Blood and milk derived mirnas from a biological sample as indicators of stress and animal welfare
By employing miRNA biomarkers from blood and milk samples, the method effectively addresses the inefficiencies in current animal welfare assessment techniques, providing a reliable and non-invasive means to detect stress and improve dairy cattle welfare.
Patent Information
- Application Number
- PCT/EP2024/085186
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-15
- Filing Date
- 2024-12-09
- Publication Date
- 2025-06-19
AI Technical Summary
Current methods for assessing animal stress and welfare in dairy cattle are subjective and lack specific physiological markers, making them inefficient and unreliable for managing animal welfare.
The use of miRNA biomarkers, specifically bta-miR-339b-5p, bta-miR-339a-5p, and bta-miR-664b-3p, derived from exosomes in blood and milk samples, as indicators of stress and welfare parameters in cattle.
These miRNA biomarkers provide a non-invasive and reliable method to detect heat stress and other welfare compromises in dairy cattle, enabling timely interventions to improve animal welfare and productivity.
Smart Images

Figure IMGF000025_0001 
Figure IMGF000031_0001 
Figure IMGF000032_0001
Abstract
Description
[0001] BLOOD AND MILK DERIVED miRNAs FROM A BIOLOGICAL SAMPLE AS INDICATORS OF STRESS AND ANIMAL WELFARE
[0002] Technical field of the invention
[0003] This present invention relates to the use of micro-RNAs from a biological sample from a dairy cattle as indicators of animal welfare, such as indicators of stress such as heat stress.
[0004] Background of the invention
[0005] International regulatory framework proposes observations of changes in animal health status and behaviour to define if the animal(s) are stressed and to propose improvements in animal welfare management. However, a visual observation alone is subjective and does not consider specific physiological markers of stress.
[0006] Currently, different indicators are used to evaluate if an animal has or is experiencing stress conditions. These include,
[0007] - observations in changes in animal health status and behaviour, which is currently considered the reference tool to monitor and detect early warning signs in animal health and welfare deterioration;
[0008] - changes in blood parameters, such as glycemia, blood cell counts, levels of hormones and metabolites. However, these parameters are highly variable across different animal breeds, age, stage of the life. Moreover, the level of hormones such as cortisol passing in milk is too variable, and as such classical biomarkers are not suitable stress specific indicators.
[0009] By contrast, the expression of miRNA is specific to cells and tissues and well-regulated. loannidis et al. discloses associations of plasma microRNA expression with age, genetic background and functional traits in dairy cattle (SCIENTIFIC REPORTS] (2018) 8:12955).
[0010] Miretti et al. discloses microRNAs as biomarkers for animal health and welfare in Livestock (Front. Vet. Sci. 7:578193). Billa et al. discloses that nutrigenomic analyses reveal miRNAs and mRNAs affected by feed restriction in the mammary gland of midlactation dairy cows (PLoS ONE 16(4): e0248680).
[0011] Li et al. (BMC Genomics (2018) 19:975) discloses a characterization of miRNA profiles in the mammary tissue of dairy cattle in response to heat stress.
[0012] Hence, an improved method to non-invasively determine animal welfare would be advantageous, and in particular a more efficient and / or reliable method to determine animal stress, such as heat stress would be advantageous. The present invention addresses this need.
[0013] Summary of the invention
[0014] The present invention relates to miRNA biomarkers from a biological sample, e.g. exosome- derived microRNA, as indicators of welfare or a welfare parameter in cattle. In particular, the present invention relates to the identification of stress, particularly heat stress in cattle, which in turn means actions can be taken to manage and improve productive animal welfare at the individual or the herd level.
[0015] Thus, an object of the present invention relates to the provision of miRNA biomarkers - and specifically the provision of one or more of bta-miR-339b-5p, bta-miR-339a-5p and bta-miR- 664b-3p as biomarkers, which can be indicative of welfare parameters in cattle, such as stress, preferably in dairy cattle.
[0016] In particular, it is an object of the present invention to provide miRNA biomarkers obtained by a non-invasive technique - from exosomes, which can indicate heat stress in (dairy) cattle and which can be used across different breeds of (dairy) cattle.
[0017] Thus, in one aspect of the invention there is provided a method of determining at least one welfare parameter of at least one head of cattle, the method comprising i. determining in a biological sample the level of at least one miRNA that regulates the cell cycle, wherein the miRNA is selected from SEQ ID NOs: 1 , 2 or 3 or a functional variant thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO:1 , 2 or 3 respectively; and ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference level the welfare of the at least one head of cattle is or has been compromised; and wherein said biological sample is blood and / or milk.
[0018] In one embodiment, the miRNA is SEQ ID NO: 1 or a functional variant thereof, as defined herein.
[0019] In another embodiment, the miRNA is SEQ ID NO: 2 or a functional variant thereof, as defined herein.
[0020] In another embodiment, the miRNA is SEQ ID NO: 3 or a functional variant thereof, as defined herein.
[0021] In one embodiment the biological fluid is blood or blood and milk.
[0022] It has also been found that the three miRNAs in combination were particularly effective in determining welfare.
[0023] In another aspect there is provided a method of determining at least one welfare parameter of at least one head of cattle, the method comprising i. determining in a biological sample the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; and ii. comparing the level of each of the miRNAs to a reference level; wherein where the level of each miRNA is above said reference level the welfare of the at least one head of cattle is or has been compromised.
[0024] In one embodiment, the biological sample is selected from a milk sample, a blood sample, a meat sample or a urine sample. In a further embodiment, the biological sample is not milk or a milk-derived sample.
[0025] In one embodiment, said biological sample is blood sample.
[0026] In another embodiment, said biological sample is a milk sample. In a further embodiment, said biological sample comprises both a milk and a blood sample.
[0027] In another aspect of the invention, there is provided a method for improving at least one welfare parameter of at least one head of cattle, the method comprising: i. determining in a first biological sample from at least one head of cattle the level of at least one miRNA that regulates the cell cycle, wherein the miRNA is selected from SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 and 3 respectively ; ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference level the welfare of the at least one head of cattle is or has been compromised; and ill. improving the welfare of the at least one head of cattle; iv. determining in a second biological sample from the same at least one head of cattle, the level of at least one miRNA as defined in SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; and v. comparing the level of the at least one miRNA in the first biological sample to the level of the at least one miRNA in the second biological sample, wherein if the level in the second biological sample is lower than the level in the first biological sample or lower than the level in the reference sample the welfare of the head of cattle has improved; and wherein the first and / or second biological fluid is blood and / or milk.
[0028] In one embodiment the biological fluid is blood or blood and milk.
[0029] In one embodiment, the miRNA is SEQ ID NO: 1 or a functional variant thereof, as defined herein.
[0030] In another embodiment, the miRNA is SEQ ID NO: 2 or a functional variant thereof, as defined herein. In another embodiment, the miRNA is SEQ ID NO: 3 or a functional variant thereof, as defined herein.
[0031] In another embodiment, the method comprises determining the level of two miRNAs selected from SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 1 and SEQ ID NO: 3 or SEQ ID NO: 2 and SEQ ID NO: 3. In another embodiment, the method comprises determining the level of three miRNAs selected from SEQ ID NOs: 1 , 2 and 3.
[0032] In a further aspect of the invention there is provided a method for improving at least one welfare parameter of at least one head of cattle, the method comprising: i. determining in a first biological sample from at least one head of cattle the level of at least one miRNA, wherein the miRNA is selected from SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 and 3 respectively; ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference the welfare of the at least one head of cattle is or has been compromised; ill. improving the welfare of the at least one head of cattle; iv. determining in a second biological sample from the same at least one head of cattle, the level of at least one miRNA as defined in SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 and 3 respectively; and v. comparing the level in the first biological sample to the level in the second biological sample, wherein if the level in the second biological sample is lower than the level in the first biological sample or lower than the level in the reference sample the welfare of the head of cattle has improved; and wherein the first biological fluid is milk and the second biological fluid is blood or wherein the first biological fluid is blood and the second biological fluid is milk.
