the chest cavity, suture the skin.
[0132] (5) Continue ventilation for 5-10 minutes, then remove the ventilator and place the rat on a 37°C warming blanket for 1 hour. Once the rat can move independently, return the cage to the cage rack. Administer analgesics once daily for three consecutive days after surgery.
[0133] (6) Observe the survival of rats every other day and record the results. If any rats die, perform a thoracotomy to examine the cause of death and record the cause.
[0134] Example 5: Pharmacological Effect Detection
[0135] (1) WB and qPCR verified the successful delivery of MYL4 therapy: One month after intra-atrial injection of MYL4 overexpressing adenovirus, rats were anesthetized with a mixed gas of 2 ml / min oxygen and 2% isoflurane, sacrificed, and atrial muscle tissue was isolated. WB and qPCR were performed according to the above methods. Compared with the empty control group, the expression of MYL4 at both the protein and mRNA levels in the MYL4 treatment group was significantly increased, indicating that the MYL4 therapy was successfully delivered (Figure 4).
[0136] (2) Surface electrocardiogram verification of the therapeutic effect of MYL4 on arrhythmias in rats with atrial cardiomyopathy: The surface electrocardiogram acquisition method was as described above. The baseline electrocardiogram of the rats was recorded before modeling and again one month after modeling. The results were compared with those before surgery. It was found that the control group showed a variety of arrhythmias compared with the MYL4-treated group. After MYL4 treatment, the frequency of arrhythmias decreased, and the rats showed sinus rhythm (Figure 5).
[0137] (3) Transthoracic echocardiography evaluated the therapeutic effect of MYL4 on cardiac structural remodeling and mechanical function in rats with atrial cardiomyopathy: Transthoracic echocardiography was used to record the left ventricular ejection fraction (LVEF), left atrial area, and left atrial ejection fraction (LAEF) of rats before and after modeling. Comparison between the control group and the MYL4-treated group revealed that MYL4 significantly reduced left atrial remodeling and increased left atrial ejection fraction. Doppler ultrasound showed that the proportion of single peaks in mitral valve blood flow in the control group was significantly higher than that in the MYL4-treated group, suggesting that MYL4 can rescue atrial mechanical function (Figure 6).
[0138] (4) Masson staining to evaluate the therapeutic effect of MYL4 on the structural remodeling of atrial cardiomyopathy: One month after modeling, rats were anesthetized with 2 ml / min oxygen and 2% isoflurane mixed gas and sacrificed, and the left atrial tissue was retained for Masson staining (method is shown in Example 2). Five photos of each slice were taken under a light microscope in different fields of view. Image J was used to measure the fibrosis area and total area: the image was opened in Image J software, the image format was adjusted to RGB Stack, the area to be counted was selected, and adjust was selected under the image menu. The threshold function was turned on, and the red area was adjusted to cover the fibrous tissue, and the size of the fibrosis area was measured. The red area was adjusted again to cover all myocardial tissue, and the size of the overall area was measured. The comparison of the two was the percentage of atrial fibrosis. The average value of the measured values of the five fields of view represented the degree of fibrosis of one sample, and the degree of fibrosis of 4-6 rats was calculated for each group. Compared with the sham operation group, the atrial fibrosis of rats with atrial cardiomyopathy was significantly fibrotic, and the fibrosis level of the MYL4 treatment group did not change significantly after modeling, which proved that MYL4 treatment can significantly inhibit atrial fibrosis (Figure 7).
[0139] (5) WB evaluation of the improvement effect of MYL4 on the atrial apoptosis level of rats after modeling: The expression levels of key proteins related to atrial apoptosis in the control group and the MYL4 treatment group were detected by WB method. It was found that the atrial apoptosis signal was activated after modeling. After MYL4 treatment, the expression level of Caspase-3, a key protein of atrial apoptosis, was significantly reduced, and the ratio of Bcl2 to Bax was increased, indicating that MYL4 treatment has the effect of resisting atrial apoptosis (Figure 8).
[0140] (6) Fluorescence method to evaluate the therapeutic effect of MYL4 on key proteins of electrical conduction: Fresh atrial myocardial tissue was embedded in OCT, slowly immersed in liquid nitrogen for 30 seconds, and then serial frozen sections with a thickness of 5 μm were made on a -20°C constant temperature microtome. Fluorescence staining was performed as follows:
[0141] ① Using a histochemical pen, draw a circle on the section closely following the edge of the tissue block. Place the section in a humidified chamber, where all subsequent manipulations should be performed. Fix with 4% paraformaldehyde at room temperature for 10 minutes. Wash three times with PBS for 3 minutes each.
[0142] ②Permeabilize with 0.25% Triton (in PBS) at room temperature for 10 minutes, then wash three times with PBS, each time for 3 minutes.
[0143] ③ Add fluorescent section blocking solution and block at room temperature for 30 minutes.
[0144] ④ Prepare the primary antibody at a ratio of 1% BSA:antibody = 50:1, add dropwise to completely cover the tissue block, and incubate overnight at 4°C in a humidified chamber.
[0145] ⑤ After 16 hours, transfer the wet box to room temperature. After the slices return to room temperature, wash them three times with PBS for 5 minutes.