[0033] In another aspect of the invention there is provided a method for improving at least one welfare parameter of at least one head of cattle, the method comprising: i. determining in a first biological sample the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; ii. comparing the level of the three miRNAs to a reference level; wherein where the level of the at least one miRNA is above said reference level, the welfare of the at least one head of cattle is or has been compromised; ill. improving the welfare of the at least one head of cattle; iv. determining in a second biological sample from the same at least one head of cattle, the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; and v. comparing the level of the three miRNAs in the first biological sample to the level of the three miRNAs in the second biological sample, wherein if the level of all three miRNAs in the second biological sample is lower than the level of all three miRNAs in the first biological sample or lower than the level in the reference sample the welfare of the head of cattle has improved.
[0034] In one embodiment, the biological sample is selected from a milk sample, a blood sample, a meat sample or a urine sample. In a further embodiment, the biological sample is not milk or a milk-derived sample.
[0035] In one embodiment, said biological sample is blood sample.
[0036] In another embodiment, said biological sample is a milk sample.
[0037] In a further embodiment, said biological sample comprises both a milk and a blood sample.
[0038] Improving the welfare of the at least one head of cattle may comprise one or more of changing heat exposure, improving access to additional water, changing the feed, reducing animal density and the provision of cooling systems.
[0039] In another aspect of the invention, there is provided a method of improving at least one milk yield, milk quality, meat yield, meat quality from at least one head of cattle, the method comprising i. determining in a biological sample from the at least one head of cattle, the level of at least one miRNA as defined in SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 and 3 respectively; ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference the welfare of the at least one head of cattle is or has been compromised; and ill. improving the welfare of the at least one head of cattle; wherein improving the welfare of the at least one head of cattle improves at least one of milk yield, milk quality, meat yield and meat quality; and wherein said biological sample is blood and / or milk.
[0040] In one embodiment the biological fluid is blood or blood and milk.
[0041] In one embodiment, the miRNA is SEQ ID NO: 1 or a functional variant thereof, as defined herein.
[0042] In another embodiment, the miRNA is SEQ ID NO: 2 or a functional variant thereof, as defined herein.
[0043] In another embodiment, the miRNA is SEQ ID NO: 3 or a functional variant thereof, as defined herein.
[0044] In another aspect of the invention there is provided a method of improving at least one milk yield, milk quality, meat yield, meat quality from at least one head of cattle, the method comprising i. determining in a biological sample the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; ii. comparing the level of the three miRNAs to a reference level; wherein where the level of each of the three miRNAs are above said reference level the welfare of the at least one head of cattle is or has been compromised; and ill. improving the welfare of the at least one head of cattle; wherein improving the welfare of the at least one head of cattle improves at least one of milk yield, milk quality, meat yield and meat quality.
[0045] In one embodiment, the biological sample is selected from a milk sample, a blood sample, a meat sample or a urine sample. In a further embodiment, the biological sample is not milk or a milk-derived sample.
[0046] In one embodiment, said biological sample is blood sample.
[0047] In another embodiment, said biological sample is a milk sample.
[0048] In a further embodiment, said biological sample comprises both a milk and a blood sample.
[0049] In one embodiment, the method comprises determining the level of at least two miRNAs, wherein the at least two miRNAs are selected from SEQ ID NOs 1 and 2 or SEQ ID NOs 2 and 3 or SEQ ID NOs 1 and 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively.
[0050] In one embodiment, the welfare parameter of at least one head of cattle may be or is comprised by at least one type of stress, examples of which include but are not limited to heat stress, social stress, metabolic stress, disease stress or combinations thereof. In one embodiment, the stress is heat stress. In an alternative embodiment the stress is social stress.
[0051] In one embodiment, the cattle is dairy cattle, preferably bovine. In another embodiment, the breed of cattle is selected from Holstein and / or Brown Swiss.
[0052] The method according to any preceding claim, wherein the cattle is dairy cattle, wherein preferably the dairy cattle is bovine.
[0053] In one embodiment, the biological sample is from a herd of cattle.
[0054] In another aspect of the invention, there is provided a method of determining at least one welfare parameter of at least one head of cattle, the method comprising determining the level of at least one miRNA, wherein the miRNA is selected from 1 , 2 or 3 or a functional variant thereof, wherein said functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 or 3 respectively; wherein when the level of SEQ ID NO: 1 , 2 or 3 or a functional variant thereof is increased by 1 log2FC (1 log fold change) or more compared to a reference level at least one welfare parameter of the at least one head of cattle has been or is not compromised. Alternatively, the at least one miRNA is increased by at least 5 to 70%, preferably 5 to 50%, more preferably 5 to 30% compared to the reference level.
[0055] The reference level may be the level of the one or more miRNAs in a biological sample from at least one head of cattle where the welfare of the head of cattle is not or has not been compromised or wherein the reference level is an average level from cattle where the welfare of the cattle is not or has not been compromised, as discussed below.
[0056] The method may further comprise determining in a biological sample from said head of cattle, the level of a physiological parameter, wherein the physiological parameter may be selected from one or more of heat shock protein 70, a serum protein profile, blood urea nitrogen, blood uric acid, serum chloride, serum phosphorous, serum triglyceride and serum magnesium.
[0057] In one embodiment the method comprises determining the level of heat shock protein 70 in a biological sample from said head of cattle, comparing said level to corresponding reference level of heat shock protein 70 (a reference level is defined herein), wherein where the level of heat shock protein 70 is increased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0058] In one embodiment the method comprises determining the serum protein profile in a biological sample from said head of cattle, comparing said level to corresponding reference serum protein profile (a reference level is defined herein), wherein if total proteins are increased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0059] In one embodiment the method comprises determining the level of blood urea nitrogen in a biological sample from said head of cattle, comparing said level to corresponding reference level of blood urea nitrogen (a reference level is defined herein), wherein where the level of blood urea nitrogen is increased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0060] In one embodiment the method comprises determining the level of the blood uric acid in a biological sample from said head of cattle, comparing said level to corresponding reference level of the blood uric acid (a reference level is defined herein), wherein where the level of the blood uric acid is decreased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0061] In one embodiment the method comprises determining the level of serum chloride in a biological sample from said head of cattle, comparing said level to corresponding reference level of serum chloride (a reference level is defined herein), wherein where the level of serum chloride is increased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0062] In one embodiment the method comprises determining the level of serum phosphorous in a biological sample from said head of cattle, comparing said level to corresponding reference level of serum phosphorous (a reference level is defined herein), wherein where the level of serum phosphorous is increased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0063] In one embodiment the method comprises determining the level of serum magnesium in a biological sample from said head of cattle, comparing said level to corresponding reference level of serum magnesium (a reference level is defined herein), wherein where the level of serum magnesium is decreased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0064] In one embodiment the method comprises determining the level of serum triglyceride in a biological sample from said head of cattle, comparing said level to corresponding reference level of serum triglyceride (a reference level is defined herein), wherein where the level of triglyceride is decreased compared to the reference level it is indicative that at least one welfare parameter (i.e. the welfare) of the at least one head of cattle has been compromised.
[0065] In another aspect of the invention, there is provided a device or system adapted to determine if at least one welfare parameter of at least one head of cattle has been or is compromised, the device comprising: a unit able to determine the level of one or more miRNAs as defined in SEQ ID NO: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively;
[0066] - a processor configured with a reference table;
[0067] - wherein the device or system is adapted to
[0068] - receive the biological sample;
[0069] - determine the levels of the one or more miRNAs;
[0070] - compare the determined levels of the one or more miRNAs to the reference table; and
[0071] - determine if the welfare of the at least one head of cattle has been or is compromised.
[0072] In another aspect of the invention, there is provided a computer implemented method of determining if the welfare of at least one head of cattle has been compromised, the method comprising: providing levels of one or more miRNAs as defined in SEQ ID NO: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively from a cattle biological sample; providing a mathematical model comprising reference levels of one or more corresponding miRNAs;
[0073] - determining if the provided levels deviates significantly from the reference levels, using the mathematical model; and
[0074] - providing to a system or a user a determination of whether the welfare of the at least one head of cattle has been or is compromised. li In one embodiment, the biological sample is selected from a blood sample, a meat sample or a urine sample. In a further embodiment, the biological sample is not milk or a milk- derived sample.
[0075] In another aspect of the invention, there is provided a kit for evaluating at least one welfare parameter of at least one head of cattle comprising the device of the invention and instructions for use.
[0076] The present invention will now be described in more detail in the following passages.
[0077] Brief Description of the Figures
[0078] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings.
[0079] Figure 1 shows the experimental design of the trial.
[0080] Figure 2 shows a box plot of miRNAs in HS compared with TC cows. Significance was declared at P<0.05 (*) and P< 0.01 (**). Black lines inside the boxes mark the medians and the red crosses the means. Whiskers indicate variability outside the upper and lower quartiles.
[0081] Figure 3 shows receiver-operator characteristic (ROC) curve analysis of DE-miRNAs. AUC, area under the curve.
[0082] Figure 4 shows the average expression of three DE-miRNAs in blood EVs. (A) Weighted average relative quantification (RQ) values of three - bta-miR-339a-5p, bta-miR-339b-5p, and bta-miR-664b-3p -DE-miRNAs. (B) ROC curve analysis, constructed using the logit model, three - bta-miR-339a-5p, bta-miR-339b-5p, and bta-miR-664b-3p -DE-miRNAs. AUC, area under the curve. Black lines inside the boxes mark the medians and the red crosses the means. *** P< 0.001 . Detailed description of the invention
[0083] Definitions
[0084] Prior to discussing the present invention in further details, the following terms and conventions will first be defined:
[0085] Head of cattle
[0086] At least one head of cattle refers to one animal of unspecified age or gender.
[0087] Dairy cattle
[0088] Dairy cattle (also called dairy cows) are cattle bred for the ability to produce large quantities of milk, from which dairy products are made. Dairy cattle generally are of the species Bos Taurus.
[0089] Functional Variant
[0090] The term ‘variant’ or ‘functional variant’ refers to a miRNA sequence where the nucleotides of the miRNA are substantially identical to one of the recited sequences. The variant may be achieved by modifications such as insertion, substitution or deletion of one or more nucleotides. In a preferred embodiment, the variant has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to any one of the recited sequences, such as SEQ ID NOs 1 , 2 and 3, preferably over the full length of the sequence. In one embodiment, sequence identity is at least 90%. In another embodiment, sequence identity is 100%. Sequence identity can be determined by any one known sequence alignment program in the art. For the avoidance of doubt, a functional variant performs the same function as the non-variant sequence. For example, a functional variant of an miRNA that regulates the cell cycle also regulates the cell cycle in the same way as the non-variant sequence.
[0091] Increase
[0092] In the context of the present invention an increase is an increase in the level of a miRNA by up to or more than 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to the reference level. Alternatively, an increase as used herein is an increase by up to or at least 1 log2FC, 1.5log2FC, 2log2FC, 3log2FC, 4log2FC, 5log2FC, 6log2FC, 7log2FC 8log2FC, 9log2FC, 10log2FC or more compared to the reference level. Decrease
[0093] In the context of the present invention a decrease is a decrease in the level of an miRNA by up to or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 or 95% compared to the reference level. Alternatively, as used herein a decrease is a decrease by up to or at least -1 log2FC, -1.5log2FC, -2log2FC, -3log2FC, - 4log2FC, -5log2FC, -6log2FC, -7log2FC, -8log2FC, -9log2FC, -10log2FC or more compared to the reference level.
[0094] Log2FC
[0095] Log2FC stands for Iog2 fold change, which is a statistical measure used to quantify the change in expression of a nucleic acid between two conditions. The fold change is simply the ratio of the expression levels of the nucleic acid in the two conditions and the Iog2 transformation is used to normalise the data for interpretation. A log2FC of 1 indicates that the expression of a miNA has doubled, while a log2FC of 2 indicates that the expression of a miRNA has quadrupled. The log2FC is used to identify miRNAs that are differentially expressed under different conditions.
[0096] Welfare
[0097] Welfare is a broad term, which includes the many elements that contribute to an animal's quality of life, including those referred to in the ’five freedoms’:
[0098] I. freedom from hunger, thirst and malnutrition;
[0099] II. freedom from fear and distress;
[0100] III. freedom from physical and thermal (heat) discomfort;
[0101] IV. freedom from pain, injury and disease; and
[0102] V. freedom to express normal patterns of behaviour.
[0103] If one of those five freedoms (“welfare parameters”) are not fulfilled, a freedom or welfare parameter is or has been considered to be compromised. For example, if an animal is exposed to heat stress, said parameter is considered to be compromised. Thus, in the present context, the term “compromised welfare parameter” refers to one of these five freedoms not being fulfilled for the animal or herd of animals. By “has been comprised” may mean that the welfare was comprised in an animal. The phrasing “at least one welfare parameter” and “welfare” may be used interchangeably. When a welfare parameter is compromised, it means that the animal is not receiving the level of welfare they should be. Welfare parameters include but are not limited to nutritional welfare, physical welfare, behavioural welfare and environmental welfare. Action can then be taken to improve the welfare of the animal or animals.
[0104] Animal welfare means the physical and mental state of an animal in relation to the conditions in which it lives and dies. An animal experiences good welfare if the animal is healthy, comfortable, well nourished, safe, is not suffering from unpleasant states such as pain, fear and distress (such as heat stress), and is able to express behaviours that are important for its physical and mental state.
[0105] Some measures of animal welfare involve assessing the degree of impaired functioning associated with injury, disease and malnutrition. Other measures provide information on animals' needs and affective states such as hunger, pain and fear, often by measuring the strength of animals' preferences, motivations and aversions. Others assess the physiological, behavioural and immunological changes or effects that animals show in response to various challenges.
[0106] Such measures can lead to criteria and indicators that help to evaluate how different methods of managing animals influence their welfare.
[0107] Many aspects of the environment can impact the welfare of animals. The risk of heat stress for cattle is influenced by environmental factors including air temperature, relative humidity, wind speed, animal density (area and volume available per animal), shade availability, animal factors including breed, age, body condition, metabolic rate and stage of lactation, and coat colour and density.
[0108] In a preferred embodiment, compromised welfare is determined as cattle being exposed to heat stress. Heat stress may be defined by the “temperature-humidity index (THI)”.
[0109] Temperature-humidity index (TH!)
[0110] The temperature-humidity index (THI) is a single value representing the combined effects of air temperature and humidity associated with the level of thermal stress. This index has been developed as a weather safety index to monitor and reduce heat-stress-related losses. Different animal species and humans have different sensitivities to ambient temperature and the amount of moisture in the air. During hot and humid weather the natural capability of cattle to dissipate heat load by sweating and panting is compromised and heat stress occurs. At THI values of 75 to 78, the animal organism is under heat stress, but the mechanisms of thermoregulation still manage to cope, while at THI over 78 it is assumed that the stress is so high that it is impossible to maintain the thermoregulatory mechanisms or normal body temperature.