[0146] ⑥ Prepare secondary antibody at a ratio of PBS: secondary antibody = 500:1 and incubate at room temperature for 1 hour.
[0147] ⑦ Prepare DAPI buffer according to DAPI:PBS=1:2000, counterstain cell nuclei, and incubate at room temperature for 30 minutes.
[0148] ⑧Wash three times with PBS for 5 minutes. Aspirate thoroughly and add anti-fading mounting medium. Cover the tissue block with a coverslip and fix with a curing agent. Store the sections in a light-proof section box at 4°C.
[0149] The stained sections were observed and photographed under a Nikon fluorescence confocal microscope, with five different fields of view captured for each sample. The inventors found that the localization of the myocardial gap junction protein Cx43 in rats after modeling shifted from the intercalated disc to both sides of the long axis of the myocardial tissue. Cx43 mainly transmits ions between myocardial cells, thereby propagating myocardial electrical signals throughout the heart; its localization change suggests atrial conduction system disorders, which is consistent with the results of 3.4.1. After MYL4 treatment, the percentage of Cx43 localization abnormalities in the modeling group decreased significantly, suggesting that MYL4 can help Cx43 to be correctly positioned and maintain the normal atrial conduction system (Figure 9).
[0150] In summary: The inventors have successfully verified the therapeutic effect of MYL4 gene and its protein overexpression on atrial cardiomyopathy in multiple disease models, proving that MYL4 can treat and prevent atrial structural remodeling and electrical remodeling, reduce atrial fibrosis, apoptosis and electrical conduction abnormalities, provide a new treatment option for atrial cardiomyopathy, and provide new ideas for the subsequent development of atrial cardiomyopathy treatment drugs.
[0151] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. Use of the MYL4 gene, the protein encoded by it, the recombinant plasmid expressing it, the recombinant virus expressing it or the transgenic cell expressing it in the preparation of a drug for treating or preventing atrial disease, wherein: The NCBI number of the MYL4 gene is NM_002476.
2.
2. The use according to claim 1, characterized in that The atrial diseases include diseases caused by myocardial infarction and / or left atrial appendage ligation leading to increased left atrial pressure; Preferably, the atrial disease includes abnormal atrial structural remodeling, abnormal electrical remodeling, atrial fibrosis, atrial apoptosis, abnormal electrical conduction and / or atrial myocardial lesions.
3. The use according to claim 1, characterized in that The recombinant plasmid backbone is GV138, and its element sequence is CMV-MCS-3FLAG.
4. The use according to claim 1, characterized in that The recombinant virus is a recombinant AAV virus or a recombinant adenovirus; Preferably, the recombinant adenovirus is obtained by co-transfecting an adenovirus shuttle plasmid containing the MYL4 gene and an adenovirus auxiliary packaging plasmid into HEK293 cells for packaging.
5. The use according to claim 4, characterized in that The auxiliary packaging plasmid is pBHG loxΔE1,3Cre.
6. The use according to claim 1, characterized in that The transgenic cells are myocardial cells containing the recombinant plasmid or the recombinant virus.
7. Use of the MYL4 gene, the protein encoded by it, the recombinant plasmid expressing it, the recombinant virus expressing it or the transgenic cell expressing it in the preparation of a product for inhibiting arrhythmia, inhibiting the increase of left atrial area, inhibiting left atrial systolic dysfunction, inhibiting the expression of Caspase-3 protein, inhibiting the abnormal localization of myocardial gap junction protein Cx43 and / or inhibiting the expression of myocardial gap junction protein Cx43, wherein: The NCBI number of the MYL4 gene is NM_002476.
2.
8. A method for inhibiting arrhythmia, inhibiting the increase of left atrial area, inhibiting left atrial systolic dysfunction, inhibiting the expression of Caspase-3 protein, inhibiting the abnormal localization of myocardial connexin Cx43 and / or inhibiting the decrease of myocardial connexin Cx43 expression for non-therapeutic purposes, comprising the following steps: Overexpressing the MYL4 gene in a cell, an animal or a human body, wherein the NCBI number of the MYL4 gene is NM_002476.
2.
9. The method according to claim 8, characterized in that This includes transfecting a recombinant adenovirus or a recombinant AAV virus containing the MYL4 gene into cells, or injecting a recombinant adenovirus or a recombinant AAV virus containing the MYL4 gene.
10. A drug, characterized in that Its only active ingredient is a recombinant virus that expresses the MYL4 gene; Preferably, the recombinant virus is a recombinant adenovirus or a recombinant AAV virus; More preferably, the recombinant adenovirus is obtained by co-transfecting an adenovirus shuttle plasmid containing the MYL4 gene and an adenovirus auxiliary packaging plasmid into HEK293 cells for packaging.
Citation Information
Patent Citations
MYL4 genetic mutant and application thereof
CN104561015A
Atrial fibrillation / atrial cardiomyopathy rat model based on MYL4 gene editing and construction method thereof
CN111621500A
Application of MYL4 gene in treatment or prevention of atrial diseases
CN117959432A
Methods and compositions for treating mybpc3 related hypertrophic cardiomyopathy with a viral vector
WO2023108157A1
Cited By
Application of inhibitor targeting Connexin43 gene in preparation of medicine for preventing or treating myocardial fibrosis
CN120837519A