[0111] Thus, in an embodiment, heat stress is defined as the cattle has been exposed to a THI of 75 or above, preferably 76 or above, such as in the range 75-78 or 76-78.
[0112] In a preferred embodiment, compromised welfare is determined as cattle being exposed to social stress. The most common social stressors in cattle are maternal separation and weaning, social isolation and mixing and cattle overstocking.
[0113] Maternal separation and weaning:
[0114] In 5 to 6 month old calves, abrupt maternal separation produces: Psychological stress of breaking the maternal bond; and / or Nutritional changes associated with their changed diet
[0115] This separation results in behavioural changes in cattle, both calves and cows that may persist for several days and cause a more chronic form of social stress.
[0116] Their vocalisation and ambulation activity may increase, and this may persist at elevated levels for at least three days.
[0117] Mixing and social isolation:
[0118] Cattle are herd animals that establish social orders with dominant and submissive animals within each group. Factors that cause social stress include competition for resources, stocking density, group size, group composition, especially commingling of primiparous and multiparous cows.
[0119] Introducing a single animal to an established group produces acute behavioural and biological responses, including:
[0120] Reduced epithelial cell tight junctions
[0121] Altered response to infection Increased fear response
[0122] Altered heart rate
[0123] Decreased milk production
[0124] Overstocking
[0125] Many studies document the effects of short-term overstocking on cow behaviour. Cattle overstocking can affect the lying and standing behaviour of dairy cattle because competition for stalls is increased, causing a reduction of lying time and a higher standing time outside the stalls. Reducing the feeding space per cow increases competition for feed, causing aggressiveness. Cows can vary their feeding rate in response to increased stocking pressure, and social mixing can lead to a decrease in time the cows spend feeding.
[0126] MicroRNA (miRNA)
[0127] MicroRNA (miRNA) are small, single-stranded, non-coding RNA molecules containing around 21 to 23 nucleotides.
[0128] The level of any given miRNA can be measured using techniques known in the art, such techniques include but are not limited to northern blot, microarray assays, RT-PCR, RNA- SEQ and miRNA-SEQ. These are standard assays in the art.
[0129] Exosomes
[0130] Exosomes are membrane-bound extracellular vesicles (EVs) that are produced in the endosomal compartment of most eukaryotic cells. In the present context the terms “exosome”, “extracellular vesicle” and “EV” are used interchangeably.
[0131] Reference level
[0132] In the context of the present invention, the term "reference level" relates to a standard in relation to a quantity, which other values or characteristics can be compared to.
[0133] Reference levels can be selected in different ways, known to the person skilled in the art. In an embodiment, said reference level is the level of the one or more miRNA’s in a biological sample from a cattle having normal welfare or an average level from several cattle having normal welfare. Preferably from dairy cattle. In another embodiment, said reference level is the level of the one or more miRNA’s in a biological sample from a (dairy) cattle, which is not or has not been exposed to heat stress or an average level from several (dairy) cattle not exposed to heat stress.
[0134] In one embodiment of the present invention, it is possible to determine a reference level by investigating the abundance of one or more of the biomarkers according to the invention in biological samples from (dairy) cattle, which are considered to have normal welfare (i.e. not subject to one or more of the forms of stress discussed herein). By applying different statistical means, such as multivariate analysis, one or more reference levels can be calculated.
[0135] Based on these results a cut-off may be obtained that shows the relationship between the level(s) detected and (dairy) cattle considered at risk of not having normal welfare. The cutoff can thereby be used to determine the amount of the one or more biomarkers, which corresponds to, for instance, an increased risk of the cattle not having normal welfare.
[0136] The cut-off level could be established using a number of methods, including: multivariate statistical tests (such as partial least squares discriminant analysis (PLS-DA), random forest, support vector machine, etc.), percentiles, mean plus or minus standard deviation(s); median value; fold changes.
[0137] The multivariate discriminant analysis and other risk assessments can be performed on the free or commercially available computer statistical packages (SAS, SPSS, Matlab, R, etc.) or other statistical software packages or screening software known to those skilled in the art.
[0138] As obvious to one skilled in the art, in any of the embodiments discussed above, changing the risk cut-off level could change the results of the discriminant analysis for each sample tested.
[0139] Statistics enables evaluation of the significance of each biomarker level. Commonly used statistical tests applied to a data set include t-test, f-test or even more advanced tests and methods of comparing data. Using such a test or method enables the determination of whether two or more samples are significantly different or not. The significance may be determined by the standard statistical methodology known by the person skilled in the art.
[0140] The chosen reference level may be changed depending on the specific sample for which the test is applied.
[0141] The chosen reference level may be changed if desired to give a different specificity or sensitivity as known in the art. Sensitivity and specificity are widely used statistics to describe and quantify how good and reliable a biomarker or a diagnostic test is. Sensitivity evaluates how good a biomarker or a diagnostic test is at detecting a disease or state of health, while specificity estimates how likely the tested cattle or group of cattle (i.e. control, cattle having normal welfare) can be correctly identified as having normal welfare.
[0142] Several terms are used along with the description of sensitivity and specificity; true positives (TP), true negatives (TN), false negatives (FN) and false positives (FP). If a compromised welfare is proven to be present in cattle with compromised welfare, the result of the test is considered to be TP. If compromised welfare is not present in the cattle (i.e. control, without disease), and the test confirms the absence of compromised welfare, the test result is TN. If the test indicates the presence of compromised welfare in cattle with no such compromised welfare, the test result is FP. Finally, if the test indicates no presence of compromised welfare in cattle with compromised welfare, the test result is FN.
[0143] Sensitivity
[0144] Sensitivity = TP / (TP + FN) = number of true positive assessments / number of all samples from cattle with compromised welfare.
[0145] As used herein the sensitivity refers to the measures of the proportion of actual positives which are correctly identified as such - in analogy with a diagnostic test, i.e. the percentage of cattle having welfare below normal who are identified as having welfare below normal.
[0146] Specificity
[0147] Specificity= TN / (TN+ FP) = number of true negative assessments / number of all samples from controls.
[0148] As used herein the specificity refers to measures of the proportion of negatives, which are correctly identified - i.e. the percentage of cattle having welfare at a normal level who are identified as having welfare at a normal level. The relationship between both sensitivity and specificity can be assessed by the ROC curve. This graphical representation helps to decide the optimal model through determining the best threshold or cut-off for a test or a biomarker candidate.
[0149] As will be generally understood by those skilled in the art, methods for screening are processes of decision-making and therefore the chosen specificity and sensitivity depend on what is considered to be the optimal outcome by a given animal handler / farmer / personnel or buyer of the milk from the cattle or dairy products in question.
[0150] It would be obvious for a person skilled in the art that it may be advantageous to select a higher sensitivity at the expense of lower specificity in most cases, to identify as many patients with disease as possible.
[0151] In a preferred embodiment, the invention relates to a method with a high specificity, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as 100%.
[0152] In another preferred embodiment, the invention relates to a method with a high sensitivity, such as at least 80%, such as at least 90%, such as 100%.
[0153] In a preferred embodiment, compromised welfare is determined as cattle being exposed to heat stress.
[0154] Welfare
[0155] Different welfare parameters may be evaluated using the method of the invention. Thus, in an embodiment, the at least one compromised welfare parameter is caused by a parameter selected from the group consisting of heat stress, social stress, metabolic stress, disease stress, and combinations thereof, preferably the parameter is heat stress. In e.g. example 1 , miRNA biomarkers in relation to heat stress have been identified.
[0156] Thus, in a preferred embodiment, the compromised welfare parameter is caused by heat stress.
[0157] Cattle Different kind of cattle may be evaluated using the method of the invention. Hence, in an embodiment, the cattle is dairy cattle. In a related embodiment, the cattle is bovine, such as Bos taurus, more preferably bovine dairy cattle.
[0158] The method of the invention may be used on a single cattle or group or herd of cattle. Thus, in an embodiment, said cattle is an individual cattle (a “head of cattle” as referred to herein) or a herd of cattle, preferably a herd of cattle.
[0159] In a related embodiment, said biological sample is from a single cattle or a mixed biological sample from a herd of cattle.
[0160] As also outlined in the example section, the Applicant has identified a number of biomarkers that can be used irrespective of the breed. However, in an embodiment the cattle is of the breed Brown Swiss and / or Holstein.
[0161] Milk sample
[0162] Different types of milk samples can be used in the method of the invention. Thus, in an embodiment, the milk sample is in the form of raw milk, skimmed milk, milk powder, or a food product or food ingredient comprising milk, dairy-containing products, such as an infant formula, cheese or yoghurt or being derived from such food product or food ingredient.
[0163] If the milk sample is a mixed sample from several individual milk samples, it can also be considered “bulk milk”.
[0164] In an embodiment, the level of miRNA, is the level of miRNA in milk-derived exosomes. In example 1 , the level of miRNA has been determined from milk-derived exosomes.
[0165] In a preferred embodiment the miRNA is derived from a milk-derived exosome that expresses CD9 and / or TSG101 .
[0166] Blood sample
[0167] As outlined in the examples section, the method works efficiently on blood samples.
[0168] In example 1 , the levels of miRNA is determined in blood. Biomarkers
[0169] As shown in example 1 and Figure 4, different individual biomarkers have been identified, which can be used cross-breed. To improve the overall strength of the method, it may be advantageous to use more than one biomarker. Thus, in an embodiment, method is performed for at least 2 of the miRNAs and most preferably for all 3 biomarkers as defined in SEQ ID NO: 1 , 2 and 3.
[0170] It may also be an advantage to include at least some of the listed biomarkers in the method based on the pathways they are involved in. The identified miRNAs have also been found to be involved in different pathways - but in particular in cell cycle and cell arrest pathways. In a preferred embodiment, the miRNAs are involved in at least regulating the cell cycle - or regulate the cell cycle, more preferably cell cycle arrest.
[0171] The cell cycle is the series of events that takes place in a cell as it grows and divides into two genetically identical daughter cells. It is a highly regulated process that comprises several phases:
[0172] • G1 Phase: Metabolic changes prepare the cell for division; the cell grows physically larger and organelles are copied.
[0173] • S Phase: DNA is replicated.
[0174] • G2 Phase: The cell grows more, makes proteins and organelles, and begins to reorganise its contents in preparation for mitosis.
[0175] • M Phase: Nuclear DNA of the cell condenses into visible chromosomes and is pulled apart by the mitotic spindle, a specialised structure made out of microtubules. Mitosis takes place in five stages: prophase, prometaphase, metaphase, anaphase, and telophase.
[0176] • Cytokinesis: The cytoplasm is split in two, resulting in two individual cells.
[0177] Cyclins and cyclin-dependent kinases (CDKs) are regulatory molecules that determine how a cell progresses through the cell cycle. When activated by a bound cyclin, CDKs phosphorylate target proteins to activate or deactivate them leading to coordinated progression through the cell cycle.
[0178] As used herein, “regulate” or “regulation” of the cell cycle refers to the mechanisms that control the orderly progression. Positive regulation of the cell cycle drives its progression, while negative regulation of the cell cycle slows progression or arrests the cell cycle. Cell cycle arrest refers to a temporary or permanent halting of the cell cycle, preventing cells from progressing through the normal stages of cell division. miRNAs can act as either positive or negative regulators of cell cycle progression. When miRNAs target and downregulate genes encoding cell cycle proteins, they can inhibit cell cycle progression and promote cell cycle arrest. Conversely, when miRNAs target genes encoding proteins that inhibit the cell cycle, they can promote cell cycle progression and proliferation. This delicate balance of miRNA mediated regulation is important for normal cell growth.
[0179] The cell cycle can be measured using a variety of commercially available assays. For example, DyeCycle stains can be used that measure DNA content distribution and are analysed with flow cytometry. Alternatively, antibodies for cell cycle analysis are also available, which can be analysed using flow cytometry or imaging.
[0180] Levels of miRNA can be determined using methods known to the person skilled in the art. Thus, in an embodiment, the levels are determined by a method selected from the group consisting of NGS, qPCR, dPCR, and ELISA miRNA.
[0181] In an embodiment, initiatives have taken place between the sampling of the first sample and the sampling of the second sample, to improve the one or more welfare parameters of the cattle.
[0182] In yet an embodiment, the welfare parameter is heat stress.
[0183] Heat stress occurs when body temperature rises above normal due to an inability to dissipate heat effectively. This can happen when the environmental temperature is high, air movement is low, or humidity is high. Cattle rely on various mechanisms to regulate their body temperature, including panting, sweating, and behavioural changes. Signs and symptoms of heat stress in cattle include but are not limited to, an increased respiratory rate, increases salivation, loss of appetite, reduced biological production and increased susceptibility to disease.
[0184] Table 1 : Common parameters to determine heat stress
[0185] In yet another embodiment, the initiatives are selected from the group consisting of a change in heat exposure, such as lowering of temperature, installation of fans, possibility of shadowing, installation of sprinklers, improved access to additional water, change in feed, reduction of the animal density, provision of cooling systems as appropriate for the local conditions, changes in moving cattle, and a less stressful environment.
[0186] Milk yield refers to the amount of milk produced by an animal over a given period of time. Improving milk yield means increasing the amount of milk produced in a given time period.
[0187] Milk quality is concept that encompasses multiple factors such as sensory qualities, composition and bacterial safety. High quality milk is a rich source of protein, fat, calcium and other nutrients such as branched chain fatty acids (BCA’s). High quality milk is also free from contaminants, has a low bacterial count, is a rich creamy white colour with a clean fresh smell and a mild taste,
[0188] Meat yield refers to the amount of meat that can be obtained from an animal after slaughter. Meat yield is typically expressed as the percentage of the live weight or carcass weight of the animal.
[0189] Meat quality is a complex concept that encompasses a variety of factors including:
[0190] - Appearance : high quality meat has a bright appealing colour, uniform texture and no signs of discloration.
[0191] - Texture : high quality meat is tender and easy to chew, whereas low quality meat is chewy and / or tough. - Flavour : high quality meat has a richer and more complex flavour than low quality meat.
[0192] Device
[0193] The method of the invention may also be implemented in a device or system. Thus, yet another aspect of the invention relates to a device or system adapted to determine in a cattle biological sample or biological derived sample if at least one welfare parameter of cattle, preferably bovine, has been compromised or not, the device comprising: a unit able to determine the level of one or more miRNAs described herein alone or in combination;
[0194] - a processor configured with a reference table; wherein the device or system is adapted to
[0195] - receive the biological sample or biological-derived sample;
[0196] - determine the levels of the one or more miRNAs;
[0197] - comparing the determined levels of the one or more miRNAs to the reference table; and
[0198] - determining if at least one welfare parameter of the cattle has been compromised or not.
[0199] In an embodiment, the reference table comprises corresponding miRNAs values from cattle where the corresponding welfare parameter has not been compromised.
[0200] In another embodiment, the device or system comprises a user interface, the user interface adapted to receive input from a user relating to one or more of, the miRNA tested, the breed from which the biological sample is derived, and the type of biological sample.
[0201] Computer implemented method
[0202] The method of the invention can also be computer-implemented. Thus, a further aspect of the invention relates to a computer implemented method of determining in a cattle biological sample if at least one welfare parameter of cattle, preferably bovine, has been compromised or not, the method comprising: providing levels of one or more miRNAs as described herein; providing a mathematical model comprising reference levels of one or more corresponding miRNAs; - determining if the provided levels deviates (significantly) from the reference levels, using the mathematical model; and
[0203] - providing to a system or a user a determination of at least one welfare parameter of the cattle being compromised or not.
[0204] In an embodiment, the reference table comprises corresponding miRNAs values from cattle where the corresponding welfare parameter has not been compromised.
[0205] Yet another aspect of the invention relates to a computer system comprising an input / output device and a processor, the system being enabled to execute the computer implemented method according to the invention on the processor.
[0206] It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.
[0207] All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.
[0208] The invention will now be described in further details in the following non-limiting examples
[0209] Example 1
[0210] Abbreviation
[0211] EVs= extracellular vesicles
[0212] HS= heat stress
[0213] TC= thermal comfort conditions
[0214] H= Holstein
[0215] BS= Brown Swiss
[0216] DE= differentially expressed
[0217] Aim of study
[0218] To investigate changes of physiological parameters, oxidative and inflammatory markers in biologicals samples of Holstein (H) and Brown Swiss (BS) cows during temperature comfort conditions and heat stress.
[0219] Materials and methods Ethics statement:
[0220] The trial carried out by the University of Milan during the summer of 2021 has been approved by the Ethical Committee for experiments with animals of the Department of Veterinary Medicine of the University of Bari.
[0221] Sample collection and experimental conditions
[0222] In vivo experiments investigating the adaptive responses of H and BS under farm conditions were carried out in the Apulia region during the summer of 2021 . Eighteen multiparous midlactating H and 18 BS balanced for parity and days in milk (DIM - between 80 and 160 DIM) and reared in the same commercial farm were included in each group. Two data loggers recorded environmental THI (temperature humidity index) every 5 minutes in two positions in the cubicle lying area (at the height of the animal's head). The other two data loggers were put in different positions in the feeding area. All these devices were put at the height of animals' heads. The time-lapse video recording system (every 5 minutes) was set to provide the collection of images in a cloud data storage system during the whole trial to evaluate all the feeding, resting, and other primary activities and behavioural patterns. The lactating cows' barn was provided with fan coolers and automatic sprinklers in the feeding area and roof fans in the cubicle resting area. During the warmest weeks of summer 2021 , the cooling system was turned off for four consecutive days and then re-activated. Ambient temperature and relative humidity were recorded every 30 seconds across the trial period with Hobo Pro series Temp probes (Onset Computer Corp. Pocasset, MA, USA) to calculate THI. The THI ranged from 68 to 86. During the experimental period, cows were fed a standard total mixed ration (TMR). During the HS days (four days), physiological patterns were recorded daily, and biological samples were collected.
[0223] EVs isolation and characterization
[0224] EVs were purified from 0.5 ml of plasma by Size Exclusion Chromatography (SEC) using the qEV original - 35 nm columns (IZON). The sample was depleted of cell debris by a series of centrifugations at 1000, 2000, 3000 x g for 15 min at 4°C. Samples were loaded into the qEV column and the EVs isolation was performed following the manufacturer’s procedure. Briefly, after sample loading, the first 3.0 ml were discarded and the next three fractions (0.5 ml each) containing the EVs were collected. The column equilibration and the fractions’ elution were carried out using sterile three times-filtered (0.22 pm) Ammonium Bicarbonate buffer 20mM pH 7.5. (a) Nanoparticle tracking analysis
[0225] The size and concentration of EVs were assessed immediately after using the NanoSight NS300 (Malvern Panalytical). The purified EVs were diluted 50 or 100 times using fresh three-times filtered PBS (0.22pm). Particles were visualized and analyzed by the NTA 3.3 Dev Build 3.3.301 software. The instrument set up was to operate at 22°C, syringe pump speed 30 AU, and for each sample were recorded 5 videos of 60 sec each; results were the mean of the 5 measurements.
[0226] (b) Transmission electron microscopy (TEM)
[0227] To assess the morphology, EVs were visualized using negative staining by TEM. A few microliters of samples were absorbed on glow-discharged carbon-coated formvar copper grids contrasted with 2% uranyl acetate, air-dried, and observed in an FEI Talos 120kV transmission electron microscope (FEI Company, Netherlands). Images of exosomes were acquired by a 4kx4K Ceta CMOS camera.
[0228] EVs miRNA extraction and reverse transcription
[0229] Small RNAs were extracted using microRNA concentrator kits (A&A Biotechnology, Cat. No 035- 25) following the manufacturers’ instructions. Only EVs eluted in the second and third fractions after the SEC procedures were included in the analysis. The Caenorhabditis elegans miRNA cel-miR-39 (25 fmol final concentration) (Qiagen, Cat. No 219610) was selected as a synthetic spike-in control because of a lack of sequence homology to bovine miRNAs. The quantifications of RNA were determined using a NanoDropTM Lite Spectrophotometer (Thermo Fisher Scientific). Reverse transcription was performed on 20 ng of RNA of each sample using TaqMan Advanced miRNA cDNA Synthesis KIT (Cat. No A28007, Applied Biosystems), following the manufacturer’s instructions. To check extraction and retrotranscription reactions, the spike-in cel-miR-39 was quantified by qPCR following the MIQE Guidelines. The quantitative reaction was performed in duplicate with a reaction volume of 15 pl on CFX Connect Real-Time PCR Detection System (Biorad) using 7.5 pl of 2X TaqMan Fast Advanced Master Mix (Cat. No 4444557), 0.75 pl of 20x cel-miR- 39 probe (assay ID 478293_mir), 1 pl of cDNA diluted in sterile water to reach the final volume. The thermal profile was 50 °C for 2 min, 95 °C for 3 min, and 40 cycles of 95°C for 15 s and 60 °C for 40 s.
[0230] Droplet Digital PCR (ddPCR) Droplet Digital (dd)PCR was carried out on the QX100 Droplet Digital PCR System (BioRad Laboratories). The reaction volume of 20|_il included 2 or 5 pl of cDNA, 10 pl of ddPCR™ Supermix for Probes (BioRad, Cat. No 1863023), 1 pl TaqMan probes (20x, table 1 ), and 7 or 4 pl of nuclease- free water. Nine out of 24 probes were commercially available while 15 probes were custom designed by ThermoFisher Scientific support center. The droplets were generated according to the manufacturer's instructions, transferred to a 96- well PCR plate (BioRad Laboratories) and amplified in a T100™ thermal cycler (Bio-Rad Laboratories). Amplification conditions started with 5 min of activation of DNA polymerase at 95 °C, followed by 40 cycles of a two-step thermal profile of 30 s at 95 °C for denaturation and 1 min at 60 °C for annealing and extension (ramping rate reduced to 2%). Three final steps at 4 °C for 5 min, 90 °C for 5 min and a 4°C infinite hold were used for droplet stabilization. Finally, plates were transferred to a droplet reader (Bio-Rad Laboratories) and the software (QuantaSoft™ 1 .3.2.0; Bio-Rad Laboratories) was used for data acquisition to calculate the concentration of target DNA in copies / pL. Data are presented as copy numbers / pl.
[0231] Statistical analysis
[0232] Statistical analysis was conducted using XLStat for Windows (Addinsoft, New York, U.S.A.), IBM SPSS Statistics 25 software (IBM Corp., 2017), and MedCalc 14.0 (MedCalc Software bvba, Ostend, Belgium). Normality test was carried out using Shapiro-Wilk tests and based on the results parametric (t test) or nonparametric (Wilcoxon) paired samples test were used (results not shown). Principal Component Analysis (PCA) was used as an exploratory analysis to detect the underlying relationships among miRNAs and to identify case clusters. To determine the diagnostic accuracy of targets differing statistically between HS and TC cows, receiver operating characteristic (ROC) analysis was performed. The diagnostic values were calculated for miRNAs that showed significant differential expression in the blood EVs. Significance was accepted at P < 0.05.
[0233] Results
[0234] Extracellular vesicle characterization
[0235] The EVs isolated from the blood of TC and HS cows were isolated by ultracentrifugation and size exclusion chromatography. The particle size distribution was assessed by nanoparticle tracking analysis (NTA), revealing that the EV population was characterized by small vesicles. The modal average was 121 .15 nm ± 37.9 nm and 129.7 nm ± 13.7 nm, and the concentration was 9.4E+09 particles / ml and 7.7E+09 particles / ml in TC and HS, respectively. The modal average of TC and HS EVs was 123.1 nm ± 10.99 nm and 131.63 nm ± 21 .88 nm for H, and 1 19.23 nm ± 37.9 and 127.7 nm ± 13.7 nm for BS at TC and HS, respectively. The concentration of isolated EVs was 6.1 E+09 particles / ml and 3.3 E+09 particles / ml for H at TC and HS, respectively, and 1.3 E+10 particles / ml and 2 E+10 particles / ml for BS at TC and HS, respectively. No statistical differences were identified in size or concentration. The shape and integrity of EV were assessed by electronic transmission microscopy (TEM), showing the presence of whole, undamaged small Evs.
[0236] Validation of differentially expressed miRNAs in blood EVs
[0237] Droplet Digital (dd)PCR validation was performed on 24 blood samples, collected from 12 cows in thermal comfort conditions (d1 ) and after heat stress (d4). To validate the results of milk sequencing, 23 differentially expressed (DE)-miRNAs were selected. Their absolute abundance was quantified using ddPCR. Cel-miR-39, an artificial spike-in, was used as an internal control. Twelve out of 23 miRNAs were not detected in blood EVs, including bta- let-7b-3p, bta-miR-10225b-5p, bta-miR-1777a-3p, bta-miR-2285n-1 -5p, bta-miR-2326-3p, bta-miR-2427-3p, bta-miR-2436-3p, bta-miR-25-5p, bta-miR-500-5p, bta-miR-502b-5p, and bta-miR-6525-5p. By the milk sequencing data, ddPCR results demonstrated that the levels of four miRNAs (bta-miR-339a-5p: P= 0.047, ratioHS / TC= 1 .9; bta-miR-339b-5p: P= 0.0018, ratioHS / TC= 2.1 ; bta-miR-92a-2-3p: P= 0.0386, ratioHS / TC= 2.6; bta-miR-664b- 3p: P= 0.0521 , ratioHS / TC= 3.0) were significantly over-expressed in HS (heat stress) compared to TC (thermal comfort) cows. Remarkably, the ddPCR validation for miR-301 (P= 0.146, ratioHS / TC 0.067) confirmed the sequencing results, presenting the evidence that this miRNA is down-regulated also in blood EVs. MiR-30a (P= 0.39), miR-30b (P= 0.106), miR-30c (P= 0.77), miR-30f (P= 0.68), miR-2288 (P= 0.39), and miR-532 (P= 0.235) did not exhibit statistically significant differences between TC and HS cows. Data are summarized in Table 2 and Figure 2. The expression profile of DE-miRNAs in blood EVs was used to perform cluster analysis. Samples were grouped into two clusters, TC and HS (data not shown). In light of this data we chose the 3 miRNAs (bta-miR-339b-5p, bta-miR- 339a-5p and bta-miR-664b-3p that pass 10% FDR, or 0.05 p-value).
[0238] Table 2: List of miRNAs evaluated in blood EVs (ND = not detected. NA = not applicable.)
[0239] Assessment of the diagnostic value of DE-miRNAs
[0240] To investigate the diagnostic value and the diagnostic potency of DE-miRNAs in the blood, ROC curves and the area under the curve (AUC) were calculated. The diagnostic performance is reported in Table 3. An AUC of 1 represents perfect discrimination, while 0.5 represents zero discrimination — equivalent to a coin toss. Within those boundaries, AUCs of 0.9 or more are considered “excellent,” 0.80-0.89 are “good,” 0.70-0.79 “fair,” 0.60-0.69 “poor,” and 0.50-0.59 extremely poor. The Youden Index is the specific cut-point that maximizes the proportion of true positives and true negatives (the sum of sensitivity and specificity). The AUC was poor for bta-miR-92a-2-3p, fair for bta-miR-339a-5p, and bta- miR-339b-5p, and good for bta-miR-664b-3p (Figure 3). Discriminant analysis was carried out to investigate the potential for improving diagnostic performance by analyzing multiple DE-miRNAs. The best- discriminating subset was selected after a backward elimination of miRNAs, and it includes bta-miR- 339a-5p, bta-miR-339b-5p, and bta-miR-664b-3p. Their weighted average relative quantification (RQ) values were included in further analysis. Median expression levels including the RQ of these 3 DE-miRNAs were -8.1383 (range, - 17.48 to -0.68) and -17.56 (range, -29.59 to -6.95) in TC and HS cows, respectively (Figure 4a). The predicted probability of being discriminated as heat-stressed from the logit model based on the three [logit = (-3.2252 x expression level of bta-miR-339a-5p) + (-2.7918 x expression level of bta-miR-339b-5p) + (-2.3527 x expression level of bta-miR-664b-3p)]
[0241] DE-miRNAs was used to construct the ROC curves (Figure 4b). The results of the ROC curves analysis are reported in Table 3.
[0242] The assessment for the differential expression was performed using the non-parametric Wilcoxon signed-rank sum test for paired samples for both breeds combined, using a significance threshold of p-value < 0.05 and the effect size average value of the miRNAs at day 1 should be at least increased by 75% as compared to the average value of the other day. Table 3: Area under the curve (ALIC), sensitivity, specificity and accuracy for DE-miRNAs in the cerumen. Av3= weighted average relative quantification of bta-miR-339a-5p, bta- miR-339b-5p and bta-miR-664b-3b.
[0243] Comparison between miRNA level and serological markers and milk parameters
[0244] The dataset included in this analysis contains 24 individuals and 65 variables. Two qualitative variables are considered illustrative: breed and treatment. Serological and milk parameters were: Na, K, TP, ALB, Glob, Col, Trigl, Mg, P, Ca, Gli, ALT, AST, Urea, Uric, ALP, Bil, Crea, Nefa, HSP70, SAA, HPT, TBARS, Hydroperoxides, Carbonyls, FRAP, RR, RT, Fat, Protein, Lactose, Non-fat dry matter, Dry matter, Casein, Acetone, Beta hydroxybutyrate, Citric acid, C140, C181 , C180, C160, Short Chain FA, Medium Chain FA, Long Chain FA, MUFA, PUFA, Saturated FA, Unsaturated FA, Trans FA, A30 The inertia of the first dimensions of PCA (not shown) indicates if there are strong relationships between variables and suggests the number of dimensions that should be studied.
[0245] Correlation
[0246] Briefly, almost all miRNAs are negatively (~-0,3 and -0.5) correlated with ALP and TBARS except miR-339b-5p (~0,5). CL and Na are negatively and strongly correlated with miR- 301 b-5p (~ between -0.6 and -0.8).
[0247] Discussion
[0248] The findings of this study provided evidence that heat stress influences the miRNAs cargoes of EVs isolated from bovine blood. A previous project on milk EVs showed that HS modulated the expression of 132 exo-miRNAs in BS milk and 32 exo-miRNAs in H milk and that 24 DE-miRNAs were shared between BS and H, among which 3 were down-delivered, and 21 were over delivered by milk-exosomes. The 24 DE-miRNAs in milk were investigated also in the EVs isolated from 12 cows, 4 Holstein and 8 Brown Swiss, and the results demonstrated that (a) 1 1 out of 23 milk DE-miRNAs are delivered by blood EVs; (b) 4 out of 11 miRNAs are differentially expressed between HS and TC cows ; (c) diagnostic accuracy for HS is good for miR-664b-3p and fair for two miRNAs (miR-339a-5p and miR- 339b-5p); (d) the diagnostic accuracy of the combination of three differentially expressed miRNAs was good (miR-664b-3p, miR-339a-5p, and miR-339b-5p; AUC= 0.8750). The results are supported by PCA analysis (not shown), whose first principal component accounts for as much of the variability in the data as possible.
[0249] In conclusion, blood EVs share with milk EVs 1 1 miRNAs, among which 4 are overexpressed after heat stress, and 3 are potentially useful biomarkers of heat stress. SEQUENCE LISTING
[0250] SEQ ID NO: 1 : bta-miR-339b-5p ucccuguccuccaggagcuc
[0251] SEQ ID NO: 2: bta-miR-339a-5p ucccuguccuccaggagcucac SEQ ID NO: 3: bta-miR-664b-3p uauucauuuaucucccagccuac
Claims
Claims1. A method of determining at least one welfare parameter of at least one head of cattle, the method comprising i. determining in a biological sample the level of at least one miRNA that regulates the cell cycle, wherein the miRNA is selected from SEQ ID NOs: 1 , 2 or 3 or a functional variant thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO:1 , 2 and 3 respectively; and ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference level the welfare of the at least one head of cattle is or has been compromised; and wherein said biological sample is blood and / or milk.
2. A method of determining at least one welfare parameter of at least one head of cattle, the method comprising i. determining in a biological sample the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; and ii. comparing the level of each of the miRNAs to a reference level; wherein where the level of each miRNA is above said reference level the welfare of the at least one head of cattle is or has been compromised.
3. The method of claim 2, wherein said biological sample is blood and / or milk.
4. A method for improving at least one welfare parameter of at least one head of cattle, the method comprising: i. determining in a first biological sample from at least one head of cattle the level of at least one miRNA that regulates the cell cycle, wherein the miRNA is selected from SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 or 3 respectively;ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference level the welfare of the at least one head of cattle is or has been compromised; and ill. improving the welfare of the at least one head of cattle; iv. determining in a second biological sample from the same at least one head of cattle, the level of at least one miRNA as defined in SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 or 3 respectively; and v. comparing the level of the at least one miRNA in the first biological sample to the level of the at least one miRNA in the second biological sample, wherein if the level in the second biological sample is lower than the level in the first biological sample or lower than the level in the reference sample the welfare of the head of cattle has improved; and wherein the first and / or second biological fluid is blood and / or milk.
5. A method for improving at least one welfare parameter of at least one head of cattle, the method comprising: i. determining in a first biological sample from at least one head of cattle the level of at least one miRNA, wherein the miRNA is selected from SEQ ID NOs: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 or 3 respectively; ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference the welfare of the at least one head of cattle is or has been compromised; ill. improving the welfare of the at least one head of cattle; iv. determining in a second biological sample from the same at least one head of cattle, the level of at least one miRNA as defined in SEQ ID NOs: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 or 3 respectively; andv. comparing the level in the first biological sample to the level in the second biological sample, wherein if the level in the second biological sample is lower than the level in the first biological sample or lower than the level in the reference sample the welfare of the head of cattle has improved; and wherein the first biological fluid is milk and the second biological fluid is blood or wherein the first biological fluid is blood and the second biological fluid is milk.
6. A method for improving at least one welfare parameter of at least one head of cattle, the method comprising: i. determining in a first biological sample the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; ii. comparing the level of the three miRNAs to a reference level; wherein where the level of the at least one miRNA is above said reference level, the welfare of the at least one head of cattle is or has been compromised; ill. improving the welfare of the at least one head of cattle; iv. determining in a second biological sample from the same at least one head of cattle, the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; and v. comparing the level of the three miRNAs in the first biological sample to the level of the three miRNAs in the second biological sample, wherein if the level of all three miRNAs in the second biological sample is lower than the level of all three miRNAs in the first biological sample or lower than the level in the reference sample the welfare of the head of cattle has improved.
7. The method according to claim 6, wherein the biological fluid is blood and / or milk.
8. The method of any of claims 4 to 7, wherein improving the welfare of the at least one head of cattle comprises one or more of changing heat exposure, improvingaccess to additional water, changing the feed, reducing animal density and the provision of cooling systems.
9. A method of improving at least one milk yield, milk quality, meat yield, meat quality from at least one head of cattle, the method comprising i. determining in a biological sample from the at least one head of cattle, the level of at least one miRNA as defined in SEQ ID NO:s: 1 , 2 or 3 or a functional variant thereof wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO :1 , 2 or 3 respectively; ii. comparing the level of the at least one miRNA to a reference level; wherein where the level of the at least one miRNA is above said reference the welfare of the at least one head of cattle is or has been compromised; and i. improving the welfare of the at least one head of cattle; wherein improving the welfare of the at least one head of cattle improves at least one of milk yield, milk quality, meat yield and meat quality; and wherein said biological sample is blood and / or milk.
10. A method of improving at least one milk yield, milk quality, meat yield, meat quality from at least one head of cattle, the method comprising i. determining in a biological sample the level of a miRNA as defined in SEQ ID NO: 1 , a miRNA as defined in SEQ ID NO: 2 and a miRNA as defined in SEQ ID NO: 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 and 3 respectively; ii. comparing the level of the three miRNAs to a reference level; wherein where the level of each of the three miRNAs are above said reference level the welfare of the at least one head of cattle is or has been compromised; and ii. improving the welfare of the at least one head of cattle; wherein improving the welfare of the at least one head of cattle improves at least one of milk yield, milk quality, meat yield and meat quality.11 . The method of claim 10, wherein the biological sample is milk and / or blood.
12. The method according to claim 1 , 4 or 9, wherein the method comprises determining the level of at least two miRNAs, wherein the at least two miRNAs are selected from SEQ ID NOs 1 and 2 or SEQ ID NOs 2 and 3 or SEQ ID NOs 1 and 3 or functional variants thereof, wherein the functional variant has at least 60% overall sequence identity to SEQ ID NO: 1 , 2 or 3 respectively.
13. The method according to any preceding claim, wherein the welfare of at least one head of cattle may be comprised by at least one of heat stress, social stress, metabolic stress, disease stress or combinations thereof.
14. The method according to claim 13, wherein the welfare of the at least one head of cattle is or has been compromised by heat stress.
15. The method according to claim 13, wherein the welfare of the at least one head of cattle is or has been compromised by social stress.
16. The method according to any preceding claim wherein the at least one miRNA is increased by at least 5 to 70%, preferably 5 to 50%, more preferably 5 to 30% compared to the reference level.
17. The method according to any preceding claim, wherein the cattle is dairy cattle, wherein preferably the dairy cattle is bovine.
18. The method according to any preceding claim, wherein said biological sample is from a herd of cattle.
19. The method according to any preceding claim, wherein said reference level is the level of the one or more miRNA’s in a biological sample from at least one head of cattle where the welfare of the head of cattle is not or has not been compromised or wherein the reference level is an average level from cattle where the welfare of the cattle is not or has not been compromised.
Citation Information
Patent Citations
Markers, methods, biochips and kits for milk quality detection
US20120252694A1
Cited By
Mirnas from processed milk products as indicators of stress in bovine
WO2026002940A1